High extracellular calcium attenuates adipogenesis in 3T3-L1 preadipocytes

Experimental Cell Research 301 (2004) 280 – 292 www.elsevier.com/locate/yexcr

High extracellular calcium attenuates adipogenesis in 3T3-L1 preadipocytes Brian Jensen1, Mary C. Farach-Carson, Erin Kenaley, Kamil A. Akanbi* Department of Biological Sciences, University of Delaware, Newark, DE 19716, United States Received 24 February 2004, revised version received 9 July 2004 Available online 5 October 2004

Abstract We studied the effect of extracellular Ca2+ concentration ([Ca2+]e) on adipocyte differentiation. Preadipocytes exposed to continuous [Ca2+]e higher than 2.5 mmol/l accumulated little or no cytoplasmic lipid compared to controls in 1.8 mmol/l [Ca2+]e. Differentiation was monitored by Oil Red O staining of cytoplasmic lipid and triglyceride assay of accumulated lipid, by RT-PCR analysis of adipogenic markers, and by the activity of glycerol-3-phosphate dehydrogenase (GPDH). Elevated [Ca2+]e inhibited expression of peroxisome proliferator-activated receptor g, CCAAT/enhancer binding protein a, and steroid regulatory binding element protein. High [Ca2+]e significantly inhibited differentiation marker expression including adipocyte fatty acid binding protein, and GPDH. The decrease in Pref-1 expression that accompanied differentiation also was prevented by high [Ca2+]e. Treatment of 3T3-L1 cells with high [Ca2+]e did not significantly affect cell number or viability and did not trigger apoptosis. Levels of intracellular Ca+2 remained unchanged in various [Ca2+]e. Treatment of 3T3-L1 with pertussis toxin (PTX) partially restored lipid accumulation and increased differentiation markers in cells treated with 5 mmol/l [Ca2+]e. dClassicalT parathyroid cell Ca2+ sensing receptors (CaSR) were not detected either by RT-PCR or by Western blotting. These results suggest that continuos exposure to high [Ca2+]e inhibits preadipocyte differentiation and that this may involve a G-proteincoupled mechanism mediated by a novel Ca2+ sensor or receptor. D 2004 Elsevier Inc. All rights reserved. Keywords: Calcium; Preadipocytes; Adipocytes; Differentiation; Lipid

Introduction Growth of adipose tissue involves both hyperplasia and hypertrophy of the adipocytes [1]. Adipocytes play a major Abbreviations: ALBP, adipocyte fatty acid binding protein; BSA, bovine serum albumin; CaSR, calcium sensing receptor; C/EBP, CCAAT element binding protein; DMSO, dimethyl sulfoxide; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum; GPDH, glycerol-3phosphate dehydrogenase; HBSS, Hank’s balanced salt solution; HPRT, hypoxanthine phosphoribosyl transferase; MDI, 3-isobutyl-1-methylxanthine, dexamethasone, insulin; mGluR, metabotropic glutamate receptors; ORO, Oil Red O; PBS, phosphate-buffered saline; PPAR, peroxisome proliferator-activated receptor; PTX, pertussis toxin; Pref-1, preadipocyte factor-1; RT-PCR, reverse transcriptase-polymerase chain reaction; SREBP, steroid regulatory element binding protein; TG, triglyceride; Tg, thapsigargin. * Corresponding author. Department of Biological Sciences, University of Delaware, 206 Wolf Hall, Newark, DE 19716. Fax: +1 302 831 2281. E-mail address: [email protected] (K.A. Akanbi). 1 Current address: Department of Biology, Manhattanville College, 2900 Purchase Street, Purchase, NY 10577, United States. 0014-4827/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2004.08.030

role in energy homeostasis. They store energy in the form of lipid during plethora of food and release the stored energy in response to nutritional needs or inadequacies [1]. Adipocytes are not only involved in energy regulation, but also perform an endocrine function by secreting hormones and factors, which are involved in the regulation of food intake, immune response, reproduction, insulin sensitivity, and vascular and skeletal growth [2,3]. Though adipocytes perform important physiological functions, excessive body deposition of fat can result in obesity. Being obese increases the risk for many diseases especially heart disease, hypertension, stroke, cancer, and diabetes [4]. Because the growth of adipose tissue can be due to both hyperplasia and hypertrophy of adipocytes, the process of adipocyte differentiation and its regulation has been the focus of several studies [1,5–8]. Adipocyte differentiation is accompanied by complex changes in the pattern of gene expression [5]. Among the genes that undergo changes in expression during adipocyte differentiation are a cascade of transcription factors be-

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

longing to the families of CCAAT/enhancer-binding protein (C/EBP) and perosixome proliferators-activated receptor gamma (PPARg) [5–7,9]. The activation of PPARg and C/EBPa induces the expression of adipocyte-specific genes that are responsible for lipid accumulation [5,10]. The process of adipogenesis is influenced by a variety of extrinsic factors including hormones and growth factors and different intracellular signaling pathways [6,8]. Ca2+ is a versatile signaling molecule, which is involved in the regulation of several aspects of cell functions including proliferation, differentiation, matrix synthesis, and death. Elevation of intracellular Ca2+ ([Ca2+]i) during the early phase of adipocyte differentiation inhibits preadipocyte conversion to mature adipocytes [11–13]. However, elevation of [Ca2+]i during later stages of differentiation enhances adipose conversion of preadipocytes [13] and a sustained increase in ([Ca2+]i) promotes triglyceride accumulation in adipocytes [14,15] indicating that the effect of Ca2+ on adipogenesis may be complex. Because all of the earlier studies were performed using artificial means to elevate or lower [Ca2+]i, it is important to evaluate effects of divalent cations under more physiological conditions. Cells detect and respond to subtle changes in extracellular Ca2+ concentration ([Ca2+]e), which can modulate the balance between proliferation and differentiation of cells including chondrocytes and fibroblasts [16–18]. This response is mediated by calcium sensing receptors (CaSRs) that respond to changes in [Ca2+]e [19–21]. In fat cells of normal parathyroid glands, the expression of the classical CaSR was not detected using either immunocytochemistry or by in situ hybridization [22], but the existence of other molecularly distinct extracellular Ca2+ sensors remains a possibility [22]. The murine preadipocyte cell line 3T3-L1 provides a reliable model for adipocyte development including growth, metabolism, and differentiation. 3T3-L1 cells were used in this study to investigate the relationship between [Ca2+]e levels and adipocyte differentiation. The mechanisms for adipocyte development are similar in rodent and human preadipocytes [23]. We report that increasing [Ca2+]e inhibits the differentiation of 3T3-L1 preadipocytes through inhibition of the expression of key adipogenic transcription factors and differentiation marker genes without elevating [Ca2+]I or causing apoptosis. These data support the possibility that the terminal phase of adipocyte differentiation is likely to be influenced by the levels of extracellular [Ca2+]e.

