- Email: [email protected]
High-Resolution Genetic, Physical, and Transcript Map of themnd2Region of Mouse Chromosome 6
GENOMICS
54, 107–115 (1998) GE985496
ARTICLE NO.
High-Resolution Genetic, Physical, and Transcript Map of the mnd2 Region of Mouse Chromosome 6 John S. Weber, Wonhee Jang, Karl Simin, Wei Lu, Jennifer Yu, and Miriam H. Meisler1 Department of Human Genetics, University of Michigan, Ann Arbor, Michigan 48109-0618 Received June 8, 1998; accepted July 28, 1998
The autosomal recessive mutation mnd2 is responsible for a lethal neuromuscular wasting disorder in the mouse. A high-resolution genetic map of the mnd2 region of mouse chromosome 6 was generated by analysis of 1147 F2 offspring from an intersubspecific cross between strains C57BL/6J-mnd2/1 and CAST/Ei. The results localize mnd2 to the 0.2-cM interval between D6Mit164 and D6Mit128. A contig of overlapping YAC, BAC, and P1 clones spanning the nonrecombinant interval was constructed. One novel gene isolated from the contig, D6Mm3e, is a new member of the WD repeat gene family. The observed gene order for the five positional candidate genes previously mapped to the region and five newly isolated genes is centromere–Hexokinase II– D6Mm5e–p62 Dok–Aup1–Rhotekin, D6Mm3e–Dynactin 1–Smooth muscle g actin–D6Mm4e–b-adducin–telomere. Seven of these genes are located within the 400-kb nonrecombinant interval for mnd2. Comparison between wildtype and mutant failed to detect any differences in mRNA size, abundance, or coding sequence for these seven genes. The genes described here are positional candidates for the Parkinson disease susceptibility locus PARK3 that was recently mapped to the corresponding region of human chromosome band 2p13.1. © 1998 Academic Press
INTRODUCTION
mnd2 is an autosomal recessive neuromuscular disorder characterized by muscle atrophy and severe wasting (Jones et al., 1993). We have initiated a positional cloning project to determine the molecular basis of this disorder. mnd2 was originally mapped to the 6-cM interval between D6Mit4 and D6Mit6 on mouse chromosome 6 (Jones et al., 1993). To localize the gene further, we have generated a large intersubspecific cross and characterized 2294 meiotic events. Microsatellite markers were used to construct a physical map of the nonrecombinant region. Genes previously mapped to mouse chromosome 6 or the corresponding region of 1
To whom correspondence should be addressed at Department of Human Genetics, 4708 Medical Science II, University of Michigan, Ann Arbor, MI 48109-0618. Telephone: (313) 763-5546. Fax: (313) 763-9691. E-mail: [email protected].
human chromosome 2p13 have been localized on our genetic and physical map, and several novel genes were isolated. This paper describes the high-resolution genetic map, a set of overlapping clones that span the nonrecombinant interval, and a gene map of the region. We previously reported the mouse cDNA sequences for three genes in the region, Aup1 (Jang et al., 1996), rhotekin (Jang et al., 1997a), and dynactin 1 (Jang et al., 1997b). The PARK3 locus responsible for susceptibility to Parkinson disease was recently mapped to a 10.3-cM interval on human chromosome 2p13 (Gasser et al., 1998). The PARK3 interval overlaps the human chromosome region that corresponds to mnd2 (Bashir et al., 1996), indicating that the genes described here can be considered as candidates for this Parkinson disease locus. MATERIALS AND METHODS Animals. The mnd2 mutation arose in our laboratory on a chromosome derived from strain C57BL/6J (Jones et al., 1993). The mutation is maintained by crossing mnd2/1 heterozygotes to C57BL/6J mice. Generation of the (C57BL/6J-mnd2/1 3 CAST/Ei) F2 mice was carried out as previously described (Jones et al., 1993). The mnd2 genotype of F1 animals was determined by test crossing with known heterozygotes and examining the incidence of affected offspring. The mnd2 genotype of unaffected F2 animals with recombination break points between flanking markers was also determined by test crossing. PCR. Genomic DNA was prepared from tail (Miller et al., 1988; Osborn et al., 1987), toe clip (Popp and Murray, 1991), or other tissues (Jones et al., 1993). Microsatellite markers were analyzed as described by Dietrich et al. (1992, 1994) or by ethidium bromide staining after electrophoresis on 2.5% Metaphor Agarose (FMC Bioproducts) or 3:1 Agarose (Sigma). Genomic DNA (0.05– 0.1 mg) was amplified by PCR in buffer containing 50 mM KCl, 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2, 0.01% gelatin, 0.01% NP-40, 0.01% Tween 20, 200 mM dNTPs, 2 mM DTT, 2 units of Taq polymerase, and 0.33 or 0.5 mM concentrations of each primer. Primers and reaction conditions are described in Table 1. Typical reactions began with 5 cycles at 95°C for 1 min, 50 to 65°C for 15 s, and 72°C for 30 s, followed by 25 to 30 cycles with the time at 72°C reduced to 10 s. Taq polymerase was added at the beginning of the first cycle at 95°C. RFLP analysis. Ten-microgram aliquots of genomic DNA were digested with restriction enzymes, electrophoresed through 1.2 or 0.8% agarose gels, and transferred onto Zetaprobe GT nylon membranes (Bio-Rad). Hybridization probes (Table 2) were labeled with [a-32P]dCTP (Amersham) by random priming. Prehybridization and
107
0888-7543/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.
108
WEBER ET AL.
