High efficiency co-production of ferulic acid and xylooligosaccharides from wheat bran by recombinant xylanase and feruloyl esterase

Biochemical Engineering Journal 120 (2017) 41–48

Contents lists available at ScienceDirect

Biochemical Engineering Journal journal homepage: www.elsevier.com/locate/bej

Regular article

High efficiency co-production of ferulic acid and xylooligosaccharides from wheat bran by recombinant xylanase and feruloyl esterase Hongli Wu a , Hailong Li b , Yong Xue a , Gan Luo a , Lihui Gan a , Jian Liu a,∗ , Liuhao Mao a , Minnan Long a,∗ a

College of Energy, Xiamen University, Xiamen 361005, PR China Guangdong Key Laboratory of New and Renewable Energy Research and Development, CAS Key Laboratory of Renewable Energy, Guangzhou Institute of Energy Conversion, Chinese Academy of Sciences, Guangzhou 510640, PR China b

a r t i c l e

i n f o

Article history: Received 22 October 2016 Received in revised form 8 December 2016 Accepted 3 January 2017 Available online 5 January 2017 Keywords: Heterologous expression Xylanase Feruloyl esterase Aspergillus niger Ferulic acid Xylooligosaccharides

a b s t r a c t The enzymatic hydrolysis of lignocellulosic biomass has been studied for years, but this hydrolysis has been minimally used in the industry due to its high costs and low conversion yields. In the work reported here, ferulic acid (FA) and xylooligosaccharides (XOS) were generated from wheat bran at high yields based on the synergistic action of two xylan-degrading enzymes, xylanase (AnXyn11A) and feruloyl esterase (AnFaeA), which were cloned from Aspergillus niger BE-2 and heterologously expressed at high levels in Pichia pastoris. AnXyn11A exhibited a maximal activity of 240 U mL−1 at pH 5.0 and 60 ◦ C and less thermostability above 50 ◦ C. AnFaeA showed a maximal activity of 21 U mL−1 at pH 5.0 and 45 ◦ C and high thermostability below 55 ◦ C. The ratio of FA released from destarched wheat bran (DSWB) under the synergistic action of AnXyn11A and AnFaeA increased to 70% in comparison with that of the individual enzyme acting alone (only 16.8% of FA was released). Moreover, at the optimum level of enzyme addition, the XOS yield was double that under the single enzyme action. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Recently, intense interest has been focused on environmentally friendly methods to utilize lignocellulosic biomass to lower the dependency on fossil fuel feedstocks [1]. Agricultural waste materials such as wheat bran, rice straw, corncob and bagasse, which have been adopted for biofuels and high value-added compounds, are considered to be a potential substitute for fossil resources. The enzymatic hydrolysis of lignocellulosic biomass has been a hot research topic recently. The major obstacle to the efficient and economically feasible bioconversion of lignocellulose is its recalcitrance to enzymes due to its complexity of composition and structure [2]. To obtain any of these biomass constituents, the synergistic action of several types of enzymes is required [3]. Ferulic acid (FA) and xylooligosaccharides (XOS) liberated from lignocellulose are two promising functional foods [4,5]. FA is the most abundant hydroxycinnamic acid and is distributed widely throughout the plant kingdom. Most graminaceous plants such as wheat, bamboo, barley, maize, and tropical grasses contain up to 3% (w/w)

∗ Corresponding authors. E-mail addresses: [email protected] (J. Liu), [email protected] (M. Long). http://dx.doi.org/10.1016/j.bej.2017.01.001 1369-703X/© 2017 Elsevier B.V. All rights reserved.

FA, which is esterified to the C-5 position of ␣-l-arabinofuranosyl. As a renewable resource for biocatalysis and chemical conversion, FA can be used as an antioxidant, antimicrobial agent, photo-active compound in sunscreens and food preservative or enzymatically converted to vanillin as an essential flavor in the food and perfume industry [6–8,9]. XOS generated from lignocellulose has great potential as an agent to maintain a balanced intestinal flora for health [10,11]. Fig. 1 shows a simplified structure of wheat bran arabinoxylan, giving a visual guide to the pattern of most substituents. The main xylan backbone is composed of ˇ-1,4-d-xylpyranose residues. Arabinofuranosyl substituents are attached to D-xylose residues via an ␣-1,3 and/or ␣-1,2 linkage. The feruloyl residues are attached via ester bonds at the C-5 position of the arabinofuranosyl substituents. Endo-ˇ-1,4-xylanases (EC 3.2.1.8, EXs) are critical enzymes in the degradation of xylan that are able to cleave the xylan main chain and release various XOS species [3]. According to the amino acid sequence similarity and hydrophobic cluster analysis, we can identify characterized endo-ˇ-1,4-xylanases in families 5, 8, 10, 11, 43 and 62 [12] among all the glucoside hydrolase (GH) families. GH10 and 11 EXs are widely used, and the majority of researches has been focused on them. There are great differences between these two families. Compared with GH10 EXs, GH11 EXs are more

