- Email: [email protected]
HIF-1α and VEGF Are Involved in Deferoxamine-Ameliorated Traumatic Brain Injury
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 9 ( - ) 1 e8
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.JournalofSurgicalResearch.com
HIF-1a and VEGF Are Involved in DeferoxamineAmeliorated Traumatic Brain Injury Kai Wang, MD,a,b,1 Yao Jing, MD,a,1 Chen Xu, MD,a Jianwei Zhao, MD,a Qiuyuan Gong, MD,a and Shiwen Chen, MD, PhDa,* a
Department of Neurosurgery, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, China Department of Neurosurgery, The Affiliated Huai’an Hospital of Xuzhou Medical University and The Second People’s Hospital of Huai’an, Huai’an, China
b
article info
abstract
Article history:
Background: Deferoxamine (DFX) has been reported to have neuroprotective effect. This
Received 5 May 2019
study aimed to investigate the neuroprotective effect of DFX and its effect on hypoxia-
Received in revised form
inducible factor 1 alpha (HIF-1a) and vascular endothelial growth factor (VEGF) in rats
1 August 2019
after traumatic brain injury (TBI).
Accepted 13 September 2019
Materials and methods: Rats were randomly divided into sham operation, TBI þ DFX, and
Available online xxx
TBI þ vehicle groups. The rats in the TBI þ DFX group were intraperitoneally injected with DFX 2 and 6 h after injury, thereafter once every 12 h. The rats in the TBI þ vehicle group
Keywords:
were intraperitoneally injected with saline at the same time points. At 6, 12, 24, and 48 h
Controlled cortical impact
after TBI, 6 rats in each group were euthanized, and the brains were harvested. The
Deferoxamine
expression of HIF-1a and VEGF in the pericontusional area was detected using real-time
Hypoxia-inducible factor 1a
polymerase chain reaction and Western blot analysis. TBI-induced apoptosis was inves-
Traumatic brain injury
tigated using the TdT-mediated dUTP nick-end labeling (TUNEL) method. Three days after
Vascular endothelial growth factor
TBI, the density of microvessels was examined via immunohistochemical staining. Results: DFX treatment upregulated the expression of HIF-1a and VEGF after TBI. DFX treatment reduced apoptosis and improved the neurobehavioral score after TBI. The density of microvessels was higher in the TBI þ DFX group than that in the TBI þ vehicle group 3 d after TBI. Conclusions: DFX can stimulate angiogenesis, inhibit apoptosis, and play a protective role after TBI. The protective effect of DFX may, at least in part, be through upregulating the expression of HIF-1a and its downstream target gene VEGF. ª 2019 Elsevier Inc. All rights reserved.
Introduction Traumatic brain injury (TBI) is a serious problem worldwide owing to its high mortality and/or induction of disability. Although research on TBI has made great progress and clinical
treatment is being constantly improved, the prognosis of patients with TBI is still not optimistic. Deferoxamine (DFX), an iron chelator, has a protective effect on cerebral hemorrhage, cerebral hypoxiaeischemia, and spinal cord injury.1-6 It can penetrate the blood-brain barrier,
The authors declare no conflict of interest. * Corresponding author. Department of Neurosurgery, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200233, China. Tel.: þ8602124058405; fax: þ8602164701361. E-mail address: [email protected] (S. Chen). 1 These authors contributed equally to this work. 0022-4804/$ e see front matter ª 2019 Elsevier Inc. All rights reserved. https://doi.org/10.1016/j.jss.2019.09.023
2
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 9 ( - ) 1 e8
where it binds to ferric irons released from hemoglobin and thereby prevents the formation of hydroxyl radicals through inhibiting Fenton reaction and attenuates brain injury caused by iron overload.7 However, there have been few reports of its neuroprotective actions in TBI. DFX can attenuate brain atrophy and hydrocephalus and contributes to the recovery of spatial learning and memory in rats after TBI.8-10 However, the neuroprotective role of DFX remains largely unknown. Hypoxia-inducible factor 1 (HIF1), a transcription factor, is an important regulatory factor of the hypoxia responsesignaling pathway. HIF1 is made up of two subunits: an inducible subunit (HIF-1a) and a constitutive subunit (HIF-1b). HIF-1a is both a regulatory subunit and a reactive subunit, and its transcriptional activity and protein stability are mainly regulated by the oxygen concentration in cells.11 During cerebral ischemia and hypoxia, the expression of HIF-1a is upregulated, thereby increasing the tolerance of brain tissue to hypoxia.12,13 Previous studies have demonstrated that DFX can inhibit the hydrolysis of HIF-1a, induce the expression of HIF-1a, and increase the expression levels of HIF-1, thus playing a neuroprotective role in cerebral ischemia and hypoxia injury.13,14 However, whether DFX has the ability to upregulate the expression of HIF-1a in animals with TBI is not clear. Vascular endothelial growth factor (VEGF) signaling represents a critical rate-limiting step in physiological angiogenesis. It was reported as a target gene of HIF-1a, and its expression is regulated by HIF-1a.12,13 VEGF is a trophic factor expressed in the central nervous system after injury and induces angiogenesis.15,16 A previous study showed that VEGF had a strong capacity to augment neurogenesis and angiogenesis and had a neuroprotective effect after TBI.17 DFX can stimulate the expression of VEGF,18 but reports on its involvement in TBI are lacking. In the present study, several preclinical target validation paradigms were used, and the in vivo efficacy of DFX in a controlled cortical impact (CCI) model of TBI in rats was examined.
group) was evaluated 1, 3, 7, and 14 d after TBI. The expression levels of HIF-1a and VEGF in the pericontusional area were measured using real-time polymerase chain reaction and Western blot analysis. The apoptosis was detected using the TdT-mediated dUTP nick-end labeling (TUNEL) method. Three days after TBI, the brains of the remaining six rats in each group were harvested, and the microvessel density was examined using immunohistochemical staining. This study was approved by the Institutional Animal Care and Use Committee of Shanghai Jiao Tong University Affiliated to Sixth People’s Hospital and conducted in accordance with the guidelines of the International Council on Animal Care.
Surgical procedures and CCI injury model The rat CCI injury model was established as Yuan’s description.20 The rats were anesthetized with ketamine (75 mg/kg) and xylazine (10 mg/kg). A midline incision was made over the head after the surgical site was disinfected with ethanol scrubs. A craniotomy was performed using a 5-mm dental drill over the central aspect of the right parietal bone, 1 mm lateral to the sagittal suture. The process was performed carefully to keep the dura intact and avoid blood vessels traveling through the superior sagittal sinus. CCI was created oriented perpendicular to the cortical surface using a 4-mmdiameter, rounded steel impactor of an electronically controlled CCI device (PinPoint Precision Cortical Impactor PCI3000; Hatteras Instruments Inc, Cary, NC). TBI of moderate severity was induced by the CCI instrument at an impact velocity of 1.5 m/s, deformation depth of 1.5 mm, and dwell time of 85 ms. After injury, the bleeding of the injured cortical surface was controlled with sterile cotton and then closed the incision using 6-0 silk sutures. The rats in the sham group underwent the same procedure as the injured animals except they did not undergo CCI. The entire procedure was performed by the same person to minimize the variance.