TABLE 1 PCR Primer Sequences Marker
Primers
D6Mit70-30
Product (bp)
F-CAACCACGGACAGCAACCCATTATTTCTTG R-CCAAGCCTGATGACCTGAATTCATCTCTGG F-ATGTATGAATACTCAGTCACTCTGTTAGGC R-TACATGAACATGCACATATACCACATGCAC F-CACAGTCTCTAATTCACCCCAGCCACTCC R-GATCTGATTAGTGCAGCATGTGTCTTGTCC F-CCTGATGCCACCCTGAGTTTGTATAACTGA R-CTATACACTCTCTCCCCCATGTCCCACAGG F-GATCCATCACCTCCTCTGGTCTCCAC R-GTTCCCTGCTCTCTCCAGTCTTGCC F-AGTGCTTTTACCCAGAGCCAGTTCCCTG R-CTTGACATCATAGCACATCTGGAAAGCC F-AGCAGTGGAGGAGCATTTGG R-CATTAGCTGATGCTTCCAGG F-ACGTGCTCTAGAGTCGACCCAGCA R-CCCCTCGGGAGATCTCCAGGT AGTTCCAGGACAGCCAGGG GCAAGGCGATTAAGTTGGGTAAC AATACGACTCACTATAGGGCGAA TAGAGTCGACCTGCAGGCAT
D6Mit128-30 D6Umi1 D6Umi2 D6Umi3 D6Umi4 E10 EX B1MvsCH 59BAC1 59BAC2 59BAC3
167, (a) 157, (a) 160 435 181 182 135 Clone insert (b)
Note. Reactions were carried out under the standard conditions described under Materials and Methods, with two exceptions: (a) 40 cycles total with addition of 2 units of Taq polymerase after 30 cycles; (b) 94°C for 5 min, 40 cycles of 94°C (10 s), 50°C (30 s), 72°C (60 s), followed by 72°C (5 min).
hybridization were carried out in Church buffer (Church and Gilbert, 1984) for 16 h at 65°C. Filters were washed in 0.13 SSC with 0.1% SDS at 65°C and autoradiographed for 1–7 days. Isolation of YAC clones. YAC libraries from the Whitehead Institute (Kusumi et al., 1993), St. Mary’s Hospital (Chartier et al., 1992), Princeton (Burke et al., 1991), and the NMRI (Larin et al., 1991) were screened by PCR for the nonrecombinant marker D6Mit70 and by hybridization with the IRS-PCR product B1-1 (Table 2). Three YAC clones were isolated by both methods: two unstable clones, 9707 and 110B10, and the chimeric clone 34A10. The Whitehead YAC library was also screened for the flanking markers D6Mit164 and D6Mit128 using newly designed PCR primers (Table 1) that permitted the use of stringent reaction conditions. Isolation of P1 and BAC clones. Two mouse P1 libraries (Sternberg et al., 1994; Pierce et al., 1992) were screened by PCR and hybridization for the markers D6Mit70, D6Umi1, D6Umi2, D6Umi3,
and D6Umi4 (Table 2). Colony lifts and processing of Hybond-N1 nylon filters (Amersham) were carried out as described by Sambrook et al. (1989) and the manufacturer’s instructions. P1 DNA was isolated using a mini-prep protocol from Genome Systems (St. Louis, MO). Optimal yields were obtained from 10-ml cultures grown for 3 to 5 h. A mouse BAC library (Shizuya et al., 1992) was screened at Research Genetics (Huntsville, AL) by hybridization with probe E2 (Table 2). DNA from positive clones was isolated by the alkaline lysis method (Sambrook et al., 1989). Isolation of end clones. YAC end fragments were isolated by homologous recombination (Hermanson et al., 1991). The end fragment E4 from BAC 245c12T was isolated using a modification of the TAIL-PCR method (Liu and Whittier, 1995). For isolation of BAC ends, the degenerate primer AD3 (Liu and Whittier, 1995) was used in primary, secondary, and tertiary PCRs with the new nested primers 59BAC1, 59BAC2, or 59BAC3 complementary to the vector
TABLE 2 Restriction Fragment Length Polymorphisms Locus
Probe
Enzyme
C57BL/6J
CAST/Ei
— Add2 DctnI E2 D6Umi1 D6Umi1 E4 E6 D6Umi3 D6Mm4e Hk2 Actg2
B1-1 (0.5) b-adducin cDNA Rat dynactin cDNA Genomic subclone from P1-3 End clone 3, E3a End clone 3, E3b End clone 4 End clone 6 End clone 7 Human EST, IMAGE 22590 Rat hexokinase II cDNA Human g actin cDNA
H H T H E H H T T T H T
7.5, 2.2 3.2, 1.9 4.7, 2.4 2.1, 1.9 1.7, 1.4 3.6 8, 3.5 3.6, 1.1, 0.25 15.5, 0.9 4.9, 1.0 4.6, 3.3 6.0, 5.5, 4.9 6.4, 5.1, 3.9 2.2, 1.8, 0.5
9 3.3, 1.9 5.6, 4.7, 2.4, 2.2 1.9, 1.8, 1.4 3.3 11.5, 2.7 3.3, 1.1, 0.25 20, 0.9 3.3 4.6, 1.1 6.4, 6.0 6.4, 3.9, 3.1 2.2, 1.6, 0.7, 0.5
Note. The length of hybridizing restriction fragments in each parental strain is indicated in kb. The underlined fragments were used to determine the genotype of F2 animals. IMAGE 22590 is a 1.8-kb infant brain cDNA (GenBank Accession Nos. T74013 and T87214). The g actin cDNA was previously described (Miwa and Kamada, 1990). H, HindIII; T, TaqI; E, EcoRI.