42

H. Wu et al. / Biochemical Engineering Journal 120 (2017) 41–48

Fig. 1. Sketch of arabinoxylan structure of wheat bran. fer, feruloyl residue. Xylans consist of a backbone of ␤-1,4-d-xylpyranose residues. Arabinofuranosyl substituents are attached in D-xylose residues via ␣-1,3 and/or ␣-1,2 linkages. Feruloyl residues are attached via ester bonds at the C-5 position of the arabinofuranosyl substituents.

liable to be influenced by side chains [13]. The molecular weight of GH11 xylanases are lower, providing great advantages for penetrating into insoluble substrates [14]. Ferulic acid or feruloyl esterases (EC 3.1.1.73, FAEs) are core enzymes for cleaving ester linkages between hydroxycinnamic acids and carbohydrates in the process of the biodegradation of plant cell walls [15,16]. The evidence accumulated in recent years suggests that FAEs produced by microorganisms differ in structure, biochemical properties and substrate specificity. Thus, four types of FAEs (A, B, C, and D) were identified based on those characteristics [17]. So far, multiple efforts have been devoted to the construction of engineering microorganisms. Various EXs and FAEs have been isolated and characterized from fungi and bacteria, but few were able to be applied on the industrial level due to their low levels of expression and weak catalytic activities. The heterologous expression of novel hemicellulases still remains a considerable concern. Herein, we studied the heterologous expression of Anxyn11A and AnFaeA genes in the methylotrophic yeast Pichia pastoris, and the biochemical properties were also investigated. To further explore the hydrolytic ability on complex substrates and obtain high-value-added products efficiently, a synergistic action between AnXyn11A and AnFaeA on destarched wheat bran (DSWB) for the co-production of FA and XOS was also investigated. 2. Materials and methods 2.1. Strains, vectors and culture media A. niger strain BE-2 (GenBank accession No. JQ867187) was maintained as the source of the Anxyn11A and AnfaeA genes. P. pastoris GS115 (Invitrogen, Carlsbad, CA, USA) was used for the heterologous expression of Anxyn11A and AnfaeA cDNA. Escherichia coli DH5␣, pPMD19-T (Invitrogen) pPIC9 (Invitrogen) and pPIC9 K (Invitrogen) vectors were used for the construction of the recombinant expression vector. E. coli DH5␣ was cultured at 37 ◦ C in Luria–Bertani medium (10 g L−1 tryptone, 5 g L−1 yeast extract, and 10 g L−1 NaCl, pH 7.2). P. pastoris was preserved in yeast extract peptone dextrose medium (YPD). The transformants were selected on minimal dextrose plates (MD) and cultured on buffered minimal glycerol medium (BMGY) (225 rpm, 28 ◦ C) until the culture reached a density of OD600 = 2.0–6.0. The cells were resuspended and cultured in 100 mL of buffered minimal methanol medium (BMMY), which was prepared according to the manual of the Multi-Copy Pichia expression kit (Invitrogen). 2.2. Cloning of Anxyn11A and AnfaeA genes Based on the BLAST algorithms, we designed specific primers for amplifying Anxyn11A (AnXyn11A-F, AnXyn11A-R) and AnfaeA (AnFaeA-F, AnFaeA-R) with the cDNA as a template (Table 1). The

Table 1 Gene-specific primers for AnXyn11A and AnFaeA from A. niger BE-2. Restriction endonuclease sites used for cloning are underlined. Gene

Primer sequence (Underlined restriction site) 5 -3

AnXyn11A-F AnXyn11A-R AnXyn11A-F’ AnXyn11A-R’ AnFaeA-F AnFaeA-R AnFaeA-F’ AnFaeA-R’

ATGGTCGCCTACTCGTCTCT TTAGCAGCTCTCCTCGGTG GAATCCTAGGCTCCCCAATGGCAAGGCCC ATAAGAATGCGGCCGCTTAGCAGCTCTCCTCGGTGCTGTC ATGAAGCAATTCTCTGCAAAATACG TTACCAAGTACAAGCTCCGCTCG CCGGAATTCGCGGCCTCCACGCAAGG GAATCCTAGGTTACCAAGTACAAGCTCCGCTCG

PCR product was ligated to the pPMD19-T Easy vector and transformed into E. coli DH5␣. Three positive clones were sequenced, and the correct genes were uploaded to NCBI by sequence alignment. After sequencing, the results were identified using Blast Server at the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/). The ProtParam program (http:// web.expasy.org/protparam) was used to analyze the bioinformatics of AnXyn11A and AnFaeA. The putative N-linked glycosylation sites were analyzed by the NetNGlyc program 1.0 (http://www.cbs. dtu.dk/services/NetNGlyc/). The phylogenetic tree was constructed using Mega 5.0 software. The tertiary structure of AnXyn11A was predicted by the online Swiss-Model server (https://www. swissmodel.expasy.org/) based on the crystal structure of a GH11 xylanase from Penicillium funiculosum (PDB code 1TE1) [18]. The three-dimensional (3-D) structure of AnFaeA was determined on the same online server based on the crystal structure of a type A feruloyl esterase from A. niger (PDB code 1UWC) [19]. The DNA fragment encoding the mature AnXyn11A protein was amplified with two primers (AnXyn11A-F and AnXyn11A-R ) (Table 1) that contain restriction endonuclease sites BlnI(AvrII) and NotIfor linking the target gene and plasmid. The gene Anxyn11A was inserted into the expression vector pPIC9 (Invitrogen) digested by BlnIand NotI to generate pPIC9-Anxyn11A. Likewise, the DNA fragment encoding the mature AnFaeA protein was amplified with two primers (AnFaeA-F , AnFaeA-R ) (Table 1) incorporated in EcoRIand BlnI(AvrII) restriction sites, respectively and inserted into the expression vector pPIC9K (Invitrogen) digested by EcoRIand BlnI to generate pPIC9K-AnfaeA. 2.3. Expression of AnXyn11A and AnFaeA in P. pastoris The plasmids pPIC9-Anxyn11A and pPIC9K-AnfaeA were separately linearized by SalIand StuI and then transformed into P. pastoris GS115 by electroporation with a Gene Pulser apparatus (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. The phenotypes of the transformants were identified by colony PCR using 5 AOX1 (5 -GACTGGTTCCAATTGACAAGC3 ) and 3 AOX1 (5 -GCAAATGGCATTCTGACATCC-3 ) primers. The

