Ku86 heterodimer does not affect cell growth, double-strand break repair, or genome integrity

d n a r e p a i r 5 ( 2 0 0 6 ) 303–311

available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/dnarepair

Heterozygous inactivation of human Ku70/Ku86 heterodimer does not affect cell growth, double-strand break repair, or genome integrity Koichi Uegaki, Noritaka Adachi ∗ , Sairei So, Susumu Iiizumi, Hideki Koyama ∗ Kihara Institute for Biological Research, Graduate School of Integrated Science, Yokohama City University, Maioka-cho 641-12, Totsuka-ku, Yokohama 244-0813, Japan

a r t i c l e

i n f o

a b s t r a c t

Article history:

Ku, the heterodimer of Ku70 and Ku86, plays crucial roles in non-homologous end-joining

Received 4 October 2005

(NHEJ), a major pathway for repairing DNA double-strand breaks (DSBs) in mammalian cells.

Received in revised form 19 October

It has recently been reported that heterozygous disruption of the human KU86 locus results

2005

in haploinsufficient phenotypes, including retarded growth, increased radiosensitivity, ele-

Accepted 19 October 2005

vated p53 levels and shortened telomeres. In this paper, however, we show that heterozygous

Available online 1 December 2005

inactivation of either the KU70 or KU86 gene does not cause any defects in cell proliferation or DSB repair in human somatic cells. Moreover, although these heterozygous cell lines

Keywords:

express reduced levels of both Ku70 and Ku86, they appear to maintain overall genome

Non-homologous end-joining

integrity with no elevated p53 levels or telomere shortening. These results clearly indicate

Ku

that Ku haploinsufficiency is not a commonly observed phenomenon in human cells. Our

Double-strand break repair

data also suggest that the impact of KU70/KU86 mutations on telomere metabolism varies

Telomere

between cell types in humans.

Haploinsufficiency

1.

Introduction

DNA double-strand breaks (DSBs) are one of the most severe lesions that if not repaired will lead to loss of genetic information resulting in cancer or cell death. DSBs can be caused by ionizing radiation (IR), reactive oxygen species, DNA replication across a nick, or the inhibition of DNA topoisomerase II [1]. Mammalian cells have evolved two major pathways for repairing DSBs, homologous recombination and non-homologous DNA end-joining (NHEJ) [2]. These pathways function cooperatively to maintain genomic stability in mammals [2]. NHEJ is the predominant pathway during G0, G1 and early S phases when no sister chromatid is available for homologous recombination [3].

∗

© 2005 Elsevier B.V. All rights reserved.

Ku is a heterodimeric protein composed of 70 and 86 kDa subunits (Ku70 and Ku86, respectively), which can bind all sorts of double-stranded DNA ends in a sequence-non-specific fashion [4]. It has been established that Ku plays crucial roles in NHEJ [1,2,4]. When a DSB occurs, Ku recognizes and binds to DSB ends and subsequently recruits DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK complex, which is thought to phosphorylate and activate downstream targets, including Artemis [1,5]. After the trimming of DNA ends by the Artemis:DNA-PKcs complex and additional proteins, the XRCC4:DNA ligase IV complex is recruited to complete the joining [1,2]. Genetic studies using rodent or avian cells have shown that cells lacking Ku (and any of the core NHEJ components)

Corresponding authors. Tel.: +81 45 820 1907; fax: +81 45 820 1901. E-mail addresses: [email protected] (N. Adachi), [email protected] (H. Koyama). 1568-7864/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.dnarep.2005.10.008

304

d n a r e p a i r 5 ( 2 0 0 6 ) 303–311

display increased IR sensitivity [3,6–8], consistent with a role for NHEJ in DSB repair. Hypersensitivity of NHEJ-defective cells is more pronounced toward DSBs caused by topoisomerase II inhibitors, since such lesions are repaired primarily or exclusively by NHEJ [9,10]. Accumulating evidence also suggests that Ku deficiency can induce chromosome aberrations [11,12] and telomere dysfunctions [13–15]. It should be noted, however, that genetic deletion of either Ku70 or Ku86 does not result in lethality in rodent and avian cells, although growth retardation has been observed for Ku70- and Ku86-deficient animals [6–8,16,17]. Biochemical studies have demonstrated that human cells have higher levels of DNA-PK activity than do rodent cells, possibly suggesting a more vital role for Ku (and DNA-PKcs) in humans [18]. Indeed, no human patient with mutations in either Ku70 or Ku86 has been described, contrasting with the case for Artemis or DNA ligase IV [19,20]. Recently, Hendrickson and co-workers have shown that genetic deletion of the human KU86 gene results in apoptotic cell death in the colon cancer cell line HCT116 [21], raising the possibility that Ku plays an essential role in human somatic cells. More intriguingly, the same group has reported that heterozygous disruption of the human KU86 gene leads to growth retardation, IR hypersensitivity, and telomere shortening [21,22]. This finding suggests that even an ∼50% reduction in cellular Ku86 levels might affect cell growth, DSB repair, and genome integrity in humans. Given that Ku86 functions as Ku heterodimer, any phenotypes associated with KU86 mutations could be attributed to the reduction or absence of Ku70/Ku86 heterodimer. However, it remains possible that a certain form of Ku86 protein has an essential cellular function independent of Ku70. A likely candidate for this is KARP-1, which is transcribed from the KU86 locus with the use of a 5 upstream promoter and additional exons and may regulate DSB repair [23]. Interestingly, KARP1 expression appears to be restricted to primates [23]. Hence, for the purpose of clarifying the in vivo function of human Ku protein (i.e. the Ku70/Ku86 heterodimer), it is necessary to study the impact of mutations in KU70, in addition to (or rather than) KU86. In this paper, we generate by gene targeting KU70+/− cells as well as KU86+/− cells from the human preB acute lymphoblastic leukaemia cell line Nalm-6. We show that heterozygous inactivation of the KU70 or KU86 gene does not cause any defects in cell proliferation or DSB repair. Our results indicate that Ku haploinsufficiency is not a commonly observed phenomenon in human somatic cells.