Real-time polymerase chain reaction
Materials and methods Animals Adult male Sprague-Dawley rats (250-300 g; Shanghai SipprBK Laboratory Animal Co Ltd, Shanghai, China) were randomly divided into three groups: sham operation group (n ¼ 30), TBI þ DFX group (n ¼ 42), and TBI þ vehicle group (n ¼ 42). CCI was performed in the right parietal lobe.19 The rats in the TBI þ DFX and TBI þ vehicle groups were struck with a CCI instrument, and the rats in the sham operation group underwent the same anesthesia and surgical procedure but were not injured. The rats in the TBI þ DFX group were intraperitoneally injected with DFX (100 mg/kg) 2 and 6 h after injury, and thereafter once every 12 h. The rats in the TBI þ vehicle group were injected with an equal volume of saline at the same time points. Six, 12, 24, and 48 h after TBI, 6 rats in each group were euthanized, and their brains were harvested and subjected to further analysis. The neurological status of rats in the TBI þ DFX and TBI þ vehicle groups (n ¼ 12/
Total RNAs were extracted using a TRIzol reagent kit (Invitrogen, Carlsbad, CA). Quantitative PCR reactions were performed using an SYBR Green PCR Kit (Roche, Mannheim, Germany) on a ViiA7 Real-Time PCR System (ABI, Carlsbad, CA). The expression levels of genes were calculated using bactin by the 2DDCT method.21 The primers were synthesized by BIOTNT (Shanghai, China) and are listed in Table 1.
Table 1 e Primer sequences used in this study. Gene
Sequences of primers used
HIF-1a, forward
AACTGCCACCACTGATGAAT
HIF-1a, reverse
CCACTGTATGCTGATGCCTT
VEGF, forward
TGGTCTTTCGTCCTTCTTAG
VEGF, reverse
GATGGGTTTGTCGTGTTTC
b-actin, forward
CCCATCTATGAGGGTTACGC
b-actin, reverse
TTTAATGTCACGCACGATTTC
wang et al mechanism of dfx-ameliorated tbi
3
Fig. 1 e Expression of HIF-1a and VEGF mRNA in the pericontusional area detected using RT-PCR. (A) Expression of HIF-1a mRNA in the pericontusional area. (B) Expression of VEGF mRNA. Data are presented as mean ± SEM (n [ 6/time point). *P < 0.05, **P < 0.01.
Western blot analysis Total proteins were extracted using a radioimmunoprecipitation assay lysis buffer (Sigma, St. Louis, MO). Samples were separated in 10% sodium dodecyl sulfateepolyacrylamide gel electrophoresis gels and transferred onto a polyvinylidene difluoride membrane. They were then incubated with primary antibodies of HIF-1a (CST, Boston, MA; 1:1000), VEGF (Abcam, Cambridge, UK; 1:1000), and b-actin (Abcam, Cambridge, UK; 1:400) at 4 C overnight. The next day, the membranes were incubated with secondary antibody (Abcam, Cambridge, UK; 1:2000) at 24 C for 1 h. The grayscale of the bands was determined using the QuantityOne image analysis system (Bio-Rad, Hercules, CA).
Neurological severity score assessment The neurological status of each animal was evaluated 1, 3, 7, and 14 d after TBI using the modified neurological severity score test as described in a previous study, which included
motor, sensory, balance, and reflex tests (normal score, 0; maximal deficit score, 18).22 One score point was awarded for the inability to perform a particular task or for the absence of a tested reflex. Consequently, the higher the score, the more severe was the neurological injury.
TUNEL The presence of apoptotic cells was determined by detecting apoptosis in the pericontusional regions using a TUNEL Kit (Roche Ltd, Switzerland). TUNEL staining was performed according to the manufacturer’s protocol. The stained cells were scanned with a fluorescence microscope (FV1200, Olympus, Tokyo, Japan).
Immunohistochemical analysis and calculation of microvessel density The brain tissue immersed in 4% paraformaldehyde was embedded in paraffin and then sectioned at 4 mm thickness
Fig. 2 e Expression of HIF-1a and VEGF protein in the pericontusional area detected using Western blot analysis. (A) Western blot analyses showed protein levels of HIF-1a and VEGF in brain tissue 6, 12, 24, and 48 h after TBI. (B) Expression of HIF-1a protein in the pericontusional area of mice from different experimental groups. (C) Expression of VEGF protein in the pericontusional area. Data are presented as mean ± SEM (n [ 6/time point). *P < 0.05, **P < 0.01.
4
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 9 ( - ) 1 e8
Fig. 3 e Microvessel density was detected by CD34 immunohistochemical staining. DFX treatment stimulated angiogenesis in rats after TBI. Scale bar [ 200 mm. (Color version of figure is available online.)
using a microtome. The sections were dewaxed using xylene and an alcohol gradient, placed in 3% peroxide, and incubated for 30 min to block the activity of endogenous catalase. The sections were then washed three times with 0.01 mol/L phosphate-buffered saline (PBS) for 5 min each time. The antigens were heat-revived, and the sections were incubated in a normal goat serum working solution at 37 C for 30 min. Then, the normal goat serum was discarded, and the rabbit anti-CD34 monoclonal antibody (Abcam, Cambridge, UK; 1:2500) was added to the sections, which were incubated overnight at 4 C. The sections were washed three times with 0.01 mol/L PBS for 5 min each time, incubated with horseradish peroxidaseelabeled active rabbit-anti-goat immunoglobulin G working solution at 37 C for 30 min, and washed three times with 0.01 mol/L PBS for 5 min each time. The sections were then stained for 3-5 min in a 3, 30 -diaminobenzidine staining solution, re-stained in hematoxylin, differentiated using hydrochloric alcohol, and gradient dehydrated. After the sections were sealed with neutral balsam, digital images were captured and analyzed. Microvessel density was calculated by the method reported by Weidner et al.23 Vascular endothelial cells were brown stained for CD34. A single endothelial cell or endothelial cell clusters dyed brown were deemed a countable microvessel; those with lumen greater than eight erythrocyte diameters or a thick base layer were excluded from the analysis. Five regions with the highest neovascularization in the low magnification (40) mode were identified, and then microvessels were counted in these five fields at high magnification (200). The mean number of microvessel counts represented the measure of microvessel density. Every count was performed by two investigators using a double-headed light microscope simultaneously.
Results DFX augmented the expression of HIF-1a and VEGF after TBI The expression of HIF-1a mRNA in the pericontusional area of the TBI þ DFX and TBI þ vehicle groups increased significantly in the acute phase after TBI (P < 0.01), and both reached peaks 12 h after the insult (3.2-fold and 4.3-fold of the sham group, respectively), then receded slowly, and maintained a fairly high level until 48 h after injury (2.2-fold and 3.4-fold of the sham group, respectively) (Fig. 1). The expression levels of HIF-1a mRNA in rats in the TBI þ DFX group were significantly higher than those in the TBI þ vehicle group 6, 12, 24, and 48 h after injury (P < 0.01) (Fig. 1A). The expression levels of HIF-1a protein in rats in the TBI þ vehicle group significantly increased in the acute phase after TBI (P < 0.01), then gradually decreased 6 h after injury, but were still significantly higher than those in the sham group until 48 h after injury (P < 0.01) (Fig. 2A and B). The expression levels of HIF-1a protein in the TBI þ DFX group also increased significantly in the acute phase after TBI, reached a peak 12 h after injury, and were subsequently maintained at a fairly high level until 48 h after injury. The expression levels of HIF-1a protein were higher in the TBI þ DFX group than in the TBI þ vehicle group 12, 24, and 48 h after injury (P < 0.05) (Fig. 2A and B). The mRNA and protein expression levels of VEGF in the TBI þ DFX and TBI þ vehicle groups gradually increased in the acute phase after TBI, leveled off 24 and 48 h after injury, but were maintained at a fairly high level. The mRNA and protein
Statistical analysis All data in this study were expressed as means standard error of the mean. Multiple-group comparisons were performed with one-way analysis of variance followed by least significant difference post hoc test. The Student t test was used to compare means between two groups. P values less than 0.05 was considered to be statistically significant. The statistical package used for analyses was SPSS 20.0 (SPSS Inc, Chicago, IL). GraphPad Prism 6 (GraphPad Software, San Diego, CA) was used for the graphical representation of data.