H. Wu et al. / Biochemical Engineering Journal 120 (2017) 41–48

43

selected transformants were cultured in BMMY medium. The fermentation broth was centrifuged (1500 × g, 10 min), and the supernatant was subjected to SDS-PAGE and enzymatic activity analysis.

the PMP pre-column derivatization method as described previously [23]. All the experiments were performed in triplicate. An alkali-extractable hydrolysis was conducted as reported previously to determine the total FA in the DSWB [24].

2.4. Enzyme assays

3. Results and discussion

AnXyn11A was assayed toward 10 g L−1 beechwood xylan (BWX) (Sigma-Aldrich, USA) dissolved in citrate buffer solution (50 mmol L−1 , pH 5.0). In brief, 0.2 mL of an appropriate dilution of enzyme solution was mixed with 1.8 mL of 10 g L−1 BWX and incubated at 50 ◦ C for 10 min at pH 5.0. The reducing sugars were determined using 3,5-dinitrosalicylic (DNS) reagent, where one unit of xylanase is defined as the amount of enzyme required to liberate 1 ␮mol of reducing sugar as xylose per minute under the assay conditions [20]. The AnFaeA activity was assayed toward methyl ferulate (MFA) (Sigma-Aldrich, USA) as described previously [21]. One unit of enzymatic activity was defined as the amount of enzyme releasing 1 ␮mol L−1 free ferulic acid (FA) per minute. Briefly, 0.9 mL of 1 mmol L−1 MFA dissolved in Na2 HPO4 /citric acid buffer (pH 5.0, 100 mmol L−1 ) was incubated in 45 ◦ C for 10 min and then mixed with 0.1 mL of dilute enzyme solution for 10 min at 45 ◦ C. The reaction was terminated by adding 0.4 mL of glacial acetic acid, and the integrated mixed solution was analyzed by a Waters HPLC system (US) equipped with a CAPCELL PAK C18 MG column (3.0 mm i.d. × 250 mm, 5 ␮m, Shiseido, Japan) and a diode array detector. A method of gradient elution was applied with 10 mL of L−1 acetic acid in methanol solution as the mobile phase, and detection was at 320 nm.

3.1. Cloning and sequencing of Anxyn11A and AnfaeA The cDNA fragment and genomic DNA encoding Anxyn11A and AnfaeA from A. niger was obtained using specific primers. The genomic DNA sequences have been submitted to the GenBank database with accession numbers of KX272652 and KX272651, respectively. The AnXyn11A-deduced amino acid sequence consisted of a putative 19-aa signal peptide and a mature protein of 212-aa, and the AnFaeA deduced amino acid sequence consisted of a putative 20-aa signal peptide and a mature protein of 281aa. Using the ProtParam program, the theoretical molecular weight and isoelectric point (PI) of AnXyn11A were deduced to be 24.9 kDa and 3.94, and those of AnFaeA were predicted to be 31.0 kDa and 4.39. One N-glycosylation site of the AnFaeA amino acid sequence was found using the NetNGlyc program 1.0. Based on the topology of the phylogenetic tree, AnXyn11A is closer to that of Aspergillus niger CBS 513.88 (XM 001389811), which belongs to the GH11 family (Fig. 2A), and AnFaeA shows a close relationship with that of Aspergillus niger CIB 423.1 (FJ 430154.1), which is attributed to type A FAEs (Fig. 2B). 3.2. Modeling and analysis of the tertiary structures of AnXyn11A and AnFaeA