Invitrogen (Carlsbad, CA). Calf serum (CS) was obtained from Mediatech, Inc. (Herndon, VA). Insulin (I), 3-isobutyl1-methylxanthine (M), dexamethasone (D), dihydroxy acetone phosphate (DHAP), reduced nicotinamide adenine dinucleotide (NADH), pertussis toxin (PTX), propidium iodide, and RNase A were from Sigma-Aldrich (St. Louis, MO). Rabbit antihuman calcium sensing receptor antiserum (CaSR) was from Alpha Diagnostic International (San Antonio, TX). All other chemicals were reagent grade or better. Cell culture 3T3-L1 preadipocytes were obtained from American Type Culture Collection (Manassas, VA) and maintained as stock in Ca2+-containing (1.8 mmol/l) DMEM (standard DMEM culture medium) supplemented with 10% (v/v) heat-inactivated calf serum (CS) and 100 IU penicillin and 100 IU streptomycin (growth medium) and grown for up to 20 passages. Prior to initiating Ca2+ experiments, cells were transferred to Ca2+-free DMEM supplemented with CaCl2 to the specified concentrations. MgCl2 experiments were also conducted using standard DMEM culture medium (1.8 mmol/l Ca2+;0.8 mmol/l MgCl2) supplemented with MgCl2 to specified concentrations. For all media, pH was adjusted to 7.3, the osmolarity of each medium was measured using Vapor Pressure Osmometer, Wescor 5100C (Wescor Inc., Logan, UT). Osmolarity of the media is shown in Table 1. Media were changed every other day. For experiments, cells were plated at a density of 2000 cells/cm2 and allowed to grow to confluence. Two days post-confluence, cells were switched to differentiation medium consisting of DMEM supplemented with 10% (v/v) FBS, 3-isobutyl-1-methylxanthine (M; 0.5 mmol/l), dexamethasone (D; 1 Amol/l), insulin (I; 10 nmol/l), and penicillin and streptomycin (MDI), and various concentrations of [Ca2+]e. In parallel experiments, cells were treated with various concentrations of extracellular Mg2+. After 48 h in MDI, the media were replaced with DMEM supplemented with 10% (v/v) FBS I (10 nmol/l), and penicillin and streptomycin for 48 h. Cells were subsequently maintained in DMEM supplemented with 10% FBS and penicillin/streptomycin. Cells were harvested on the indicated days in the figure legend after the induction of differentiation. Table 1 Osmolarity of cell culture media (mOs/kg)a Concentration (mM)

Growth medium

MDI

Ca2+

Ca2+

Control 2.5 5.0 7.5 10.0

321.7 320.5 322.3 331.3 334.3

Materials and methods Materials Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), Dulbecco’s phosphate-buffered saline (PBS), and penicillin/streptomycin were purchased from

281

Mg2+ F F F F F

2.7 0.5 0.3 4.7 3.8

321.7 322.0 335.0 336.5 345.0

F F F F F

2.7 2.0 4.0 4.5 1.0

335.5 328.0 314.7 336.3 340.0

Mg2+ F F F F F

1.5 1.5 0.67 2.6 2.0

334.5 327.5 337.5 345.0 342.0

F F F F F

4.5 0.5 2.5 3.0 3.0

a Osmolarity of culture media F SEM for four different media preparations.

282

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

RNA extraction and RT-PCR Total RNA was harvested on the designated days using RNEasy kit (Qiagen Inc., Valencia, CA) following the manufacturer’s directions. Residual genomic DNA was digested away with DNase in the buffer provided by the manufacturer according to manufacturer’s instructions (Promega Corp., Madison, WI). The DNA-free RNA was used as template for first strand cDNA synthesis, which was carried out using OmniscriptR Reverse Transcriptase (Qiagen Inc.) according to manufacturer’s instructions. PCR amplification was performed using HotStarR Taq Polymerase (Qiagen Inc.) in a GeneAmp PCR system 9700 (PE Applied Biosystems, Forster City, CA). Hypoxanthine phosphoribosyl transferase (HPRT) or 18S was used as internal control in PCR amplification. All PCR primers were synthesized by Sigma-Genosys (The Woodlands, TX). Primer sequences for adipogenic genes and PCR conditions are shown in Table 2, and are similar to those published by Ref. [24]. A set of primers flanking exon 5 of the mouse CaSR [25] with correction for the two mismatches in the antisense primer was used to amplify CaSR. Primers were designed for metabotropic glutamate receptors (mGluR) 1 and 3 from the published sequences in the Genbank accession numbers XM 125507 and XM 131877, respectively, using the Primer-3 program. All RT-PCR products were analyzed on 1.5% (w/v) agarose gels stained with ethidium bromide. DNA contamination was excluded by PCR experiments without reverse transcriptase. Oil Red-O staining Cytoplasmic lipid droplets were stained with Oil Red O (ORO). Briefly, cells were rinsed three times in PBS and then fixed in 10% (v/v) paraformaldyhyde for 1 min. Fixed cells were rinsed three times in deionized water, stained with a working solution of ORO for 30 min at room temperature, and rinsed three times with deionized water. The cells were counterstained with Harris’s hematoxylin for 30 s for

nuclear staining and finally rinsed three times with deionized water. Images were collected using a Nikoninverted microscope with a Nikon D100 digital camera. Triglyceride assay Triglyceride content of the cells was determined using the Wako L-type TG H test (Wako, Richmond, VA). Briefly, cells were seeded at 2000 cells/cm2 in 6-well plates. Cells were grown and differentiated in variable concentrations of Ca2+ or Mg2+ as described (see cell culture method). Eight days after the induction of differentiation, cells were harvested. Cells were rinsed three times with phosphatebuffered saline (PBS) and scraped off the plates with a rubber policeman into individual 1.5-ml microcentrifuge tubes. Cells were lysed in lysing buffer (0.25 M sucrose, 1 mM sodium-EDTA, 5 mM Tris, and 1 mM dithiotreitol, pH 7.4) by vigorous vortexing followed by 15 s of sonication on ice. The homogenates were assayed according to manufacturer’s instructions. Cell number assay Cell numbers were determined by counting cells visually using a hemacytometer under a microscope and by a colorimetric method using the CellTiter 96R AQueous One Solution Cell Proliferation Assay (Promega Corp.) according to the manufacturer’s instructions. The assay is a colorimetric method for the quantitation of cell number or cell viability based on the conversion of tetrazolium compound 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium to formazan. The amount of formazan-colored product formed is directly proportional to the number of living cells in culture. Cells were seeded at a density of 2000 cells per well in 96well plates, then grown in various Ca2+ concentrations as shown in the individual experiments. Proliferation assays were performed while the cells were in the exponential growth phase.

Table 2 Forward and reverse primer sequence, amplicon length, and PCR amplification cyclesa Name

Forward/Reverse primer sequence 5V–3V

Length (bp)

Annealing temperature (8C)

Cycles

C/EBPa SREBP-1c PPARg Pref-1 HPRT 18S ALBP GPDH CaSR mGluR1 mGluR3

AGGTGCTGGAGTTGACCAGT CAGCCTAGAGATCCAGCGAC GGAGCCATGGATTGCACATT AGGAAGGCTTCCAGAGAGGA CCAGAGCATGGTGCCTTCGCTG GAGCTGACCCAATGGTTGCTG CGTGATCAATGGTTCTCCCT AGGGGTACAGCTGTTGGTTG CTTGCTCGAGATGTCATGAAG GTTTGCATTGTTTTACCAGTG GGACCAGAGCGAAAGCATTTGCC TCAATCTCGGGTGGCTGAACGC TGAAAGAAGTGGGAGTTGGC CCTGTCATCTGGGGTGATTT AGAGATGCTCGCCACAGAAT AAAGGGTCTCTGGGGTCTGT CAAGGTCATTGTCGTTTTCTCCAGC GCAATGCAGGAAGTGTAGTTCTCAT ACGACGATGATGACAGCAG CCTTTCCTTTCCTTTCCTTTTC GCTTAACTAAGTCTTGTGTCCC AGCACTTCGTCTAACAGCC

238 191 220 148 290 495 182 284 1007/777 445 158

60 60 60 57 58 65 52 60 58 58 58

22 36 22 22 22 22 22 22 35 35 35

a Abbreviations: PCR, polymerase chain reaction; PPAR, peroxisome proliferator-activated receptor; C/EBP, CCAAT element binding protein; SREBP, steroid regulatory element binding protein; Pref-1, preadipocyte factor-1; HPRT, hypoxanthine phosphoribosyl transferase; ALBP, adipocyte fatty acid binding protein; GPDH, glycerol-3-phosphate dehydrogenase.

