- Email: [email protected]
High levels of faecal contamination in drinking groundwater and recreational water due to poor sanitation, in the sub-rural neighbourhoods of Kinshasa, Democratic Republic of the Congo
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
International Journal of Hygiene and Environmental Health journal homepage: www.elsevier.com/locate/ijheh
High levels of faecal contamination in drinking groundwater and recreational water due to poor sanitation, in the sub-rural neighbourhoods of Kinshasa, Democratic Republic of the Congo John M. Kayembea, Florian Thevenonb, Amandine Laffitec, Periyasamy Sivalingamc, ⁎ Patience Ngelinkotoa, Crispin K. Mulajid, Jean-Paul Otamongaa, Josué I. Mubedia, John Potéa,c,d, a Université Pédagogique Nationale (UPN), Croisement Route de Matadi et Avenue de la Libération, Quartier Binza/UPN, B.P. 8815 Kinshasa, Democratic Republic of the Congo b WaterLex International Secretariat, 7 Bis Avenue de la Paix, 1202 Geneva, Switzerland c University of Geneva, Faculty of science, Department F.-A. Forel for Environmental and Aquatic Sciences, Institute of Environmental Sciences, 66, Boulevard Carl-Vogt, CH - 1205, Geneva, Switzerland d University of Kinshasa (UNIKIN), Faculty of Science, Department of Chemistry, B.P. 190, Kinshasa XI, Democratic Republic of the Congo
A R T I C L E I N F O
A B S T R A C T
Keywords: Urban river contamination Shallow well drinking water Hygiene and water quality Human faecal contamination Tropical condition Human risk
In many urban and peri-urban areas of developing countries, shallow wells and untreated water from urban rivers are used for domestic purposes, including drinking water supply, population bathing and irrigation for urban agriculture. The evaluation and monitoring of water quality are therefore necessary for preventing potential human risk associated with the exposure to contaminated water. In this study, physicochemical and bacteriological parameters were assessed in an urban river (named Kokolo Canal/Jerusalem River) draining the municipality of Lingwala (City of Kinshasa, Democratic Republic of the Congo) and in two shallow wells used as drinking water supplies, during the wet and dry seasons in order to estimate the seasonal variation of contamination. The faecal indicator bacteria (FIB) isolated strains (Escherichia coli (E. coli) and Enterococcus (ENT)) from water and surface sediment, were characterized for human-specific bacteroides by molecular approach. The results revealed very high faecal contamination of water from the shallow wells, and of water and sediments from the river, during both wet and dry seasons. During the wet season, E. coli reached the values of 18.6 × 105 and 4.9 × 105 CFU 100 mL−1 in Kokolo Canal and shallow wells, respectively; and Enterococcus reached the values of 7.4 × 104 and 2.7 × 104 CFU 100 mL−1. Strong mutually positive correlation was observed between E. coli and ENT, with the range of R-value being 0.93 < r < 0.97 (p-value < 0.001, n = 15). The PCR assays for human-specific Bacteroides indicated that more than 98% of 500 isolated FIB strains were of human origin, pointing out the effect of poor household sanitation practices on surface water but also on groundwater contamination. The water samples from the shallow wells and Kokolo Canal were highly polluted with faecal matter in both seasons. However, the pollution level was significantly higher during the wet season compared to the dry season. Physicochemical analysis revealed also very high water electrical conductivity, with values much higher than the recommended limits of the World Health Organization guideline for drinking water. These results highlight the potential human health risk associated with the exposure to water contamination from shallow wells and Kokolo Canal, due to the very high level of human FIB. Rapid, unplanned and uncontrolled population growth in the city of Kinshasa is increasing considerably the water demand, whereas there is a dramatic lack of appropriate sanitation and wastewater facilities, as well as of faecal sludge (and solid waste) management and treatment. The lack of hygiene and the practice of open defecation is leading to the degradation of water quality, consequently the persistence of waterborne diseases in the neighbourhoods of sub-rural municipalities, and there is a growing threat to the sustainability to water resources and water quality. The results of this study should encourage municipality policy and strategy on increasing the access to safely managed sanitation services; in order to better protect surface water and groundwater sources, and limit the proliferation of epidemics touching regularly the city.
⁎ Corresponding author at: University of Geneva, Faculty of Sciences, Earth and Environmental Sciences, Department F.-A. Forel for Environmental and Aquatic Sciences, Bd Carl-Vogt 66, CH-1205, Geneva, Switzerland. E-mail address: [email protected] (J. Poté).
https://doi.org/10.1016/j.ijheh.2018.01.003 Received 30 November 2017; Received in revised form 8 January 2018; Accepted 8 January 2018 1438-4639/ © 2018 Elsevier GmbH. All rights reserved.
Please cite this article as: M. Kayembe, J., International Journal of Hygiene and Environmental Health (2018), https://doi.org/10.1016/j.ijheh.2018.01.003
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
1. Introduction
variation of water quality from the Kokolo Canal (KC) and from two shallow wells. The KC is one of important river sources of Kinshasa City for urban agricultural irrigation, recreational activities, fishing and domestic purposes. It receives the untreated urban and hospital effluent waters and serves as sources of domestic purpose, including bathing, but also irrigation for urban agriculture. The shallow wells located at the vicinity of KC are serving for domestic use including drinking, cooking and washing. The water quality assessment is based on (i) the quantification of water physicochemical parameters including pH, electrical conductivity (EC) and dissolved oxygen (O2), (ii) the quantification of FIB including E. coli and ENT in water and sediment, and (iii) the characterization of the isolated FIB strains by molecular approach, in order to identify the source of water contamination.
The 2030 Agenda which was one of the outcomes from the Rio +20 conference of 2012, and the adoption of Sustainable Development Goals (SDGs) by all member states of the United Nations in 2015, dedicated a goal to water and sanitation (SDG 6) with its first Target (6.1) focusing on the universal and equitable access to safe and affordable drinking water for all (UN-Water, 2016). There is also an urgent need for increasing the access to adequate and equitable sanitation and hygiene and end open defecation (Target 6.2), not only for human dignity, but also for protecting the quality of natural drinking water sources that are frequently contaminated by faecal pathogens. In order to improve the ambient water quality, which is essential to protect human health (and ecosystem health), the SDG 6 framework entails halving the proportion of wastewater generated by households (and all economic activities) that is untreated, and substantially increasing recycling and safe reuse globally (Target 6.3). There is however, a major concern with respect to the quality of drinking water in rapidly developing mega-cities of low and middleincome countries, where people are drinking untreated surface water and groundwater. Many urban rivers are heavily polluted due to the large discharge of untreated domestic, hospital and industrial effluents, the frequent presence of landfills near the river banks, and poultry farming manure (Laffite et al., 2016). Moreover, the data concerning the occurrence of pathogenic organisms in these aquatic environments are very limited (Rochelle-Newall et al., 2015; Rodriguez-Alvareza et al., 2015; Nienie et al., 2017a,b). Due to the economic situation and to the lack of effective water treatment infrastructure in many regions of developing countries, peoples are directly using contaminated water from rivers, shallow wells, boreholes, springs and streams for irrigation, domestic and drinking purposes; which has the potential to significantly impact human health (Mubedi et al., 2013; Tshibanda et al., 2014; Mwanamoki et al., 2015; Kapembo et al., 2016; Laffite et al., 2016; Martínez-Santos et al., 2018). According to the WHO/UNICEF Joint Monitoring Program (JMP) for Water Supply, Sanitation and Hygiene (WHO/UNICEF, 2017) which is used to monitor international progress in access to drinking water, sanitation and hygiene, in 2015, i) 29% of the global population (2.1 billion people) lacked “safely managed drinking water” (meaning water at home, available, and safe); and ii) 61% of the global population (4.5 billion people) lacked “safely managed sanitation” (meaning access to a toilet or latrine that leads to treatment or safe disposal of excreta). In the Democratic Republic of the Congo (DRC), with an estimated population of about 70 million inhabitants and despite the potential of its rich freshwater resources, more than 75% of the population have no access to in-home piped water (UNEP, 2011). At a national level, Water, Sanitation and Hygiene (WASH) access in DRC lags behind most of subSaharan Africa, with 47% of the population using unimproved sanitation facilities, 36% of the population using unimproved drinking water services, and 84% of the population using no hygiene facilities (i.e., handwashing facilities with soap and water) (WHO/UNICEF, 2017). Moreover, 16% of the rural population is using surface water as drinking water source (i.e., rivers, streams, wells, and springs). The evaluation of water quality from natural sources is still very limited in DRC due to the absence of national and state's water quality monitoring system. The evaluation of the microbiological quality of natural water (rivers and lakes) can be performed in both water and surface sediments, in order to assess seasonal and inter-annual contamination trends, respectively (Alm et al., 2003; Craig et al., 2004; Lee et al., 2006; Poté et al., 2009). The FIB including E. coli (a subset of the faecal coliform group) and members of the genus Enterococcus (the enterococci (ENT)), are recommended by the US Environmental Protection Agency, the European Environment Agency and the World Health Organization to assess the contamination of water with faecal matter (Haller et al., 2009; Brinkmeyer et al., 2015). The main objective of this research is to assess the seasonal
2. Materials and methods 2.1. Study site description This study was performed in an important urban river, the Kokolo Canal (KC) named Jerusalem River and two shallow wells (P1) and P2, both located near the river. KC is flowing through the urban commune of Lingwala and traversing the military region (named Camp Kokolo) in Kinshasa. Kinshasa is the capital and largest city of the Democratic Republic of the Congo (DRC) (Fig. 1), with an estimated population of about 12 million inhabitants and covering 9′965 km2. Kinshasa has a tropical wet and dry climate. Its length rainy season spans from October through May, and a relatively short dry season occurs between June and September. Daily temperature varies between 25 and 38 °C (during wet season) and 12–18 °C (during dry season). The average annual rainfall is about 124 mm, but it often varies between 2 mm and 250 mm. 2.2. Sampling procedure Water (n = 3) and sediment (n = 3) samples from KC were collected at the same points in April 2017 (wet season) and in July 2017 (dry season). KC water samples were collected manually at 10–50 cm water depth and about 50 cm from the shore, and labelled as KCW1KCW3. Water from shallow wells (n = 2) was taken by a craft device made of 1 L clean polyethylene bottle attached to a rope (Kapembo et al., 2016), and labelled P1 and P2. The water samples (500 mL sealed in clean plastic bottles) were collected in triplicate from each sampling site. While sampling water at each site, three clean plastic bottles of 2 L containing Milli-Q water were kept open to the air to estimate field controls (Nienie et al., 2017b). The KC sediment samples (0–5 cm) were collected at a distance less than 50 cm from the shore and at less than 50 cm water depth. From each sampling point, about 350 g of sediment samples were collected in triplicate using a sterile plastic spoon and transferred into 1.5 L sterile bottles. The sediment samples are labelled KCS1-KCS3. Once taken, the samples were stored in an icebox and transported to the laboratory for analysis within 48 h. The sampling points in the river as well as for the shallow well were selected according to their frequent use for domestic and agricultural purposes (Fig. 2A–D). A referential hospital rejecting untreated effluent water into KC (HOP) has been taken as reference in order to evaluate the possible contribution of this hospital effluent to the river contamination by FIB. For this reason, the water and sediment samples have been taken upstream and downstream to the reject point, and in the hospital effluent outlet pipe (HOP). The samples from HOP are labelled KCW4 and KCS4 for water and sediment, respectively. Sample description and GPS geographical coordinates of sampling sites are presented in Table 1. 2.3. Water physicochemical parameter analysis Water Physicochemical parameters including temperature (T), pH, 2
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Fig. 1. Location map of the study area. A: Location Map of Congo DR in Africa. B: Location Mapof Kinshasa City in Congo DR. C: Location map of studied River (Kokolo Canal) and shallow wells P1 and P2 at Kinshasa, Congo DR.