109
mnd2 REGION OF MOUSE CHROMOSOME 6
RESULTS
Phenotype of Homozygous mnd2 Mice
FIG. 1. Appearance of affected mnd2 mouse in the final stages of the disease. The 34-day-old homozygous mnd2 animal is shown at the right, with an unaffected littermate at the left. pBeloBAC11 (Table 1). P1 end fragments were isolated by digestion of P1 DNA with SacI, intramolecular ligation, and transformation of Escherichia coli into DH5a. The NotI–SacI and SalI–SacI end fragments were isolated from 1% agarose gels and purified using the Qiaex kit (Qiagen Inc, Chattsworth, CA). The characterized end clones are as follows: E1 (1.4 kb) from YAC 18F8; E2 (0.6 kb) from P1-3; E3 (1.4 kb) from YAC 18F8; E4 (0.325 kb) from BAC 245C12; E5 (0.7 kb) from P1-1; E6 (1.3 kb) from P1-7; E7 (0.8 kb) from YAC 2D8; E8 (0.8 kb) from YAC 34A10; E9 (1.6 kb) from YAC 2D8; E10 (135 bp) from BAC 245c12. E5 contains D6Umi2, E8 contains D6Umi4, and E9 contains D6Umi5. Sequencing of the smooth muscle g actin cDNA. The Actg cDNA and the 59 and 39 UTRs of the gene were isolated by RT-PCR and PCR, respectively. Reverse transcription was carried out on 5 mg of total intestinal RNA from strains C57BL/6J and mnd2/mnd2 that was primed with a specific oligonucleotide from the 39UTR of the g actin cDNA. The complete g actin cDNA was amplified by PCR with primers provided by Dr. James Lessard (Kim et al., 1989; Szucsik and Lessard, 1995; and unpublished results) and sequenced at the University of Michigan Sequencing Core (R. Lyons, Director). Exon amplification. DNA from P1 clones 3, 4, 5, and 7 was digested with BamHI, BglII, NsiI, and/or PstI and cloned into the vector pSPL3 (Gibco BRL). Exon amplification was carried out as described (Church et al., 1994). Exon clones were picked into nine 96-well microtiter plates. Inserts were amplified by PCR using the new primers EX-F and EX-R (Table 1), designed from the pSPL3 sequence to minimize the vector sequences in amplified products. The PCR products were analyzed by Southern blotting to eliminate clones containing sequences from Dctn1, Actg2, Aup1, or the pSPL3 vector. Redundant clones were identified by hybridization of the blots in succession with three pools of four clones each. Unique clones that hybridized back to the original P1 were sequenced.
Affected animals can be recognized at 2 to 3 weeks of age by their unsteady gait and growth retardation and do not survive beyond 6 weeks. In the later stages of the disease, there is severe muscle atrophy, hunched posture, and wasted appearance (Fig. 1). Behavioral abnormalities include loss of balance and generalized seizures that increase in frequency. No body fat is detectable on dissection. Regression of the spleen and thymus was previously described (Jones et al., 1993). High-Resolution Genetic Map Defines an mnd2 Nonrecombinant Region of 0.2 6 0.1 cM Genomic DNA from 1126 F2 animals from the cross (C57BL/6J-mnd2/1 3 CAST/Ei) was typed for markers flanking the mnd2 locus (Fig. 1). The first 342 animals were typed for D6Mit5 and D6Mit6, the next 749 animals were typed for D6Mit5 and D6Mit21, and the final 33 animals were typed for D6Mit164 and D6Mit21. The proportion of homozygotes and heterozygotes among the 1097 nonrecombinant F2 animals was consistent with the expected ratio of 1:2:1. The 29 animals with recombination breakpoints between the flanking markers were typed for additional microsatellite markers from the region (Dietrich et al., 1994). The genotypes of these animals define an mnd2 nonrecombinant region of 0.7 6 0.2 cM between D6Mit164 and D6Mit21 (recombination frequency, 16/2248) (Fig. 2). The nonrecombinant interval was reduced to 0.2 6 0.1 cM by one recombinant between mnd2 and D6Mit128, 189, and 211 that occurred in a test cross between an unaffected recombinant F2 animal (I-1) and a heterozygous mnd2/1 F1 animal (I-2) (Fig. 3). The observation of two affected individuals among the eight offspring of this cross demonstrated that individual I-1 was a heterozygous carrier, mnd2/1. Each of the affected offspring carried one additional recombination breakpoint in the mnd2 region (Fig. 2, arrows). These recombinations could have occurred in the germline of (I-1) or (I-2). The recombinant genotypes of the two affected offspring were confirmed by analysis of several additional genetic markers (see below).
FIG. 2. Genotypes of F2 progeny from the cross C57BL/6J-mnd2/1 3 CAST/Ei. The number of animals with each genotype is indicated below each column. Nonrecombinant animals were typed for flanking markers only, as described in the text. Solid symbol, C57BL/6J homozygote; open symbol, CAST homozygote; striped symbol, heterozygote.
110
WEBER ET AL.
recombinant region is spanned by a minimum tiling path containing two BAC clones and three P1 clones that provide a resource for isolation of the mnd2 gene (Fig. 4B). Based on the clone sizes, the length of the nonrecombinant interval is estimated to be between 360 and 500 kb. DNA from P1 clones 3, 4, 5, and 7 was used for exon amplification. Identification of the Novel WD Repeat Protein D6Mm3e
FIG. 3. Two recombination events observed in a test cross. An unaffected F2 male (I-1) with a recombination between D6Mit164 and D6Mit70 was test-crossed to a known mnd/1 heterozygous F1 female (I-2). (The microsatellite genotypes of I-2 are inferred.) The observation of two affected progeny demonstrated that I-1 was heterozygous mnd2/1. The genotypes of individuals II-1 and II-2 define two new recombination events (arrows), one of which reduced the size of the nonrecombinant region. Solid symbol, affected; open symbol, unaffected.