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

283

Cell cycle analysis

Intracellular Ca2+ measurements

Cell cycle analysis of differentiating 3T3-L1 cells was performed during postconfluent mitotic phase. Cells were cultured as described above. Two-day post-confluent 3T3L1 cells were treated with MDI containing various [Ca2+]e to induce differentiation. On day 2 of differentiation, cells were harvested with trypsin buffer, washed with PBS containing 0.1% BSA, and centrifuged at 1400 rpm for 5 min at room temperature. After decanting the supernatant, cells were fixed with ice-cold 70% ethanol. Cells were kept at 48C overnight or later. Cells were then washed twice with PBS pipetting up and down, and centrifuged at 2000 rpm for 5 min. Cells were incubated with 50 ng/Al of RNase A and 50 Ag/ml propidium iodide in PBS at 48C for 30 min in the dark. Cells were subjected to flow cytometry using FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA, USA). Data were analyzed using ModFit LT (Verity Software House, Inc., Topsham, ME).

[Ca2+]i concentrations of proliferating 3T3-L1 cells were determined using a single-cell Ca2+ imaging system (Intracellular Imaging, Cincinnati, OH) as previously described [28,29]. Briefly, 3T3-L1 cells were grown to approximately 30% confluence in growth medium containing various concentrations of Ca2+ in 35-mm glass bottom tissue culture dishes. Growth medium was removed from the dishes and cells were rinsed with Hank’s balanced salt solution (HBSS) containing 140 mmol/l NaCl, 4.2 mmol/l KCl, 0.5 mmol/l NaH2PO4, 0.4 mmol/l MgSO4, 0.3 mmol/l MgCl2, 1 mmol/l CaCl2, 6 mmol/l glucose, 0.1% (w/v) BSA, and 20 mmol/l N -2-hydroxyethylpiperazine-N -2-ethanesulfonic acid (HEPES), pH 7.4. Cells were loaded with 3 Amol/l fura 2AM in HBSS containing 0.12 Amol/l pluronic F-127 for 30 min at 378C. After the initial incubation, cells were rinsed twice with HBSS without fura 2-AM and pluronic F-127. The fura 2-AM-loaded cells were maintained in HBSS and further incubated at 378C for 15 min in the dark to allow deesterification of fura 2-AM. The fluorescence of fura 2loaded cells was visualized under an inverted Nikon microscope with a 40 fluor objective. Illumination of the cells was performed using a xenon lamp outfitted with quartz collector lenses. Four to eight single cells were selected in a microscopic field. The cells were excited alternatively at 340 and 380 nm, and the ratio of emitted fluorescence was determined at 510 nm. [Ca2+]i in each cell was determined from the ratio of 340 and 380 nm fluorescence by comparison with fura-2-free acid standards. For some studies, the fura-2AM-loaded cells were shifted to fresh medium containing different concentrations of Ca2+ and then acute effect on [Ca2+]i followed over a 10-min period. The single cell monitoring procedure became impractical for preadipocytes 8 days after the induction of differentiation, because the cells no longer adhered well to glass and became buoyant after accumulating cytoplasmic lipid. To compensate for this, we used a cell suspension technique as described previously [30,31]. Briefly, cells were cultured and differentiated with IMD containing various Ca2+ concentrations in 35-mm culture dishes as described above. Eight days after the induction of differentiation, cells were rinsed three times in HBSS containing indicated concentrations of Ca2+. The cells were incubated at 378C in the dark in HBSS solution containing 3 Amol/l fura-2AM and 1.5 Ag/ml pluronic F-127. After this initial incubation step, cells were rinsed twice with and then incubated in HBSS without fura-2AM or pluronic in the dark at 378C for 30 min. Fura-2AM-loaded cells were gently scraped into a quartz cuvette and suspended with 2 ml HBSS. Cuvettes were placed in the chamber of a dualexcitation spectrofluorometer (Photon Technology International, Monmouth Junction, NJ) at room temperature with constant stirring. Cells in the suspension were excited at 340 and 380 nm alternatively and the determination of fluorescent emission ratio was performed at 510 nm.

Glycerol-3-phosphate dehydrogenase (GPDH) activity GPDH (EC 1.1.1.8) activity was measured by a spectrophotometric method for the determination of oxidized NADH during GPDH-catalyzed reduction of DHAP [26] as modified by Ref. [27]. Protein content was determined by bicinchoninic acid (BCA) method using BSA as a standard (Pierce Chemical, Rockford, IL). Apoptosis assay 3T3-L1 cells were plated at a density of 10,000 cells/ well in 6-well plates and were seeded in growth medium containing variable concentrations of Ca2+ until they reached confluence. In a parallel experiment, cells in positive control wells were treated with 3.4 Amol/l staurosporine dissolved in DMSO for 3.5 h prior to the enzymatic assay for caspase-3 activity. This dose of staurosporine was sufficient to cause apoptosis in control wells. The treatment dose of staurosporine was determined in a separate experiment. Caspase-3 activity was determined with an apoptosis assay kit (R&D Systems, Minneapolis, MN) according to the manufacturer’s suggestions with minor modifications. Briefly, cells were rinsed three times with PBS then trypsinized and centrifuged for 5 min at 300  g. The supernatant was carefully and completely removed. Cells were lysed with 60-Al lysis buffer and incubated for 10 min on ice. The lysate was centrifuged for 3 min at 14,000 RPM. A 50-Al aliquot of the resulting supernatant was then used for the colorimetric caspase-3 assay. Caspase-3 activity in each sample was expressed relative to caspase-3 activity in the positive control. All samples were further standardized by protein content, which was determined using BCA colorimetric protein assay reagents purchased from Pierce.

284

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

Statistical analysis Data were analyzed by ANOVA followed by Tukey’s multiple comparison tests. P b 0.05 was considered statistically significant.