2.5. Characterization of FIB strains
dissolved oxygen (O2) and electrical conductivity (EC) were measured in situ using a Multi parameter 350i (WTW, Germany).
The characterization of FIB isolated strains was performed as described by Thevenon et al. (2012) and Nienie et al. (2017a,b). Briefly; before PCR human-specific Bacteroides amplification, the genomic profiles of general origin of E. coli and ENT were performed by PCR assays (presence/absence) using specific primers and operational conditions as summarized in Table 2 (Ahmed et al., 2007; Ke et al., 1999; Bernhard and Field, 2000; Morrison et al., 2008; Scott et al., 2005). More than 500 isolated colonies from KC (water and sediment samples), P1 and P2 were selected. The PCR amplification was performed directly on the colonies picked from selective media plates (resuspended in 20 μL of sterile water) using human-specific Bacteroides primers shown in Table 3 with the PCR conditions as described by Thevenon et al. (2012) and Nienie et al. (2017a,b). The experiment was conducted in triplicate for each set of conditions. The negative (without DNA) and positive controls (e.g. 520 bp length expected for HF183/Bac708 from sewage (Poté et al., 2009) were used for each PCR assays.
2.4. Faecal indicator bacteria (FIB) analysis in water and sediment samples The FIB (including E. coli and ENT) were quantified in water samples and sediment supernatants according to the international standard methods for water quality determination using the membrane filtration method (APHA 2005). E. coli and ENT analysis in sediment samples was performed as described by Haller et al. (2009), Poté et al. (2009) and Kilunga et al. (2016). Briefly; the sediments were resuspended by adding 100 g of fresh sediment to 500 mL of 0.2% Na6(PO3)6 in 1 L sterile plastic bottles and mixed for 30 min using the agitator rotary printing-press Watson-Marlow 601 controller (Skan, Switzerland). The mixture was then centrifuged at 4000 rpm (Sigma, 3–16 K) for 15 min at 15 °C. For each sample, triplicates of serially diluted sediment supernatant (100 mL) were used. Water samples and sediment supernatant were then passed through a 0.45 μm filter (47 mm diameter, Millipore, Bedford, USA), and placed on different selective culture media (Biolife Italiana, Milano Italy) supplemented with the anti-fungal compound Nystatin (100 μg mL−1 final concentration), using the following incubation conditions: E. coli: Tryptone Soy Agar (TSA) medium, incubated at 37 °C for 4 h and transferred to Tryptone Bile X-Gluc Agar (TBX) medium at 44 °C for 24 h; ENT: Slanetz Bartley Agar (SBA) medium, incubated at 44 °C for 48 h and transferred into Bile Aesculin Agar (BAA) medium at 44 °C for 4 h. The results were expressed as colony forming units per 100 mL of water (CFU 100 mL−1) or 100 g of fresh sediments (CFU 100 g−1). The reproducibility of the whole experimental procedure was estimated by means of triplicates on selected sediment samples. The sample revealed a mean variation coefficient of 7 and 9% for E. coli and ENT respectively.
2.6. Data analysis All analyses were conducted in triplicate for each set of conditions. In addition, three plates per dilution were performed for FIB quantification to establish plant count standard deviation. Statistical processing of data (Spearman's Rank-Order Correlation) was performed using SigmaStat 11.0 (Systat Software, Inc., USA).
3
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Fig. 2. Photos taken by John Kayembe in April 2017. A: Bathing, recreational activity in Kokolo Canal; B: Kokolo canal using for domestic purpose; C: Shallow well P1 using for domestic purpose; D: Shallow well P2 using for domestic and agricultural purpose.
3. Results and discussion
Table 1 GPS Location and description of sampling sites. Sampling sites
Sample name
Comment
Latitude
Longitude
Kokolo Canal HOP
KCW1/ KCS1 KCW2/ KCS2 KCW3/ KCS3 KCW4/ KCS4 P1
Upstream
04°20′00.8′’S
015°17′24.6′’E
Reject point
04°20′00.2′’S
015°17′23.1′’E
Downstream
04°19′59.6′’S
015°17′21.6′’E
Hospital outlet pipe About 1000 users About 1300 users
04°20′01.4′’S
015°17′23.4′’E
04°20′01.7” S
015°17′23.9” E
04°20′01.8′’S
015°17′23.0′’E
Shallow well
P2
3.1. Water physicochemical parameters The results of water physicochemical parameters including T, pH, EC, and O2 according to the seasonal variation are presented in Table 3. In Kokolo Canal and HOP, the values during the wet season ranged from 27.4–28.8 °C (T), 7.3–7.4 (pH), 323.0–614.0 μS cm−1 (EC) and 0.2–0.6 mg L−1 (O2) while dry season values ranged from 25.3–27.4 °C (T), 6.6–7.4 (pH), 323–567 μS cm−1 (EC) and 0.2–0.9 mg L−1 (O2). Except for electrical conductivity, there was no significant difference in pH, T and O2 levels according to the seasonal variation (P ˃ 0.05). The EC values varied significantly according to the seasonal variation and sampling sites in KC (P ˂ 0.05). The physicochemical results observed in KC are comparable with our previous studies performed in the region (Mubedi et al., 2013; Tshibanda et al., 2014). In shallow wells, during the wet season, the average values of physicochemical parameters ranged from 27.8–28.2 °C (T), 6.4–6.9 (pH), 543.0–552.0 μS cm−1 (EC), 1.8–2.1 mg L−1 (O2) while the values
KCW1-3 and KCS1-3: Water and sediment samples, respectively from Kokolo Canal. KCW4 and KCS4: water and sediment samples, respectively from hospital outlet pipe (HOP) discharging to the Kokolo Canal. P1 and P2: Samples from shallow well.
Table 2 Primers used for PCR amplification of general E. coli and Enterococci, and human-specific bacteroidesa. Primers
Target
Size PCR prod.
Sequence (5′–3′)
Anealing T°(°C)
Reference
ECA75F ECA619R Ent1 Ent2 HF183/134
General E. coli
544
60
Sabat et al. (2000)
General Enterococci
112
55/49
Ke et al. (1999)/Morrison et al. 2008)
human HF183 human HF134
520
GGAAGAAGCTTGCTTCTTTGCTGAC AGCCCGGGGATTTCACATCTGACTTA TACTGACAAACCATTCATGATG AACTTCGTCACCAACGCGAAC ATCATGAGTTCACATGTCCG ATCARGTCACATGTCCCG CAATCGGAGTTCTTCGTG ATCARGTCACATGTCCCG
59
Bernhard and Field (2000)/Ahmed et al. (2007)
Bac708R
570
a The operational conditions for PCR amplification were carried out according to the published methods (references in this Table with minor modification Thevenon et al. (2012); Tshibanda et al. (2014); Kilunga et al. (2016)).
4
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Table 3 Physicochemical parameters of water samples from Kokolo Canal and wells (P1 and P2) during the wet season (Wet) and dry season (Dry). Sampling sites
Kokolo Canal
HOP Minimum Maximum Shallow wells
Sample name
KCW1 KCW2 KCW3 KCW4
P1 P2
T°C
pH
O2 (mg L−1)
Cond. (μS cm-1)
Wet
Dry
Wet
Dry
Wet
Dry
Wet
Dry
27.4 28.0 28.8 28.2 27.4 28.8 28.2 27.8
27.4 26.0 26.4 25.3 25.3 27.4 25.8 25.3
7.4 7.3 7.3 7.3 7.3 7.4 6.4 6.9
7.4 6.8 7.1 6.6 6.6 7.4 5.7 6.1
323.0 401.0 533.0 614.0 323.0 614.0 543.0 552.0
323.0 458.0 567.0 325.0 323.0 567.0 527.0 568
0.5 0.3 0.2 0.6 0.2 0.6 1.8 2.1
0.5 0.2 0.3 0.9 0.3 0.9 3.3 2.9
of 25.3–25.8 (T), 5.7–6.1 (pH), 527.0–568.0 μS cm−1 (EC) and 2.9–3.3 mg L−1 (O2) were observed during the dry season. Except for the EC, the values of physicochemical parameters in P1 and P2 comply within WHO recommendation for drinking water (WHO, 2011) and are comparable with other published data obtained under tropical conditions (Pritchard et al., 2008; Nola et al., 2013; Nienie et al., 2017b). In P1, the EC reach the values of 543 and 527 μS cm−1 during the wet and dry season, respectively, while in P2 the value of 552 and 568 μS cm−1 were observed during the wet and dry season, respectively. These EC values in P1 and P2 are higher than the limit recommended by WHO. However, the EC values from P1 and P2 are lower than the values found by Kapembo et al. (2016), showing the high values of conductivity in shallow wells from municipality of Bumbu, city of Kinshasa. The authors found the values ranging from 618 to 1547 and from 605 to 1121 μS cm−1 during the dry and wet season, respectively.
very preoccupants. These results also indicate that the single analysis of water quality could underestimate the risk of exposure to potentially pathogenic microorganisms in recreational waters (Craig et al., 2002; Lee et al., 2006; Poté et al., 2009). It has been furthermore demonstrated that sediments may contain 100–1000 times as many FIB as the overlying water, and FIB can survive longer in sediments than in the water column, as sediments provide favourable conditions for their proliferation and growth (Davies et al., 1995; Poté et al., 2009). Resuspension of FIB and pathogens from the sediments to the water column can occur during the recreational activities and may contribute to potential human health risk (Craig et al., 2004; Haller et al., 2009). Therefore, the high levels of FIB found in the KC sediments may cause considerable water failures and children risks during bathing (Fig. 2A). Water and sediment samples from the hospital outlet pipe (HOP) discharging to the Kokolo Canal present high concentration of FIB during both, wet and dry season. Concerning the water, during the wet season, the values ranged from (1.7–2.6) × 105 and (1.3–3.7) × 105 CFU 100 mL−1 for E. coli and ENT respectively. During the dry season, the values ranged from (0.4–2.1) × 105 and (0.9–2.5) × 105 CFU 100 mL−1 for E. coli and ENT respectively. Additionally, in sediment samples during the wet season, the values ranged from (7.5–12.4) × 105 and (12.4–48.4) × 105 CFU 100 g−1 for E. coli and ENT respectively. During the dry season, the values ranged from (1.8–14.8) × 105 and (8.8–39.6) × 105 CFU 100 g−1 for E. coli and ENT respectively (Table 4). These values are lowers than those found in water and sediment upstream of the river, indicating that the hospital effluent cannot be considered as an exclusive source of river contamination by faecal material. The urban canal pollution could be rather explained by possible multiple sources, especially inadequate sanitation and open defecation practices, and urban and agricultural runoff (Mwanamoki et al., 2015; Laffite et al., 2016; Kilunga et al., 2016).