CCATAGAACACCACAGCCAAGAGA-3 ) for the 5 -arm, and kku70-3 (5 -GGAGACCTTGAATCACTCATTGCC-3 ) and kku704 (5 -CCATAGGACGTTCTCATCTGAGAG-3 ) for the 3 -arm. A floxed hygromycin resistance gene cassette was inserted between the 5 - and 3 -arms, thus yielding the targeting vector. Likewise, 2.8 and 2.3 kb KU86 (XRCC5) fragments were obtained by genomic PCR using primers kku86-l (5 -GGGGACAACTTTGTATAGAAAAGTTGAGTGGTAGTTGTCTCTGAAGGGTC3 ), kku86-2 (5 -GGGGACTGCTTTTTTGTACAAACTTGCAGCTGCCTGGAAACAAAGTTCCA-3 ), kku86-3 (5 -GGGGACAGCTTTCTTGTACAAAGTGGTAAGATGGATGCTTGTCTAGGCGG-3 ), and kku86-4 (5 -GGGGAC AACTTTGTATAATAAAGTTGTCCATGCTCACGATTAGTGCATCC-3 ). To construct a KU86 targeting vector, the two genomic fragments and a floxed hygromycin resistance gene were assembled into a plasmid carrying a diphtheria toxin A gene cassette by using the MultiSite Gateway system (Invitrogen, Carlsbad, CA). The materials and detailed protocol for this assembly will be described elsewhere (Iiizumi et al., in preparation).

2.

Materials and methods

2.4.

2.1.

Vector construction

Clonogenic survival assays were performed as previously described [26]. Briefly, exponentially growing cells were plated at 102 –105 cells/dish into 60 mm bacterial dishes containing 5 ml of agarose medium. For X-ray sensitivity assays, cells were exposed to various doses of X-rays, as described [26,28]. For VP-16 sensitivity assays, cells were plated as above along with various concentrations of VP-16 (Sigma–Aldrich, St. Louis, MO). After a 2–3 weeks incubation at 37 ◦ C, visible colonies were counted, and the percent survival was determined by comparing the number of surviving colonies to

A KU70 targeting vector was constructed in pMC1DT-ApA (Kurabo, Osaka, Japan) carrying a diphtheria toxin A gene cassette. Briefly, 3.6 and 4.1 kb KU70 genomic fragments containing part of intron 2 and intron 5, respectively, were obtained by PCR using Nalm-6 genomic DNA as template. These fragments were used as 5 - and 3 -arms, respectively. The primers used were kku70-l (5 -GTTCTTGTAGTTGGCACACCAGA-3 ) and kku70-2 (5 -GATAGGCCATTGCGG-

2.2.

Cell culture and transfection

Nalm-6 cells were cultured in ES medium (Nissui Seiyaku, Tokyo, Japan) supplemented with 10% calf serum and 50 ␮M 2-mercaptoethanol at 37 ◦ C in a humidified atmosphere of 5% CO2 in air. HCT116 cells were grown at 37 ◦ C in McCoy’s 5A medium (Gibco) supplemented with 10% FCS in a humidified atmosphere of 5% CO2 in air. HeLa cells were maintained as previously described [24]. DNA transfection was performed as described previously [25]. Briefly, 4 × 106 cells were electroporated with 4 ␮g of DNA construct, and incubated for 2–3 weeks at 37 ◦ C in agarose medium containing 0.4 mg/ml hygromycin B (Wako Pure Chemical, Osaka). Genomic DNA was isolated from drug-resistant colonies and subjected to Southern blot analysis as described previously [26].

2.3.

Western blotting

Western blot analysis was carried out as described previously [27]. Anti-Ku70 and -Ku86 monoclonal antibodies were purchased from BD Biosciences (Bedford, MA). Anti-p53 monoclonal antibody (DO-1) and anti-phospho-p53 (Ser15) polyclonal antibody were purchased from Santa Cruz and Cell Signaling Technology, respectively. Levels of expression were quantified using an ATTO CS Analyzer ver2.0 (ATTO, Tokyo, Japan).

Clonogenic assays

d n a r e p a i r 5 ( 2 0 0 6 ) 303–311

untreated controls. For each assay, at least three independent experiments were performed.

2.5.

Telomeric TRF analysis

Genomic DNA (5 ␮g) was digested with AluI and MboI and electrophoresed on a 0.8% agarose gel. Fractionated DNA fragments were transferred to a nylon membrane (Hybond-N+, Amersham Biosciences) by an alkaline transfer technique, followed by hybridization for >12 h at 50 ◦ C in hybridization buffer (0.9 M NaCl, 60 mM sodium phosphate, 6 mM EDTA, 1% SDS) containing a 32 P-labeled d(CCCTAA)4 or d(TTAGGG)4 probe. The membrane was washed with 2 × SSC at room temperature for 5 min and then washed with 6 × SSC, 0.1% SDS, at 50 ◦ C for 15 min. Signals were detected with a Fujix BAS 2000 BioImaging analyzer (Fuji Photo Film Co., Tokyo). For simplicity, TRF lengths were recorded as telomere lengths.

2.6.

Telomerase activity measurement

Telomerase activity was measured by using the TRAPeze XL kit (Chemicon International, Temecula, CA) according to the manufacturer’s instructions. Briefly, cell extract was prepared using CHAPS lysis buffer and an aliquot (0.6 ␮g) of the extract was used for PCR analysis. The PCR products were measured with the fluorescence plate reader by using appropriate excitation and emission filters. The levels of telomerase activity were quantified by the ratio of the fluorescence intensity of the entire TRAP ladder to the sulforhodamine intensity of the internal control.