Table 2 e Microvessel density 3 d after TBI. Group Microvessel density *
Sham (n ¼ 6)
TBI þ vehicle (n ¼ 6)
TBI þ DFX (n ¼ 6)
5.11 0.78
6.86 1.09*
8.96 1.01y,z
P < 0.05. P < 0.01 versus the sham group. z P < 0.05 versus the TBI þ vehicle group. y
wang et al mechanism of dfx-ameliorated tbi
5
Fig. 4 e Apoptotic cells in the pericontusional area detected by the TUNEL method (A) 6, (B) 12, (C) 24, and (D) 48 h after injury. (E) The apoptotic rate in the brains of rats was less in the TBI D DFX group than in the TBI D vehicle group at each time point after injury. Data are presented as mean ± SEM (n [ 6/time point). *P < 0.05, **P < 0.01. Scale bar [ 50 mm. (Color version of figure is available online.)
expression levels of VEGF were higher in the TBI þ DFX group than in the TBI þ vehicle group 6, 12, 24, and 48 h after injury (P < 0.05) (Fig. 1B-C). The results showed that DFX treatment could increase the expression of HIF-1a and VEGF in rats after TBI.
TBI þ DFX and TBI þ vehicle groups than in the sham group 3 d after injury (P < 0.05), and also higher in the TBI þ DFX group than in the TBI þ vehicle group (P < 0.05) (Table 2). The results indicated that DFX could stimulate angiogenesis in rats after TBI.
DFX treatment stimulated angiogenesis after TBI To investigate the role of DFX in angiogenesis after TBI, the microvessel density of the pericontusional area was examined immunohistochemically (Fig. 3). The results showed that the microvessel density of brain in rats was higher in the
DFX treatment reduced apoptosis and improved neurological function after TBI The apoptosis rate in the brains of rats was less in the TBI þ DFX group than in the TBI þ vehicle group at each time
6
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 9 ( - ) 1 e8
Fig. 5 e The modified neurological severity score (mNSS) test. Rats in the TBI D DFX group had significantly lower scores at 3 d (P < 0.05), 7 d (P < 0.05), and 14 d (P < 0.01) after CCI injury compared with rats in the TBI D vehicle group. Data are presented as mean ± SEM (n [ 12/group). *P < 0.05, **P < 0.01. point after injury, as detected by TUNEL (P < 0.05). Furthermore, 12, 24, and 48 h after injury, the apoptosis rate was found to be significantly less in the cortex of the TBI þ DFX group than in the TBI þ vehicle group (P < 0.01) (Fig. 4). The results showed that DFX treatment could decrease the level of apoptosis in the brain and ameliorate brain damage in rats after TBI. None of the animals used in the study died during the experiment. TBI resulted in neurological deficits. To explore the effects of DFX on neurological functional recovery, the modified neurological severity score test was used to examine the motor, balance, and reflex functions of rats after CCI injury. The rats in the TBI þ DFX group had significantly lower scores 3 (P < 0.05), 7 (P < 0.05), and 14 d (P < 0.01) after CCI injury, compared with the DFX þ vehicle group (Fig. 5). The results showed that DFX treatment could improve neurological function after TBI.
Discussion The present study revealed that DFX treatment increased the density of microvessels. This finding showed that DFX could stimulate angiogenesis and thus increase the blood and oxygen supply to the local brain tissue. It was also found that DFX could suppress the level of apoptosis and improve neurobehavioral outcomes after TBI. We speculate that DFX has a protective effect mainly on neurons as the rescue of neurons is closely related to the improvement of neural dysfunction. It was also reported that DFX suppresses both apoptosis and oncosis in an astrocytes in vitro model of the ischemic core.24 These findings further confirmed a protective role of DFX after TBI. A few studies have shown that DFX can attenuate brain atrophy and hydrocephalus and contributes to the recovery of spatial learning and memory in rats after TBI.8-10 Previous researchers speculated that this function of DFX may be related to reducing brain injury accentuated by iron overload as the presence of hemoglobin in the area of injury is a common phenomena.8-10 After injection, DFX can penetrate the
blood-brain barrier and then combine with trivalent ferric ions to avoid further chemical reactions of these ions that are known to aggravate brain injury.2 DFX can also increase the levels of malondialdehyde and play a role in inhibiting lipid peroxidation.2,5 In addition, this protection is associated with stabilizing the transcription factor HIF-1a.12-14,25 During cerebral ischemia and hypoxia, the expression of HIF-1a is upregulated, thereby increasing the tolerance of brain tissue to hypoxia by activating the transcriptional expression of downstream genes such as erythropoietin (EPO) and VEGF, which have been implicated as a neuroprotectant.12,13,16,18 Therefore, upregulating the expression of HIF-1a after TBI may play a neuroprotective role and improve the prognosis of patients. DFX could inhibit the hydrolysis of HIF-1a, enhance the stability of HIF-1, and increase the level of HIF-1 in brain tissue after cerebral ischemia and hypoxia injury. In addition, it could directly induce the expression of HIF-1a.14,26 However, whether DFX has this kind of function after TBI is still unknown. Many studies confirmed that the expression of HIF-1a increased after TBI. In the present study, the expression levels of HIF-1a mRNA and protein in rats in the TBI þ vehicle group significantly increased after TBI, and treatment with DFX could further upregulate the expression of HIF-1a. This finding suggested that DFX treatment might play a neuroprotective role after TBI through actions on the HIF-1a pathway. VEGF increases angiogenesis around the lesion by increasing the number of blood vessels.17 The results of the present study showed that the expression level of VEGF increased after TBI. Compared with the TBI þ vehicle group, the mRNA and protein expression levels of VEGF in the TBI þ DFX group were higher at each time point after injury (P < 0.05). This finding indicated that DFX could induce the expression of VEGF after TBI. This action might be related to the upregulation of HIF-1a because VEGF is one of its downstream target genes.27 Brain angiogenesis increases the blood and oxygen supply to brain tissue, providing the critical neurovascular niches for neuronal remodeling and functional recovery after TBI.28,29 The data showed that the microvessel density in the brain 3 d after TBI was greater in the TBI þ DFX group than in the TBI þ vehicle group (P < 0.05). This finding showed that DFX could stimulate angiogenesis and thus increase the blood and oxygen supply to local brain tissue. In other words, DFX promoted brain angiogenesis in the pericontusional area after TBI. These findings suggested that DFX rendered protection against continued evolution of brain injury by inducing the expression of VEGF and then promoting brain angiogenesis. The increased expression of VEGF reduced apoptosis and played a neuroprotective role in intracranial hemorrhage.16,30 In addition, VEGF expression was upregulated, and the increased expression of VEGF played a neuroprotective role after TBI.27,31 The present study found that DFX could suppress the level of apoptosis. This neuroprotective role might be related to the upregulation of VEGF and angiogenesis. The contribution of other HIF-1a downstream target genes, such as EPO and neuroglobin, that have been proven to be endogenous brain protection factors cannot be excluded.13,32 In addition, it cannot be claimed unequivocally that the upregulation of HIF-1a and EPO is related to iron chelation and radical scavenging by DFX. Further studies should focus on
wang et al mechanism of dfx-ameliorated tbi
this area to clarify the exact mechanism associated with the neuroprotective effect of DFX. DFX therapy protects against brain injury in rats after TBI. The protective effect of DFX may be, in part, through the upregulation of the expression of HIF-1a and its downstream target gene VEGF.