3.2. River microbiological quality The variation faecal indicator bacteria (FIB) levels in water and sediment samples from Kokolo Canal (KC) are presented in Fig. 4. Water samples from all sampled sites showed highly level of FIB which varied significantly according to sampling sites and seasonal variation (P ˂ 0.05). The FIB levels in water samples from the KC recorded during the wet season ranged from (1.8–18.6) × 105 and (1.3–7.4) × 104 CFU 100 mL−1 for E. coli and ENT, respectively. On other hand, the FIB values recorded in the dry ranged from (1.1–6.8) × 105 and (0.9–4.7) × 104 CFU 100 mL−1 for E. coli and ENT, respectively. These results indicate that studied river is substantially polluted with faecal matter with FIB concentrations exceeded the limits for bathing water according to both European Directive (EU, Directive 2006/7/CE) and WHO guidelines for domestic use water. According to the European Directive 2006/7/CE concerning the management of bathing water quality, recreational waters are to be classified as poor, if concentrations of E. coli exceed 900 CFU 100 mL−1 and concentrations of ENT exceed 330 CFU 100 mL−1, based upon a 90–percentile evaluation (Haller et al., 2009). By comparison, the FIB in KC water largely exceeded the legal limits for the microbial quality and the contamination of bathing waters according to the WHO regulation. The sediments from KC present relatively similar high concentrations of FIB during both, wet and dry seasons, because the microbiological (and geochemical) composition of the surface sediments does not vary quickly like the composition of water – but rather represents the inter-annual composition of the water. The FIB values in sediment samples from KC recorded during the wet season ranged from (1.1–33.2) × 105 and (8.4–59.7) × 105 CFU 100 mL−1 for E. coli and ENT, respectively. In addition, the FIB concentrations in sediment samples recorded in the dry season ranged from (2.4–62.8) × 105 and (7.7–53.4) × 105 CFU 100 g−1 for E. coli and ENT, respectively (Table 4). Although there are no health standards to evaluate the contamination of sediment by FIB, according to several researches, the present level of contamination of river sediments can be considered as
3.3. Microbiological quality of water from wells The microbial analysis of the investigated shallow wells showed a high contamination of water by faecal material during both dry and wet season (Fig. 4). During the wet season, the FIB values ranged from (0.3–4.9) × 105 and (0.3–2.7) × 105 CFU 100 mL−1 for E. coli and ENT, respectively; while during dry season the values ranged from (0.2–1.5) × 105 and (0.2–0.8) × 105 CFU 100 mL−1 for E. coli and ENT, respectively. Interestingly and as previously suggested by the authors in a similar environment, the results of this study showed that the concentration of E. coli and ENT in shallow wells during the wet season could increase by 2–3 orders of magnitude compared to those measured during the dry season (Kapembo et al., 2016; Kilunga et al., 2016; Nienie et al., 2017a,b). Such increasing contamination by faecal bacteria during the wet season may result from the higher runoff and from the overflow of onsite sanitation systems (e.g. pit latrines and septic tanks) into urban drains. The higher concentration of FIB in water indicate the potential presence of pathogenic organisms responsible for 5
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Table 4 Average of Escherichia coli and Enterococcus quantification in water and sediment samples from river (Kokolo Canal) and shallow wells (drinking water) during the wet and dry seasons. Sampleb
KCW1/KCS1 KCW2/KCS2 KCW3/KCS3 KCW4/KCS4 P1 P2
Watera
Min. Max. Min. Max. Min. Max. Min. Max. Min. Max. Min. Max.
Sediment
E. coli (CFU ± SD) x 105 100 mL−1
ENT (CFU ± SD) x 104 100 mL−1
E. coli (CFU ± SD) x 105100 g−1
ENT (CFU ± SD) x 105100 g−1
Wet
Dry
Wet
Wet
Dry
Wet
Dry
3.2 ± 1.8 9.5 ± 2.6 1.8 ± 0.7 5.7 ± 0.3 4.5 ± 0.4 18.6 ± 5.8 1.7 ± 0.7 2.6 ± 1.3 0.3 ± 0.1 1.8 ± 1.1 0.5 ± 0.2 4.9 ± 0.6
1.4 3.7 1.1 2.6 3.9 6.8 0.4 2.1 0.2 0.7 0.8 1.5
1.1 ± 0.7 33.2 ± 12.4 0.2 ± 0.1 27.5 ± 6.7 0.9 ± 0.6 0.3 ± 0.1 7.5 ± 1.3 12.4 ± 2.6 n.a n.a n.a n.a
2.4 ± 1.3 41.5 ± 12.3 3.7 ± 0.3 33.4 ± 7.8 2.1 ± 0.7 62.8 ± 16.8 1.8 ± 0.5 14.8 ± 3.6 n.a n.a n.a n.a
8.4 ± 2.5 56.0 ± 16.7 16.0 ± 4.8 45.0 ± 11.9 14.1 ± 3.6 59.7 ± 17.2 12.4 ± 4.1 48.4 ± 13.8 n.a n.a n.a n.a
7.7 ± 1.4 44.0 ± 15.8 12.0 ± 1.9 49.0 ± 13.2 13.2 ± 4.1 53.4 ± 15.5 8.8 ± 2.2 39.6 ± 7.4 n.a n.a n.a n.a
± ± ± ± ± ± ± ± ± ± ± ±
0.9 1.8 0.7 1.2 01.3 1.9 0.1 0.5 0.1 0.2 0.2 0.2
2.9 3.8 1.7 4.2 2.8 7.4 1.3 3.7 0.3 0.6 0.3 2.7
Dry ± ± ± ± ± ± ± ± ± ± ± ±
1.4 1.2 0.6 1.8 1.3 2.6 0.8 1.7 0.1 0.2 0.2 0.5
1.7 2.6 0.9 2.7 1.8 4.7 0.9 2.5 0.3 0.5 0.2 0.8
± ± ± ± ± ± ± ± ± ± ± ±
0.5 0.9 0.2 1.2 1.1 1.5 0.2 0.4 0.1 0.3 0.1 0.3
E. coli: Escherichia coli. ENT: Enterococcus. ± SD: Standard deviation. n.a: analysis no performed, no sediments in shallow wells. a WHO guideline for drinking recommends 0 CFU 100 mL−1, for both E. coli and ENT. Recreational waters are classified as poor quality if E. coli levels exceed 900 CFU 100 mL−1 and ENT exceed 330 CFU 100 m L−1. b KCW1-3 and KCS1-3: Water and sediment samples, respectively from Kokolo Canal; KCW4 and KCS4: water and sediment samples, respectively from hospital outlet pipe discharging to the Kokolo Canal; P1 and P2: Water samples from shallow wells.
Fig. 3. Photos taken by John Kayembe in July 2017. A: Pit latrines located in the bank of Kokolo Canal; B: Recreational activity (children playing foot) near Kokolo Canal; C: Children playing in Kokolo canal; D: Children bathing/enjoying in Kokolo Canal after playing foot.
attributed to several potential sources including the lack of hygiene, inadequate sanitation, the lack of safe management of the human waste, the non-protection of wells, the presence of pit latrines located in the proximity of wells, and open defecation practice (Figs. Figure 2C and D and Figure 3A ). As a consequence, the precipitation poses important challenges for Kinshasa’s surface drinking water safety, since the frequency and the intensity of floods is increasing the
water-related diseases such as gastro-intestinal illnesses, typhoid, cholera, and other diarrhoeal diseases (Noble et al., 2004; Davis et al., 2005). These diseases are recurrent and persistence in the peri-urban communes of Kinshasa City which are characterized by low economic status (Kapembo et al., 2016). As demonstrated in our previous studies performed in similar context (Nienie et al., 2017a,b; Kilunga et al., 2016), the pollution of KC and in the investigated wells can be 6
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Fig. 4. Average of Escherichia coli and Enterococcus quantification in water and sediment samples from river (Kokolo Canal), Hospital Outlet Pipe and shallow wells (P1 and P2) during the wet and dry seasons*.
3.4. Characterization of faecal indicator bacteria
contamination of natural water sources by excreta, thus creating additional health risks for the urban population. The results showed that the concentration of FIBs in rivers and wells are higher than 1000 times US EPA recommended concentrations in irrigation water (US EPA, 2004). Intriguingly, the results appear to be a strong recommendation for the further epidemiological study to define the probabilistic dose-effect relationship.
The FIB characterization is very important in order to assess the water contamination by human material and the prevention of human health risk for drinking water or during the recreational activities (Scott et al., 2005; Converse et al., 2009). In this study, qualitative PCR assays was performed for screening of the FIB isolated strains from water and sediment samples. The results are presented in Table 5. More than 500 7
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
considered to originate from common sources and they are carried to the river receiving system as well as in shallow wells by common transporters (Haller et al., 2009; Kilunga et al., 2016; Kapembo et al., 2016).
Table 5 PCR presence/absence assays for detection of human-specific bacteroides in water samples from wells, river and hospital outlet pipe and sediment samples from river (Kokolo Canal). Sampling sites
Sample name
Escherichia coli
Enterococcus
Wet
Wet
4. Conclusion
Kokolo Canal
Shallow wells Hospital out let pipe
KCW1 KCW2 KCW3 KCS1 KCS2 KCS3 P1 P2 KCW4 KCS4
Dry
Dry
NT
NP
NT
NP
NT
NP
NT
NP
15 15 15 17 17 17 28 26 22 16
15 15 15 14 16 17 28 26 22 13
14 14 14 13 13 13 18 18 14 14
14 14 14 13 11 13 18 18 14 8
12 12 12 14 14 14 10 10 n.a n.a
12 12 12 14 14 12 10 10 n.a n.a
9 9 9 9 9 9 10 10 n.a n.a
9 9 9 9 6 8 10 10 n.a n.a
Microbiological analyses of water and sediments samples from shallow wells and Kokolo Canal during the wet season showed that the wells and river are substantially polluted with faecal matter and do not meet the WHO guideline for bathing, drinking and domestic purpose. Interestingly, the highly FIB values observed in water and sediment samples located upstream of the hospital outlet discharges indicate that this hospital cannot be considered as a unique source of deterioration of urban water quality. The pollution of the river by faecal material may be rather explained by several different sources, including open defecation practice, and inadequate wastewater and faecal sludge containment, collection and treatment (e.g., the presence of basic pit latrines located nearby the river and the studied wells). Further detailed analysis, comparing the seasonal fluctuation of faecal contamination with regional precipitation, is therefore recommended to confirm the suggested relationship between the contamination of surface and groundwater sources, and higher urban runoff and groundwater table, respectively. The investigated Kokolo Canal is of particular importance because it constitutes not only an important water supply for urban agriculture and domestic uses, but also for recreational activities of many children (Fig. 3B–D). After their day’s activities, many children are taking bath into this part of the contaminated Kokolo Canal, and are therefore exposed to high potential health hazards (see discussion in 3.2). The microbial contamination of rivers and wells into the urban environment of Kinshasa are overall increasing the potential risks of human infections either by direct uptake (drinking water), by possible source of bacterial contamination in raw vegetables, or by contamination during recreational activities (Kilunga et al., 2016). According to the results of this study, it is strongly recommend to (1) urgently increase the proportion of population using safely managed sanitation services, (2) better protect the river banks, groundwater and shallow wells from faecal contamination, (3) monitor surface water and groundwater quality for faecal contaminants (and priority chemicals like trace metals), and to (4) increase the proportion of wastewater and faecal sludge generated by households (and economic activities) that is safely treated. Such objectives imply massive investment for improving the containment, collection and treatment/reuse of wastewater and faecal sludge. The SDG 6 indicators and monitoring framework (e.g., Targets 6.1, 6.2 and 6.3) can help to develop an adapted implementation strategy and to report on the access to safely managed sanitation and drinking water services; as well as to reduce the persistence and recurrence of epidemics in sub-rural communes of the city of Kinshasa. The method and approach developed in this study can provide a better understanding and assessment of the microbiological pollution of urban water resources in rapidly developing mega-cities of low and middle-income countries; under tropical conditions and in the lack of appropriate wastewater and faecal sludge treatment facilities, hygiene and sanitation systems. Such approach is therefore recommended in similar environment and in city planning process of poor urban and peri-urban communities, to further reduce the faecal contamination of natural sources of (surface and ground) waters that are used by urban dwellers without any treatment.