2.5. Influences of temperature, pH and enzyme kinetics The optimum temperature of AnXyn11A and AnFaeA was determined in the range from 30 ◦ C to 70 ◦ C. To study the thermal stability, samples of AnXyn11A and AnFaeA were incubated in a water bath at 45 ◦ C–65 ◦ C, and the residual activity was determined every 10 min. The optimum pH of AnXyn11A was detected between pH 3.0–7.5 (citric acid buffer, 50 mmol L−1 ), and the optimum pH of AnFaeA was determined at different pH values in the range of 3.0–7.5 (Na2 HPO4 /citric acid buffer, 100 mmol L−1 ). The Michaelis–Menten kinetic parameters Km and Vmax of AnXyn11A were determined from Lineweaver–Burk plots with different substrate concentrations ranging from 10 g L−1 to 60 g L−1 , and those of AnFaeA were detected with different substrate concentrations ranging from 0.6 mmol L−1 to 6 mmol L−1 . 2.6. Synergistic interaction between AnXyn11A and AnFaeA The wheat bran (WB) used in this study was obtained locally from Xiamen, China. De-starched wheat bran (DSWB) was prepared following the method described previously with modification [22]. WB was incubated in 3 g L−1 potassium acetate at 95 ◦ C for 30 min followed by stirring constantly and washing with water to remove the starch. The DSWB was dried at 105 ◦ C to constant weight and passed through a 60 mesh sieve to preserve it as the hydrolysis substrate. The hydrolysis experiments were carried out at 20 g L−1 solids loading in Na2 HPO4 /citric acid buffer (pH 5.0, 100 mmol L−1 ). 0.5 g DSWB was mixed well with AnFaeA or/and AnXyn11A of different activities at 45 ◦ C on a thermo mixer incubator at 300 rpm for 12 h. Buffer without enzymes was used as the control, and the reaction was terminated by boiling for 10 min. All the samples were centrifuged at 12000 rpm for 2 min and sampled every 2 h to determine the optimal hydrolysis time. The amount of free FA released into the supernatant was determined by HPLC following the method described above. The xylooligosaccharides were analyzed by high-performance liquid chromatography (HPLC) using

Based on the model of known crystal structures that shared relative high identities, the predicted structures of AnXyn11A and AnFaeA are shown in Fig. 3. The modeled structure of AnXyn11A is a classical half-open hand with two ␤-sheets and one ␣-helix (Fig. 3A). Two residues (Glu117 and Glu208 ) were located on the concave side and supposed to work as the active site of catalysis. The predicted structure of AnFaeA displays a global shape with a catalytic triad Ser154 -Asp215 -His268 (Fig. 3B). The overall topology of the predicted protein is a classical ␣/␤-hydrolase fold, similar to that of most lipases [25]. 3.3. Expression of the transformants in P. pastoris The plasmids pPIC9-Anxyn11A and pPIC9K-AnfaeA were transformed into P. pastoris by electrotransformation. The selected transformants were cultured in BMMY medium induced by 10 mL of L−1 methanol. After 144 h culturing, the supernatants were harvested and preserved in a frozen state of −80 ◦ C for activity and SDS-PAGE analyses. Both AnXyn11A and AnFaeA showed a single protein band, as analyzed by SDS-PAGE, with an apparent molecular weight of approximately 25 kDa and 40 kDa, respectively (Fig. 4). Clearly, the SDS-PAGE result of AnXyn11A was the same as that forecast by the ProtParam program. However, the molecular weight of AnFaeA analyzed by SDS-PAGE was much larger than the theoretical value (31 kDa). The results of the bioinformatic analysis proved that there was one putative N-glycosylation site in the AnFaeA sequence that may be responsible for the appearance of the increased molecular weight. SDS-PAGE analysis showed that all of the recombinant proteins expressed by Pichia pastoris were in high purity (greater than 95% of the total protein as detected by the density). Thus, there is no need to further purify the recombinant protein. Several impressive reports [26,27] have shown the same behavior. The enzymatic activity of AnXyn11A was 240 U mL−1 with a protein concentration of 0.15 mg mL−1 . AnXyn11A was more highly expressed in P. pastoris compared to previous reports, in

44

H. Wu et al. / Biochemical Engineering Journal 120 (2017) 41–48

Fig. 2. Phylogenetic trees showing the evolutionary relativity and the homological degrees among the genes of Anxyn11A (A) and AnFaeA (B). The estimated genetic distance between sequences is proportional to the lengths of the horizontal lines connecting one sequence to another. Genbank accession numbers are shown in brackets.

which only 0.06 mg mL−1 and 0.12 mg mL−1 proteins were secreted [28,29]. The Km and Vmax values of AnXyn11A for BWX as substrate were 13.67 mg mL−1 and 3333.33 U mg−1 , respectively. AnFaeA showed a high activity of 21 U mL−1 with a protein concentration of

0.23 mg mL−1 . To the best of our knowledge, the AnFaeA exhibited the highest enzymatic activity in comparison to previous reports (Table 2). The Km and Vmax values of AnFaeA at standard assay conditions were graphically determined to be 1.40 mmol L−1 and 125.0 U mg−1 , respectively. This is a lower Km value than those (4.46 mmol L−1 and 14.40 mmol L−1 ) from Aspergillus usamii E001 [31] and Aspergillus niger [39], which indicates that AnFaeA has a stronger affinity to the substrates.