Results [Ca2+]e decreases cytoplasmic lipid accumulation in differentiating 3T3-L1 preadipocytes We used 1.8 mmol/l [Ca2+]e as control in these experiments. Microscopic examination of the cells showed that continuous treatment of 3T3-L1 cells with defined concentrations of [Ca2+]e from the day of plating to day 8 after the induction of differentiation did not affect the morphology of the cells in either 7.5 or 10 mmol/l Ca2+ concentrations. Cells retained the spindle-like features characteristic of preadipocytes. Increasing [Ca2+]e at the induction of differentiation (2 days after the cells became

confluent) produced similar results (data not shown). When cells were induced to differentiate control cells (1.8 mmol/l Ca2+), cells in 2.5 or 5.0 mmol/l Ca2+ underwent morphological changes. Cells changed from the spindlelike features characteristic of preadipocytes to rounded shape and accumulated intracellular lipid. Cells treated with 1.8 or 2.5 mmol/l Ca2+ accumulated substantially more intracellular lipid than cells treated with 5.0 mmol/l Ca2+ as revealed by ORO staining (Fig. 1A). There was no difference in lipid accumulation between cells cultured in 1.8 and 2.5 mmol/l Ca2+ (Figs. 1A and B). In contrast, cells treated with higher [Ca2+]e (5 and 10 mmol/l) displayed little or no visible intracellular lipid accumulation (Figs. 1C and D). The effect of 7.5 mmol/l Ca2+ was similar to 10 mmol/l (data not shown). Fig. 1E shows the corresponding intracellular lipid concentrations of ORO-stained cells. When cells were cultured in medium containing high concentrations of Ca2+ after the induction of differentiation (day 2 or later), we did not observe the inhibitory effect of Ca2+ on 3T3-L1 differentiation (data not shown). The inhibitory effect of Ca2+

Fig. 1. Elevated [Ca2+]e inhibits 3T3-L1 preadipocyte differentiation. Photomicrographs are shown of Oil Red O staining of cells treated with (A) 1.8 mmol/l (control), (B) 2.5 mmol/l, (C) 5.0 mmol/l, and (D) 10.0 mmol/l Ca2+ on day 8 after initiation of differentiation (original magnification 100, photomicrographs are representative of at least four independent experiments). Cytoplasmic lipids are stained red. The cells were counterstained with Harris’s hematoxylin, nuclei stained blue/purple. Shown in E is the TG contents of 3T3-L1 cells treated with the indicated concentrations of Ca2+ from the day of plating to day 8 of differentiation, and shown in F is the GPDH activity of 3T3-L1 cells treated with the indicated concentrations of Ca2+ from day of plating to day 8 after initiation of differentiation. TG and GPDH activities reflect the inhibition of differentiation. Values are means F SEM, n = 4 (**P b 0.01, ***P b 0.001 compared with 1.8 mmol/l (control)).

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

on intracellular lipid accumulation was only observed when higher [Ca2+]e (5 or 10 mmol/l) were present prior to or at the time of the induction of differentiation. The results of experiments with MgCl2 are in contrast to that of CaCl2. The basal MgCl2 in the culture media was 0.8 mmol/l (control), when cells were treated with variable concentrations of MgCl2, there was no morphological changes as observed with CaCl2. Regardless of the concentrations of MgCl2 added to the culture media, cells maintained their spindle-like features characteristic of preadipocytes and became rounded upon induction of differentiation with MDI and accumulated lipid droplets. Cells treated with various concentrations of MgCl2 accumulated substantial amount of lipid droplets by day 8 of the induction of differentiation as revealed by ORO staining (Figs. 2A–E). There were no differences in the corresponding intracellular lipid concentrations in the control (0.8 mmol/l Mg2+) 7.5 and 10.0 mmol/l Mg2+; however, there was significant intracellular lipid accumulation in cultures treated with 2.5 and 5.0 mmol/l Mg2+ (Fig. 2F).

285

[Ca2+]e does not affect cell proliferation or apoptosis [Ca2+]e has been shown to affect cell proliferation and apoptosis in other systems. Therefore, we determined if increasing [Ca2+]e altered 3T3-L1 cell proliferation. We used two different time points, when cells are in exponential growth phase and after cells were induced to differentiate (postconfluent growth phase) to examine the effect of [Ca2+]e on 3T3-L1 cells proliferation. There was no statistically significant effect of [Ca2+]e on preconfluent cell number (Fig. 3A). The effect of [Ca2+]e on cell cycle was investigated on postconfluent 3T3-L1 cells using flow cytometry. As we increased [Ca2+]e, the percentage of cells in G0/G1 phase in differentiated 3T3-L1 cells did not significantly change (Table 3) and the percentage of cells in S phase did not show any significant change (Table 3), meaning that G0/G1 to S progression was not executed in response to increased [Ca2+]e. There was no statistically significant difference in the percentage of cells in G2M phase when we compared the control (1.8 mmol/l Ca2+) with calcium concentration that most effectively inhibited

Fig. 2. Elevated [Mg2+]e does not inhibit 3T3-L1 preadipocyte differentiation. Photomicrographs are shown of Oil Red O staining of cells treated with (A) 0.8 mmol/l (control), (B) 2.5 mmol/l, (C) 5.0 mmol/l, (D) 7.5 mmol/l, and (E) 10.0 mmol/l Mg2+ on day 8 after initiation of differentiation (original magnification 100, photomicrographs are representative of at least four independent experiments). Cytoplasmic lipids are stained red. The cells were counterstained with Harris’s hematoxylin, nuclei stained blue/purple. Shown in F is the TG contents of 3T3-L1 cells treated with the indicated concentrations of Mg2+ from the day of plating to day 8 of differentiation and shown in G is the GPDH activity of 3T3-L1 cells treated with the indicated concentrations of Mg2+ from day of plating to day 8 after initiation of differentiation. TG and GPDH activities reflect the promotion of differentiation. Values are means F SEM, n = 4 (**P b 0.01, ***P b 0.001 compared with 0.8 mmol/l (control)).

286

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

Fig. 3. Elevated [Ca2+]e does not affect 3T3-L1 cell proliferation or apoptosis. (A) Preadipocytes were cultured in the indicated concentrations of Ca2+ for 48 h. Cell number was determined based on the formation of formazan after 4-h incubation in tetrazolium salt (see Materials and methods) and (B) preadipocytes were cultured in the indicated concentrations of Ca2+ and caspase-3 activity was determined while the cells were in growth phase. Cell number was not reduced by high [Ca2+]e compared to 1.8 mmol/l (control) and there was no indication that high [Ca2+]e caused apoptosis. Values are means F SEM, n = 6. Values with different letters are significantly different (P b 0.05).

adipocyte conversion (7.5 mmol/l, Table 3). To determine if increased [Ca2+]e triggered apoptosis, we measured caspase-3 activity as an indicator of apoptosis in 3T3-L1 cells grown in various [Ca2+]e. Caspase-3 activity in cells grown in higher concentrations of Ca2+ was not significantly different from control (Fig. 3B). Collectively, these observations indicate that high [Ca2+]e did not affect the total number of cells in cultures and was not cytotoxic to adherent cells. High [Ca2+]e does not alter [Ca2+]i levels or Ca2+ stores To assess whether cells cultured in [Ca2+]e change cytoplasmic Ca2+ concentration, we used a single-cell Ca2+ imaging system to measure the resting levels of cytoplasmic Ca2+ in cells cultured in various [Ca2+]e and in cell suspension system for differentiated cells. The cells were treated with thapsigargin (Tg), an endoplasmic reticulum (ER) Ca2+ ATPase inhibitor, to determine the level of releasable Ca2+ stores in cells grown in various concenTable 3 Cell cycle status of 3T3-L1 cells treated with various concentrations of [Ca2+]e on day 2 of differentiation Cell cycle status