NT: number of tested colonies, NP: number of positive PCR, n.a: analysis not performed.
isolated strains of E. coli and ENT were screened by PCR amplification using the primers HF183/HF134 for faecal human pollution (humanspecific Bacteroides) as performed in our previous studies (Thevenon et al., 2012; Tshibanda et al., 2014). The results showed that more than 98% of FIB isolated from sediment samples and 100% of strains from water samples in both the wet and dry season seasons were of human origin, consequently the potential human health risks associated with direct use of water from wells and use of river during the recreational activities. The same results were observed in the samples from HOP. Such results should encourage the local authorities to conduct an epidemiological survey in selected exposure groups, in order to further limit the proliferation of epidemics touching regularly the city. Multi stakeholder workshops and awareness campaigns are also recommended, in order to support the government's long-term strategy to substantially increase the access to safely managed sanitation services; as well as to improve the protection of drinking/recreational water sources and the health of crop/vegetable producers and consumers in the peri-urban areas of Kinshasa. 3.5. Correlation between parameters The results of Spearman's Rank-order correlation of data from Kokolo Canal are presented in Table 6. The strong positive mutual correlation (p-value < 0.005) was observed between pH, T, EC, E. coli and ENT in water samples from the KC. The same trend was observed in water samples from P1 and P2 during the wet season showing a strong mutually positive correlation between E. coli and ENT with the range of R-value being 0.93 < r < 0.97 (p-value < 0.001, n = 15). Additionally, water analysis collected from the P1 and P2 in the dry season shown E. coli and ENT with a mutually positive with R-values ranged from 0.87 to 0.98 (p-value < 0.05, n = 15). These results indicate that during both, wet and dry season, the FIB in water samples could be Table 6 Spearman's Rank-Order Correlation of selected parameters* analysed in water samples from Kokolo Canal.
EC pH E. coli ENT T
pH
E. coli
ENT
T
O2
0.837
0.792 0.768
0.867 0.973 0.988
0.691 0.764 0.836 0.763
0.283 0.519 0.735 0.834 0.916
Acknowledgements We are grateful to financial support from the Swiss National Science Foundation (grant no. 31003A_173281/1) and to Swiss Embassy in Kinshasa Democratic Republic of the Congo for supporting the field experimentations via Bumbu Projet. Periyasamy Sivalingam is a
* Analysed parameters include Temperature (T), pH, Electrical conductivity (EC), dissolved oxygen (O2), Escherichia coli (E. coli) and Enterococcus (ENT). Significant coefficients (p < 0.05) are in bold.
8
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Postdoctoral fellow supported by The Dean, Faculty of Science, University of Geneva. This study presents a collaboration between University of Geneva (Forel Department), University of Kinshasa and Pedagogic National University of the Congo (Democratic Republic of the Congo).
supplies. Int. J. Hyg. Environ. Health 220, 1179–1189. Morrison, C., Bachoon, D., Gates, K., 2008. Quantification of enterococci and Bifidobacteria in Georgia estuaries using conventional and molecular methods. Water Res. 42, 4001–4009. Mubedi, J.I., Devarajan, N., Faucheur, S.L., et al., 2013. Effects of untreated hospital effluents on the accumulation of toxic metals in sediments of receiving system under tropical conditions: case of South India and Democratic Republic of Congo. Chemosphere 93, 1070–1076. Mwanamoki, P.M., Devarajan, N., Niane, B., Ngelinkoto, P., et al., 2015. Trace metal distributions in the sediments from river-reservoir systems: case of the Congo River and Lake Ma Vallée, Kinshasa (Democratic Republic of Congo). Environ. Sci. Pollut. Res. 22, 586–597. Nienie, A.B., Periyasamy, S., Laffite, A., Ngelinkoto, P., et al., 2017a. Microbiological quality of water in a city with persistent and recurrent waterborne diseases under tropical sub-rural conditions: the case of Kikwit City, Democratic Republic of the Congo. Int. J. Hyg. Environ. Health 220, 820–828. Nienie, A.B., Sivalingam, P., Laffite, A., Ngelinkoto, P., 2017b. Seasonal variability of water quality by physicochemical indexes and traceable metals in suburban area in Kikwit, Democratic Republic of the Congo. Int. Soil Water Conserv. Res. 5, 158–165. Noble, R.T., Leecaster, M.K., McGee, C.D., Weisberg, S.B., Ritter, K., 2004. Comparison of bacterial indicator analysis methods in stormwater-affected coastal waters. Water Res. 38, 1183–1188. Nola, M., Nougang, M.E., Noah Ewoti, O.V., Moungang, L.M., Krier, F., Chihib, N.E., 2013. Detection of pathogenic Escherichia coli strains in groundwater in the Yaoundé region (Cameroon, Central Africa). Water Environ. J. 27, 328–337. Poté, J., Haller, L., Kottelat, R., Sastre, V., Arpagaus, P., Wildi, W., 2009. Persistence and growth of faecal culturable bacterial indicators in water column and sediments of Vidy Bay, Lake Geneva, Switzerland. J. Environ. Sci. 21, 62–69. Pritchard, M., Mkandawire, T., O’Neill, J.G., 2008. Assessment of groundwater quality in shallow wells within the southern districts of Malawi. Phys. Chem. Earth Part B 33, 812–823. http://dx.doi.org/10.1016/j.pce.2008.06.036. Rochelle-Newall, E., Nguyen, T.M.H., Le, T.P.Q., Sengtaheuanghoung, O., Ribolzi, O., 2015. A short review of fecal indicator bacteria in tropical aquatic ecosystems: knowledge gaps and future directions. Front. Microbiol. 6 (308). http://dx.doi.org/ 10.3389/fmicb.2015.00308. Rodriguez-Alvareza, c.M.S., Weirb, M.H., Popee, J.M., Seghezzoc, L., Rajald, V.B., Salussoa, M.M., Morana, L.B., 2015. Development of a relative risk model for drinking water regulation and design recommendations for a peri urban region of Argentina. Int. J. Hyg. Environ. Health 218, 627–638. Sabat, G., Rose, P., Hickey, W.J., Harkin, J.M., 2000. Selective and sensitive method for PCR amplification of Escherichia coli 16S rRNA genes in soil. Appl. Environ. Microbiol. 66, 844–849. Scott, T.M., Jenkins, T.M., Lukasik, J., Rose, J.B., 2005. Potential use of a host associated molecular marker in Enterococcus faecium as an index of human fecal pollution. Environ. Sci. Technol. 39, 283–287. Thevenon, F., Regier, N., Benagli, C., Tonolla, M., Adatte, T., Wildi, W., Poté, J., 2012. Characterization of faecal indicator bacteria in sediments cores from the largest freshwater lake of Western Europe (Lake Geneva, Switzerland). Ecotoxicol. Environ. Saf. 78, 50–56. Tshibanda, J.B., Devarajan, N., Birane, N., Mwanamoki, P.M., Atibu, E.K., et al., 2014. Microbiological and physicochemical characterization of water and sediment of an urban river: N’Djili River, Kinshasa, Democratic Republic of the Congo. Sustainability 3–4, 47–54. UN-Water, 2016. Integrated Monitoring Guide for SDG 6 Targets and Global Indicators. Version, 19 July 2016. UNEP, 2011. Post-Conflict Environmental Assessment in Democratic Republic of the Congo. Synthesis for Policy Makers. United Nations Environment Programme, Nairobi, Kenya ISBN: 978-92-807-3226-9. US EPA, 2004. U.S. Environmental Protection Agency. http://www.epa.gov/owow/info/ NewsNotes/pdf/73issue.pdf. (Accessed 5 January 2018). WHO (World Health Organization), 2011. Guidelines for Drinking-Water Quality, 4th edition. pp. 541 Geneva, Switzerland. WHO/UNICEF, 2017. Joint Monitoring Program for Water Supply, Sanitation and Hygiene (JMP) – 2017 Update and SDG Baselines.
References Ahmed, W., Stewart, J., Gardner, T., Powell, D., Brooks, P., Sullivan, D., Tindale, N., 2007. Sourcing faecal pollution: a combination of library-dependent and library-independent methods to identify human faecal pollution in non-sewered catchments. Water Res. 41, 3771–3779. Alm, E.W., Burke, J., Spain, A., 2003. Fecal indicator bacteria are abundant in wet sand and freshwater beaches. Water Res. 37, 3978–3982. Bernhard, A.E., Field, K.G., 2000. A PCR assay to discriminate human and ruminant feces on the basis of host differences in bacteroides-Prevotella genes encoding 16S rRNA. Appl. Environ. Microbiol. 66, 4571–4574. Brinkmeyer, R., Amon, R.M.W., Schwarz, J.R., Saxton, T., et al., 2015. Distribution and persistence of Escherichia coli and Enterococci in stream bed and bank sediments from two urban streams in Houston, TX. Sci. Total Environ. 502, 650–658. Converse, R.R., Blackwood, A.D., Kirs, M., Griffith, J.F., Noble, R.T., 2009. Rapid QPCRbased assay for fecal Bacteroides spp. as a tool for assessing fecal contamination in recreational waters. Water Res. 43, 4828–4837. Craig, D.L., Fallowfield, H.J., Cromar, N.J., 2002. Enumeration of faecal coliforms from recreational coastal sites: evaluation of techniques for the separation of bacteria from sediments. J. Appl. Microbiol. 93, 557–565. Craig, D.L., Fallowfield, H.J., Cromar, N.J., 2004. Use of microcosms to determine persistence of Escerichia coli in recreational coastal water and sediment and validation with in situ measurements. J. Appl. Microbiol. 96, 922–930. Davies, C.M., Long, J.A.H., Donald, M., Ashbolt, N., 1995. Survival of fecal microorganisms in marine and freshwater sediments. Appl. Environ. Microbiol. 61, 1888–1896. Davis, K., Anderson, M.A., Yates, M.V., 2005. Distribution of indicator bacteria in Canyon Lake, California. Water Res. 39, 1277–1288. EU, 2006. European Directive 2006/7/CE of the European Parliament and of the Council of 15 February 2006 Concerning the Management of Bathing Water Quality and Repealing Directive 76/160/EEC. Haller, L., Poté, J., Loizeau, J.-L., Wildi, W., 2009. Distribution and survival of faecal indicator bacteria in the sediments of the Bay of Vidy, Lake Geneva, Switzerland. Ecol. Indic. 9, 540–547. Kapembo, M.L., Laffite, A., Bokolo, M.K., Mbanga, A.L., Maya-Vangua, M.M., Otamonga, J.-P., Poté, J., 2016. Evaluation of water quality from suburban shallow wells under tropical conditions according to the seasonal variation, Bumbu, Kinshasa, Democratic Republic of the Congo. Exposure Health 8 (4), 487–496. http://dx.doi.org/10.1007/ s12403-016-0213-y. Ke, D.B., Martineau, F., Menard, C., Picard, F.J., Ménard, C., Roy, P.H., Ouellette, M., Bergeron, M.G., 1999. Development of a PCR assay for rapid detection of enterococci. J. Clin. Microbiol. 37, 3497–3503. Kilunga, P.I., Kayembe, J.M., Laffite, A., Thevenon, F., et al., 2016. The impact of hospital and urban wastewaters on the bacteriological contamination of the water resources in Kinshasa, Democratic Republic of Congo. J. Environ. Sci. Health Part A 51 (12), 1034–1042. Laffite, A., Kilunga, P.I., Kayembe, J.M., Devarajan, N., Mulaji, C.K., et al., 2016. Hospital effluents are one of several sources of metal, antibiotic resistance genes, and bacterial markers disseminated in sub-Saharan urban rivers. Front. Microbiol. 7 (1128). http:// dx.doi.org/10.3389/fmicb.2016.01128. Lee, C.M., Lin, T.Y., Lin, C., Kohbodi, G.A., Bhatt, A., Lee, R., Jay, J.A., 2006. Persistence of fecal indicator bacteria in Santa Monica Bay beach sediments. Water Res. 40, 2593–2602. Martínez-Santos, P., Martín-Loeches, M., García-Castro, N., Solera, D., Díaz-Alcaide, S., Montero, E., García-Rincón, J., 2018. A survey of domestic wells and pit latrines in rural settlements of Mali: implications of on-site sanitation on the quality of water
9
Contents lists available at ScienceDirect
International Journal of Hygiene and Environmental Health journal homepage: www.elsevier.com/locate/ijheh
High levels of faecal contamination in drinking groundwater and recreational water due to poor sanitation, in the sub-rural neighbourhoods of Kinshasa, Democratic Republic of the Congo John M. Kayembea, Florian Thevenonb, Amandine Laffitec, Periyasamy Sivalingamc, ⁎ Patience Ngelinkotoa, Crispin K. Mulajid, Jean-Paul Otamongaa, Josué I. Mubedia, John Potéa,c,d, a Université Pédagogique Nationale (UPN), Croisement Route de Matadi et Avenue de la Libération, Quartier Binza/UPN, B.P. 8815 Kinshasa, Democratic Republic of the Congo b WaterLex International Secretariat, 7 Bis Avenue de la Paix, 1202 Geneva, Switzerland c University of Geneva, Faculty of science, Department F.-A. Forel for Environmental and Aquatic Sciences, Institute of Environmental Sciences, 66, Boulevard Carl-Vogt, CH - 1205, Geneva, Switzerland d University of Kinshasa (UNIKIN), Faculty of Science, Department of Chemistry, B.P. 190, Kinshasa XI, Democratic Republic of the Congo