The genetic map of the mnd2 region was derived from the 31 recombinants in Figs. 2 and 3, as well as two previously reported F2 recombinants (Jones et al., 1993) and one new recombinant from a small backcross containing 46 animals. Genomic DNA from the 34 recombinant animals was typed by PCR and Southern blotting for 27 markers including polymorphic microsatellites and subclones from the physical contig (described below). The observed mnd2 nonrecombinant interval is defined by the recombination frequency of 5/2294 between D6Mit164 and D6Mit128 (Fig. 4A). This interval is predicted to contain approximately 400 kb of genomic DNA. The gene order observed in the genetic map in Fig. 4A is consistent with the physical map described below. Genetic Mapping of Four Positional Candidate Genes Four genes had been previously mapped to the mnd2 region of mouse chromosome 6 or the corresponding region of human chromosome 2p13: muscle hexokinase II, dynactin I, b-adducin, and smooth muscle g actin. F2 animals were genotyped for these five loci by analysis of RFLPs (Table 2). Twenty nonrecombinant affected F2 animals were first tested and found to be homozygous for the C57BL/6J alleles at all of these loci (data not shown), confirming the map assignments to this region. Analysis of 17 recombinant animals demonstrated that muscle hexokinase II is proximal to D6Mit164, b-adducin is distal to Mit128, and dynactin I (Dctn1) and smooth muscle g actin (Actg2) are located within the nonrecombinant interval (Fig. 4A). A Clone Contig of the Nonrecombinant Region Overlapping YAC, BAC, and P1 clones were isolated as described under Materials and Methods. The non-
Database searches using the BLAST program (Altschul et al., 1990) identified matches between two putative exons amplified from clone P1-7 and EST sequences from human and mouse. One exon matched the 59 end of IMAGE clone 24339 (GenBank Accession No. T78227), and the other matched the 39 end of the same clone (GenBank Accession No. R37876), indicating that both exons are derived from the same cDNA. This mouse gene was designated D6Mm3e. We isolated the cDNA by a combination of 59 RACE and screening of a neonatal mouse brain cDNA library (Stratagene). The 1230 sequence includes 194 bp of 59 UTR, an open reading frame of 1002 bp, and 34 bp of 39 UTR (GenBank Accession No. AF053618) (Fig. 5). The encoded amino acid sequence of D6Mm3e contains two transmembrane domains predicted by the TMpred program, one leucine zipper motif identified by the PROCITE program, and two WD-40 repeat domains (Neer et al., 1994) identified by ProfileScan search (Fig. 5). The 50 amino acids between residues 230 and 279 are related to the b-subunit (Gb) of the heterotrimeric bovine GTP-binding protein (GenBank Accession No. M15369), with 30% sequence identity and 50% sequence conservation. The D3Mme3 cDNA hybridizes with a 1.2-kb transcript in total brain RNA, indicating that the isolated cDNA is nearly complete (not shown). Transcripts were also detected by RT-PCR in muscle, spinal cord, testis, and E8.5 embryos. Matching ESTs in the databases were isolated from heart, lymphoid tissue, uterus, and placenta. A transcript lacking nucleotides 54 –122 was detected by RT-PCR and is also represented by several EST sequences in the databases. The origin of this transcript is unclear, since nucleotides 1–193 are contiguous in genomic DNA and the variable 69 bp are not flanked by consensus splice sites (Fig. 5). Rhotekin and Dok Are Located in the mnd2 Nonrecombinant Region Partial sequencing of the clone P1-3 identified a region with 94% identity to nucleotides 1158 to 1610 of the mouse p62Dok cDNA (GenBank Accession No. U78818). p62Dok is a rasGAP-binding protein involved in tyrosine kinase signaling. Tyrosine phosphorylation of p62Dok increases its binding affinity for rasGAP. Mouse and human cDNAs have been cloned (Carpino et al., 1997; Yamanashi and Baltimore, 1997) but the chromosomal location of the Dok gene was not previously known.
mnd2 REGION OF MOUSE CHROMOSOME 6
111
FIG. 4. (A) High-resolution genetic map of the mnd2 gene region. (B) Physical map of the mnd2 region. Italicized numbers represent Mit microsatellites (Dietrich et al., 1992, 1994). (C) Clone contig and gene map of the mnd2 region. The distance between hexokinase 2 and b-adducin is less than 1 Mb. Based on the sizes of the clones, the length of the nonrecombinant region between D6Mit164 and D6Mit128 is between 360 and 500 kb.
112
WEBER ET AL.
FIG. 5. cDNA and protein sequence of D6Mm3e, a new member of the WD repeat gene family. Boldface plus sign, asparagine glycosylation site; filled circle, myristylation site; solid line, leucine zipper motif; dashed line, transmembrane domain; boxed regions, WD-40 repeat domain; circled P, casein kinase II phosphorylation consensus site; open-face P, protein kinase C phosphorylation consensus site. The underlined 69-bp region (nucleotides 54 –122) is missing in some transcripts.
Database searches using the BLAST program (Altschul et al., 1990) demonstrated that an amplified exon from clone P1-7 was derived from the recently de-
scribed gene rhotekin. Rhotekin was originally isolated on the basis of its ability to bind the protein Rho (Reid et al., 1996). Binding of rhotekin to the GTP-bound
113
mnd2 REGION OF MOUSE CHROMOSOME 6
TABLE 3 Evaluation of Six Candidate Genes in the mnd2 Nonrecombinant Region Gene
mRNA (kb)
Northern blot RNA
RT-PCR products for sequencing
Actg2 Aup1 Dok Dynactin 1 Rhotekin D6Mm3e
1.5 1.5 1.9 4.2 3.0 1.3
Stomach, intestine Brain Muscle Muscle Brain, muscle Muscle
Intestine Brain Muscle Brain Brain Brain
Note. Tissues were obtained from mnd2/mnd2 homozygotes and age-matched C57BL/6J controls at 3– 4 weeks of age. No differences between mutant and wildtype were observed for these genes with regard to transcript size, transcript abundance, or transcript sequence including the complete open reading frame and portions of the 59 UTR and 39 UTR.