3.4. Characterization of AnXyn11A and AnfaeA

Fig. 3. Predicted 3-D structure of recombinant enzymes. A: AnXyn11A; B: AnFaeA; red, ␣-helix, green, random coil, yellow, ˇ-sheet, blue ball and stick, putative catalytic residues. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

The effects of temperature and pH on AnXyn11A and AnFaeA were investigated (Fig. 5). AnXyn11A exhibited maximum activity at 60 ◦ C, higher than those (35 ◦ C and 40 ◦ C) of the xylanases from Polyplastron multivesiculatum [33] and Fusarium graminearum [34], respectively. Its optimum pH was 4.5–5.0, with 70% of the maximum activity being retained between pH 3.5 and pH 5.5, showing a broad range of pH for hydrolysis. AnXyn11A was comparatively stable (retaining over 80% of its activity) when preincubated in 50 ◦ C

H. Wu et al. / Biochemical Engineering Journal 120 (2017) 41–48

45

3.5. Cooperative action of AnXyn11A and AnFaeA in generating xylooligosaccharides and ferulic acid from DSWB

Fig. 4. SDS-PAGE of AnXyn11A and AnFaeA expressed in P. pastoris. Lanes: M1 protein marker; 1 AnXyn11A; M2 protein marker; 2 AnFaeA.

for 30 min, but it entirely lost its activity after 60 min of incubation at 55 ◦ C (Fig. 5c). AnFaeA showed its maximum activity at 45 ◦ C, which was equal to the AuFaeA from Aspergillus usamii and the FAE from Aspergillus nidulans (Table 2). The pH for the optimal activity of AnFaeA was determined to be 5.0, which was different from other feruloyl esterases obtained by Aspergillus oryzae [32] and Streptomyces olivochromogenes [36] (Table 2). AnFaeA showed high residual activity (retaining over 80% of its activity) after pre-incubation at 50 ◦ C for 60 min. Even after incubation at 55 ◦ C for 30 min, there was still 50% residual activity retaining (Fig. 5d). The AnFaeA was more stable than those from Aspergillus usamii E001 [31], Aspergillus nidulans [37] and Fusarium oxysporum [38] (Table 2).

The amount of FA released from DSWB hydrolyzed by AnFaeA alone was detected and is shown in Fig. 6a. As the AnFaeA activity was enhanced, an upward trend in the amount of ferulic acid appeared and remained stable over the activity of 100 U. The maximum amount of released FA was 16.8% of theoretical value with AnFaeA alone. The hydrolysis feature was similar to that of previous studies [31,40]. As shown in Fig. 6b, when AnFaeA (100 U) and AnXyn11A (with different activities from 0 to 1000 U) were added simultaneously, the final released FA increased from 16.8% to 61% as the activity of AnXyn11A increased from 0 to 300 U, but after that, a very slight increase was detected. The maximum amount of FA released was 70% under the simultaneous cooperation of AnXyn11A and AnFaeA, and no trace of FA was released when hydrolyzed by AnXyn11A alone, which indicated a great synergistic effect between the two enzymes in generating FA from DSWB. Since there have been few reports on the synergistic mechanism between xylanases and feruloyl esterases, we presume that the xylanases may release low-molecular-mass feruloylated oligosaccharides, but not free FA. Only when the feruloyl esterase was present could the soluble feruloylated oligosaccharides be converted into free FA. Agger and his co-workers [42] reported that feruloyl esterase appeared to show better synergistic effect with xylanase in hydrolyzing soluble corn bran containing more feruloylated oligosaccharides than that of the insoluble part, which was consistent with our speculation. The release of FA became limited as the AnXyn11A concentration increased, mainly because of other substituents on the backbone of xylan impeding the further hydrolysis of AnXyn11A. Several researchers reported that the xylanase could cooperate with feruloyl esterases to enhance the amount of FA released from agricultural waste materials, but the synergistic

Fig. 5. Effects of temperature and pH on activity of the enzymes. (a) effect of temperature on the AnXyn11A and AnFaeA activities; (b) effect of pH on the AnXyn11A and AnFaeA activities; (c) thermo-stability of AnXyn11A; (d) thermo-stability of AnFaeA.

46

H. Wu et al. / Biochemical Engineering Journal 120 (2017) 41–48

Table 2 Comparison of properties of various microbial feruloyl esterases. Organism

Name

Enzyme activity

MW(kDa)

pHopt

Topt (◦ C)

Tsta (◦ C)

Reference

Aspergillus niger Aspergillus nidulans Aspergillus usamii Aspergillus oryzae Aspergillus oryzae Penicillium expansum Streptomyces olitrochromogenes Aspergillus nidulans Fusarium oxysporum

AnFaeA AnidFAE AuFaeA AoFaeB AoFaeC – FAE FaeB FoFAE-I

91.3 U/mg 21.7 IU/mg – 0.57 IU/mg 1.5 IU/mg 14.4 U/mg 0.19 U/mg 2.6 U/mg 6.9 U/mg

31 – 36 61 75 65 29 130 31

5.0 – 5.0 6.0 6.0 5.6 5.5 7.0 7.0

45 – 45 ND ND 37 30 45 55

<55 – <45 <55 <55 – – 45 30

This study [30] [31] [32] [32] [35] [36] [37] [38]

The unit of enzyme activity (IU and U) was defined as the amount of enzyme that releases 1 ␮mol free ferulic acid (FA) per minute toward MFA. – Not determined; opt, optimum; sta, stability.

Fig. 7. Yields of FA released as the hydrolysis time increased from 0 to 14 h.