3.

Results

3.1.

Generation of human KU70+/− cells

To disrupt the KU70 gene in the human pre-B acute lymphoblastic leukaemia cell line Nalm-6, we constructed a tar-

305

geting vector carrying a hygromycin-resistance gene flanked by the 3.6 and 4.1 kb KU70 sequences. A diphtheria toxin A gene was added to the construct for selection against random integrants (Fig. 1A). The targeting vector was linearized with SalI and electroporated into Nalm-6 cells. A total of 80 hygromycin-resistant clones were isolated and subjected to Southern blot analysis. Three clonal lines exhibited band patterns indicative of the precise targeting event (Fig. 1B), indicating that these cell lines are heterozygous mutants for the KU70 gene.

3.2. Ku86

KU70+/− cells have reduced levels of Ku70 and

To examine whether KU70+/− cells express reduced levels of Ku70 protein, we performed Western blot analysis of wild-type and KU70+/− cells. As expected, KU70+/− cells (clones H1 and H2) showed an ∼50% reduction in Ku70 levels as compared with wild-type cells (Fig. 1C). Importantly, Ku86 levels in these KU70+/− cells were also reduced to ∼50% that in wild-type cells (Fig. 1C). The concomitant reduction of Ku86 levels is consistent with earlier observations that Ku86 becomes unstable in the absence of Ku70 (and vice versa) [4]. We therefore conclude that the heterozygous disruption of the KU70 locus resulted in a 50% reduction in cellular levels of Ku70/Ku86 heterodimer.

3.3. KU70 haplodeficiency has no impact on cell proliferation or DSB repair Li et al. [21] have reported that KU86 heterozygous HCT116 cells display retarded growth, increased IR sensitivity, and elevated (three-fold) p53 expression levels. These observations led us to examine whether KU70 heterozygous Nalm-6 cells might exhibit similar phenotypes. We thus compared the growth rate of KU70+/− cells with that of wild-type cells; however, we observed no difference between these cell lines (Fig. 2A). The doubling-time of KU70+/− cells was 21–22 h,

Fig. 1 – Targeted disruption of the human KU70 gene. (A) Scheme for KU70 gene targeting. The human KU70 gene is composed of 13 exons, located on chromosome 22q13. The KU70 targeting vector was designed to replace exons 3–5 with the hygromycin-resistance (Hygr ) gene. Triangles represent loxP sequences. DT-A, diphtheria toxin A gene. (B) Southern blot analysis of PvuII-digested genomic DNA of wild-type (WT) and KU70 heterozygous cells (HI). The probe used is shown in (A). (C) Western blot analysis for Ku70 and Ku86. Samples used contained 10 ␮g of total protein extracted from wild-type (WT) cells and two independent KU70 heterozygous clones, H1 and H2. Levels of expression were quantified using an image analyzer. Actin served as a loading control.

306

d n a r e p a i r 5 ( 2 0 0 6 ) 303–311

Fig. 2 – Effect of KU70 haplodeficiency on cell proliferation and DSB repair. (A–C) Growth curves (A) and sensitivities to X-ray (B) and VP-16 (C) of wild-type (WT) and KU70 heterozygous (H1 and H2) cells. Data are the mean ± S.D. of at least three independent experiments. (D) Western blot analysis for p53 protein (top) and p53 phosphorylated at Ser15 (bottom). Levels of expression were quantified using an image analyzer.

which was indistinguishable from that of wild-type cells. In addition, FACS analysis of wild-type and KU70+/− cells did not show any difference in the cell-cycle distribution of asynchronous cells (data not shown). These results clearly indicate that the 50% reduction in Ku70 (and Ku86) levels does not affect cell proliferation. We then investigated whether KU70+/− cells might exhibit increased IR sensitivity. As shown in Fig. 2B, there was no significant difference in X-ray sensitivity between wild-type and KU70+/− cells. We also examined the sensitivity to VP16, a potent topoisomerase II inhibitor that induces DSBs [9], and found no significant difference in the sensitivity between wild-type and KU70+/− cells (Fig. 2C). Because VP-16-induced DNA lesions are primarily repaired by NHEJ [9,10], even a slight decrease in NHEJ activity would result in elevated VP-16 sensitivity, and apparently this is not the case with KU70+/− cells. Taken together, we conclude that KU70 haplodeficiency has no impact on DSB repair. The notion that reduced levels of Ku70/Ku86 affect neither cell growth nor DSB repair is further reinforced by Western blot analysis with anti-p53 antibodies. As shown in Fig. 2D, p53 protein levels were unaltered in KU70+/− cells. Essentially the same results were obtained using anti-phospho-p53 (Serl5) antibody (Fig. 2D). These results suggest that KU70 haplodeficiency does not lead to increased amounts of cellular DNA damage, implying that overall genome integrity is maintained in KU70+/− cells.

tion 4). Myung et al. [22] have reported that KU86 heterozygous HCT116 cells show telomere shortening. To examine the effect of KU70 haplodeficiency in telomere length, we performed telomeric terminal restriction fragments (TRF) analysis [22], as described in Section 2. Hybridization of AluI/MboI-digested genomic DNA with a d(CCCTAA)4 probe enabled us to measure the length of the telomeric G-strand. Interestingly, we found that KU70+/− cells contained moderately extended telomeres compared with wild-type cells (Fig. 3A). Very similar observations were made using a d(TTAGGG)4 probe that detects the telomeric C-strand (Fig. 3B). These results suggest that

3.4. KU70 haplodeficiency does not induce telomere shortening, nor does it affect telomerase activity

Fig. 3 – TRF analysis in wild-type and KU70+/− cells. AluI/MboI-digested genomic DNA (5 ␮g) was electrophoresed on a 0.8% agarose gel, and subjected to Southern blot analysis with a 32 P-labeled d(CCCTAA)4 (A) or d(TTAGGG)4 (B) probe. The detected signals indicate telomeric G- or C-strand length, respectively.