Acknowledgment Authors’ contributions: Kai Wang, Yao Jing, and Shiwen Chen designed the study; Chen Xu, Jianwei Zhao, and Qiuyuan Gong participated in the experimental design; Kai Wang, Yao Jing, and Chen Xu conducted the experiments. Jianwei Zhao and Qiuyuan Gong participated in the animal experiments. Shiwen Chen provided all the funds. Kai Wang and Yao Jing conducted data analysis and drafted the paper. All authors read and approved the final manuscript. This work was supported by the project of Shanghai Science and Technology Commission (19ZR1438600).
Disclosure The authors reported no proprietary or commercial interest in any product mentioned or concept discussed in this article.
references
1. Hanson LR, Roeytenberg A, Martinez PM, et al. Intranasal deferoxamine provides increased brain exposure and significant protection in rat ischemic stroke. J Pharmacol Exp Ther. 2009;330:679e686. 2. Lee JY, Keep RF, He Y, Sagher O, Hua Y, Xi G. Hemoglobin and iron handling in brain after subarachnoid hemorrhage and the effect of deferoxamine on early brain injury. J Cereb Blood Flow Metab. 2010;30:1793e1803. 3. Hatakeyama T, Okauchi M, Hua Y, Keep RF, Xi G. Deferoxamine reduces cavity size in the brain after intracerebral hemorrhage in aged rats. Acta Neurochir Suppl. 2011;111:185e190. 4. Lee JY, Keep RF, Hua Y, Ernestus RI, Xi G. Deferoxamine reduces early brain injury following subarachnoid hemorrhage. Acta Neurochir Suppl. 2011;112:101e106. 5. Liu J, Tang T, Yang H. Protective effect of deferoxamine on experimental spinal cord injury in rat. Injury. 2011;42:742e745. 6. Kletkiewicz H, Nowakowska A, Siejka A, et al. Deferoxamine improves antioxidative protection in the brain of neonatal rats: the role of anoxia and body temperature. Neurosci Lett. 2016;628:116e122. 7. Won SM, Lee JH, Park UJ, Gwag J, Gwag BJ, Lee YB. Iron mediates endothelial cell damage and blood-brain barrier opening in the hippocampus after transient forebrain ischemia in rats. Exp Mol Med. 2011;43:121e128. 8. Long DA, Ghosh K, Moore AN, Dixon CE, Dash PK. Deferoxamine improves spatial memory performance following experimental brain injury in rats. Brain Res. 1996;717:109e117. 9. Zhang L, Hu R, Li M, et al. Deferoxamine attenuates ironinduced long-term neurotoxicity in rats with traumatic brain injury. Neurol Sci. 2013;34:639e645.
7
10. Zhao J, Chen Z, Xi G, Keep RF, Hua Y. Deferoxamine attenuates acute hydrocephalus after traumatic brain injury in rats. Transl Stroke Res. 2014;5:586e594. 11. Chandel NS, Budinger GR. The cellular basis for diverse responses to oxygen. Free Radic Biol Med. 2007;42:165e174. 12. Sharp FR, Bernaudin M. HIF1 and oxygen sensing in the brain. Nat Rev Neurosci. 2004;5:437e448. 13. Mu D, Chang YS, Vexler ZS, Ferriero DM. Hypoxia-inducible factor 1alpha and erythropoietin upregulation with deferoxamine salvage after neonatal stroke. Exp Neurol. 2005;195:407e415. 14. Hamrick SE, McQuillen PS, Jiang X, Mu D, Madan A, Ferriero DM. A role for hypoxia-inducible factor-1alpha in desferoxamine neuroprotection. Neurosci Lett. 2005;379:96e100. 15. Dore-Duffy P, Wang X, Mehedi A, Kreipke CW, Rafols JA. Differential expression of capillary VEGF isoforms following traumatic brain injury. Neurol Res. 2007;29:395e403. 16. Wu X, Liu S, Hu Z, Zhu G, Zheng G, Wang G. Enriched housing promotes post-stroke neurogenesis through calpain 1-STAT3/HIF-1a/VEGF signaling. Brain Res Bull. 2018;139:133e143. 17. Thau-Zuchman O, Shohami E, Alexandrovich AG, Leker RR. Vascular endothelial growth factor increases neurogenesis after traumatic brain injury. J Cereb Blood Flow Metab. 2010;30:1008e1016. 18. Wang C, Cai Y, Zhang Y, Xiong Z, Li G, Cui L. Local injection of deferoxamine improves neovascularization in ischemic diabetic random flap by increasing HIF-1a and VEGF expression. PLoS One. 2014;9:e100818. 19. Xiong Y, Zhang Y, Mahmood A, Meng Y, Qu C, Chopp M. Erythropoietin mediates neurobehavioral recovery and neurovascular remodeling following traumatic brain injury in rats by increasing expression of vascular endothelial growth factor. Transl Stroke Res. 2011;2:619e632. 20. Yuan F, Xu ZM, Lu LY, et al. SIRT2 inhibition exacerbates neuroinflammation and blood-brain barrier disruption in experimental traumatic brain injury by enhancing NF-kB p65 acetylation and activation. J Neurochem. 2016;136:581e593. 21. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402e408. 22. Chen J, Sanberg PR, Li Y, et al. Intravenous administration of human umbilical cord blood reduces behavioral deficits after stroke in rats. Stroke. 2001;32:2682e2688. 23. Weidner N, Semple JP, Welch WR, Folkman J. Tumor angiogenesis and metastasis–correlation in invasive breast carcinoma. N Engl J Med. 1991;324:1e8. 24. Zhang R, Huang Q, Zou L, Cao X, Huang H, Chu X. Beneficial effects of deferoxamine against astrocyte death induced by modified oxygen glucose deprivation. Brain Res. 2014;1583:23e33. 25. Mericli AF, Das A, Rodeheaver P, Rodeheaver GT, Lin KY. The impact of deferoxamine on vascularity and soft-tissue biomechanics in a rat TRAM flap model. Plast Reconstr Surg. 2015;136:125ee127e. 26. Xie P, Yang L, Talaiti A, et al. Deferoxamine-activated hypoxia-inducible factor-1 restores cardioprotective effects of sevoflurane postconditioning in diabetic rats. Acta Physiol (Oxf). 2017;221:98e114. 27. Tado M, Mori T, Fukushima M, et al. Increased expression of vascular endothelial growth factor attenuates contusion necrosis without influencing contusion edema after traumatic brain injury in rats. J Neurotrauma. 2014;31:691e698. 28. Chopp M, Li Y, Zhang J. Plasticity and remodeling of brain. J Neurol Sci. 2008;265:97e101.
8
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 9 ( - ) 1 e8
29. Xiong Y, Mahmood A, Chopp M. Angiogenesis, neurogenesis and brain recovery of function following injury. Curr Opin Investig Drugs. 2010;11:298e308. 30. Shi FP, Wang XH, Zhang HX, et al. MiR-103 regulates the angiogenesis of ischemic stroke rats by targeting vascular endothelial growth factor (VEGF). Iran J Basic Med Sci. 2018;21:318e324.
31. Thau-Zuchman O, Shohami E, Alexandrovich AG, Leker RR. Subacute treatment with vascular endothelial growth factor after traumatic brain injury increases angiogenesis and gliogenesis. Neuroscience. 2012;202:334e341. 32. Jin K, Mao XO, Xie L, John V, Greenberg DA. Pharmacological induction of neuroglobin expression. Pharmacology. 2011;87:81e84.