(100 U). As shown in Table 3, the main sugars released from DSWB by AnXyn11A were xylobiose, xylotriose, and xylotetraose. The addition of AnFaeA played a key role in generating xylooligosaccharides and made their concentrations nearly double. As noted previously, type A feruloyl esterases can release 5-5 diFA (diferulic acid) and 8-O-4’diFA forms from soluble WB and cause the opening of the structure of the substrate for xylanases [44]. Since GH11 xylanases are known to prefer less substituted regions of the xylan backbone, the cleavage of the ferulic acid side group by feruloyl esterases may contribute to the relaxation of the cell wall structures and reduce the steric hindrance to provide more binding sites for xylanase [45,46]. These results suggest that AnFaeA efficiently cooperates with AnXyn11A in the hydrolysis of DSWB. Fig. 6. FA released in enzyme hydrolysis of DSWB. a. Yields of FA released from DSWB by AnFaeA alone with activity ranging from 0 to 140 U at 45 ◦ C for 12 h. b. Yields of FA released by AnFaeA (100 U) and AnXyn11A (0–1000 U) at 45 ◦ C for 12 h.

effect was poor, probably due to the different types of enzymes and substrates [21,31,41]. The appropriate choice of enzymes is the key point for the release of FA, as previously reported. The GH11 xylanases worked more effectively with FAEs in generating free FA, whereas the GH10 xylanases was more inclined to release FA-substituted products in collaboration with the FAEs [43]. In addition, compared to the GH10 xylanases, the GH11 xylanases have greater chance to permeate into the insoluble substrates due to its smaller molecular weight [14]. Fig. 7 showed the FA released as the hydrolysis time increased. The optimal hydrolysis time was 12 h, after which no obvious increase was detected. The amount of xylooligosaccharides released from DSWB was detected in the optimal dosages of AnXyn11A (300 U) and AnFaeA

4. Conclusions In summary, the xylan-degrading enzymes, AnXyn11A and AnFaeA from A. niger BE-2. were heterologously expressed in P. pastoris for the first time. Both of them displayed high specific activity and thermostability, which confirmed that the enzymes could be used under relatively broad conditions without side reactions. Moreover, the synergistic cooperation between AnXyn11A and AnFaeA provide promising value-added product efficiencies. (1) The FA released from DSWB was greatly enhanced from 16.8% to 70.0%, compared to using AnFaeA alone. (2) The XOS yield was almost doubled in the optimum level of enzyme addition. The study of the high efficiency co-production of FA and XOS by recombinant enzymes could provide a potential building block to unlock a key source of renewable resources.

H. Wu et al. / Biochemical Engineering Journal 120 (2017) 41–48

47

Table 3 Amount of xylooligosaccharides (XOS) released from DSWB hydrolysis by AnXyn11A (300 U) and/or AnFaeA (100 U). Xylooligosaccharides (mg mL−1 )

Substrate (DSWB) Enzymes AnFaeA AnXyn11A AnXyn11A/AnFaeA a b c

a

X2 n.d 0.09 ± 0.01 0.18 ± 0.00

X3 b 0.01 ± 0.00 0.27 ± 0.02 0.40 ± 0.02

X4 c n.d 0.12 ± 0.00 0.27 ± 0.02

XOS 0.01 ± 0.00 0.48 ± 0.02 0.85 ± 0.04

X2 , xylobiose. X3 , xylotriose. X4 , xylotetraose.

Acknowledgements The authors wish to express their gratitude for the financial support from the research fund from the Natural Science Foundation of Guangdong Province, China (2016A030310124), National Natural Science Foundation of China (Grant Nos. 21303142, 31600475), Xiamen Southern Oceanographic Center(No. 14GZP59HJ29), Fujian Provincial Department of Ocean and Fisheries(No. 2015-27), and President Fund of Xiamen University (20720150090).