A large body of evidence indicates that Ku is involved in telomere metabolism [4]. However, the impact of Ku mutations on telomere length varies considerably between species (see Sec-

d n a r e p a i r 5 ( 2 0 0 6 ) 303–311

KU70 haplodeficiency results in the lengthening, rather than shortening, of telomeres, a phenotype also seen in Arabidopsis mutants lacking either Ku70 or Ku86 [29,30]. Human Ku protein is shown to physically associate with telomerase through interaction with a reverse transcriptase protein subunit (hTERT), suggesting a possible role for Ku in regulating telomerase activity [31]. To investigate whether the extended telomeres in KU70+/− cells are caused by an elevated telomerase activity in these cells, we quantified telomerase activity in wild-type and KU70+/− cell extracts by the telomeric repeat amplification protocol (TRAP) assay [32]. As shown in Fig. 4, the assay clearly showed that Nalm-6 cells are positive for telomerase activity. (We note that Nalm-6 telomerase activity is comparable to, or slightly higher than, that of HCT116 or HeLa cells.) In addition, no significant difference in telomerase activity was observed between wild-type and KU70+/− cells (Fig. 4), indicating that KU70 haplodeficiency does not affect

307

Fig. 4 – Comparison of telomerase activity levels between various human cell lines. Telomerase activity was measured by TRAP assay as described in Section 2. Telomerase activity in wild-type Nalm-6 cells (WT) was normalized to 1. For each cell type, at least three independent samples were extracted and tested for telomerase activity, bars, S.D.

Fig. 5 – Generation and analysis of KU86+/− cells. (A) Targeted disruption of the human KU86 (XRCC5) gene. The human KU86 gene is composed of 21 exons, located on chromosome 2q35. The KU86 targeting vector was designed to delete exon 2. Symbols are as in Fig. 1A. (B) Western blot analysis for Ku70 and Ku86. Samples used contained 10 ␮g of total protein extracted from wild-type (WT), KU70+/− (H1), and three independent KU86+/− (H20, H21 and H30) cells. Levels of expression were quantified using an image analyzer. Actin served as a loading control. (C–E) Growth curves (C) and sensitivities to X-ray (D) and VP-16 (E) of wild-type (WT), KU70+/− (H1), and KU86+/− (H20 and H30) cells. Data are the mean ± S.D. of at least three independent experiments. (F) Western blot analysis for p53 protein. (G) TRF analysis in wild-type and mutant cells. AluI/MboI-digested genomic DNA was subjected to Southern blot analysis as in Fig. 3. The detected signals indicate the length of telomeric G-strand (left) or C-strand (right).

308

d n a r e p a i r 5 ( 2 0 0 6 ) 303–311

telomerase activity. Thus, extended telomeres in KU70+/− cells cannot be attributable to changes in telomerase activity in these cells.

differences between Nalm-6 and HCT116 cell mutants could not be accounted for by differences in Ku expression levels.

3.5. KU86 haplodeficiency has no impact on cell proliferation, DSB repair or genome integrity

4.

To further reinforce the conclusion that an ∼50% reduction in Ku70/Ku86 expression levels affects neither cell proliferation nor DSB repair in human cells, we then sought to disrupt the KU86 gene and compare the phenotype of KU86+/− cells with that of wild-type and KU70+/− cells. For this purpose, Nalm-6 cells were transfected with a linearized KU86 targeting vector, which, after homologous recombination, is expected to completely delete exon 2 (plus most part of intron 2) of the human KU86 gene (Fig. 5A). Eighty-four hygromycin-resistant clones were screened for heterozygous disruption of the KU86 gene, which allowed us to isolate seven KU86+/− cell lines (data not shown). As expected, the heterozygous disruption resulted in an ∼50% reduction in cellular levels of Ku70 as well as Ku86 (Fig. 5B; clones H20, H21, and H30), consistent with the above observations described for KU70+/− cells. Similar to KU70+/− cells, the growth rate of KU86+/− cells (clones H20 and H30) was indistinguishable from that of wildtype cells (Fig. 5C), indicating clearly that the 50% reduction in Ku70/Ku86 levels does not affect cell proliferation. We also examined the sensitivity of these KU86+/− cells to Xrays and the topoisomerase II inhibitor VP-16, and observed no significant difference between wild-type and KU86+/− cells (Fig. 5D and E). We therefore conclude that, similar to KU70, KU86 haplodeficiency has no impact on DSB repair. We also note that neither p53 upregulation nor telomere shortening was observed in KU86+/− cells (Fig. 5F and G), suggesting that KU86 haplodeficiency does not affect overall genome integrity.

3.6. Ku70/Ku86 expression levels are comparable between Nalm-6 and HCT116 Ku is one of the most abundant proteins expressed in human somatic cells [4]. Thus, we compared cellular Ku70/Ku86 levels of various human cell lines, because there remained a possibility that we failed to observe haploinsufficient phenotypes in the KU70+/− and KU86+/− mutants due to abnormally high Ku expression levels in Nalm-6 cells (relative to other human cell lines including HCT116 cells). As shown in Fig. 6, this was not the case; Ku70 and Ku86 levels were both comparable between Nalm-6, HCT116, and HeLa cells. Therefore, any phenotypic

Fig. 6 – Comparison of Ku expression levels between Nalm-6, HCT116, and HeLa cells. Whole-cell extracts (10 ␮g) prepared from each cell line were subjected to Western blot analysis for Ku70 and Ku86.