Ca2+ concentration (mM)

Cell population (%)

G0/G1 S G2/M G0/G1 S G2/M G0/G1 S G2/M G0/G1 S G2/M

Control (1.8)

68.74 16.41 14.53 79.30 12.65 8.05 79.62 13.42 8.62 73.91 15.82 15.67

2.5

5.0

7.5

F F F F F F F F F F F F

6.35 0.53 1.61 1.14 1.42 0.64 2.89 4.46 1.73 5.90 2.23 1.07

Data are shown as mean F SEM in percentage for five individual experiments.

trations of [Ca2+]e. In both the single-cell Ca2+ imaging of 3T3-L1 preadipocytes (Fig. 4A) and the cell suspension recordings for day 8 adipocytes (Fig. 4B), there was no change in resting levels of Ca2+. Cells in exponential growth phase were also cultured in various concentrations of Ca2+ for 36, 48, 72 h, and 2 days after the induction of differentiation (data not shown); the duration of cells in different levels of [Ca2+]e neither changed the resting levels of cytoplasmic Ca2+ nor the levels of releasable Ca2+ stores. There was a slight decrease in cytoplasmic Ca2+ release induced by the addition of thapsigargin in both proliferating 3T3-L1 preadipocytes and day 8 adipocytes (differentiated) cells grown in 5 mmol/l Ca2+ (Figs. 4A and B). In order to determine whether increases in [Ca2+]e caused acute changes in [Ca2+]i that could be detected by fura-2AM, growth phase preadipocytes were transferred to medium containing 1.8, 2.5, 5.0, 7.5, and 10 mmol/l Ca2+. In no case was a Ca2+ transient observed within 10 min following transfer to high Ca2+, nor was an immediate change in baseline observed (data not shown). This result indicates that the effects of Ca2+ in the medium reflect chronic changes rather than acute changes in [Ca2+]i. High [Ca2+]e decreases expression of adipogenic transcription factors Adipocyte differentiation is accompanied by complex changes in the pattern of gene expression [5]. To determine if the attenuation of cytoplasmic lipid accumulation by [Ca2+]e involves alteration in expression of genes encoding key adipogenic transcription factors, we used an RT-PCR approach to examine the expression of PPARg, C/EBPa, SREBP-1c, preadipocyte factor-1 (Pref-1), and ALBP. Two days after the induction of differentiation, an increase in the mRNA levels of PPARg and C/EBPa, two important adipogenic transcription factors in the control cells (1.8

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

287

Fig. 4. Elevated [Ca2+]e does not alter [Ca2+]i levels in 3T3-L1 preadipocytes. (A) [Ca2+]i in 3T3-L1 cells in growth phase (proliferating). Panels 1, 2, 3, and 4 were cultured in 1.8, 2.5, 5.0, and 10.0 mmol/l Ca2+, respectively. After 24 h in various [Ca2+]e, [Ca2+]i was determined. Plots are representatives of results from independent experiments obtained from four to eight single cells selected in a microscopic field. (B) [Ca2+]i levels of 3T3-L1 cells 8 days after the induction of differentiation using a cell suspension technique. Cells were cultured in Ca2+. Traces are representative of the results of independent experiments (n = 3). Arrow indicates the addition of 2.5 Amol/l Tg to cause the release of Ca2+ from the store.

mmol/l Ca2+), was observed. In contrast, PPARg and C/ EBPa mRNA levels in cells cultured in 5 or 10 mmol/l Ca2+ were inhibited (data not shown). Eight days after the induction of differentiation, there was a decrease in the abundance of mRNAs for PPARg, C/EBPa, SREBP-1c, and

ALBP in cells receiving continuous treatment of high [Ca2+]e in a concentration-dependent manner. On the other hand, the transcript for Pref-1 was increased (Figs. 5A and B). The changes in gene expression were specific for these transcription factors because [Ca2+]e did not affect the

288

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

Fig. 5. Elevated [Ca2+]e inhibits adipogenic gene expression in 3T3-L1 preadipocytes. (A) Representative gel images for 18S rRNA, hypoxanthine phosphoribosyl transferase (HPRT), adipocyte fatty acid binding protein (ALBP), CCAAT element binding protein (C/EBPa), peroxisome proliferatoractivated receptor (PPARg), preadipocyte factor-1 (Pref-1), steroid regulatory element binding protein (SREBP), and glycerol-3-phosphate dehydrogenase (GPDH) are shown. (B) The quantitative changes of the target genes relative to 18S were determined densitometrically (three individual experiments).

expression level of 18S or HPRT, housekeeping genes used in these experiments. High [Ca2+]e inhibits adipocyte late differentiation marker gene expression Expression of GPDH is induced several fold upon conversion of preadipocytes to adipocytes [5]. In this study, mRNA levels of GPDH were greatly reduced and GPDH

enzyme activity was lower in 3T3-L1 cells 8 days after the induction of differentiation treated with increasing concentrations of Ca2+. The differentiation markers were inhibited in 3T3-L1 cells receiving supplemental Ca2+ in the following order: 1.8 = 2.5 b 5 b 7.5 = 10 mmol/l (Figs. 5A and B). In contrast, GPDH enzyme activity was not affected in cells receiving 5.0, 7.5, or 10 mmol/l MgCl2 when compared to the control, 0.8 mmol/l Mg2+ (Fig. 2G). There was, however, a significant increase in GPDH

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

enzyme activity in cultures treated with 2.5 mmol/l MgCl2 (Fig. 2G). 3T3-L1 cells do not express parathyroid cell Ca2+ sensing receptor To detect the expression of CaSR, we performed RT-PCR using gene-specific primers for mouse CaSR. Mixtures of mouse RNA were used as positive controls for PCR reactions and to the utility of the primer pairs. We were able to detect CaSR expression in control RNA, but consistently failed to detect CaSR in 3T3-L1 cells at any stage of growth or differentiation (Fig. 6A). Using commercially available antibodies to CaSR, we performed Western blot analysis using mouse kidney protein extract as a positive control. There was no detectable protein expression of CaSR in 3T3L1 preadipocytes at different stages of growth and differentiation (data not shown). It has been suggested that cells that respond to changes in Ca2+ that do not express CaSR may use other Ca2+ sensors or yet to be characterized receptors to sense and respond to changes in [Ca2+]e. We also used RT-PCR technique to test for the expression of sensors or receptors suggested to detect changes in [Ca2+]e including megalin/gp330 and mGluRs. The results of our RT-PCR indicate that the mRNA for megalin/gp330 is expressed in 3T3-L1 preadipocytes at different stages of growth and differentiation (Fig. 6C), but we were unable to amplify mGluRs 1 or 3 in 3T3-L1 cells (Fig. 6B). However, when cells were treated with 100 ng/ml of pertussis toxin (PTx), we observed an increase in number of cells that were stained with ORO (Fig. 7). Lipid filling was partially restored in cells receiving 5.0 mmol/l Ca2+ (Fig. 7).