A R T I C L E I N F O
A B S T R A C T
Keywords: Urban river contamination Shallow well drinking water Hygiene and water quality Human faecal contamination Tropical condition Human risk
In many urban and peri-urban areas of developing countries, shallow wells and untreated water from urban rivers are used for domestic purposes, including drinking water supply, population bathing and irrigation for urban agriculture. The evaluation and monitoring of water quality are therefore necessary for preventing potential human risk associated with the exposure to contaminated water. In this study, physicochemical and bacteriological parameters were assessed in an urban river (named Kokolo Canal/Jerusalem River) draining the municipality of Lingwala (City of Kinshasa, Democratic Republic of the Congo) and in two shallow wells used as drinking water supplies, during the wet and dry seasons in order to estimate the seasonal variation of contamination. The faecal indicator bacteria (FIB) isolated strains (Escherichia coli (E. coli) and Enterococcus (ENT)) from water and surface sediment, were characterized for human-specific bacteroides by molecular approach. The results revealed very high faecal contamination of water from the shallow wells, and of water and sediments from the river, during both wet and dry seasons. During the wet season, E. coli reached the values of 18.6 × 105 and 4.9 × 105 CFU 100 mL−1 in Kokolo Canal and shallow wells, respectively; and Enterococcus reached the values of 7.4 × 104 and 2.7 × 104 CFU 100 mL−1. Strong mutually positive correlation was observed between E. coli and ENT, with the range of R-value being 0.93 < r < 0.97 (p-value < 0.001, n = 15). The PCR assays for human-specific Bacteroides indicated that more than 98% of 500 isolated FIB strains were of human origin, pointing out the effect of poor household sanitation practices on surface water but also on groundwater contamination. The water samples from the shallow wells and Kokolo Canal were highly polluted with faecal matter in both seasons. However, the pollution level was significantly higher during the wet season compared to the dry season. Physicochemical analysis revealed also very high water electrical conductivity, with values much higher than the recommended limits of the World Health Organization guideline for drinking water. These results highlight the potential human health risk associated with the exposure to water contamination from shallow wells and Kokolo Canal, due to the very high level of human FIB. Rapid, unplanned and uncontrolled population growth in the city of Kinshasa is increasing considerably the water demand, whereas there is a dramatic lack of appropriate sanitation and wastewater facilities, as well as of faecal sludge (and solid waste) management and treatment. The lack of hygiene and the practice of open defecation is leading to the degradation of water quality, consequently the persistence of waterborne diseases in the neighbourhoods of sub-rural municipalities, and there is a growing threat to the sustainability to water resources and water quality. The results of this study should encourage municipality policy and strategy on increasing the access to safely managed sanitation services; in order to better protect surface water and groundwater sources, and limit the proliferation of epidemics touching regularly the city.
⁎ Corresponding author at: University of Geneva, Faculty of Sciences, Earth and Environmental Sciences, Department F.-A. Forel for Environmental and Aquatic Sciences, Bd Carl-Vogt 66, CH-1205, Geneva, Switzerland. E-mail address: [email protected] (J. Poté).
https://doi.org/10.1016/j.ijheh.2018.01.003 Received 30 November 2017; Received in revised form 8 January 2018; Accepted 8 January 2018 1438-4639/ © 2018 Elsevier GmbH. All rights reserved.
Please cite this article as: M. Kayembe, J., International Journal of Hygiene and Environmental Health (2018), https://doi.org/10.1016/j.ijheh.2018.01.003
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
1. Introduction
variation of water quality from the Kokolo Canal (KC) and from two shallow wells. The KC is one of important river sources of Kinshasa City for urban agricultural irrigation, recreational activities, fishing and domestic purposes. It receives the untreated urban and hospital effluent waters and serves as sources of domestic purpose, including bathing, but also irrigation for urban agriculture. The shallow wells located at the vicinity of KC are serving for domestic use including drinking, cooking and washing. The water quality assessment is based on (i) the quantification of water physicochemical parameters including pH, electrical conductivity (EC) and dissolved oxygen (O2), (ii) the quantification of FIB including E. coli and ENT in water and sediment, and (iii) the characterization of the isolated FIB strains by molecular approach, in order to identify the source of water contamination.
The 2030 Agenda which was one of the outcomes from the Rio +20 conference of 2012, and the adoption of Sustainable Development Goals (SDGs) by all member states of the United Nations in 2015, dedicated a goal to water and sanitation (SDG 6) with its first Target (6.1) focusing on the universal and equitable access to safe and affordable drinking water for all (UN-Water, 2016). There is also an urgent need for increasing the access to adequate and equitable sanitation and hygiene and end open defecation (Target 6.2), not only for human dignity, but also for protecting the quality of natural drinking water sources that are frequently contaminated by faecal pathogens. In order to improve the ambient water quality, which is essential to protect human health (and ecosystem health), the SDG 6 framework entails halving the proportion of wastewater generated by households (and all economic activities) that is untreated, and substantially increasing recycling and safe reuse globally (Target 6.3). There is however, a major concern with respect to the quality of drinking water in rapidly developing mega-cities of low and middleincome countries, where people are drinking untreated surface water and groundwater. Many urban rivers are heavily polluted due to the large discharge of untreated domestic, hospital and industrial effluents, the frequent presence of landfills near the river banks, and poultry farming manure (Laffite et al., 2016). Moreover, the data concerning the occurrence of pathogenic organisms in these aquatic environments are very limited (Rochelle-Newall et al., 2015; Rodriguez-Alvareza et al., 2015; Nienie et al., 2017a,b). Due to the economic situation and to the lack of effective water treatment infrastructure in many regions of developing countries, peoples are directly using contaminated water from rivers, shallow wells, boreholes, springs and streams for irrigation, domestic and drinking purposes; which has the potential to significantly impact human health (Mubedi et al., 2013; Tshibanda et al., 2014; Mwanamoki et al., 2015; Kapembo et al., 2016; Laffite et al., 2016; Martínez-Santos et al., 2018). According to the WHO/UNICEF Joint Monitoring Program (JMP) for Water Supply, Sanitation and Hygiene (WHO/UNICEF, 2017) which is used to monitor international progress in access to drinking water, sanitation and hygiene, in 2015, i) 29% of the global population (2.1 billion people) lacked “safely managed drinking water” (meaning water at home, available, and safe); and ii) 61% of the global population (4.5 billion people) lacked “safely managed sanitation” (meaning access to a toilet or latrine that leads to treatment or safe disposal of excreta). In the Democratic Republic of the Congo (DRC), with an estimated population of about 70 million inhabitants and despite the potential of its rich freshwater resources, more than 75% of the population have no access to in-home piped water (UNEP, 2011). At a national level, Water, Sanitation and Hygiene (WASH) access in DRC lags behind most of subSaharan Africa, with 47% of the population using unimproved sanitation facilities, 36% of the population using unimproved drinking water services, and 84% of the population using no hygiene facilities (i.e., handwashing facilities with soap and water) (WHO/UNICEF, 2017). Moreover, 16% of the rural population is using surface water as drinking water source (i.e., rivers, streams, wells, and springs). The evaluation of water quality from natural sources is still very limited in DRC due to the absence of national and state's water quality monitoring system. The evaluation of the microbiological quality of natural water (rivers and lakes) can be performed in both water and surface sediments, in order to assess seasonal and inter-annual contamination trends, respectively (Alm et al., 2003; Craig et al., 2004; Lee et al., 2006; Poté et al., 2009). The FIB including E. coli (a subset of the faecal coliform group) and members of the genus Enterococcus (the enterococci (ENT)), are recommended by the US Environmental Protection Agency, the European Environment Agency and the World Health Organization to assess the contamination of water with faecal matter (Haller et al., 2009; Brinkmeyer et al., 2015). The main objective of this research is to assess the seasonal
2. Materials and methods 2.1. Study site description This study was performed in an important urban river, the Kokolo Canal (KC) named Jerusalem River and two shallow wells (P1) and P2, both located near the river. KC is flowing through the urban commune of Lingwala and traversing the military region (named Camp Kokolo) in Kinshasa. Kinshasa is the capital and largest city of the Democratic Republic of the Congo (DRC) (Fig. 1), with an estimated population of about 12 million inhabitants and covering 9′965 km2. Kinshasa has a tropical wet and dry climate. Its length rainy season spans from October through May, and a relatively short dry season occurs between June and September. Daily temperature varies between 25 and 38 °C (during wet season) and 12–18 °C (during dry season). The average annual rainfall is about 124 mm, but it often varies between 2 mm and 250 mm. 2.2. Sampling procedure Water (n = 3) and sediment (n = 3) samples from KC were collected at the same points in April 2017 (wet season) and in July 2017 (dry season). KC water samples were collected manually at 10–50 cm water depth and about 50 cm from the shore, and labelled as KCW1KCW3. Water from shallow wells (n = 2) was taken by a craft device made of 1 L clean polyethylene bottle attached to a rope (Kapembo et al., 2016), and labelled P1 and P2. The water samples (500 mL sealed in clean plastic bottles) were collected in triplicate from each sampling site. While sampling water at each site, three clean plastic bottles of 2 L containing Milli-Q water were kept open to the air to estimate field controls (Nienie et al., 2017b). The KC sediment samples (0–5 cm) were collected at a distance less than 50 cm from the shore and at less than 50 cm water depth. From each sampling point, about 350 g of sediment samples were collected in triplicate using a sterile plastic spoon and transferred into 1.5 L sterile bottles. The sediment samples are labelled KCS1-KCS3. Once taken, the samples were stored in an icebox and transported to the laboratory for analysis within 48 h. The sampling points in the river as well as for the shallow well were selected according to their frequent use for domestic and agricultural purposes (Fig. 2A–D). A referential hospital rejecting untreated effluent water into KC (HOP) has been taken as reference in order to evaluate the possible contribution of this hospital effluent to the river contamination by FIB. For this reason, the water and sediment samples have been taken upstream and downstream to the reject point, and in the hospital effluent outlet pipe (HOP). The samples from HOP are labelled KCW4 and KCS4 for water and sediment, respectively. Sample description and GPS geographical coordinates of sampling sites are presented in Table 1. 2.3. Water physicochemical parameter analysis Water Physicochemical parameters including temperature (T), pH, 2
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Fig. 1. Location map of the study area. A: Location Map of Congo DR in Africa. B: Location Mapof Kinshasa City in Congo DR. C: Location map of studied River (Kokolo Canal) and shallow wells P1 and P2 at Kinshasa, Congo DR.