Discussion

In this paper, we have shown that heterozygous disruption of the human Ku genes (KU70 and KU86 loci) does not cause defects in cell proliferation or DSB repair, as evidenced by the normal growth rate and wild-type levels of IR sensitivity of KU70+/− and KU86+/− cells (Figs. 2A, B and 5C, D). Our data also suggest that these heterozygous cells maintain overall genome integrity with no elevated cellular p53 levels (Figs. 2D and 5F), nor shortened telomeres (Figs. 3 and 5G). The notion that Ku haplodeficiency has no impact on DSB repair is further supported by the observation that KU70/KU86 heterozygous cells do not exhibit elevated sensitivities to VP-16 (Figs. 2C and 5E), an anticancer agent that induces DSBs by stabilizing topoisomerase II cleavable complexes [33]. LIG4−/− Nalm-6 cells are shown to be extremely hypersensitive to the drug, indicating that NHEJ is the predominant pathway for repairing VP-16-induced DNA lesions in human cells [10,26]. We note that LIG4+/− cells, like KU70+/− cells, do not show VP16 hypersensitivity (data not shown). Therefore, neither LIG4 nor KU70 haplodeficiency appears to affect NHEJ activity. Our finding that human Ku heterozygosity does not cause haploinsufficient phenotypes clearly contrasts with the previous report that described a variety of KU86 haploinsufficient phenotypes (i.e. retarded growth, increased radiosensitivity, elevated p53 levels, and shortened telomeres) using the human colon cancer cell line HCT116 [21]. We showed that both Ku70 and Ku86 levels are reduced by half in KU70+/− as well as KU86+/− cells (Figs. 1C and 5B). Likewise, simultaneous reduction of Ku levels has been observed in KU86+/− HCT116 cells [21], indicating that both heterozygous cell lines express reduced levels of Ku70/Ku86 heterodimer relative to their respective wild-type counterparts. Therefore, it seems unlikely that the phenotypic differences are solely due to the reduced Ku levels. Importantly, we showed that Ku70/Ku86 expression levels are comparable between the two human cell lines (Fig. 6), eliminating the possibility that Nalm-6 cells express abnormally high levels of Ku, which could prevent the appearance of dramatic haploinsufficient phenotypes. Why, then, do KU86+/− HCT116 cells exhibit haploinsufficient phenotypes, while KU70+/− and KU86+/− Nalm-6 cells do not? It is possible that the phenotypic differences simply reflect differences in genetic and/or epigenetic factors intrinsic to the cell line used. In this regard, it is interesting to note that Nalm6 and HCT116 cells are both normal for p53 status [34,35] but deficient in mismatch repair activity [36,37], implying that their genetic backgrounds might be similar in terms of DNA damage response and repair. However, as mouse pre-B cells are triggered to die more easily than other cell types [11,38], it might be that in Nalm-6 cells an increased apoptosis rate could mask a possible haploinsufficient phenotype(s) caused by Ku heterozygosity. In Ku86+/− mice, an elevated chromosome breakage phenotype is observed for primary fibroblasts, but not for primary pre-B cells due to a more rapid triggering to apoptotic cell death [11]. It is also tempting to speculate that HCT116 cells are more easily triggered to cell death by Ku

dna repair

5

heterozygosity, partly due to their abnormal karyotype (relative to Nalm-6) [39,40] in combination with reduced Ku levels. Possibly, heterozygous disruption of KU86 in HCT116 resulted in far more than 50% reduction of Ku expression levels. This could account for the severer phenotypes of KU86+/− HCT116 cells and recent reports by Sibani et al. [41,42] would support this view. Alternatively, the phenotypic differences between Nalm-6 and HCT116 cells might reflect the presence of KARP1, a 9 kDa longer isoform of Ku86 that is transcribed from the KU86 locus by using an upstream promoter and additional exons [23]. Interestingly, KARP-1 is only observed in primate cells and not in rodent cells [23] and, in fact, murine cells heterozygous for Ku70 or Ku86 mutations do not exhibit growth defects or elevated IR sensitivity [16,43]. Furthermore, KARP1 expression is induced following DNA damage in a p53- and ATM-dependent fashion, and a possible role for KARP-1 in DSB repair has been suggested [23,44]. Hence, it could be that KU86 haploinsufficient phenotypes have been caused by heterozygous inactivation of KARP-1. In this scenario, however, KARP-l’s role in HCT116 cells should be much more important than in Nalm-6 cells, and further studies will be required to clarify this issue. Ku has been considered as one of the main factors for maintaining telomere stability [4,45]. Interestingly, our data show that KU70/KU86 haplodeficiency does not result in telomere shortening. Rather, our heterozygous cells had moderately extended telomeres (Figs. 3 and 5G), despite no detectable changes in telomerase activity levels (Fig. 4). Again, this is in marked contrast to KU86+/− HCT116 cells [22] or HeLa cells with reduced Ku levels due to siRNA-mediated knockdown of the KU86 gene [46]. We would like to emphasize, therefore, that telomere shortening is not a commonly observed phenomenon in human cells with reduced Ku levels. Intriguingly, conflicting observations regarding Ku and telomere metabolism have been reported using rodent cells, where a lack of Ku results in extended [14] or shortened [15] telomeres. Furthermore, the impact of Ku null mutations on telomere length varies considerably between species. Yeast, chicken DT40, and Arabidopsis mutants lacking either Ku subunit have abnormally shortened [47], unchanged [48], or massively extended [29,30] telomeres, respectively. It is also worth mentioning that genome instability, such as end-to-end fusions of chromosomes, has not been observed in cells devoid of shortened telomeres (i.e. in the cases of DT40 and Arabidopsis). This further supports the notion that slightly extended telomeres observed in our KU70+/− and KU86+/− cells do not cause genome instability. Human telomeric DNA is composed of d(TTAGGG) repeats, forming a unique structure called t-loop, a conformation believed to protect chromosomal ends [45,49,50]. Ku is physically associated with telomeric DNA and the telomere repeatbinding proteins TRF1 and TRF2, which both contribute to t-loop formation [51–53]. Overexpression of TRF1 or TRF2 is shown to induce progressive telomere shortening [54,55], suggesting a role(s) for these proteins in the regulation of telomerase activity. Furthermore, human Ku protein is shown to physically associate with telomerase through interaction with the reverse transcriptase protein subunit hTERT, suggesting a possible role for Ku in regulating telomerase activity [31]. In fact, Ku86 deficiency results in telomere elongation