Discussion Ca2+ is a versatile second messenger whose actions affect many aspects of cell behavior and influence cell prolifer-

289

ation, differentiation, survival, and death. Since the discovery and cloning of parathyroid CaSRs, there has been increased interest in Ca2+ as a first messenger. In the current study, we used 3T3-L1 preadipocytes and the standard MDI treatment differentiation protocol to examine the action of Ca2+ as a first messenger in the differentiation of 3T3-L1 preadipocytes. Our data indicate that continuous culture of 3T3-L1 preadipocytes with [Ca2+]e higher than 2.5 mmol/l diminished the ability of preadipocytes to differentiate and accumulate intracellular lipid. The ability of [Ca2+]e to regulate cellular differentiation has been demonstrated in several cell types [16,32,33]. We found that the timing of preadipocyte exposure to elevated Ca2+ levels is important. Exposure of cells before or during induction of differentiation to high [Ca2+]e levels (5, 7.5 or 10.0 mmol/l) inhibited preadipocyte differentiation. Our results indicate that [Ca2+]e can inhibit the ability of 3T3-L1 preadipocytes to accumulate triglyceride and also suggest that 3T3-L1 preadipocytes can sense and respond to changes in their [Ca2+]e. The inhibition of differentiation that we observed is specific for Ca2+. In parallel experiments using MgCl2, a divalent cation used to offset the changes in osmolarity associated with CaCl2, we did not observe inhibition of 3T3-L1 differentiation. There was no difference in the ability of cells cultured in the various concentrations of Mg2+ to accumulate intracellular lipid. This contrasted what we observed with CaCl2 treatment in 3T3-L1 preadiopcytes after the induction of differentiation. Because the osmolarity of culture media containing CaCl2 or MgCl2 is similar, we believe the effect of Ca2+ in the present study is not due to changes in media osmolarity, but rather represents a specific first messenger function of [Ca2+]e. The effect of changing [Ca2+]e on cell behavior is not generally well understood. Elevated [Ca2+]e inhibits proliferation of several cell types [16–18], but low [Ca2+]e inhibits the growth of human dermal fibroblasts. In this study, elevated [Ca2+]e treatment had no statistically

Fig. 6. 3T3-L1 cells do not express dclassicalT CaSR or mGluRs. The expression of CaSR (A) was analyzed by RT-PCR. Lane 1 is 100 bp molecular weight standard; lane 2 is RNA obtained from 3T3-L1 cells in growth phase; lane 3 is RNA obtained from 3T3-L1 cells 7 days post-differentiation; lane 4 is RNA obtained from 3T3-L1 cells 14 days post-differentiation; and lane 5 is control RNA (mixture of RNA from a variety of mouse tissues including kidney and brain). The two amplified DNA bands are shown by arrow. The upper band corresponds to the full-length CaSR (1007 bp) and the lower band corresponds to the spliced variant lacking exon 5 (777 bp). The same RNAs were amplified by sets of primers for mGluR 1 and 3 and megalin (B and C). (B) Lane is 100 bp molecular weight standard; lanes 2 and 7 are RT; lanes 3 and 8 are 3T3-L1 RNA during growth phase; lanes 4 and 10 are 3T3-L1 RNA 7 days after the induction of differentiation; lanes 5 and 11 are 3T3-L1 RNA 14 days after the induction of differentiation; and lanes 6 and 12 are mouse brain RNA (control) for mGluR 1 and 3 primers, respectively. (C) The same RNA was amplified by a primer set for megalin. Megalin is expressed in 3T3-L1 at different stage of growth. Mouse kidney RNA was used as control.

290

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

Fig. 7. Pertussis toxin partially restores 3T3-L1 preadipocytes differentiation in response to high [Ca2+]e. Post-confluent 3T3-L1 cells were incubated for 24 h in culture medium containing 100 ng/ml pertussis toxin (PTX) prior to adipogenic induction. Photomicrographs of ORO-stained cells on day 4 after the induction of differentiation are shown (1) 1.8 mmol/l, (2) 2.5 mmol/l, (3) 5.0 mmol/l, and (4) 10.0 mmol/l Ca2+ without PTX. (5) 1.8 mmol/l, (6) 2.5 mmol/l, (7) 5.0 mmol/l, and (8) 10.0 mmol/l with 100 ng/ml PTX. These experiments were performed three times with similar results. Cytoplasmic lipids are stained red. The cells were counterstained with Harris’s hematoxylin, nuclei stained blue/purple. Addition of PTX was able to partially restore lipid filling in cells treated with 5.0 mmol/l Ca2+, but no lipid filling was observed in cells treated with 10.0 mmol/l Ca2+.

significant effect on preadipocyte number during the exponential growth phase, suggesting that the relatively high [Ca2+]e levels were not cytotoxic to the adherent 3T3L1 preadipocytes. Cell cycle analysis of postconfluent mitotic phase 3T3-L1 differentiating cells also revealed that elevation of [Ca2+]e did not affect postconfluent rounds of mitosis in early differentiating 3T3-L1 cells. Our analysis of postconfluent mitotic phase 3T3-L1 cells contrasts with the results of Ntambi and Takova [12] who hypothesized that intracellular Ca2+-mobilizing agents interfered with calcium signaling pathways that support cell division, thus repressing DNA replication. The differences are likely to reflect protocol differences. Ntambi and Takova [12] used Ca2+ ionophore and other chemical agents to augment the cytoplasmic Ca2+; in the current experiments, we merely increased Ca2+ in the extracellular environment. The longterm survival of cells in elevated [Ca2+]e was confirmed using a caspase-3 apoptosis assay. Our results showed that caspase-3 enzyme activity was not significantly different in any of the [Ca2+]e tested. Chronic elevated levels of [Ca2+]i are toxic to most cells [34,35]. We found that increasing [Ca2+]e did not chronically elevate [Ca2+]i. The total pool of Ca2+ released from the intracellular stores by Tg was the same regardless of [Ca2+]e. Furthermore, in our experiments, elevation of [Ca2+]e did not trigger an acute rise in [Ca2+]i. This may explain some of the differences between our results and those previously reported using ionophore. Cells are equipped with machinery to tightly regulate both [Ca2+]e and [Ca2+]i by directional Ca2+ transport across the plasma membrane and across the membranes of intra-

cellular organelles. Our data showed that treatment of 3T3L1 preadipocytes with high [Ca2+]e did not chronically impact [Ca2+]i directly, nor did it lead to an acute [Ca2+]i response. This provides a second line of evidence that the effects of elevating [Ca2+]e are due to a long-term first messenger signaling function rather than a cytotoxic response. The cellular and molecular events that take place during preadipocyte differentiation have been studied extensively [5,7]. C/EBPs and PPARg families of transcription factors are involved in terminal differentiation of adipocytes. Induction of preadipocyte differentiation produces a transient increase in the expression of C/EBPh and C/EBPy, both of which are involved in the activation of PPARg and C/EBPa [5,6,9]. These two transcription factors, C/EBPa and PPARg2, can act individually or in cooperation to modulate adipogenic gene transcription [5,10]. We found that exposure of 3T3-L1 preadipocytes to [Ca2+]e levels higher than 2.5 mmol/l significantly inhibited C/EBPa and PPARg expression. Therefore, it was not surprising to see that GPDH, a gene product responsible for fat accumulation, was reduced in cells cultured in elevated [Ca2+]e. During the late phase of differentiation, adipocytes increase the expression of GPDH. GPDH mRNA expression and GPDH enzyme activity were reduced relative to [Ca2+]e in the culture. Treatment of preadipocyte with high [Ca2+]e (concentrations equal to or greater than 5 mmol/l) prevented lipid accumulation; therefore, it was not surprising that the steady state levels of mRNA encoding GPDH were low.