References [1] G. Mandalari, G. Bisignano, R.L. Curto, K. Waldron, C. Faulds, Production of feruloyl esterases and xylanases by Talaromyces stipitatus and Humicola grisea var thermoidea on industrial food processing by-products, Bioresour. Technol. 99 (2008) 5130–5133. [2] H. Li, Y. Xue, J. Wu, et al., Enzymatic hydrolysis of hemicelluloses from Miscanthus to monosaccharides or xylo-oligosaccharides by recombinant hemicellulases, Ind. Crop Prod. 79 (2016) 170–179. [3] M. Imai, K. Ikari, I. Suzuki, High-performance hydrolysis of cellulose using mixed cellulase species and ultrasonication pretreatment, Biochem. Eng. J. 17 (2004) 79–83. [4] J. Van Dyk, B. Pletschke, A review of lignocellulose bioconversion using enzymatic hydrolysis and synergistic cooperation between enzymes—factors affecting enzymes conversion and synergy, Biotechnol. Adv. 30 (2012) 1458–1480. [5] B.C. Saha, Hemicellulose bioconversion, J. Ind. Microbiol. Biotechnol. 30 (2003) 279–291. [6] M. Garcia-Conesa, P. Wilson, G. Plumb, J. Ralph, G. Williamson, Antioxidant properties of 4, 4 -dihydroxy-3, 3 -dimethoxy-␤, ␤ -bicinnamic acid 8-8-diferulic acid, non-cyclic form, J. Sci. Food Agric. 79 (1999) 379–384. [7] E. Graf, Antioxidant potential of ferulic acid, Free Radical Bio. Med. 13 (1992) 435–448. [8] C. Faulds, B. Clarke, G. Williamson, Ferulic acid unearthed, Chem. Br. 36 (2000) 48–50. [9] K.W. Waldron, A. Ng, M.L. Parker, A.J. Parr, Ferulic acid dehydrodimers in the cell walls of Beta vulgaris and their possible role in texture, J. Sci. Food Agric. 74 (1997) 221–228. [10] A.A. Aachary, S.G. Prapulla, Xylooligosaccharides (XOS) as an emerging prebiotic: microbial synthesis, utilization, structural characterization, bioactive properties, and applications, Compr. Rev. Food Sci. Food 10 (2011) 2–16. [11] R. Crittenden, S. Karppinen, S. Ojanen, M. Tenkanen, R. Fagerström, J. Mättö, K. Poutanen, In vitro fermentation of cereal dietary fibre carbohydrates by probiotic and intestinal bacteria, J. Sci. Food Agric. 82 (2002) 781–789. [12] T. Collins, C. Gerday, G. Feller, Xylanases, xylanase families and extremophilic xylanases, FEMS Microbiol. Rev. 29 (2005) 3–23. [13] A. Pollet, J.A. Delcour, C.M. Courtin, Structural determinants of the substrate specificities of xylanases from different glycoside hydrolase families, Crit. Rev. Biotechnol. 30 (2010) 176–191. [14] J. Beaugrand, G. Chambat, V.W. Wong, F. Goubet, C. Rémond, G. Paës, S. Benamrouche, P. Debeire, M. O’Donohue, B. Chabbert, Impact and efficiency of GH10 and GH11 thermostable endoxylanases on wheat bran and alkali-extractable arabinoxylans, Carbohydr. Res. 339 (2004) 2529–2540. [15] C.B. Faulds, What can feruloyl esterases do for us? Phytochem. Rev. 9 (2010) 121–132. [16] D.W. Wong, Feruloyl esterase, Appl. Biochem. Biotechnol. 133 (2006) 87–112. [17] V. Crepin, C. Faulds, I. Connerton, Functional classification of the microbial feruloyl esterases, Appl. Microbiol. Biotechnol. 63 (2004) 647–652. [18] F. Payan, P. Leone, S. Porciero, et al., The dual nature of the wheat xylanase protein inhibitor XIP-I structural basis for the inhibition of family 10 and family 11 xylanases, J. Biol. Chem. 279 (2004) 36029–36037. [19] K.E. McAuley, A. Svendsen, S.A. Patkar, et al., Structure of a feruloyl esterase from Aspergillus niger, Acta Crystallogr. D 60 (2004) 878–887. [20] M.J. Bailey, P. Biely, K. Poutanen, Interlaboratory testing of methods for assay of xylanase activity, J. Biotechnol. 23 (1992) 257–270.