( 2 0 0 6 ) 303–311

309

in telomerase-positive mice, but not in telomerase-negative mice [56]. Given the interactions between Ku, telomerase, and the telomere repeat-binding proteins, it is highly likely that Ku contributes to the maintenance of normal telomere length by virtue of these interactions [57], and even a 50% reduction of Ku levels can affect telomere metabolism. As mentioned, we did not observe any changes in in vitro telomerase activity levels by KU70 haplodeficiency. We therefore speculate that telomere elongation is caused by an increased accessibility of telomerase to telomeres and/or an increased telomerase activity in vivo in cells with Ku mutations and that such cells can maintain overall genome integrity (see above). Conversely, shortened telomeres may be intrinsic to cells unable to gain the increased accessibility and/or activity of telomerase due to unknown reasons. Such cells may have difficulties in maintaining genome stability, leading to increased chromosomal fusions, as exemplified by KU86+/− HCT116 cells [22]. In this regard, it is interesting to mention that Nalm-6 cells possess slightly higher levels of telomerase activity than do HCT116 or HeLa cells (Fig. 4). Apparently, however, further studies will be required to elucidate the relationship between Ku and telomere metabolism in human somatic cells. In conclusion, we have demonstrated using human somatic cells that neither KU70 nor KU86 haplodeficiency causes defects in cell proliferation or DSB repair, and presented data showing that genomic instability, involving telomere shortening, is not a commonly observed phenomenon in human cells with reduced Ku levels. Thus, the impact of Ku70/86 mutations on telomere metabolism appears to vary not only between species, but also between cell types, even in humans.

Acknowledgements We thank Kiyoshi Miyagawa for generously providing us with the HCT116 cell line. We also thank Atsushi Enomoto for helpful discussions. This work was supported in part by grants from Uehara Memorial Foundation and by Grant-in-Aids for Scientific Research on Priority Areas from the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) of Japan.

references

[1] M.R. Lieber, Y. Ma, U. Pannicke, K. Schwarz, Mechanism and regulation of human non-homologous DNA end-joining, Nat. Rev. Mol. Cell Biol. 4 (2003) 712–720. [2] D.B. Lombard, F.K. Chua, R. Mostoslavsky, S. Franco, M. Gostissa, F.W. Alt, DNA repair, genome stability, and aging, Cell 120 (2005) 497–512. [3] M. Takata, M.S. Sasaki, E. Sonoda, C. Morrison, M. Hashimoto, H. Utsumi, Y. Yamaguchi-Iwai, A. Shinohara, S. Takeda, Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells, EMBO J. 17 (1998) 5497–5508. [4] J.A. Downs, S.P. Jackson, A means to a DNA end: the many roles of Ku, Nat. Rev. Mol. Cell Biol. 5 (2004) 367–378.

310

dna repair

[5] Y. Ma, U. Pannicke, K. Schwarz, M.R. Lieber, Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D)J recombination, Cell. 108 (2002) 781–794. [6] Y. Gu, K.J. Seidl, G.A. Rathbun, C. Zhu, J.P. Manis, N. van der Stoep, L. Davidson, H.L. Cheng, J.M. Sekiguchi, K. Frank, P. Stanhope-Baker, M.S. Schlissel, D.B. Roth, F.W. Alt, Growth retardation and leaky SCID phenotype of Ku70-deficient mice, Immunity 7 (1997) 653–665. [7] H. Ouyang, A. Nussenzweig, A. Kurimasa, V.C. Soares, X. Li, C. Cordon-Cardo, W. Li, N. Cheong, M. Nussenzweig, G. Iliakis, D.J. Chen, G.C. Li, Ku70 is required for DNA repair but not for T cell antigen receptor gene recombination in vivo, J. Exp. Med. 186 (1997) 921–929. [8] G.C. Li, H. Ouyang, X. Li, H. Nagasawa, J.B. Little, D.J. Chen, C.C. Ling, Z. Fuks, C. Cordon-Cardo, Ku70: a candidate tumor suppressor gene for murine T cell lymphoma, Mol. Cell 2 (1998) 1–8. [9] N. Adachi, H. Suzuki, S. Iiizumi, H. Koyama, Hypersensitivity of nonhomologous DNA end-joining mutants to VP-16 and ICRF-193: implications for the repair of topoisomerase II-mediated DNA damage, J. Biol. Chem. 278 (2003) 35897–35902. [10] N. Adachi, S. Iiizumi, S. So, H. Koyama, Genetic evidence for involvement of two distinct nonhomologous end-joining pathways in repair of topoisomerase II-mediated DNA damage, Biochem. Biophys. Res. Commun. 318 (2004) 856–861. [11] Z.E. Karanjawala, U. Grawunder, C.L. Hsieh, M.R. Lieber, The nonhomologous DNA end joining pathway is important for chromosome stability in primary fibroblasts, Curr. Biol. 9 (1999) 1501–1504. [12] M.J. Difilippantonio, J. Zhu, H.T. Chen, E. Meffre, M.C. Nussenzweig, E.E. Max, T. Ried, A. Nussenzweig, DNA repair protein Ku80 suppresses chromosomal aberrations and malignant transformation, Nature 404 (2000) 510–514. [13] S.M. Bailey, J. Meyne, D.J. Chen, A. Kurimasa, G.C. Li, B.E. Lehnert, E.H. Goodwin, DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 14899–14904. [14] E. Samper, F.A. Goytisolo, P. Slijepcevic, P.P. van Buul, M.A. Blasco, Mammalian Ku86 protein prevents telomeric fusions independently of the length of TTAGGG repeats and the G-strand overhang, EMBO Rep. 1 (2000) 244–252. [15] F. d’Adda di Fagagna, M.P. Hande, W.M. Tong, D. Roth, P.M. Lansdorp, Z.Q. Wang, S.P. Jackson, Effects of DNA nonhomologous end-joining factors on telomere length and chromosomal stability in mammalian cells, Curr. Biol. 11 (2001) 1192–1196. [16] A. Nussenzweig, C. Chen, V. da Costa Soares, M. Sanchez, K. Sokol, M.C. Nussenzweig, G.C. Li, Requirement for Ku80 in growth and immunoglobulin V(D)J recombination, Nature 382 (1996) 551–555. [17] C. Zhu, M.A. Bogue, D.S. Lim, P. Hasty, D.B. Roth, Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates, Cell 86 (1996) 379–389. [18] K. Meek, L. Kienker, C. Dallas, W. Wang, M.J. Dark, P.J. Venta, M.L. Huie, R. Hirschhorn, T. Bell, SCID in Jack Russell terriers: a new animal model of DNA-PKcs deficiency, J. Immunol. 167 (2001) 2142–2150. [19] E. Riballo, S.E. Critchlow, S.H. Teo, A.J. Doherty, A. Priestley, B. Broughton, B. Kysela, H. Beamish, N. Plowman, C.F. Arlett, A.R. Lehmann, S.P. Jackson, P.A. Jeggo, Identification of a defect in DNA ligase IV in a radiosensitive leukaemia patient, Curr. Biol. 9 (1999) 699–702.