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

Other transcription factors that were affected by [Ca2+]e treatment include ADD1/SREBP, a key transcription factor that modulates a number of liver genes involved in lipid metabolism and adipocyte differentiation [8,36], and Pref-1, which inhibits adipocyte differentiation [37–39]. Pref-1 is downregulated as 3T3-L1 preadipocytes differentiate, and remains highly expressed in undifferentiated preadipocytes [3]. Our results showed that SREBP-1c expression was reduced in cells grown in [Ca2+]e higher than 2.5 mmol/l, and this level of [Ca2+]e interfered with the normal downregulation of Pref-1 that accompanies 3T3-L1 preadipocytes differentiation. As a result, the cells were able to accumulate little or no lipid. Though the experimental methods and the mechanism(s) of Ca2+ action may be different, the results of the present study with elevation of [Ca2+]e on gene expression pattern are in agreement with the results of Neal and Clipstone [40] who found that elevation of [Ca2+]i by calcium ionophore prevented the expression of transcription factors, PPARg and C/EBPa, thus inhibiting adipocyte differentiation. Together, our findings suggest that high [Ca2+]e prevents lipid accumulation by blocking a cascade of events leading to the initiation of the adipogenic program. PTX partially restored the ability of preadipocytes to accumulate lipid. The effects of PTX on differentiation in 3T3-L1 cells further support the notion that [Ca2+]e may be acting as a first messenger via a receptor or a sensor. The dclassicalT parathyroid cell CaSR is a G-protein-coupled receptor; however, we failed to detect CaSR using either RTPCR or immunocytochemistry. The parathyroid CaSR is a member of the seven-transmembrane-spanning receptor superfamily that is linked to phospholipase C and adenylyl cyclase through the heterotrimeric guanine nucleotidebinding regulatory proteins (G-proteins), isoforms Gq and Gi, respectively [41]. In addition to CaSRs, several other Ca2+-sensing protein candidates have been suggested including megalin and the metabotropic glutamate receptors (mGluRs) [22]. We could not detect mGluRs with RT-PCR; however, megalin is expressed in 3T3-L1 preadipocytes. Because megalin does not function through a Gi-mediated pathway [42,43], we suspect that [Ca2+]e is acting through a sensor or a receptor that remains to be identified. This sensor is unlikely to be coupled to release of Ca2+ from internal stores, because transfer of cells to high [Ca2+]e medium did not trigger Ca2+ release. Circulating plasma Ca2+ levels normally range from 2.3 to 2.6 mmol/l [44], although local levels can reach 8–40 mmol/l [45]. The levels of Ca2+ that inhibited preadipocyte differentiation are higher than the general circulating Ca2+ levels; however, the elevated concentrations used in this experiment remain physiologically relevant in the context of local microenvironment. Adipocytes exist in a variety of local microenvironments depending on their anatomical location, and the levels of Ca2+ surrounding them in these sites remain largely unknown. In summary, the results of this study support the notion that the levels of [Ca2+]e are important in regulating

291

adipocyte lipid accumulation. The tendency of elevated [Ca2+]e to impair adipogenesis can be explained, at least in part, by inhibition of the expression of key adipogenic genes. In normal preadipocytes, in vivo fluctuation of local concentrations of Ca2+ around preadipocytes may inhibit their differentiation program by exerting its effects on different adipogenic factors thus controlling adipocyte hypertrophy. Additional in vivo studies are needed to establish if there is a causal association between elevated [Ca2+]e and body fat deposition.

Acknowledgments This work was supported by a grant from the National Institute of Dental and Craniofacial Research (DE 12641) to M.C.F.-C. and supplement (DE 12641-S1) to K.A.A. E.K. received financial support for these studies from the Howard Hughes Medical Institute.

References [1] B.M. Spiegelman, J.S. Flier, Adipogenesis and obesity: rounding out the big picture, Cell 87 (1996) 377 – 389. [2] G. Fruhbeck, J. Gomez-Ambrosi, F.J. Muruzabal, M.A. Burrell, The adipocyte: a model for integration of endocrine and metabolic signaling in energy metabolism regulation, Am. J. Physiol: Endocrinol. Metab. 280 (2001) E827 – E847. [3] F.M. Gregoire, Adipocyte differentiation: from fibroblast to endocrine cell, Exp. Biol. Med. (Maywood) 226 (2001) 997 – 1002. [4] T.L. Visscher, J.C. Seidell, The public health impact of obesity, Annu. Rev. Public Health 22 (2001) 355 – 375. [5] F.M. Gregoire, C.M. Smas, H.S. Sul, Understanding adipocyte differentiation, Physiol. Rev. 78 (1998) 783 – 809. [6] O.A. MacDougald, S. Mandrup, Adipogenesis: forces that tip the scales, Trends Endocrinol. Metab. 13 (2002) 5 – 11. [7] S. Mandrup, M.D. Lane, Regulating adipogenesis, J. Biol. Chem. 272 (1997) 5367 – 5370. [8] E.D. Rosen, B.M. Spiegelman, Molecular regulation of adipogenesis, Annu. Rev. Cell Dev. Biol. 16 (2000) 145 – 171. [9] J.L. Kirkland, T. Tchkonia, T. Pirtskhalava, J. Han, I. Karagiannides, Adipogenesis and aging: does aging make fat go MAD? Exp. Gerontol. 37 (2002) 757 – 767. [10] Z. Wu, E.D. Rosen, R. Brun, S. Hauser, G. Adelmant, A.E. Troy, C. McKeon, G.J. Darlington, B.M. Spiegelman, Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity, Mol. Cell 3 (1999) 151 – 158. [11] C.W. Miller, D.A. Casimir, J.M. Ntambi, The mechanism of inhibition of 3T3-L1 preadipocyte differentiation by prostaglandin F2alpha, Endocrinology 137 (1996) 5641 – 5650. [12] J.M. Ntambi, T. Takova, Role of Ca2+ in the early stages of murine adipocyte differentiation as evidenced by calcium mobilizing agents, Differentiation 60 (1996) 151 – 158. [13] H. Shi, Y.D. Halvorsen, P.N. Ellis, W.O. Wilkison, M.B. Zemel, Role of intracellular calcium in human adipocyte differentiation, Physiol. Genomics 3 (2000) 75 – 82. [14] B.H. Jones, J.H. Kim, M.B. Zemel, R.P. Woychik, E.J. Michaud, W.O. Wilkison, N. Moustaid, Upregulation of adipocyte metabolism by agouti protein: possible paracrine actions in yellow mouse obesity, Am. J. Physiol. 270 (1996) E192 – E196.