2.5. Characterization of FIB strains
dissolved oxygen (O2) and electrical conductivity (EC) were measured in situ using a Multi parameter 350i (WTW, Germany).
The characterization of FIB isolated strains was performed as described by Thevenon et al. (2012) and Nienie et al. (2017a,b). Briefly; before PCR human-specific Bacteroides amplification, the genomic profiles of general origin of E. coli and ENT were performed by PCR assays (presence/absence) using specific primers and operational conditions as summarized in Table 2 (Ahmed et al., 2007; Ke et al., 1999; Bernhard and Field, 2000; Morrison et al., 2008; Scott et al., 2005). More than 500 isolated colonies from KC (water and sediment samples), P1 and P2 were selected. The PCR amplification was performed directly on the colonies picked from selective media plates (resuspended in 20 μL of sterile water) using human-specific Bacteroides primers shown in Table 3 with the PCR conditions as described by Thevenon et al. (2012) and Nienie et al. (2017a,b). The experiment was conducted in triplicate for each set of conditions. The negative (without DNA) and positive controls (e.g. 520 bp length expected for HF183/Bac708 from sewage (Poté et al., 2009) were used for each PCR assays.
2.4. Faecal indicator bacteria (FIB) analysis in water and sediment samples The FIB (including E. coli and ENT) were quantified in water samples and sediment supernatants according to the international standard methods for water quality determination using the membrane filtration method (APHA 2005). E. coli and ENT analysis in sediment samples was performed as described by Haller et al. (2009), Poté et al. (2009) and Kilunga et al. (2016). Briefly; the sediments were resuspended by adding 100 g of fresh sediment to 500 mL of 0.2% Na6(PO3)6 in 1 L sterile plastic bottles and mixed for 30 min using the agitator rotary printing-press Watson-Marlow 601 controller (Skan, Switzerland). The mixture was then centrifuged at 4000 rpm (Sigma, 3–16 K) for 15 min at 15 °C. For each sample, triplicates of serially diluted sediment supernatant (100 mL) were used. Water samples and sediment supernatant were then passed through a 0.45 μm filter (47 mm diameter, Millipore, Bedford, USA), and placed on different selective culture media (Biolife Italiana, Milano Italy) supplemented with the anti-fungal compound Nystatin (100 μg mL−1 final concentration), using the following incubation conditions: E. coli: Tryptone Soy Agar (TSA) medium, incubated at 37 °C for 4 h and transferred to Tryptone Bile X-Gluc Agar (TBX) medium at 44 °C for 24 h; ENT: Slanetz Bartley Agar (SBA) medium, incubated at 44 °C for 48 h and transferred into Bile Aesculin Agar (BAA) medium at 44 °C for 4 h. The results were expressed as colony forming units per 100 mL of water (CFU 100 mL−1) or 100 g of fresh sediments (CFU 100 g−1). The reproducibility of the whole experimental procedure was estimated by means of triplicates on selected sediment samples. The sample revealed a mean variation coefficient of 7 and 9% for E. coli and ENT respectively.
2.6. Data analysis All analyses were conducted in triplicate for each set of conditions. In addition, three plates per dilution were performed for FIB quantification to establish plant count standard deviation. Statistical processing of data (Spearman's Rank-Order Correlation) was performed using SigmaStat 11.0 (Systat Software, Inc., USA).
3
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Fig. 2. Photos taken by John Kayembe in April 2017. A: Bathing, recreational activity in Kokolo Canal; B: Kokolo canal using for domestic purpose; C: Shallow well P1 using for domestic purpose; D: Shallow well P2 using for domestic and agricultural purpose.
3. Results and discussion
Table 1 GPS Location and description of sampling sites. Sampling sites
Sample name
Comment
Latitude
Longitude
Kokolo Canal HOP
KCW1/ KCS1 KCW2/ KCS2 KCW3/ KCS3 KCW4/ KCS4 P1
Upstream
04°20′00.8′’S
015°17′24.6′’E
Reject point
04°20′00.2′’S
015°17′23.1′’E
Downstream
04°19′59.6′’S
015°17′21.6′’E
Hospital outlet pipe About 1000 users About 1300 users
04°20′01.4′’S
015°17′23.4′’E
04°20′01.7” S
015°17′23.9” E
04°20′01.8′’S
015°17′23.0′’E
Shallow well
P2
3.1. Water physicochemical parameters The results of water physicochemical parameters including T, pH, EC, and O2 according to the seasonal variation are presented in Table 3. In Kokolo Canal and HOP, the values during the wet season ranged from 27.4–28.8 °C (T), 7.3–7.4 (pH), 323.0–614.0 μS cm−1 (EC) and 0.2–0.6 mg L−1 (O2) while dry season values ranged from 25.3–27.4 °C (T), 6.6–7.4 (pH), 323–567 μS cm−1 (EC) and 0.2–0.9 mg L−1 (O2). Except for electrical conductivity, there was no significant difference in pH, T and O2 levels according to the seasonal variation (P ˃ 0.05). The EC values varied significantly according to the seasonal variation and sampling sites in KC (P ˂ 0.05). The physicochemical results observed in KC are comparable with our previous studies performed in the region (Mubedi et al., 2013; Tshibanda et al., 2014). In shallow wells, during the wet season, the average values of physicochemical parameters ranged from 27.8–28.2 °C (T), 6.4–6.9 (pH), 543.0–552.0 μS cm−1 (EC), 1.8–2.1 mg L−1 (O2) while the values
KCW1-3 and KCS1-3: Water and sediment samples, respectively from Kokolo Canal. KCW4 and KCS4: water and sediment samples, respectively from hospital outlet pipe (HOP) discharging to the Kokolo Canal. P1 and P2: Samples from shallow well.
Table 2 Primers used for PCR amplification of general E. coli and Enterococci, and human-specific bacteroidesa. Primers
Target
Size PCR prod.
Sequence (5′–3′)
Anealing T°(°C)
Reference
ECA75F ECA619R Ent1 Ent2 HF183/134
General E. coli
544
60
Sabat et al. (2000)
General Enterococci
112
55/49
Ke et al. (1999)/Morrison et al. 2008)
human HF183 human HF134
520
GGAAGAAGCTTGCTTCTTTGCTGAC AGCCCGGGGATTTCACATCTGACTTA TACTGACAAACCATTCATGATG AACTTCGTCACCAACGCGAAC ATCATGAGTTCACATGTCCG ATCARGTCACATGTCCCG CAATCGGAGTTCTTCGTG ATCARGTCACATGTCCCG
59
Bernhard and Field (2000)/Ahmed et al. (2007)
Bac708R
570
a The operational conditions for PCR amplification were carried out according to the published methods (references in this Table with minor modification Thevenon et al. (2012); Tshibanda et al. (2014); Kilunga et al. (2016)).
4
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Table 3 Physicochemical parameters of water samples from Kokolo Canal and wells (P1 and P2) during the wet season (Wet) and dry season (Dry). Sampling sites
Kokolo Canal
HOP Minimum Maximum Shallow wells
Sample name
KCW1 KCW2 KCW3 KCW4
P1 P2
T°C
pH
O2 (mg L−1)
Cond. (μS cm-1)
Wet
Dry
Wet
Dry
Wet
Dry
Wet
Dry
27.4 28.0 28.8 28.2 27.4 28.8 28.2 27.8
27.4 26.0 26.4 25.3 25.3 27.4 25.8 25.3
7.4 7.3 7.3 7.3 7.3 7.4 6.4 6.9
7.4 6.8 7.1 6.6 6.6 7.4 5.7 6.1
323.0 401.0 533.0 614.0 323.0 614.0 543.0 552.0
323.0 458.0 567.0 325.0 323.0 567.0 527.0 568
0.5 0.3 0.2 0.6 0.2 0.6 1.8 2.1
0.5 0.2 0.3 0.9 0.3 0.9 3.3 2.9
of 25.3–25.8 (T), 5.7–6.1 (pH), 527.0–568.0 μS cm−1 (EC) and 2.9–3.3 mg L−1 (O2) were observed during the dry season. Except for the EC, the values of physicochemical parameters in P1 and P2 comply within WHO recommendation for drinking water (WHO, 2011) and are comparable with other published data obtained under tropical conditions (Pritchard et al., 2008; Nola et al., 2013; Nienie et al., 2017b). In P1, the EC reach the values of 543 and 527 μS cm−1 during the wet and dry season, respectively, while in P2 the value of 552 and 568 μS cm−1 were observed during the wet and dry season, respectively. These EC values in P1 and P2 are higher than the limit recommended by WHO. However, the EC values from P1 and P2 are lower than the values found by Kapembo et al. (2016), showing the high values of conductivity in shallow wells from municipality of Bumbu, city of Kinshasa. The authors found the values ranging from 618 to 1547 and from 605 to 1121 μS cm−1 during the dry and wet season, respectively.
very preoccupants. These results also indicate that the single analysis of water quality could underestimate the risk of exposure to potentially pathogenic microorganisms in recreational waters (Craig et al., 2002; Lee et al., 2006; Poté et al., 2009). It has been furthermore demonstrated that sediments may contain 100–1000 times as many FIB as the overlying water, and FIB can survive longer in sediments than in the water column, as sediments provide favourable conditions for their proliferation and growth (Davies et al., 1995; Poté et al., 2009). Resuspension of FIB and pathogens from the sediments to the water column can occur during the recreational activities and may contribute to potential human health risk (Craig et al., 2004; Haller et al., 2009). Therefore, the high levels of FIB found in the KC sediments may cause considerable water failures and children risks during bathing (Fig. 2A). Water and sediment samples from the hospital outlet pipe (HOP) discharging to the Kokolo Canal present high concentration of FIB during both, wet and dry season. Concerning the water, during the wet season, the values ranged from (1.7–2.6) × 105 and (1.3–3.7) × 105 CFU 100 mL−1 for E. coli and ENT respectively. During the dry season, the values ranged from (0.4–2.1) × 105 and (0.9–2.5) × 105 CFU 100 mL−1 for E. coli and ENT respectively. Additionally, in sediment samples during the wet season, the values ranged from (7.5–12.4) × 105 and (12.4–48.4) × 105 CFU 100 g−1 for E. coli and ENT respectively. During the dry season, the values ranged from (1.8–14.8) × 105 and (8.8–39.6) × 105 CFU 100 g−1 for E. coli and ENT respectively (Table 4). These values are lowers than those found in water and sediment upstream of the river, indicating that the hospital effluent cannot be considered as an exclusive source of river contamination by faecal material. The urban canal pollution could be rather explained by possible multiple sources, especially inadequate sanitation and open defecation practices, and urban and agricultural runoff (Mwanamoki et al., 2015; Laffite et al., 2016; Kilunga et al., 2016).