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.JournalofSurgicalResearch.com
HIF-1a and VEGF Are Involved in DeferoxamineAmeliorated Traumatic Brain Injury Kai Wang, MD,a,b,1 Yao Jing, MD,a,1 Chen Xu, MD,a Jianwei Zhao, MD,a Qiuyuan Gong, MD,a and Shiwen Chen, MD, PhDa,* a
Department of Neurosurgery, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, China Department of Neurosurgery, The Affiliated Huai’an Hospital of Xuzhou Medical University and The Second People’s Hospital of Huai’an, Huai’an, China
b
article info
abstract
Article history:
Background: Deferoxamine (DFX) has been reported to have neuroprotective effect. This
Received 5 May 2019
study aimed to investigate the neuroprotective effect of DFX and its effect on hypoxia-
Received in revised form
inducible factor 1 alpha (HIF-1a) and vascular endothelial growth factor (VEGF) in rats
1 August 2019
after traumatic brain injury (TBI).
Accepted 13 September 2019
Materials and methods: Rats were randomly divided into sham operation, TBI þ DFX, and
Available online xxx
TBI þ vehicle groups. The rats in the TBI þ DFX group were intraperitoneally injected with DFX 2 and 6 h after injury, thereafter once every 12 h. The rats in the TBI þ vehicle group
Keywords:
were intraperitoneally injected with saline at the same time points. At 6, 12, 24, and 48 h
Controlled cortical impact
after TBI, 6 rats in each group were euthanized, and the brains were harvested. The
Deferoxamine
expression of HIF-1a and VEGF in the pericontusional area was detected using real-time
Hypoxia-inducible factor 1a
polymerase chain reaction and Western blot analysis. TBI-induced apoptosis was inves-
Traumatic brain injury
tigated using the TdT-mediated dUTP nick-end labeling (TUNEL) method. Three days after
Vascular endothelial growth factor
TBI, the density of microvessels was examined via immunohistochemical staining. Results: DFX treatment upregulated the expression of HIF-1a and VEGF after TBI. DFX treatment reduced apoptosis and improved the neurobehavioral score after TBI. The density of microvessels was higher in the TBI þ DFX group than that in the TBI þ vehicle group 3 d after TBI. Conclusions: DFX can stimulate angiogenesis, inhibit apoptosis, and play a protective role after TBI. The protective effect of DFX may, at least in part, be through upregulating the expression of HIF-1a and its downstream target gene VEGF. ª 2019 Elsevier Inc. All rights reserved.
Introduction Traumatic brain injury (TBI) is a serious problem worldwide owing to its high mortality and/or induction of disability. Although research on TBI has made great progress and clinical
treatment is being constantly improved, the prognosis of patients with TBI is still not optimistic. Deferoxamine (DFX), an iron chelator, has a protective effect on cerebral hemorrhage, cerebral hypoxiaeischemia, and spinal cord injury.1-6 It can penetrate the blood-brain barrier,
The authors declare no conflict of interest. * Corresponding author. Department of Neurosurgery, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200233, China. Tel.: þ8602124058405; fax: þ8602164701361. E-mail address: [email protected] (S. Chen). 1 These authors contributed equally to this work. 0022-4804/$ e see front matter ª 2019 Elsevier Inc. All rights reserved. https://doi.org/10.1016/j.jss.2019.09.023
2
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 9 ( - ) 1 e8
where it binds to ferric irons released from hemoglobin and thereby prevents the formation of hydroxyl radicals through inhibiting Fenton reaction and attenuates brain injury caused by iron overload.7 However, there have been few reports of its neuroprotective actions in TBI. DFX can attenuate brain atrophy and hydrocephalus and contributes to the recovery of spatial learning and memory in rats after TBI.8-10 However, the neuroprotective role of DFX remains largely unknown. Hypoxia-inducible factor 1 (HIF1), a transcription factor, is an important regulatory factor of the hypoxia responsesignaling pathway. HIF1 is made up of two subunits: an inducible subunit (HIF-1a) and a constitutive subunit (HIF-1b). HIF-1a is both a regulatory subunit and a reactive subunit, and its transcriptional activity and protein stability are mainly regulated by the oxygen concentration in cells.11 During cerebral ischemia and hypoxia, the expression of HIF-1a is upregulated, thereby increasing the tolerance of brain tissue to hypoxia.12,13 Previous studies have demonstrated that DFX can inhibit the hydrolysis of HIF-1a, induce the expression of HIF-1a, and increase the expression levels of HIF-1, thus playing a neuroprotective role in cerebral ischemia and hypoxia injury.13,14 However, whether DFX has the ability to upregulate the expression of HIF-1a in animals with TBI is not clear. Vascular endothelial growth factor (VEGF) signaling represents a critical rate-limiting step in physiological angiogenesis. It was reported as a target gene of HIF-1a, and its expression is regulated by HIF-1a.12,13 VEGF is a trophic factor expressed in the central nervous system after injury and induces angiogenesis.15,16 A previous study showed that VEGF had a strong capacity to augment neurogenesis and angiogenesis and had a neuroprotective effect after TBI.17 DFX can stimulate the expression of VEGF,18 but reports on its involvement in TBI are lacking. In the present study, several preclinical target validation paradigms were used, and the in vivo efficacy of DFX in a controlled cortical impact (CCI) model of TBI in rats was examined.
group) was evaluated 1, 3, 7, and 14 d after TBI. The expression levels of HIF-1a and VEGF in the pericontusional area were measured using real-time polymerase chain reaction and Western blot analysis. The apoptosis was detected using the TdT-mediated dUTP nick-end labeling (TUNEL) method. Three days after TBI, the brains of the remaining six rats in each group were harvested, and the microvessel density was examined using immunohistochemical staining. This study was approved by the Institutional Animal Care and Use Committee of Shanghai Jiao Tong University Affiliated to Sixth People’s Hospital and conducted in accordance with the guidelines of the International Council on Animal Care.
Surgical procedures and CCI injury model The rat CCI injury model was established as Yuan’s description.20 The rats were anesthetized with ketamine (75 mg/kg) and xylazine (10 mg/kg). A midline incision was made over the head after the surgical site was disinfected with ethanol scrubs. A craniotomy was performed using a 5-mm dental drill over the central aspect of the right parietal bone, 1 mm lateral to the sagittal suture. The process was performed carefully to keep the dura intact and avoid blood vessels traveling through the superior sagittal sinus. CCI was created oriented perpendicular to the cortical surface using a 4-mmdiameter, rounded steel impactor of an electronically controlled CCI device (PinPoint Precision Cortical Impactor PCI3000; Hatteras Instruments Inc, Cary, NC). TBI of moderate severity was induced by the CCI instrument at an impact velocity of 1.5 m/s, deformation depth of 1.5 mm, and dwell time of 85 ms. After injury, the bleeding of the injured cortical surface was controlled with sterile cotton and then closed the incision using 6-0 silk sutures. The rats in the sham group underwent the same procedure as the injured animals except they did not undergo CCI. The entire procedure was performed by the same person to minimize the variance.