form of Rho inhibits GTPase activity. Southern blot analysis of clone P1-7 with the full-length rhotekin cDNA demonstrated that the entire rhotekin gene is contained in this clone (Jang et al., 1997a). Identification of the Novel Genes Aup1 and D6Mm5e The sequence of end clone E5 from P1-1 matches several ESTs corresponding to the Aup1 gene (Jang et al., 1996). Aup1 encodes a ubiquitously expressed 46-kDa protein with 35% amino acid sequence identity to the Caenorhabditis elegans hypothetical protein F44b9.5 (GenBank Accession No. L23648). The gene D6Mm5e was also represented by one amplified exon. D6Mm5e spans more than 80 kb of the nonrecombinant region and has not been completely characterized. The positions of Rhotekin, Dok, D6Mm3e, and D6Mm5e on the physical map are shown in Fig. 4C. Evaluation of Seven Genes as Candidates for mnd2 Seven genes were mapped into the mnd2 nonrecombinant region: Actg2, Aup1, dynactin 1, p62Dok, rhotekin, D6Mm3e, and D6Mm5e (Fig. 4C). The expression of each of these was compared in wildtype C57BL/6J mice and homozygous mnd2 mice. Northern blots containing RNA from wildtype C57BL/6J mice and homozygous mnd2 mice were hybridized with each cDNA probe. No differences in the size or abundance of transcripts were observed for six of these genes (Table 3); the abundance of the D6Mm5e transcript was below the level of detection on Northern blots (Jang, 1998). The full-length coding sequence of each cDNA was determined. Overlapping cDNA fragments were generated by RT-PCR amplification of total RNA from the tissues indicated in Table 3. We obtained the complete coding sequences of the 1.9-kb Dok transcript, the 1.5-kb Actg2 transcript, and the 1.3-kb D6Mm3e transcript, from wildtype and mutant tissues. No differences in nucleotide sequence of these cDNAs were observed between the strain of origin, C57BL/6J, and the mnd2 mutant. The cDNA sequences of the 1.5-kb Aup1
transcript, the 4.2-kb dynactin 1 transcript, and the 3-kb rhotekin were previously reported, with no differences observed between transcripts from mnd2 and wildtype (Jang et al., 1996, 1997a, b). In view of their normal abundance and sequence, we have eliminated six of these genes from further consideration as candidates for mnd2. The analysis of D6Mm5e is still incomplete, since the 59 end of the open reading frame has not been identified. No mutation has been detected in the identified exons of this gene. DISCUSSION
We have generated a high-resolution genetic map of the 2-cM region surrounding the neuromuscular disease mutant mnd2. This map resolved the order of 14 microsatellite markers that were previously grouped into two bins (Dietrich et al., 1994). Screening YAC libraries with the MIT markers D6Mit70, 128, and 164 generated a YAC contig that spanned the nonrecombinant region. YAC clones provided additional markers in the nonrecombinant region, by IRS-PCR and isolation of end fragments. A BAC and P1 contig of the nonrecombinant region provided genomic DNA for gene identification. A novel member of the WD repeat protein family, D6Mm3e, was isolated from the mnd2 nonrecombinant region. Members of this family contain highly conserved repeating units usually ending with Trp-Asp (WD) (Neer et al., 1994). They are found in all eukaryotes but not in prokaryotic organisms. Specific members of this gene family have been shown to regulate cell functions such as cell division, cell-fate determination, gene transcription, and transmembrane signaling. The b-subunit (Gb) of the heterotrimeric GTP-binding protein is a member of this family. The detection of transcripts in several tissues is consistent with a role for D6Mm3e in basic cell biology. The physical maps of the YAC, BAC, and P1 clones allowed us to determine the order of markers and genes. Hexokinase II and D6Mm4e (IMAGE 22590) are located within the YAC contig, but genetic recombination placed them outside the nonrecombinant region. The genes Actg2, Aup1, Rtkn, D6Mm3e, D6Mm5e, Dctn1, and Dok are located in the nonrecombinant region. Several of these could account for the observed muscle atrophy in mnd2 mice, most notably Dctn1, which is involved in axon transport. Nonetheless, no differences in coding sequence or mRNA length or abundance were observed in mutant mice. The 59 exon of D6Mm5e, a large gene that spans 80 kb of the nonrecombinant region, has not been identified, but no mutations have been detected in the portion of the gene that has been characterized. Of the 32 recombination events observed in this study, 4 breakpoints were located in BAC clone B211L20 (0.2 cM in 0.15 Mb) and 11 breakpoints were located within the YAC clone 2D8 (0.5 cM in 0.5 Mb). The recombination rate within these clones is roughly twice as high as the average of 0.5 cM/Mb for the
114
WEBER ET AL.
mouse genome (1400 cM in 3000 Mb). If the breakpoints are clustered within these clones, they could represent hotspots for recombination. Future characterization of these breakpoints could contribute to defining the sequences involved in mammalian recombination. With an average gene density of 1 per 30 kb in the mammalian genome, the mnd2 nonrecombinant region is expected to contain approximately 12 genes. We have analyzed seven genes and obtained approximately 13 kb of cDNA sequence from mutant and wildtype tissues, without detection of the mutation responsible for the mnd2 disorder. The clones described here provide starting material for two additional approaches that will be pursued in the future. Largescale sequencing is a powerful method for identification of additional genes, especially when combined with comparative analysis of the corresponding human genomic sequencing. We will also attempt to rescue mnd2 homozygotes by introduction of BAC and P1 clones as transgenes. These methods should result in the identification of the gene responsible for the severe neuromuscular disorder of mnd2 mice. Genes on human chromosome band 2p13 are distributed in two conserved linkage groups in the mouse. The conserved linkage group on mouse chromosome 6 (35–38 cM) includes human MND2 and ACTG2 which has been localized cytogenetically to subband 2p13.1. The conserved linkage group on mouse chromosome 11 (11–13 cM) includes RAB1A, which was cytologically mapped to subband 2p13.3. The radiation hybrid map of chromosome 2 is also consistent with the assignment of the mnd2 linkage group to the proximal portion of band 2p13. The order of three genes from the mnd2 region, hexokinase II, Aup1, and g-actin, is conserved on human chromosome 2p13.1 (Bashir et al., 1996). The muscular dystrophy gene LGMD2B on human 2p13 is centromeric to the mnd2 target region (Bashir et al., 1996), but the 10.3-cM interval containing the PARK3 Parkinson disease gene (Gasser et al., 1998) includes the mnd2 nonrecombinant region. The observation of seizures and ataxia in mnd2 mice suggests that mnd2 could be the mouse orthologue of PARK3. The genes described here can be tested as candidate genes for PARK3 by screening mutations in patients from linked pedigrees. Our data indicate that this portion of mouse chromosome 6 and human 2p13 contains many novel genes and will be a rich substrate for additional genomic analysis. ACKNOWLEDGMENTS Sandra Spilson and David Erdody provided excellent technical assistance. We thank Jane Santoro for invaluable assistance in preparation of the manuscript, Kenneth Abel for assistance with exon amplification, and Kent Hunter for screening the YAC library by hybridization with an IRS probe. H. Ueyama provided the human g actin cDNA, John E. Wilson provided the rat hexokinase II cDNA, and James Lessard provided the mouse actin primers. Erika Holzbaur provided information about the location of the Dynactin I gene prior to publication. J.S.W. was supported by a George Meany Fel-
lowship from the Muscular Dystrophy Association. W.J. acknowledges support from the Organogenesis Center, University of Michigan. This research was supported by a grant from the Muscular Dystrophy Association.