3.2. River microbiological quality The variation faecal indicator bacteria (FIB) levels in water and sediment samples from Kokolo Canal (KC) are presented in Fig. 4. Water samples from all sampled sites showed highly level of FIB which varied significantly according to sampling sites and seasonal variation (P ˂ 0.05). The FIB levels in water samples from the KC recorded during the wet season ranged from (1.8–18.6) × 105 and (1.3–7.4) × 104 CFU 100 mL−1 for E. coli and ENT, respectively. On other hand, the FIB values recorded in the dry ranged from (1.1–6.8) × 105 and (0.9–4.7) × 104 CFU 100 mL−1 for E. coli and ENT, respectively. These results indicate that studied river is substantially polluted with faecal matter with FIB concentrations exceeded the limits for bathing water according to both European Directive (EU, Directive 2006/7/CE) and WHO guidelines for domestic use water. According to the European Directive 2006/7/CE concerning the management of bathing water quality, recreational waters are to be classified as poor, if concentrations of E. coli exceed 900 CFU 100 mL−1 and concentrations of ENT exceed 330 CFU 100 mL−1, based upon a 90–percentile evaluation (Haller et al., 2009). By comparison, the FIB in KC water largely exceeded the legal limits for the microbial quality and the contamination of bathing waters according to the WHO regulation. The sediments from KC present relatively similar high concentrations of FIB during both, wet and dry seasons, because the microbiological (and geochemical) composition of the surface sediments does not vary quickly like the composition of water – but rather represents the inter-annual composition of the water. The FIB values in sediment samples from KC recorded during the wet season ranged from (1.1–33.2) × 105 and (8.4–59.7) × 105 CFU 100 mL−1 for E. coli and ENT, respectively. In addition, the FIB concentrations in sediment samples recorded in the dry season ranged from (2.4–62.8) × 105 and (7.7–53.4) × 105 CFU 100 g−1 for E. coli and ENT, respectively (Table 4). Although there are no health standards to evaluate the contamination of sediment by FIB, according to several researches, the present level of contamination of river sediments can be considered as
3.3. Microbiological quality of water from wells The microbial analysis of the investigated shallow wells showed a high contamination of water by faecal material during both dry and wet season (Fig. 4). During the wet season, the FIB values ranged from (0.3–4.9) × 105 and (0.3–2.7) × 105 CFU 100 mL−1 for E. coli and ENT, respectively; while during dry season the values ranged from (0.2–1.5) × 105 and (0.2–0.8) × 105 CFU 100 mL−1 for E. coli and ENT, respectively. Interestingly and as previously suggested by the authors in a similar environment, the results of this study showed that the concentration of E. coli and ENT in shallow wells during the wet season could increase by 2–3 orders of magnitude compared to those measured during the dry season (Kapembo et al., 2016; Kilunga et al., 2016; Nienie et al., 2017a,b). Such increasing contamination by faecal bacteria during the wet season may result from the higher runoff and from the overflow of onsite sanitation systems (e.g. pit latrines and septic tanks) into urban drains. The higher concentration of FIB in water indicate the potential presence of pathogenic organisms responsible for 5
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Table 4 Average of Escherichia coli and Enterococcus quantification in water and sediment samples from river (Kokolo Canal) and shallow wells (drinking water) during the wet and dry seasons. Sampleb
KCW1/KCS1 KCW2/KCS2 KCW3/KCS3 KCW4/KCS4 P1 P2
Watera
Min. Max. Min. Max. Min. Max. Min. Max. Min. Max. Min. Max.
Sediment
E. coli (CFU ± SD) x 105 100 mL−1
ENT (CFU ± SD) x 104 100 mL−1
E. coli (CFU ± SD) x 105100 g−1
ENT (CFU ± SD) x 105100 g−1
Wet
Dry
Wet
Wet
Dry
Wet
Dry
3.2 ± 1.8 9.5 ± 2.6 1.8 ± 0.7 5.7 ± 0.3 4.5 ± 0.4 18.6 ± 5.8 1.7 ± 0.7 2.6 ± 1.3 0.3 ± 0.1 1.8 ± 1.1 0.5 ± 0.2 4.9 ± 0.6
1.4 3.7 1.1 2.6 3.9 6.8 0.4 2.1 0.2 0.7 0.8 1.5
1.1 ± 0.7 33.2 ± 12.4 0.2 ± 0.1 27.5 ± 6.7 0.9 ± 0.6 0.3 ± 0.1 7.5 ± 1.3 12.4 ± 2.6 n.a n.a n.a n.a
2.4 ± 1.3 41.5 ± 12.3 3.7 ± 0.3 33.4 ± 7.8 2.1 ± 0.7 62.8 ± 16.8 1.8 ± 0.5 14.8 ± 3.6 n.a n.a n.a n.a
8.4 ± 2.5 56.0 ± 16.7 16.0 ± 4.8 45.0 ± 11.9 14.1 ± 3.6 59.7 ± 17.2 12.4 ± 4.1 48.4 ± 13.8 n.a n.a n.a n.a
7.7 ± 1.4 44.0 ± 15.8 12.0 ± 1.9 49.0 ± 13.2 13.2 ± 4.1 53.4 ± 15.5 8.8 ± 2.2 39.6 ± 7.4 n.a n.a n.a n.a
± ± ± ± ± ± ± ± ± ± ± ±
0.9 1.8 0.7 1.2 01.3 1.9 0.1 0.5 0.1 0.2 0.2 0.2
2.9 3.8 1.7 4.2 2.8 7.4 1.3 3.7 0.3 0.6 0.3 2.7
Dry ± ± ± ± ± ± ± ± ± ± ± ±
1.4 1.2 0.6 1.8 1.3 2.6 0.8 1.7 0.1 0.2 0.2 0.5
1.7 2.6 0.9 2.7 1.8 4.7 0.9 2.5 0.3 0.5 0.2 0.8
± ± ± ± ± ± ± ± ± ± ± ±
0.5 0.9 0.2 1.2 1.1 1.5 0.2 0.4 0.1 0.3 0.1 0.3
E. coli: Escherichia coli. ENT: Enterococcus. ± SD: Standard deviation. n.a: analysis no performed, no sediments in shallow wells. a WHO guideline for drinking recommends 0 CFU 100 mL−1, for both E. coli and ENT. Recreational waters are classified as poor quality if E. coli levels exceed 900 CFU 100 mL−1 and ENT exceed 330 CFU 100 m L−1. b KCW1-3 and KCS1-3: Water and sediment samples, respectively from Kokolo Canal; KCW4 and KCS4: water and sediment samples, respectively from hospital outlet pipe discharging to the Kokolo Canal; P1 and P2: Water samples from shallow wells.
Fig. 3. Photos taken by John Kayembe in July 2017. A: Pit latrines located in the bank of Kokolo Canal; B: Recreational activity (children playing foot) near Kokolo Canal; C: Children playing in Kokolo canal; D: Children bathing/enjoying in Kokolo Canal after playing foot.
attributed to several potential sources including the lack of hygiene, inadequate sanitation, the lack of safe management of the human waste, the non-protection of wells, the presence of pit latrines located in the proximity of wells, and open defecation practice (Figs. Figure 2C and D and Figure 3A ). As a consequence, the precipitation poses important challenges for Kinshasa’s surface drinking water safety, since the frequency and the intensity of floods is increasing the
water-related diseases such as gastro-intestinal illnesses, typhoid, cholera, and other diarrhoeal diseases (Noble et al., 2004; Davis et al., 2005). These diseases are recurrent and persistence in the peri-urban communes of Kinshasa City which are characterized by low economic status (Kapembo et al., 2016). As demonstrated in our previous studies performed in similar context (Nienie et al., 2017a,b; Kilunga et al., 2016), the pollution of KC and in the investigated wells can be 6
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Fig. 4. Average of Escherichia coli and Enterococcus quantification in water and sediment samples from river (Kokolo Canal), Hospital Outlet Pipe and shallow wells (P1 and P2) during the wet and dry seasons*.
3.4. Characterization of faecal indicator bacteria
contamination of natural water sources by excreta, thus creating additional health risks for the urban population. The results showed that the concentration of FIBs in rivers and wells are higher than 1000 times US EPA recommended concentrations in irrigation water (US EPA, 2004). Intriguingly, the results appear to be a strong recommendation for the further epidemiological study to define the probabilistic dose-effect relationship.
The FIB characterization is very important in order to assess the water contamination by human material and the prevention of human health risk for drinking water or during the recreational activities (Scott et al., 2005; Converse et al., 2009). In this study, qualitative PCR assays was performed for screening of the FIB isolated strains from water and sediment samples. The results are presented in Table 5. More than 500 7
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
considered to originate from common sources and they are carried to the river receiving system as well as in shallow wells by common transporters (Haller et al., 2009; Kilunga et al., 2016; Kapembo et al., 2016).
Table 5 PCR presence/absence assays for detection of human-specific bacteroides in water samples from wells, river and hospital outlet pipe and sediment samples from river (Kokolo Canal). Sampling sites
Sample name
Escherichia coli
Enterococcus
Wet
Wet
4. Conclusion
Kokolo Canal
Shallow wells Hospital out let pipe
KCW1 KCW2 KCW3 KCS1 KCS2 KCS3 P1 P2 KCW4 KCS4
Dry
Dry
NT
NP
NT
NP
NT
NP
NT
NP
15 15 15 17 17 17 28 26 22 16
15 15 15 14 16 17 28 26 22 13
14 14 14 13 13 13 18 18 14 14
14 14 14 13 11 13 18 18 14 8
12 12 12 14 14 14 10 10 n.a n.a
12 12 12 14 14 12 10 10 n.a n.a
9 9 9 9 9 9 10 10 n.a n.a
9 9 9 9 6 8 10 10 n.a n.a
Microbiological analyses of water and sediments samples from shallow wells and Kokolo Canal during the wet season showed that the wells and river are substantially polluted with faecal matter and do not meet the WHO guideline for bathing, drinking and domestic purpose. Interestingly, the highly FIB values observed in water and sediment samples located upstream of the hospital outlet discharges indicate that this hospital cannot be considered as a unique source of deterioration of urban water quality. The pollution of the river by faecal material may be rather explained by several different sources, including open defecation practice, and inadequate wastewater and faecal sludge containment, collection and treatment (e.g., the presence of basic pit latrines located nearby the river and the studied wells). Further detailed analysis, comparing the seasonal fluctuation of faecal contamination with regional precipitation, is therefore recommended to confirm the suggested relationship between the contamination of surface and groundwater sources, and higher urban runoff and groundwater table, respectively. The investigated Kokolo Canal is of particular importance because it constitutes not only an important water supply for urban agriculture and domestic uses, but also for recreational activities of many children (Fig. 3B–D). After their day’s activities, many children are taking bath into this part of the contaminated Kokolo Canal, and are therefore exposed to high potential health hazards (see discussion in 3.2). The microbial contamination of rivers and wells into the urban environment of Kinshasa are overall increasing the potential risks of human infections either by direct uptake (drinking water), by possible source of bacterial contamination in raw vegetables, or by contamination during recreational activities (Kilunga et al., 2016). According to the results of this study, it is strongly recommend to (1) urgently increase the proportion of population using safely managed sanitation services, (2) better protect the river banks, groundwater and shallow wells from faecal contamination, (3) monitor surface water and groundwater quality for faecal contaminants (and priority chemicals like trace metals), and to (4) increase the proportion of wastewater and faecal sludge generated by households (and economic activities) that is safely treated. Such objectives imply massive investment for improving the containment, collection and treatment/reuse of wastewater and faecal sludge. The SDG 6 indicators and monitoring framework (e.g., Targets 6.1, 6.2 and 6.3) can help to develop an adapted implementation strategy and to report on the access to safely managed sanitation and drinking water services; as well as to reduce the persistence and recurrence of epidemics in sub-rural communes of the city of Kinshasa. The method and approach developed in this study can provide a better understanding and assessment of the microbiological pollution of urban water resources in rapidly developing mega-cities of low and middle-income countries; under tropical conditions and in the lack of appropriate wastewater and faecal sludge treatment facilities, hygiene and sanitation systems. Such approach is therefore recommended in similar environment and in city planning process of poor urban and peri-urban communities, to further reduce the faecal contamination of natural sources of (surface and ground) waters that are used by urban dwellers without any treatment.