292

B. Jensen et al. / Experimental Cell Research 301 (2004) 280–292

[15] B. Xue, N. Moustaid, W.O. Wilkison, M.B. Zemel, The agouti gene product inhibits lipolysis in human adipocytes via a Ca2+-dependent mechanism, FASEB J. 12 (1998) 1391 – 1396. [16] B.L. Black, J.E. Smith, Regulation of goblet cell differentiation by calcium in embryonic chick intestine, FASEB J. 3 (1989) 2653 – 2659. [17] J. Ochieng, Q.S. Tahin, C.C. Booth, J. Russo, Buffering of intracellular calcium in response to increased extracellular levels in mortal, immortal, and transformed human breast epithelial cells, J. Cell. Biochem. 46 (1991) 250 – 254. [18] S. Huang, V.M. Maher, J.J. McCormick, Extracellular Ca2+ stimulates the activation of mitogen-activated protein kinase and cell growth in human fibroblasts, Biochem. J. 310 (Pt 3) (1995) 881 – 885. [19] M. Ruat, M.E. Molliver, A.M. Snowman, S.H. Snyder, Calcium sensing receptor: molecular cloning in rat and localization to nerve terminals, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 3161 – 3165. [20] J. Gogusev, P. Duchambon, B. Hory, M. Giovannini, Y. Goureau, E. Sarfati, T.B. Drueke, Depressed expression of calcium receptor in parathyroid gland tissue of patients with hyperparathyroidism, Kidney Int. 51 (1997) 328 – 336. [21] O. Kifor, F.D. Moore Jr., P. Wang, M. Goldstein, P. Vassilev, I. Kifor, S.C. Hebert, E.M. Brown, Reduced immunostaining for the extracellular Ca2+-sensing receptor in primary and uremic secondary hyperparathyroidism, J. Clin. Endocrinol. Metab. 81 (1996) 1598 – 1606. [22] E.M. Brown, R.J. MacLeod, Extracellular calcium sensing and extracellular calcium signaling, Physiol. Rev. 81 (2001) 239 – 297. [23] E. Mueller, P. Sarraf, P. Tontonoz, R.M. Evans, K.J. Martin, M. Zhang, C. Fletcher, S. Singer, B.M. Spiegelman, Terminal differentiation of human breast cancer through PPAR gamma, Mol. Cell 1 (1998) 465 – 470. [24] J. Han, S.R. Farmer, J.L. Kirkland, B.E. Corkey, R. Yoon, T. Pirtskhalava, Y. Ido, W. Guo, Octanoate attenuates adipogenesis in 3T3-L1 preadipocytes, J. Nutr. 132 (2002) 904 – 910. [25] Y. Oda, C.L. Tu, W. Chang, D. Crumrine, L. Komuves, T. Mauro, P.M. Elias, D.D. Bikle, The calcium sensing receptor and its alternatively spliced form in murine epidermal differentiation, J. Biol. Chem. 275 (2000) 1183 – 1190. [26] L.P. Kozak, J.T. Jensen, Genetic and developmental control of multiple forms of L-glycerol 3-phosphate dehydrogenase, J. Biol. Chem. 249 (1974) 7775 – 7781. [27] L.S. Wise, H. Green, Participation of one isozyme of cytosolic glycerophosphate dehydrogenase in the adipose conversion of 3T3 cells, J. Biol. Chem. 254 (1979) 273 – 275. [28] M. Wahl, M.J. Lucherini, E. Gruenstein, Intracellular Ca2+ measurement with Indo-1 in substrate-attached cells: advantages and special considerations, Cell Calcium 11 (1990) 487 – 500. [29] W. Li, R.L. Duncan, N.J. Karin, M.C. Farach-Carson, 1,25 (OH)2D3 enhances PTH-induced Ca2+ transients in preosteoblasts by activating L-type Ca2+ channels, Am. J. Physiol. 273 (1997) E599 – E605. [30] J.M. Lyons, N.J. Karin, A role for G protein-coupled lysophospholipid receptors in sphingolipid-induced Ca2+ signaling in MC3T3-E1 osteoblastic cells, J. Bone Miner. Res. 16 (2001) 2035 – 2042.

[31] R. Liu, Y. Xu, M.C. Farach-Carson, J.J. Vogel, N.J. Karin, 1,25 dihydroxyvitamin D(3) activates sphingomyelin turnover in ROS17/ 2.8 osteosarcoma cells without sphingolipid-induced changes in cytosolic Ca(2+), Biochem. Biophys. Res. Commun. 273 (2000) 95 – 100. [32] S.H. Yuspa, A.E. Kilkenny, P.M. Steinert, D.R. Roop, Expression of murine epidermal differentiation markers is tightly regulated by restricted extracellular calcium concentrations in vitro, J. Cell Biol. 109 (1989) 1207 – 1217. [33] H. Hennings, D. Michael, C. Cheng, P. Steinert, K. Holbrook, S.H. Yuspa, Calcium regulation of growth and differentiation of mouse epidermal cells in culture, Cell 19 (1980) 245 – 254. [34] B.F. Trump, I.K. Berezesky, The role of cytosolic Ca2+ in cell injury, necrosis and apoptosis, Curr. Opin. Cell Biol. 4 (1992) 227 – 232. [35] B.F. Trump, I.K. Berezesky, Calcium-mediated cell injury and cell death, FASEB J. 9 (1995) 219 – 228. [36] T.F. Osborne, Sterol regulatory element-binding proteins (SREBPs): key regulators of nutritional homeostasis and insulin action, J. Biol. Chem. 275 (2000) 32379 – 32382. [37] S.E. Ross, R.L. Erickson, I. Gerin, P.M. DeRose, L. Bajnok, K.A. Longo, D.E. Misek, R. Kuick, S.M. Hanash, K.B. Atkins, S.M. Andresen, H.I. Nebb, L. Madsen, K. Kristiansen, O.A. MacDougald, Microarray analyses during adipogenesis: understanding the effects of Wnt signaling on adipogenesis and the roles of liver X receptor alpha in adipocyte metabolism, Mol. Cell. Biol. 22 (2002) 5989 – 5999. [38] J.A. Villena, K.H. Kim, H.S. Sul, Pref-1 and ADSF/Resistin: two secreted factors inhibiting adipose tissue development, Horm. Metab. Res. 34 (2002) 664 – 670. [39] H.S. Sul, C. Smas, B. Mei, L. Zhou, Function of Pref-1 as an inhibitor of adipocyte differentiation, Int. J. Obes. Relat. Metab. Disord. 24 (Suppl 4) (2000) S15 – S19. [40] J.W. Neal, N.A. Clipstone, Calcineurin mediates the calcium-dependent inhibition of adipocyte differentiation in 3T3-L1 cells, J. Biol. Chem. 277 (2002) 49776 – 49781. [41] W. Chang, S. Pratt, T.H. Chen, E. Nemeth, Z. Huang, D. Shoback, Coupling of calcium receptors to inositol phosphate and cyclic AMP generation in mammalian cells and Xenopus laevis oocytes and immunodetection of receptor protein by region-specific antipeptide antisera, J. Bone Miner. Res. 13 (1998) 570 – 580. [42] Y. Li, J. Cam, G. Bu, Low-density lipoprotein receptor family: endocytosis and signal transduction, Mol. Neurobiol. 23 (2001) 53 – 67. [43] M.M. Hussain, Structural, biochemical and signaling properties of the low-density lipoprotein receptor gene family, Front Biosci. 6 (2001) D417 – D428. [44] R.A.T. Rhoades, G.A. Tanner (Eds.), Medical Physiology, first ed., Little, Brown and Company, Boston, 1995. [45] I.A. Silver, R.J. Murrills, D.J. Etherington, Microelectrode studies on the acid microenvironment beneath adherent macrophages and osteoclasts, Exp. Cell Res. 175 (1988) 266 – 276.