REFERENCES Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. J. Mol. Biol. 215: 403– 410. Bashir, R., Keers, S., Strachan, T., Passos-Bueno, R., Zatz, M., Weissenbach, J., Paslier, D. L., Meisler, M., and Bushby, K. (1996). Genetic and physical mapping at the limp-girdle muscular dystrophy locus (LGMD2B) on chromosome 2p. Genomics 33: 46 –52. Burke, D. T., Rossi, J. M., Leung, J., Koos, D. S., and Tilghman, S. M. (1991). A mouse genomic library of yeast artificial chromosome clones. Mamm. Genome 1: 65. Carpino, N., Wisniewski, D., Strife, A., Marshak, D., Kobayashi, R., Stillman, B., and Clarkson, B. (1997). p62(dok): A constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells. Cell 88: 197–204. Chartier, F. L., Keer, J. T., Sutcliffe, M. J., Henriques, D. A., Mileham, P., and Brown, S. D. M. (1992). Construction of a mouse yeast artificial chromosome library in a recombination-deficient strain of yeast. Nat. Genet. 1: 132–136. Church, G. M., and Gilbert, W. (1984). Genomic sequencing. Proc. Natl. Acad. Sci. USA 81: 1991–1995. Church, D. M., Stotler, C. J., Rutter, J. L., Murrell, J. R., Trofatter, J. A., and Buckler, A. J. (1994). Isolation of genes from complex sources of mammalian genomic DNA using exon amplification. Nat. Genet. 6: 98 –105. Dietrich, W., Katz, H., Lincoln, S. E., Shin, H-S., Friedman, J., Dracopoli, N. C., and Lander, E. S. (1992). A genetic map of the mouse suitable for typing intraspecific crosses. Genetics 131: 423– 447. Dietrich, W. F., Miller, J. C., Steen, R. G., Merchant, M., Damron, D., Nahf, R., and Gross, A. (1994). A genetic map of the mouse with 4,006 simple sequence length polymorphisms. Nat. Genet. 7: 220 – 245. Gasser, T., Muller-Myhsok, B., Wszolek, Z. K., Oehlmann, R., Calne, D. B., Bonifati, V., Bereznai, B., Fabrizio, E., Vieregge, P., and Horstmann, R. D. (1998). A susceptibility locus for Parkinson’s disease maps to chromosome 2p13. Nat. Genet. 18: 262–265. Hermanson, G. G., Hoekstra, M. F., McElligott, D. L., and Evans, G. A. (1991). Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast. Nucleic Acids Res. 19: 4943– 4948. Jang, W. (1998). Transcript characterization in the region of the mouse neuromuscular mutation mnd2. Ph.D. Thesis, University of Michigan. Jang, W., Weber, J. S., Bashir, R., Bushby, K., and Meisler, M. H. (1996). Aup1, a novel gene on mouse chromosome 6 and human chromosome 2p13. Genomics 36: 366 –368. Jang, W., Weber, J. S., Harkins, E., and Meisler, M. H. (1997a). Localization of the rhotekin gene RTKN on the physical maps of mouse chromosome 6 and human chromosome 2p13 and exclusion as a candidate for mnd2 and LGMD2B. Genomics 40: 506 – 507. Jang, W., Weber, J. S., Tokito, M. K., Holzbauer, E. L. F., and Meisler, M. H. (1997b). Mouse p150Glued (Dynactin 1) cDNA sequence and evaluation as a candidate for the neuromuscular disease mutation mnd2. Biochem. Biophys. Res. Commun. 231: 344 –347. Jones, J. M., Albin, R. L., Feldman, E. L., Simin, K., Schuster, T. G., Dunnick, W. A., Collins, J. T., Chrisp, C. E., Taylor, B. A., and Meisler, M. H. (1993). mnd2: A new mouse model of inherited motor neuron disease. Genomics 16: 669 – 677. Kim, E., Waters, S. H., Hake, L. E., and Hecht, N. B. (1989). Identification and developmental expression of a smooth-muscle gactin in postmeiotic male germ cells of mice. Mol. Cell. Biol. 9: 1875–1881.
mnd2 REGION OF MOUSE CHROMOSOME 6 Kusumi, K., Smith, J. S., Segre, J. A., Koos, D. S., and Lander, E. S. (1993). Construction of a large-insert yeast artificial chromosome library of the mouse genome. Mamm. Genome 4: 391–392. Larin, Z., Monaco, A. P., and Lehrach, H. (1991). Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc. Natl. Acad. Sci. USA 88: 4123– 4127. Liu, Y. G., and Whittier, R. F. (1995). Thermal asymmetric interlaced PCR: Automated amplification and sequence of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25: 674 – 681. Miller, S. A., Dykes, D. D., and Polesky, H. F. (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16: 1215. Miwa, T., and Kamada, S. (1990). The nucleotide sequence of a human smooth muscle (enteric type g-actin cDNA. Nucleic Acids Res. 18: 4263. Neer, E. N., Schmidt, C. J., Nambudripad, R., and Smith, T. F. (1994). The ancient regulatory-protein family of WD-repeat proteins. Nature 371: 297–300. Osborn, L., Rosenberg, M. P., Keller, S. A., and Meisler, M. H. (1987). Tissue-specific and insulin-dependent expression of a pancreatic amylase gene in transgene mice. Mol. Cell. Biol. 7: 326 –334. Pierce, P. C., Sternberg, N., and Saur, B. (1992). A mouse genomic library in bacteriophage P1 cloning system: organization and characterization. Mamm. Genome 3: 550 –558.
115
Popp, D., and Murray, J. D. (1991). Single day detection of transgenic mice by PCR of toe-clips. Mouse Genome 89: 279. Reid, T., Furuyashiki, T., Ishizaki, T., Watanabe, G., Watanabe, N., Fujisawa, K., Morii, N., Madaule, P., and Narumiya, S. (1996). Rhotekin, a new putative target for Rho bearing homology to a serine/threonine kinase, PKN, and rhophilin in the Rho-binding domain. J. Biol. Chem. 271: 13556 –13560. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “Molecular Cloning: A Laboratory Manual,” 2nd ed., pp. 9.16 –9.19, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Shizuya, H., Birren, B., Kim, U-J., Mancino, V., Slepak, T., Tachiiri, Y., and Simon, M. (1992). Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc. Natl. Acad. Sci. USA 89: 8794 – 8797. Sternberg, N., Smoller, D., and Braden, T. (1994). Three new developments in P1 cloning. Increased cloning efficiency, improved clone recovery, and a new P1 mouse library. Genet. Anal. Technol. Appl. 11: 171–180. Szucsik, J. C., and Lessard, J. L. (1995). Cloning and sequence analysis of the mouse smooth muscle g-enteric actin gene. Genomics 28: 154 –162. Yamanashi, Y., and Baltimore, D. (1997). Identification of the Abland resFAP-associated 62kDa protein as a docking protein, Dok. Cell 88: 205–211.