5

( 2 0 0 6 ) 303–311

[20] D. Moshous, I. Callebaut, R. de Chasseval, B. Corneo, M. Cavazzana-Calvo, F. Le Deist, I. Tezcan, O. Sanal, Y. Bertrand, N. Philippe, A. Fischer, J.P. de Villartay, Artemis, a novel DNA double-strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency, Cell 105 (2001) 177–186. [21] G. Li, C. Nelsen, E.A. Hendrickson, Ku86 is essential in human somatic cells, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 832–837. [22] K. Myung, G. Ghosh, E.J. Fattah, G. Li, H. Kim, A. Dutia, E. Pak, S. Smith, E.A. Hendrickson, Regulation of telomere length and suppression of genomic instability in human somatic cells by Ku86, Mol. Cell. Biol. 24 (2004) 5050–5059. [23] K. Myung, D.M. He, S.E. Lee, E.A. Hendrickson, KARP-1: a novel leucine zipper protein expressed from the Ku86 autoantigen locus is implicated in the control of DNA-dependent protein kinase activity, EMBO J. 16 (1997) 3172–3184. [24] N. Adachi, M. Kobayashi, H. Koyama, Cell cycle-dependent regulation of the mouse DNA topoisomerase IIalpha gene promoter, Biochem. Biophys. Res. Commun. 230 (1997) 105–109. [25] N. Adachi, T. Ishino, Y. Ishii, S. Takeda, H. Koyama, DNA ligase IV-deficient cells are more resistant to ionizing radiation in the absence of Ku70: implications for DNA double-strand break repair, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 12109–12113. [26] S. So, N. Adachi, M.R. Lieber, H. Koyama, Genetic interactions between BLM and DNA ligase IV in human cells, J. Biol. Chem. 279 (2004) 55433–55442. [27] M. Kobayashi, N. Adachi, Y. Aratani, A. Kikuchi, H. Koyama, Decreased topoisomerase II alpha expression confers increased resistance to ICRF-193 as well as VP-16 in mouse embryonic stem cells, Cancer Lett. 166 (2001) 71–77. [28] K. Sado, D. Ayusawa, A. Enomoto, T. Suganuma, M. Oshimura, K. Sato, H. Koyama, Identification of a mutated DNA ligase IV gene in the X-ray-hypersensitive mutant SX10 of mouse FM3A cells, J. Biol. Chem. 276 (2001) 9742–9748. [29] K. Riha, J.M. Watson, J. Parkey, D.E. Shippen, Telomere length deregulation and enhanced sensitivity to genotoxic stress in Arabidopsis mutants deficient in Ku70, EMBO J. 21 (2002) 2819–2826. [30] M.E. Gallego, N. Jalut, C.I. White, Telomerase dependence of telomere lengthening in Ku80 mutant Arabidopsis, Plant Cell 15 (2003) 782–789. [31] W. Chai, L.P. Ford, L. Lenertz, W.E. Wright, J.W. Shay, Human Ku70/80 associates physically with telomerase through interaction with hTERT, J. Biol. Chem. 277 (2002) 47242–47247. [32] N.W. Kim, M.A. Piatyszek, K.R. Prowse, C.B. Harley, M.D. West, P.L. Ho, G.M. Coviello, W.E. Wright, S.L. Weinrich, J.W. Shay, Specific association of human telomerase activity with immortal cells and cancer, Science 266 (1994) 2011–2015. [33] S.Y. Liu, B.D. Hwang, M. Haruna, Y. Imakura, K.H. Lee, Y.C. Cheng, Podophyllotoxin analogs: effects on DNA topoisomerase II, tubulin polymerization, human tumor KB cells, and their VP-16-resistant variants, Mol. Pharmacol. 36 (1989) 78–82. [34] F. Bunz, A. Dutriaux, C. Lengauer, T. Waldman, S. Zhou, J.P. Brown, J.M. Sedivy, K.W. Kinzler, B. Vogelstein, Requirement for p53 and p21 to sustain G2 arrest after DNA damage, Science 282 (1998) 1497–1501. [35] G. Filippini, T. Balmelli, H. Eppenberger, G. Soldati, Flow cytometric detection of p53 protein after incubation of a pre-B cell line with antitumor agents, Cytometry 35 (1999) 267–273.