[21] H.-D. Shin, R.R. Chen, Production and characterization of a type B feruloyl esterase from Fusarium proliferatum NRRL 26517, Enzyme Microb. Technol. 38 (2006) 478–485. [22] K. Johnson, B. Harrison, H. Schneider, C. MacKenzie, J. Fontana, Xylan-hydrolysing enzymes from Streptomyces spp, Enzyme Microb. Technol. 10 (1988) 403–409. [23] H. Li, C. Long, J. Zhou, J. Liu, X. Wu, M. Long, Rapid analysis of mono-saccharides and oligo-saccharides in hydrolysates of lignocellulosic biomass by HPLC, Biotechnol. Lett. 35 (2013) 1405–1409. [24] P. Torre, B. Aliakbarian, B. Rivas, et al., Release of ferulic acid from corn cobs by alkaline hydrolysis, Biochem. Eng. J. 40 (2008) 500–506. [25] Z. Tan, J. Li, M. Wu, et al., High-level heterologous expression of an alkaline lipase gene from Penicillium cyclopium PG37 in Pichia pastoris, World J. Microbiol. Biotechnol. 27 (2011) 2767–2774. [26] G. Banerjee, S. Car, J.S. Scott-Craig, M.S. Borrusch, M. Bongers, J.D. Walton, Synthetic multi-component enzyme mixtures for deconstruction of lignocellulosic biomass, Bioresour. Technol. 101 (2010) 9097–9105. [27] H. Li, J. Wu, F. Jiang, Y. Xue, J. Liu, L. Gan, N. Ali, M. Long, Functional expression and synergistic cooperation of xylan-degrading enzymes from Hypocrea orientalis and Aspergillus niger, J. Chem. Technol. Biotechnol. 90 (2015) 2083–2091. [28] J.-G. Berrin, G. Williamson, A. Puigserver, J.-C. Chaix, W.R. McLauchlan, N. Juge, High-level production of recombinant fungal endo-␤-1,4-xylanase in the methylotrophic yeast Pichia pastoris, Protein Exp. Purif. 19 (2000) 179–187. [29] M. Lafond, A. Tauzin, V. Desseaux, E. Bonnin, E.H. Ajandouz, T. Giardina, GH10 xylanase D from Penicillium funiculosum: biochemical studies and xylooligosaccharide production, Microb. Cell Fact. 10 (2011) 20. [30] P. Debeire, P. Khoune, J.-M. Jeltsch, V. Phalip, Product patterns of a feruloyl esterase from Aspergillus nidulans on large feruloyl-arabino-xylo-oligosaccharides from wheat bran, Bioresour. Technol. 119 (2012) 425–428. [31] Y.-Y. Gong, X. Yin, H.-M. Zhang, M.-C. Wu, C.-D. Tang, J.-Q. Wang, Q.-F. Pang, Cloning, expression of a feruloyl esterase from Aspergillus usamii E001 and its applicability in generating ferulic acid from wheat bran, J. Ind. Microbiol. Biotechnol. 40 (2013) 1433–1441. [32] T. Koseki, A. Hori, S. Seki, T. Murayama, Y. Shiono, Characterization of two distinct feruloyl esterases AoFaeB and AoFaeC, from Aspergillus oryzae, Appl. Microbiol. Biotechnol. 83 (2009) 689–696. [33] E. Devillard, C.J. Newbold, K.P. Scott, E. Forano, R.J. Wallace, J.-P. Jouany, H.J. Flint, A xylanase produced by the rumen anaerobic protozoan Polyplastron multivesiculatum shows close sequence similarity to family 11 xylanases from gram-positive bacteria, FEMS Microbiol. Lett. 181 (1999) 145–152. [34] T. Beliën, S. Van Campenhout, M. Van Acker, G. Volckaert, Cloning and characterization of two endoxylanases from the cereal phytopathogen Fusarium graminearum and their inhibition profile against endoxylanase inhibitors from wheat, Biochem. Biophys. Res. Commun. 327 (2005) 407–414. [35] J. Donaghy, A. McKay, Purification and characterization of a feruloyl esterase from the fungus Penicilliumexpansum, J. Appl. Microbiol. 83 (1997) 718–726. [36] C.B. Faulds, G. Williamson, The purification and characterization of 4-hydroxy-3-methoxycinnamic (ferulic) acid esterase from Streptomyces olivochromogenes, J. Gen. Microbiol. 137 (1991) 2339–2345. [37] H.-D. Shin, R.R. Chen, A type B feruloyl esterase from Aspergillus nidulans with broad pH applicability, Appl. Microbiol. Biotechnol. 73 (2007) 1323–1330. [38] E. Topakas, H. Stamatis, M. Mastihubova, P. Biely, D. Kekos, B.J. Macris, P. Christakopoulos, Purification and characterization of a Fusarium oxysporum feruloyl esterase (FoFAE-I) catalysing transesterification of phenolic acid esters, Enzyme Microb. Technol. 33 (2003) 729–737. [39] S.-B. Zhang, Z.-L. Wu, Identification of amino acid residues responsible for increased thermostability of feruloyl esterase A from Aspergillus niger using the PoPMuSiC algorithm, Bioresour. Technol. 102 (2011) 2093–2096. [40] E. Topakas, H. Stamatis, P. Biely, D. Kekos, B. Macris, P. Christakopoulos, Purification and characterization of a feruloyl esterase from Fusarium oxysporum catalyzing esterification of phenolic acids in ternary water-organic solvent mixtures, J. Biotechnol. 102 (2003) 33–44. [41] E. Topakas, M. Moukouli, M. Dimarogona, P. Christakopoulos, Expression, characterization and structural modelling of a feruloyl esterase from the thermophilic fungus Myceliophthora thermophila, Appl. Microbiol. Biotechnol. 94 (2012) 399–411. [42] J. Agger, A. Viksø-Nielsen, A.S. Meyer, Enzymatic xylose release from pretreated corn bran arabinoxylan: differential effects of deacetylation and

48

H. Wu et al. / Biochemical Engineering Journal 120 (2017) 41–48

deferuloylation on insoluble and soluble substrate fractions, J. Agric. Food Chem. 58 (2010) 6141–6148. [43] C.B. Faulds, G. Mandalari, R.L. Curto, G. Bisignano, P. Christakopoulos, K.W. Waldron, Synergy between xylanases from glycoside hydrolase family 10 and family 11 and a feruloyl esterase in the release of phenolic acids from cereal arabinoxylan? Appl. Microb. Biotechnol. 71 (2006) (2006) 622–629. [44] P.A. Kroon, M.T. Garcia-Conesa, I.J. Fillingham, G.P. Hazlewood, G. Williamson, Release of ferulic acid dehydrodimers from plant cell walls by feruloyl esterases, J. Sci. Food Agric. 79 (1999) 428–434.

[45] L.P. Christov, B.A. Prior, Esterases of xylan-degrading microorganisms: production properties, and significance, Enzyme Microb. Technol. 15 (1993) 460–475. [46] F. O’Neill, L. Christov, P. Botes, B. Prior, Rapid and simple assay for feruloyl and p-coumaroyl esterases, World J. Microb. Biotechnol. 12 (1996) 239–242.