54, 107–115 (1998) GE985496
ARTICLE NO.
High-Resolution Genetic, Physical, and Transcript Map of the mnd2 Region of Mouse Chromosome 6 John S. Weber, Wonhee Jang, Karl Simin, Wei Lu, Jennifer Yu, and Miriam H. Meisler1 Department of Human Genetics, University of Michigan, Ann Arbor, Michigan 48109-0618 Received June 8, 1998; accepted July 28, 1998
The autosomal recessive mutation mnd2 is responsible for a lethal neuromuscular wasting disorder in the mouse. A high-resolution genetic map of the mnd2 region of mouse chromosome 6 was generated by analysis of 1147 F2 offspring from an intersubspecific cross between strains C57BL/6J-mnd2/1 and CAST/Ei. The results localize mnd2 to the 0.2-cM interval between D6Mit164 and D6Mit128. A contig of overlapping YAC, BAC, and P1 clones spanning the nonrecombinant interval was constructed. One novel gene isolated from the contig, D6Mm3e, is a new member of the WD repeat gene family. The observed gene order for the five positional candidate genes previously mapped to the region and five newly isolated genes is centromere–Hexokinase II– D6Mm5e–p62 Dok–Aup1–Rhotekin, D6Mm3e–Dynactin 1–Smooth muscle g actin–D6Mm4e–b-adducin–telomere. Seven of these genes are located within the 400-kb nonrecombinant interval for mnd2. Comparison between wildtype and mutant failed to detect any differences in mRNA size, abundance, or coding sequence for these seven genes. The genes described here are positional candidates for the Parkinson disease susceptibility locus PARK3 that was recently mapped to the corresponding region of human chromosome band 2p13.1. © 1998 Academic Press
INTRODUCTION
mnd2 is an autosomal recessive neuromuscular disorder characterized by muscle atrophy and severe wasting (Jones et al., 1993). We have initiated a positional cloning project to determine the molecular basis of this disorder. mnd2 was originally mapped to the 6-cM interval between D6Mit4 and D6Mit6 on mouse chromosome 6 (Jones et al., 1993). To localize the gene further, we have generated a large intersubspecific cross and characterized 2294 meiotic events. Microsatellite markers were used to construct a physical map of the nonrecombinant region. Genes previously mapped to mouse chromosome 6 or the corresponding region of 1
To whom correspondence should be addressed at Department of Human Genetics, 4708 Medical Science II, University of Michigan, Ann Arbor, MI 48109-0618. Telephone: (313) 763-5546. Fax: (313) 763-9691. E-mail: [email protected].
human chromosome 2p13 have been localized on our genetic and physical map, and several novel genes were isolated. This paper describes the high-resolution genetic map, a set of overlapping clones that span the nonrecombinant interval, and a gene map of the region. We previously reported the mouse cDNA sequences for three genes in the region, Aup1 (Jang et al., 1996), rhotekin (Jang et al., 1997a), and dynactin 1 (Jang et al., 1997b). The PARK3 locus responsible for susceptibility to Parkinson disease was recently mapped to a 10.3-cM interval on human chromosome 2p13 (Gasser et al., 1998). The PARK3 interval overlaps the human chromosome region that corresponds to mnd2 (Bashir et al., 1996), indicating that the genes described here can be considered as candidates for this Parkinson disease locus. MATERIALS AND METHODS Animals. The mnd2 mutation arose in our laboratory on a chromosome derived from strain C57BL/6J (Jones et al., 1993). The mutation is maintained by crossing mnd2/1 heterozygotes to C57BL/6J mice. Generation of the (C57BL/6J-mnd2/1 3 CAST/Ei) F2 mice was carried out as previously described (Jones et al., 1993). The mnd2 genotype of F1 animals was determined by test crossing with known heterozygotes and examining the incidence of affected offspring. The mnd2 genotype of unaffected F2 animals with recombination break points between flanking markers was also determined by test crossing. PCR. Genomic DNA was prepared from tail (Miller et al., 1988; Osborn et al., 1987), toe clip (Popp and Murray, 1991), or other tissues (Jones et al., 1993). Microsatellite markers were analyzed as described by Dietrich et al. (1992, 1994) or by ethidium bromide staining after electrophoresis on 2.5% Metaphor Agarose (FMC Bioproducts) or 3:1 Agarose (Sigma). Genomic DNA (0.05– 0.1 mg) was amplified by PCR in buffer containing 50 mM KCl, 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2, 0.01% gelatin, 0.01% NP-40, 0.01% Tween 20, 200 mM dNTPs, 2 mM DTT, 2 units of Taq polymerase, and 0.33 or 0.5 mM concentrations of each primer. Primers and reaction conditions are described in Table 1. Typical reactions began with 5 cycles at 95°C for 1 min, 50 to 65°C for 15 s, and 72°C for 30 s, followed by 25 to 30 cycles with the time at 72°C reduced to 10 s. Taq polymerase was added at the beginning of the first cycle at 95°C. RFLP analysis. Ten-microgram aliquots of genomic DNA were digested with restriction enzymes, electrophoresed through 1.2 or 0.8% agarose gels, and transferred onto Zetaprobe GT nylon membranes (Bio-Rad). Hybridization probes (Table 2) were labeled with [a-32P]dCTP (Amersham) by random priming. Prehybridization and
107
0888-7543/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.
108
WEBER ET AL.