Real-time polymerase chain reaction
Materials and methods Animals Adult male Sprague-Dawley rats (250-300 g; Shanghai SipprBK Laboratory Animal Co Ltd, Shanghai, China) were randomly divided into three groups: sham operation group (n ¼ 30), TBI þ DFX group (n ¼ 42), and TBI þ vehicle group (n ¼ 42). CCI was performed in the right parietal lobe.19 The rats in the TBI þ DFX and TBI þ vehicle groups were struck with a CCI instrument, and the rats in the sham operation group underwent the same anesthesia and surgical procedure but were not injured. The rats in the TBI þ DFX group were intraperitoneally injected with DFX (100 mg/kg) 2 and 6 h after injury, and thereafter once every 12 h. The rats in the TBI þ vehicle group were injected with an equal volume of saline at the same time points. Six, 12, 24, and 48 h after TBI, 6 rats in each group were euthanized, and their brains were harvested and subjected to further analysis. The neurological status of rats in the TBI þ DFX and TBI þ vehicle groups (n ¼ 12/
Total RNAs were extracted using a TRIzol reagent kit (Invitrogen, Carlsbad, CA). Quantitative PCR reactions were performed using an SYBR Green PCR Kit (Roche, Mannheim, Germany) on a ViiA7 Real-Time PCR System (ABI, Carlsbad, CA). The expression levels of genes were calculated using bactin by the 2DDCT method.21 The primers were synthesized by BIOTNT (Shanghai, China) and are listed in Table 1.
Table 1 e Primer sequences used in this study. Gene
Sequences of primers used
HIF-1a, forward
AACTGCCACCACTGATGAAT
HIF-1a, reverse
CCACTGTATGCTGATGCCTT
VEGF, forward
TGGTCTTTCGTCCTTCTTAG
VEGF, reverse
GATGGGTTTGTCGTGTTTC
b-actin, forward
CCCATCTATGAGGGTTACGC
b-actin, reverse
TTTAATGTCACGCACGATTTC
wang et al mechanism of dfx-ameliorated tbi
3
Fig. 1 e Expression of HIF-1a and VEGF mRNA in the pericontusional area detected using RT-PCR. (A) Expression of HIF-1a mRNA in the pericontusional area. (B) Expression of VEGF mRNA. Data are presented as mean ± SEM (n [ 6/time point). *P < 0.05, **P < 0.01.
Western blot analysis Total proteins were extracted using a radioimmunoprecipitation assay lysis buffer (Sigma, St. Louis, MO). Samples were separated in 10% sodium dodecyl sulfateepolyacrylamide gel electrophoresis gels and transferred onto a polyvinylidene difluoride membrane. They were then incubated with primary antibodies of HIF-1a (CST, Boston, MA; 1:1000), VEGF (Abcam, Cambridge, UK; 1:1000), and b-actin (Abcam, Cambridge, UK; 1:400) at 4 C overnight. The next day, the membranes were incubated with secondary antibody (Abcam, Cambridge, UK; 1:2000) at 24 C for 1 h. The grayscale of the bands was determined using the QuantityOne image analysis system (Bio-Rad, Hercules, CA).
Neurological severity score assessment The neurological status of each animal was evaluated 1, 3, 7, and 14 d after TBI using the modified neurological severity score test as described in a previous study, which included
motor, sensory, balance, and reflex tests (normal score, 0; maximal deficit score, 18).22 One score point was awarded for the inability to perform a particular task or for the absence of a tested reflex. Consequently, the higher the score, the more severe was the neurological injury.
TUNEL The presence of apoptotic cells was determined by detecting apoptosis in the pericontusional regions using a TUNEL Kit (Roche Ltd, Switzerland). TUNEL staining was performed according to the manufacturer’s protocol. The stained cells were scanned with a fluorescence microscope (FV1200, Olympus, Tokyo, Japan).
Immunohistochemical analysis and calculation of microvessel density The brain tissue immersed in 4% paraformaldehyde was embedded in paraffin and then sectioned at 4 mm thickness
Fig. 2 e Expression of HIF-1a and VEGF protein in the pericontusional area detected using Western blot analysis. (A) Western blot analyses showed protein levels of HIF-1a and VEGF in brain tissue 6, 12, 24, and 48 h after TBI. (B) Expression of HIF-1a protein in the pericontusional area of mice from different experimental groups. (C) Expression of VEGF protein in the pericontusional area. Data are presented as mean ± SEM (n [ 6/time point). *P < 0.05, **P < 0.01.
4
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 9 ( - ) 1 e8
Fig. 3 e Microvessel density was detected by CD34 immunohistochemical staining. DFX treatment stimulated angiogenesis in rats after TBI. Scale bar [ 200 mm. (Color version of figure is available online.)
using a microtome. The sections were dewaxed using xylene and an alcohol gradient, placed in 3% peroxide, and incubated for 30 min to block the activity of endogenous catalase. The sections were then washed three times with 0.01 mol/L phosphate-buffered saline (PBS) for 5 min each time. The antigens were heat-revived, and the sections were incubated in a normal goat serum working solution at 37 C for 30 min. Then, the normal goat serum was discarded, and the rabbit anti-CD34 monoclonal antibody (Abcam, Cambridge, UK; 1:2500) was added to the sections, which were incubated overnight at 4 C. The sections were washed three times with 0.01 mol/L PBS for 5 min each time, incubated with horseradish peroxidaseelabeled active rabbit-anti-goat immunoglobulin G working solution at 37 C for 30 min, and washed three times with 0.01 mol/L PBS for 5 min each time. The sections were then stained for 3-5 min in a 3, 30 -diaminobenzidine staining solution, re-stained in hematoxylin, differentiated using hydrochloric alcohol, and gradient dehydrated. After the sections were sealed with neutral balsam, digital images were captured and analyzed. Microvessel density was calculated by the method reported by Weidner et al.23 Vascular endothelial cells were brown stained for CD34. A single endothelial cell or endothelial cell clusters dyed brown were deemed a countable microvessel; those with lumen greater than eight erythrocyte diameters or a thick base layer were excluded from the analysis. Five regions with the highest neovascularization in the low magnification (40) mode were identified, and then microvessels were counted in these five fields at high magnification (200). The mean number of microvessel counts represented the measure of microvessel density. Every count was performed by two investigators using a double-headed light microscope simultaneously.
Results DFX augmented the expression of HIF-1a and VEGF after TBI The expression of HIF-1a mRNA in the pericontusional area of the TBI þ DFX and TBI þ vehicle groups increased significantly in the acute phase after TBI (P < 0.01), and both reached peaks 12 h after the insult (3.2-fold and 4.3-fold of the sham group, respectively), then receded slowly, and maintained a fairly high level until 48 h after injury (2.2-fold and 3.4-fold of the sham group, respectively) (Fig. 1). The expression levels of HIF-1a mRNA in rats in the TBI þ DFX group were significantly higher than those in the TBI þ vehicle group 6, 12, 24, and 48 h after injury (P < 0.01) (Fig. 1A). The expression levels of HIF-1a protein in rats in the TBI þ vehicle group significantly increased in the acute phase after TBI (P < 0.01), then gradually decreased 6 h after injury, but were still significantly higher than those in the sham group until 48 h after injury (P < 0.01) (Fig. 2A and B). The expression levels of HIF-1a protein in the TBI þ DFX group also increased significantly in the acute phase after TBI, reached a peak 12 h after injury, and were subsequently maintained at a fairly high level until 48 h after injury. The expression levels of HIF-1a protein were higher in the TBI þ DFX group than in the TBI þ vehicle group 12, 24, and 48 h after injury (P < 0.05) (Fig. 2A and B). The mRNA and protein expression levels of VEGF in the TBI þ DFX and TBI þ vehicle groups gradually increased in the acute phase after TBI, leveled off 24 and 48 h after injury, but were maintained at a fairly high level. The mRNA and protein
Statistical analysis All data in this study were expressed as means standard error of the mean. Multiple-group comparisons were performed with one-way analysis of variance followed by least significant difference post hoc test. The Student t test was used to compare means between two groups. P values less than 0.05 was considered to be statistically significant. The statistical package used for analyses was SPSS 20.0 (SPSS Inc, Chicago, IL). GraphPad Prism 6 (GraphPad Software, San Diego, CA) was used for the graphical representation of data.