NT: number of tested colonies, NP: number of positive PCR, n.a: analysis not performed.
isolated strains of E. coli and ENT were screened by PCR amplification using the primers HF183/HF134 for faecal human pollution (humanspecific Bacteroides) as performed in our previous studies (Thevenon et al., 2012; Tshibanda et al., 2014). The results showed that more than 98% of FIB isolated from sediment samples and 100% of strains from water samples in both the wet and dry season seasons were of human origin, consequently the potential human health risks associated with direct use of water from wells and use of river during the recreational activities. The same results were observed in the samples from HOP. Such results should encourage the local authorities to conduct an epidemiological survey in selected exposure groups, in order to further limit the proliferation of epidemics touching regularly the city. Multi stakeholder workshops and awareness campaigns are also recommended, in order to support the government's long-term strategy to substantially increase the access to safely managed sanitation services; as well as to improve the protection of drinking/recreational water sources and the health of crop/vegetable producers and consumers in the peri-urban areas of Kinshasa. 3.5. Correlation between parameters The results of Spearman's Rank-order correlation of data from Kokolo Canal are presented in Table 6. The strong positive mutual correlation (p-value < 0.005) was observed between pH, T, EC, E. coli and ENT in water samples from the KC. The same trend was observed in water samples from P1 and P2 during the wet season showing a strong mutually positive correlation between E. coli and ENT with the range of R-value being 0.93 < r < 0.97 (p-value < 0.001, n = 15). Additionally, water analysis collected from the P1 and P2 in the dry season shown E. coli and ENT with a mutually positive with R-values ranged from 0.87 to 0.98 (p-value < 0.05, n = 15). These results indicate that during both, wet and dry season, the FIB in water samples could be Table 6 Spearman's Rank-Order Correlation of selected parameters* analysed in water samples from Kokolo Canal.
EC pH E. coli ENT T
pH
E. coli
ENT
T
O2
0.837
0.792 0.768
0.867 0.973 0.988
0.691 0.764 0.836 0.763
0.283 0.519 0.735 0.834 0.916
Acknowledgements We are grateful to financial support from the Swiss National Science Foundation (grant no. 31003A_173281/1) and to Swiss Embassy in Kinshasa Democratic Republic of the Congo for supporting the field experimentations via Bumbu Projet. Periyasamy Sivalingam is a
* Analysed parameters include Temperature (T), pH, Electrical conductivity (EC), dissolved oxygen (O2), Escherichia coli (E. coli) and Enterococcus (ENT). Significant coefficients (p < 0.05) are in bold.
8
International Journal of Hygiene and Environmental Health xxx (xxxx) xxx–xxx
J.M. Kayembe et al.
Postdoctoral fellow supported by The Dean, Faculty of Science, University of Geneva. This study presents a collaboration between University of Geneva (Forel Department), University of Kinshasa and Pedagogic National University of the Congo (Democratic Republic of the Congo).
supplies. Int. J. Hyg. Environ. Health 220, 1179–1189. Morrison, C., Bachoon, D., Gates, K., 2008. Quantification of enterococci and Bifidobacteria in Georgia estuaries using conventional and molecular methods. Water Res. 42, 4001–4009. Mubedi, J.I., Devarajan, N., Faucheur, S.L., et al., 2013. Effects of untreated hospital effluents on the accumulation of toxic metals in sediments of receiving system under tropical conditions: case of South India and Democratic Republic of Congo. Chemosphere 93, 1070–1076. Mwanamoki, P.M., Devarajan, N., Niane, B., Ngelinkoto, P., et al., 2015. Trace metal distributions in the sediments from river-reservoir systems: case of the Congo River and Lake Ma Vallée, Kinshasa (Democratic Republic of Congo). Environ. Sci. Pollut. Res. 22, 586–597. Nienie, A.B., Periyasamy, S., Laffite, A., Ngelinkoto, P., et al., 2017a. Microbiological quality of water in a city with persistent and recurrent waterborne diseases under tropical sub-rural conditions: the case of Kikwit City, Democratic Republic of the Congo. Int. J. Hyg. Environ. Health 220, 820–828. Nienie, A.B., Sivalingam, P., Laffite, A., Ngelinkoto, P., 2017b. Seasonal variability of water quality by physicochemical indexes and traceable metals in suburban area in Kikwit, Democratic Republic of the Congo. Int. Soil Water Conserv. Res. 5, 158–165. Noble, R.T., Leecaster, M.K., McGee, C.D., Weisberg, S.B., Ritter, K., 2004. Comparison of bacterial indicator analysis methods in stormwater-affected coastal waters. Water Res. 38, 1183–1188. Nola, M., Nougang, M.E., Noah Ewoti, O.V., Moungang, L.M., Krier, F., Chihib, N.E., 2013. Detection of pathogenic Escherichia coli strains in groundwater in the Yaoundé region (Cameroon, Central Africa). Water Environ. J. 27, 328–337. Poté, J., Haller, L., Kottelat, R., Sastre, V., Arpagaus, P., Wildi, W., 2009. Persistence and growth of faecal culturable bacterial indicators in water column and sediments of Vidy Bay, Lake Geneva, Switzerland. J. Environ. Sci. 21, 62–69. Pritchard, M., Mkandawire, T., O’Neill, J.G., 2008. Assessment of groundwater quality in shallow wells within the southern districts of Malawi. Phys. Chem. Earth Part B 33, 812–823. http://dx.doi.org/10.1016/j.pce.2008.06.036. Rochelle-Newall, E., Nguyen, T.M.H., Le, T.P.Q., Sengtaheuanghoung, O., Ribolzi, O., 2015. A short review of fecal indicator bacteria in tropical aquatic ecosystems: knowledge gaps and future directions. Front. Microbiol. 6 (308). http://dx.doi.org/ 10.3389/fmicb.2015.00308. Rodriguez-Alvareza, c.M.S., Weirb, M.H., Popee, J.M., Seghezzoc, L., Rajald, V.B., Salussoa, M.M., Morana, L.B., 2015. Development of a relative risk model for drinking water regulation and design recommendations for a peri urban region of Argentina. Int. J. Hyg. Environ. Health 218, 627–638. Sabat, G., Rose, P., Hickey, W.J., Harkin, J.M., 2000. Selective and sensitive method for PCR amplification of Escherichia coli 16S rRNA genes in soil. Appl. Environ. Microbiol. 66, 844–849. Scott, T.M., Jenkins, T.M., Lukasik, J., Rose, J.B., 2005. Potential use of a host associated molecular marker in Enterococcus faecium as an index of human fecal pollution. Environ. Sci. Technol. 39, 283–287. Thevenon, F., Regier, N., Benagli, C., Tonolla, M., Adatte, T., Wildi, W., Poté, J., 2012. Characterization of faecal indicator bacteria in sediments cores from the largest freshwater lake of Western Europe (Lake Geneva, Switzerland). Ecotoxicol. Environ. Saf. 78, 50–56. Tshibanda, J.B., Devarajan, N., Birane, N., Mwanamoki, P.M., Atibu, E.K., et al., 2014. Microbiological and physicochemical characterization of water and sediment of an urban river: N’Djili River, Kinshasa, Democratic Republic of the Congo. Sustainability 3–4, 47–54. UN-Water, 2016. Integrated Monitoring Guide for SDG 6 Targets and Global Indicators. Version, 19 July 2016. UNEP, 2011. Post-Conflict Environmental Assessment in Democratic Republic of the Congo. Synthesis for Policy Makers. United Nations Environment Programme, Nairobi, Kenya ISBN: 978-92-807-3226-9. US EPA, 2004. U.S. Environmental Protection Agency. http://www.epa.gov/owow/info/ NewsNotes/pdf/73issue.pdf. (Accessed 5 January 2018). WHO (World Health Organization), 2011. Guidelines for Drinking-Water Quality, 4th edition. pp. 541 Geneva, Switzerland. WHO/UNICEF, 2017. Joint Monitoring Program for Water Supply, Sanitation and Hygiene (JMP) – 2017 Update and SDG Baselines.
References Ahmed, W., Stewart, J., Gardner, T., Powell, D., Brooks, P., Sullivan, D., Tindale, N., 2007. Sourcing faecal pollution: a combination of library-dependent and library-independent methods to identify human faecal pollution in non-sewered catchments. Water Res. 41, 3771–3779. Alm, E.W., Burke, J., Spain, A., 2003. Fecal indicator bacteria are abundant in wet sand and freshwater beaches. Water Res. 37, 3978–3982. Bernhard, A.E., Field, K.G., 2000. A PCR assay to discriminate human and ruminant feces on the basis of host differences in bacteroides-Prevotella genes encoding 16S rRNA. Appl. Environ. Microbiol. 66, 4571–4574. Brinkmeyer, R., Amon, R.M.W., Schwarz, J.R., Saxton, T., et al., 2015. Distribution and persistence of Escherichia coli and Enterococci in stream bed and bank sediments from two urban streams in Houston, TX. Sci. Total Environ. 502, 650–658. Converse, R.R., Blackwood, A.D., Kirs, M., Griffith, J.F., Noble, R.T., 2009. Rapid QPCRbased assay for fecal Bacteroides spp. as a tool for assessing fecal contamination in recreational waters. Water Res. 43, 4828–4837. Craig, D.L., Fallowfield, H.J., Cromar, N.J., 2002. Enumeration of faecal coliforms from recreational coastal sites: evaluation of techniques for the separation of bacteria from sediments. J. Appl. Microbiol. 93, 557–565. Craig, D.L., Fallowfield, H.J., Cromar, N.J., 2004. Use of microcosms to determine persistence of Escerichia coli in recreational coastal water and sediment and validation with in situ measurements. J. Appl. Microbiol. 96, 922–930. Davies, C.M., Long, J.A.H., Donald, M., Ashbolt, N., 1995. Survival of fecal microorganisms in marine and freshwater sediments. Appl. Environ. Microbiol. 61, 1888–1896. Davis, K., Anderson, M.A., Yates, M.V., 2005. Distribution of indicator bacteria in Canyon Lake, California. Water Res. 39, 1277–1288. EU, 2006. European Directive 2006/7/CE of the European Parliament and of the Council of 15 February 2006 Concerning the Management of Bathing Water Quality and Repealing Directive 76/160/EEC. Haller, L., Poté, J., Loizeau, J.-L., Wildi, W., 2009. Distribution and survival of faecal indicator bacteria in the sediments of the Bay of Vidy, Lake Geneva, Switzerland. Ecol. Indic. 9, 540–547. Kapembo, M.L., Laffite, A., Bokolo, M.K., Mbanga, A.L., Maya-Vangua, M.M., Otamonga, J.-P., Poté, J., 2016. Evaluation of water quality from suburban shallow wells under tropical conditions according to the seasonal variation, Bumbu, Kinshasa, Democratic Republic of the Congo. Exposure Health 8 (4), 487–496. http://dx.doi.org/10.1007/ s12403-016-0213-y. Ke, D.B., Martineau, F., Menard, C., Picard, F.J., Ménard, C., Roy, P.H., Ouellette, M., Bergeron, M.G., 1999. Development of a PCR assay for rapid detection of enterococci. J. Clin. Microbiol. 37, 3497–3503. Kilunga, P.I., Kayembe, J.M., Laffite, A., Thevenon, F., et al., 2016. The impact of hospital and urban wastewaters on the bacteriological contamination of the water resources in Kinshasa, Democratic Republic of Congo. J. Environ. Sci. Health Part A 51 (12), 1034–1042. Laffite, A., Kilunga, P.I., Kayembe, J.M., Devarajan, N., Mulaji, C.K., et al., 2016. Hospital effluents are one of several sources of metal, antibiotic resistance genes, and bacterial markers disseminated in sub-Saharan urban rivers. Front. Microbiol. 7 (1128). http:// dx.doi.org/10.3389/fmicb.2016.01128. Lee, C.M., Lin, T.Y., Lin, C., Kohbodi, G.A., Bhatt, A., Lee, R., Jay, J.A., 2006. Persistence of fecal indicator bacteria in Santa Monica Bay beach sediments. Water Res. 40, 2593–2602. Martínez-Santos, P., Martín-Loeches, M., García-Castro, N., Solera, D., Díaz-Alcaide, S., Montero, E., García-Rincón, J., 2018. A survey of domestic wells and pit latrines in rural settlements of Mali: implications of on-site sanitation on the quality of water
9