dna repair

5

[36] N. Papadopoulos, N.C. Nicolaides, B. Liu, R. Parsons, C. Lengauer, F. Palombo, A. D’Arrigo, S. Markowitz, J.K. Willson, K.W. Kinzler, et al., Mutations of GTBP in genetically unstable cells, Science 268 (1995) 1915–1917. [37] E.C. Matheson, A.G. Hall, Assessment of mismatch repair function in leukaemic cell lines and blasts from children with acute lymphoblastic leukaemia, Carcinogenesis 24 (2003) 31–38. [38] S.D. Griffiths, D.T. Goodhead, S.J. Marsden, E.G. Wright, S. Krajewski, J.C. Reed, S.J. Korsmeyer, M. Greaves, Interleukin 7-dependent B lymphocyte precursor cells are ultrasensitive to apoptosis, J. Exp. Med. 179 (1994) 1789–1797. [39] G. Traverso, C. Bettegowda, J. Kraus, M.R. Speicher, K.W. Kinzler, B. Vogelstein, C. Lengauer, Hyper-recombination and genetic instability in BLM-deficient epithelial cells, Cancer Res. 63 (2003) 8578–8581. [40] I. Wlodarska, A. Aventin, J. Ingles-Esteve, D. Falzetti, A. Criel, J.J. Cassiman, C. Mecucci, H. Van den Berghe, P. Marynen, Anew subtype of pre-B acute lymphoblastic leukemia with t(5;12)(q31q33;p12), molecularly and cytogenetically distinct from t(5;12) in chronic myelomonocytic leukemia, Blood 89 (1997) 1716–1722. [41] S. Sibani, G.B. Price, M. Zannis-Hadjopoulos, Decreased origin usage and initiation of DNA replication in haploinsufficient HCT116 Ku80+/− cells, J. Cell. Sci. 118 (2005) 3247–3261. [42] S. Sibani, G.B. Price, M. Zannis-Hadjopoulos, Ku80 binds to human replication origins prior to the assembly of the ORC complex, Biochemistry 44 (2005) 7885–7896. [43] Y. Gu, S. Jin, Y. Gao, D.T. Weaver, F.W. Alt, Ku70-deficient embryonic stem cells have increased ionizing radiosensitivity, defective DNA end-binding activity, and inability to support V(D)J recombination, Proc. Natl. Acad. Sci. U.S.A. 94 (1997) 8076–8081. [44] K. Myung, C. Braastad, D.M. He, E.A. Hendrickson, KARP-1 is induced by DNA damage in a p53- and ataxia telangiectasia mutated-dependent fashion, Proc. Natl. Acad. Sci. U.S.A. 95 (1998) 7664–7669.

( 2 0 0 6 ) 303–311

311

[45] T. de Lange, Protection of mammalian telomeres, Oncogene 21 (2002) 532–540. [46] I. Jaco, P. Munoz, M.A. Blasco, Role of human Ku86 in telomere length maintenance and telomere capping, Cancer Res. 64 (2004) 7271–7278. [47] S.J. Boulton, S.P. Jackson, Identification of a Saccharomyces cerevisiae Ku80 homologue: roles in DNA double strand break rejoining and in telomeric maintenance, Nucleic Acids Res. 24 (1996) 4639–4648. [48] C. Wei, R. Skopp, M. Takata, S. Takeda, C.M. Price, Effects of double-strand break repair proteins on vertebrate telomere structure, Nucleic Acids Res. 30 (2002) 2862–2870. [49] J.D. Griffith, L. Comeau, S. Rosenfield, R.M. Stansel, A. Bianchi, H. Moss, T. de Lange, Mammalian telomeres end in a large duplex loop, Cell 97 (1999) 503–514. [50] T. de Lange, T-loops and the origin of telomeres, Nat. Rev. Mol. Cell. Biol. 5 (2004) 323–329. [51] H.L. Hsu, D. Gilley, E.H. Blackburn, D.J. Chen, Ku is associated with the telomere in mammals, Proc. Natl. Acad. Sci. U.S.A. 96 (1999) 12454–12458. [52] H.L. Hsu, D. Gilley, S.A. Galande, M.P. Hande, B. Allen, S.H. Kim, G.C. Li, J. Campisi, T. Kohwi-Shigematsu, D.J. Chen, Ku acts in a unique way at the mammalian telomere to prevent end joining, Genes Dev. 14 (2000) 2807– 2812. [53] K. Song, D. Jung, Y. Jung, S.G. Lee, I. Lee, Interaction of human Ku70 with TRF2, FEBS Lett. 481 (2000) 81–85. [54] B. van Steensel, T. de Lange, Control of telomere length by the human telomeric protein TRF1, Nature 385 (1997) 740–743. [55] A. Smogorzewska, B. van Steensel, A. Bianchi, S. Oelmann, M.R. Schaefer, G. Schnapp, T. de Lange, Control of human telomere length by TRF1 and TRF2, Mol. Cell. Biol. 20 (2000) 1659–1668. [56] S. Espejel, S. Franco, S. Rodriguez-Perales, S.D. Bouffler, J.C. Cigudosa, M.A. Blasco, Mammalian Ku86 mediates chromosomal fusions and apoptosis caused by critically short telomeres, EMBO J. 21 (2002) 2207–2219. [57] E.H. Blackburn, Switching and signaling at the telomere, Cell 106 (2001) 661–673.