Table 2 e Microvessel density 3 d after TBI. Group Microvessel density *
Sham (n ¼ 6)
TBI þ vehicle (n ¼ 6)
TBI þ DFX (n ¼ 6)
5.11 0.78
6.86 1.09*
8.96 1.01y,z
P < 0.05. P < 0.01 versus the sham group. z P < 0.05 versus the TBI þ vehicle group. y
wang et al mechanism of dfx-ameliorated tbi
5
Fig. 4 e Apoptotic cells in the pericontusional area detected by the TUNEL method (A) 6, (B) 12, (C) 24, and (D) 48 h after injury. (E) The apoptotic rate in the brains of rats was less in the TBI D DFX group than in the TBI D vehicle group at each time point after injury. Data are presented as mean ± SEM (n [ 6/time point). *P < 0.05, **P < 0.01. Scale bar [ 50 mm. (Color version of figure is available online.)
expression levels of VEGF were higher in the TBI þ DFX group than in the TBI þ vehicle group 6, 12, 24, and 48 h after injury (P < 0.05) (Fig. 1B-C). The results showed that DFX treatment could increase the expression of HIF-1a and VEGF in rats after TBI.
TBI þ DFX and TBI þ vehicle groups than in the sham group 3 d after injury (P < 0.05), and also higher in the TBI þ DFX group than in the TBI þ vehicle group (P < 0.05) (Table 2). The results indicated that DFX could stimulate angiogenesis in rats after TBI.
DFX treatment stimulated angiogenesis after TBI To investigate the role of DFX in angiogenesis after TBI, the microvessel density of the pericontusional area was examined immunohistochemically (Fig. 3). The results showed that the microvessel density of brain in rats was higher in the
DFX treatment reduced apoptosis and improved neurological function after TBI The apoptosis rate in the brains of rats was less in the TBI þ DFX group than in the TBI þ vehicle group at each time
6
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 9 ( - ) 1 e8
Fig. 5 e The modified neurological severity score (mNSS) test. Rats in the TBI D DFX group had significantly lower scores at 3 d (P < 0.05), 7 d (P < 0.05), and 14 d (P < 0.01) after CCI injury compared with rats in the TBI D vehicle group. Data are presented as mean ± SEM (n [ 12/group). *P < 0.05, **P < 0.01. point after injury, as detected by TUNEL (P < 0.05). Furthermore, 12, 24, and 48 h after injury, the apoptosis rate was found to be significantly less in the cortex of the TBI þ DFX group than in the TBI þ vehicle group (P < 0.01) (Fig. 4). The results showed that DFX treatment could decrease the level of apoptosis in the brain and ameliorate brain damage in rats after TBI. None of the animals used in the study died during the experiment. TBI resulted in neurological deficits. To explore the effects of DFX on neurological functional recovery, the modified neurological severity score test was used to examine the motor, balance, and reflex functions of rats after CCI injury. The rats in the TBI þ DFX group had significantly lower scores 3 (P < 0.05), 7 (P < 0.05), and 14 d (P < 0.01) after CCI injury, compared with the DFX þ vehicle group (Fig. 5). The results showed that DFX treatment could improve neurological function after TBI.
Discussion The present study revealed that DFX treatment increased the density of microvessels. This finding showed that DFX could stimulate angiogenesis and thus increase the blood and oxygen supply to the local brain tissue. It was also found that DFX could suppress the level of apoptosis and improve neurobehavioral outcomes after TBI. We speculate that DFX has a protective effect mainly on neurons as the rescue of neurons is closely related to the improvement of neural dysfunction. It was also reported that DFX suppresses both apoptosis and oncosis in an astrocytes in vitro model of the ischemic core.24 These findings further confirmed a protective role of DFX after TBI. A few studies have shown that DFX can attenuate brain atrophy and hydrocephalus and contributes to the recovery of spatial learning and memory in rats after TBI.8-10 Previous researchers speculated that this function of DFX may be related to reducing brain injury accentuated by iron overload as the presence of hemoglobin in the area of injury is a common phenomena.8-10 After injection, DFX can penetrate the
blood-brain barrier and then combine with trivalent ferric ions to avoid further chemical reactions of these ions that are known to aggravate brain injury.2 DFX can also increase the levels of malondialdehyde and play a role in inhibiting lipid peroxidation.2,5 In addition, this protection is associated with stabilizing the transcription factor HIF-1a.12-14,25 During cerebral ischemia and hypoxia, the expression of HIF-1a is upregulated, thereby increasing the tolerance of brain tissue to hypoxia by activating the transcriptional expression of downstream genes such as erythropoietin (EPO) and VEGF, which have been implicated as a neuroprotectant.12,13,16,18 Therefore, upregulating the expression of HIF-1a after TBI may play a neuroprotective role and improve the prognosis of patients. DFX could inhibit the hydrolysis of HIF-1a, enhance the stability of HIF-1, and increase the level of HIF-1 in brain tissue after cerebral ischemia and hypoxia injury. In addition, it could directly induce the expression of HIF-1a.14,26 However, whether DFX has this kind of function after TBI is still unknown. Many studies confirmed that the expression of HIF-1a increased after TBI. In the present study, the expression levels of HIF-1a mRNA and protein in rats in the TBI þ vehicle group significantly increased after TBI, and treatment with DFX could further upregulate the expression of HIF-1a. This finding suggested that DFX treatment might play a neuroprotective role after TBI through actions on the HIF-1a pathway. VEGF increases angiogenesis around the lesion by increasing the number of blood vessels.17 The results of the present study showed that the expression level of VEGF increased after TBI. Compared with the TBI þ vehicle group, the mRNA and protein expression levels of VEGF in the TBI þ DFX group were higher at each time point after injury (P < 0.05). This finding indicated that DFX could induce the expression of VEGF after TBI. This action might be related to the upregulation of HIF-1a because VEGF is one of its downstream target genes.27 Brain angiogenesis increases the blood and oxygen supply to brain tissue, providing the critical neurovascular niches for neuronal remodeling and functional recovery after TBI.28,29 The data showed that the microvessel density in the brain 3 d after TBI was greater in the TBI þ DFX group than in the TBI þ vehicle group (P < 0.05). This finding showed that DFX could stimulate angiogenesis and thus increase the blood and oxygen supply to local brain tissue. In other words, DFX promoted brain angiogenesis in the pericontusional area after TBI. These findings suggested that DFX rendered protection against continued evolution of brain injury by inducing the expression of VEGF and then promoting brain angiogenesis. The increased expression of VEGF reduced apoptosis and played a neuroprotective role in intracranial hemorrhage.16,30 In addition, VEGF expression was upregulated, and the increased expression of VEGF played a neuroprotective role after TBI.27,31 The present study found that DFX could suppress the level of apoptosis. This neuroprotective role might be related to the upregulation of VEGF and angiogenesis. The contribution of other HIF-1a downstream target genes, such as EPO and neuroglobin, that have been proven to be endogenous brain protection factors cannot be excluded.13,32 In addition, it cannot be claimed unequivocally that the upregulation of HIF-1a and EPO is related to iron chelation and radical scavenging by DFX. Further studies should focus on
wang et al mechanism of dfx-ameliorated tbi
this area to clarify the exact mechanism associated with the neuroprotective effect of DFX. DFX therapy protects against brain injury in rats after TBI. The protective effect of DFX may be, in part, through the upregulation of the expression of HIF-1a and its downstream target gene VEGF.
Acknowledgment Authors’ contributions: Kai Wang, Yao Jing, and Shiwen Chen designed the study; Chen Xu, Jianwei Zhao, and Qiuyuan Gong participated in the experimental design; Kai Wang, Yao Jing, and Chen Xu conducted the experiments. Jianwei Zhao and Qiuyuan Gong participated in the animal experiments. Shiwen Chen provided all the funds. Kai Wang and Yao Jing conducted data analysis and drafted the paper. All authors read and approved the final manuscript. This work was supported by the project of Shanghai Science and Technology Commission (19ZR1438600).
Disclosure The authors reported no proprietary or commercial interest in any product mentioned or concept discussed in this article.
references
1. Hanson LR, Roeytenberg A, Martinez PM, et al. Intranasal deferoxamine provides increased brain exposure and significant protection in rat ischemic stroke. J Pharmacol Exp Ther. 2009;330:679e686. 2. Lee JY, Keep RF, He Y, Sagher O, Hua Y, Xi G. Hemoglobin and iron handling in brain after subarachnoid hemorrhage and the effect of deferoxamine on early brain injury. J Cereb Blood Flow Metab. 2010;30:1793e1803. 3. Hatakeyama T, Okauchi M, Hua Y, Keep RF, Xi G. Deferoxamine reduces cavity size in the brain after intracerebral hemorrhage in aged rats. Acta Neurochir Suppl. 2011;111:185e190. 4. Lee JY, Keep RF, Hua Y, Ernestus RI, Xi G. Deferoxamine reduces early brain injury following subarachnoid hemorrhage. Acta Neurochir Suppl. 2011;112:101e106. 5. Liu J, Tang T, Yang H. Protective effect of deferoxamine on experimental spinal cord injury in rat. Injury. 2011;42:742e745. 6. Kletkiewicz H, Nowakowska A, Siejka A, et al. Deferoxamine improves antioxidative protection in the brain of neonatal rats: the role of anoxia and body temperature. Neurosci Lett. 2016;628:116e122. 7. Won SM, Lee JH, Park UJ, Gwag J, Gwag BJ, Lee YB. Iron mediates endothelial cell damage and blood-brain barrier opening in the hippocampus after transient forebrain ischemia in rats. Exp Mol Med. 2011;43:121e128. 8. Long DA, Ghosh K, Moore AN, Dixon CE, Dash PK. Deferoxamine improves spatial memory performance following experimental brain injury in rats. Brain Res. 1996;717:109e117. 9. Zhang L, Hu R, Li M, et al. Deferoxamine attenuates ironinduced long-term neurotoxicity in rats with traumatic brain injury. Neurol Sci. 2013;34:639e645.
7
10. Zhao J, Chen Z, Xi G, Keep RF, Hua Y. Deferoxamine attenuates acute hydrocephalus after traumatic brain injury in rats. Transl Stroke Res. 2014;5:586e594. 11. Chandel NS, Budinger GR. The cellular basis for diverse responses to oxygen. Free Radic Biol Med. 2007;42:165e174. 12. Sharp FR, Bernaudin M. HIF1 and oxygen sensing in the brain. Nat Rev Neurosci. 2004;5:437e448. 13. Mu D, Chang YS, Vexler ZS, Ferriero DM. Hypoxia-inducible factor 1alpha and erythropoietin upregulation with deferoxamine salvage after neonatal stroke. Exp Neurol. 2005;195:407e415. 14. Hamrick SE, McQuillen PS, Jiang X, Mu D, Madan A, Ferriero DM. A role for hypoxia-inducible factor-1alpha in desferoxamine neuroprotection. Neurosci Lett. 2005;379:96e100. 15. Dore-Duffy P, Wang X, Mehedi A, Kreipke CW, Rafols JA. Differential expression of capillary VEGF isoforms following traumatic brain injury. Neurol Res. 2007;29:395e403. 16. Wu X, Liu S, Hu Z, Zhu G, Zheng G, Wang G. Enriched housing promotes post-stroke neurogenesis through calpain 1-STAT3/HIF-1a/VEGF signaling. Brain Res Bull. 2018;139:133e143. 17. Thau-Zuchman O, Shohami E, Alexandrovich AG, Leker RR. Vascular endothelial growth factor increases neurogenesis after traumatic brain injury. J Cereb Blood Flow Metab. 2010;30:1008e1016. 18. Wang C, Cai Y, Zhang Y, Xiong Z, Li G, Cui L. Local injection of deferoxamine improves neovascularization in ischemic diabetic random flap by increasing HIF-1a and VEGF expression. PLoS One. 2014;9:e100818. 19. Xiong Y, Zhang Y, Mahmood A, Meng Y, Qu C, Chopp M. Erythropoietin mediates neurobehavioral recovery and neurovascular remodeling following traumatic brain injury in rats by increasing expression of vascular endothelial growth factor. Transl Stroke Res. 2011;2:619e632. 20. Yuan F, Xu ZM, Lu LY, et al. SIRT2 inhibition exacerbates neuroinflammation and blood-brain barrier disruption in experimental traumatic brain injury by enhancing NF-kB p65 acetylation and activation. J Neurochem. 2016;136:581e593. 21. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402e408. 22. Chen J, Sanberg PR, Li Y, et al. Intravenous administration of human umbilical cord blood reduces behavioral deficits after stroke in rats. Stroke. 2001;32:2682e2688. 23. Weidner N, Semple JP, Welch WR, Folkman J. Tumor angiogenesis and metastasis–correlation in invasive breast carcinoma. N Engl J Med. 1991;324:1e8. 24. Zhang R, Huang Q, Zou L, Cao X, Huang H, Chu X. Beneficial effects of deferoxamine against astrocyte death induced by modified oxygen glucose deprivation. Brain Res. 2014;1583:23e33. 25. Mericli AF, Das A, Rodeheaver P, Rodeheaver GT, Lin KY. The impact of deferoxamine on vascularity and soft-tissue biomechanics in a rat TRAM flap model. Plast Reconstr Surg. 2015;136:125ee127e. 26. Xie P, Yang L, Talaiti A, et al. Deferoxamine-activated hypoxia-inducible factor-1 restores cardioprotective effects of sevoflurane postconditioning in diabetic rats. Acta Physiol (Oxf). 2017;221:98e114. 27. Tado M, Mori T, Fukushima M, et al. Increased expression of vascular endothelial growth factor attenuates contusion necrosis without influencing contusion edema after traumatic brain injury in rats. J Neurotrauma. 2014;31:691e698. 28. Chopp M, Li Y, Zhang J. Plasticity and remodeling of brain. J Neurol Sci. 2008;265:97e101.
8
j o u r n a l o f s u r g i c a l r e s e a r c h - 2 0 1 9 ( - ) 1 e8
29. Xiong Y, Mahmood A, Chopp M. Angiogenesis, neurogenesis and brain recovery of function following injury. Curr Opin Investig Drugs. 2010;11:298e308. 30. Shi FP, Wang XH, Zhang HX, et al. MiR-103 regulates the angiogenesis of ischemic stroke rats by targeting vascular endothelial growth factor (VEGF). Iran J Basic Med Sci. 2018;21:318e324.
31. Thau-Zuchman O, Shohami E, Alexandrovich AG, Leker RR. Subacute treatment with vascular endothelial growth factor after traumatic brain injury increases angiogenesis and gliogenesis. Neuroscience. 2012;202:334e341. 32. Jin K, Mao XO, Xie L, John V, Greenberg DA. Pharmacological induction of neuroglobin expression. Pharmacology. 2011;87:81e84.