TABLE 1 PCR Primer Sequences Marker
Primers
D6Mit70-30
Product (bp)
F-CAACCACGGACAGCAACCCATTATTTCTTG R-CCAAGCCTGATGACCTGAATTCATCTCTGG F-ATGTATGAATACTCAGTCACTCTGTTAGGC R-TACATGAACATGCACATATACCACATGCAC F-CACAGTCTCTAATTCACCCCAGCCACTCC R-GATCTGATTAGTGCAGCATGTGTCTTGTCC F-CCTGATGCCACCCTGAGTTTGTATAACTGA R-CTATACACTCTCTCCCCCATGTCCCACAGG F-GATCCATCACCTCCTCTGGTCTCCAC R-GTTCCCTGCTCTCTCCAGTCTTGCC F-AGTGCTTTTACCCAGAGCCAGTTCCCTG R-CTTGACATCATAGCACATCTGGAAAGCC F-AGCAGTGGAGGAGCATTTGG R-CATTAGCTGATGCTTCCAGG F-ACGTGCTCTAGAGTCGACCCAGCA R-CCCCTCGGGAGATCTCCAGGT AGTTCCAGGACAGCCAGGG GCAAGGCGATTAAGTTGGGTAAC AATACGACTCACTATAGGGCGAA TAGAGTCGACCTGCAGGCAT
D6Mit128-30 D6Umi1 D6Umi2 D6Umi3 D6Umi4 E10 EX B1MvsCH 59BAC1 59BAC2 59BAC3
167, (a) 157, (a) 160 435 181 182 135 Clone insert (b)
Note. Reactions were carried out under the standard conditions described under Materials and Methods, with two exceptions: (a) 40 cycles total with addition of 2 units of Taq polymerase after 30 cycles; (b) 94°C for 5 min, 40 cycles of 94°C (10 s), 50°C (30 s), 72°C (60 s), followed by 72°C (5 min).
hybridization were carried out in Church buffer (Church and Gilbert, 1984) for 16 h at 65°C. Filters were washed in 0.13 SSC with 0.1% SDS at 65°C and autoradiographed for 1–7 days. Isolation of YAC clones. YAC libraries from the Whitehead Institute (Kusumi et al., 1993), St. Mary’s Hospital (Chartier et al., 1992), Princeton (Burke et al., 1991), and the NMRI (Larin et al., 1991) were screened by PCR for the nonrecombinant marker D6Mit70 and by hybridization with the IRS-PCR product B1-1 (Table 2). Three YAC clones were isolated by both methods: two unstable clones, 9707 and 110B10, and the chimeric clone 34A10. The Whitehead YAC library was also screened for the flanking markers D6Mit164 and D6Mit128 using newly designed PCR primers (Table 1) that permitted the use of stringent reaction conditions. Isolation of P1 and BAC clones. Two mouse P1 libraries (Sternberg et al., 1994; Pierce et al., 1992) were screened by PCR and hybridization for the markers D6Mit70, D6Umi1, D6Umi2, D6Umi3,
and D6Umi4 (Table 2). Colony lifts and processing of Hybond-N1 nylon filters (Amersham) were carried out as described by Sambrook et al. (1989) and the manufacturer’s instructions. P1 DNA was isolated using a mini-prep protocol from Genome Systems (St. Louis, MO). Optimal yields were obtained from 10-ml cultures grown for 3 to 5 h. A mouse BAC library (Shizuya et al., 1992) was screened at Research Genetics (Huntsville, AL) by hybridization with probe E2 (Table 2). DNA from positive clones was isolated by the alkaline lysis method (Sambrook et al., 1989). Isolation of end clones. YAC end fragments were isolated by homologous recombination (Hermanson et al., 1991). The end fragment E4 from BAC 245c12T was isolated using a modification of the TAIL-PCR method (Liu and Whittier, 1995). For isolation of BAC ends, the degenerate primer AD3 (Liu and Whittier, 1995) was used in primary, secondary, and tertiary PCRs with the new nested primers 59BAC1, 59BAC2, or 59BAC3 complementary to the vector
TABLE 2 Restriction Fragment Length Polymorphisms Locus
Probe
Enzyme
C57BL/6J
CAST/Ei
— Add2 DctnI E2 D6Umi1 D6Umi1 E4 E6 D6Umi3 D6Mm4e Hk2 Actg2
B1-1 (0.5) b-adducin cDNA Rat dynactin cDNA Genomic subclone from P1-3 End clone 3, E3a End clone 3, E3b End clone 4 End clone 6 End clone 7 Human EST, IMAGE 22590 Rat hexokinase II cDNA Human g actin cDNA
H H T H E H H T T T H T
7.5, 2.2 3.2, 1.9 4.7, 2.4 2.1, 1.9 1.7, 1.4 3.6 8, 3.5 3.6, 1.1, 0.25 15.5, 0.9 4.9, 1.0 4.6, 3.3 6.0, 5.5, 4.9 6.4, 5.1, 3.9 2.2, 1.8, 0.5
9 3.3, 1.9 5.6, 4.7, 2.4, 2.2 1.9, 1.8, 1.4 3.3 11.5, 2.7 3.3, 1.1, 0.25 20, 0.9 3.3 4.6, 1.1 6.4, 6.0 6.4, 3.9, 3.1 2.2, 1.6, 0.7, 0.5
Note. The length of hybridizing restriction fragments in each parental strain is indicated in kb. The underlined fragments were used to determine the genotype of F2 animals. IMAGE 22590 is a 1.8-kb infant brain cDNA (GenBank Accession Nos. T74013 and T87214). The g actin cDNA was previously described (Miwa and Kamada, 1990). H, HindIII; T, TaqI; E, EcoRI.
109
mnd2 REGION OF MOUSE CHROMOSOME 6
RESULTS
Phenotype of Homozygous mnd2 Mice
FIG. 1. Appearance of affected mnd2 mouse in the final stages of the disease. The 34-day-old homozygous mnd2 animal is shown at the right, with an unaffected littermate at the left. pBeloBAC11 (Table 1). P1 end fragments were isolated by digestion of P1 DNA with SacI, intramolecular ligation, and transformation of Escherichia coli into DH5a. The NotI–SacI and SalI–SacI end fragments were isolated from 1% agarose gels and purified using the Qiaex kit (Qiagen Inc, Chattsworth, CA). The characterized end clones are as follows: E1 (1.4 kb) from YAC 18F8; E2 (0.6 kb) from P1-3; E3 (1.4 kb) from YAC 18F8; E4 (0.325 kb) from BAC 245C12; E5 (0.7 kb) from P1-1; E6 (1.3 kb) from P1-7; E7 (0.8 kb) from YAC 2D8; E8 (0.8 kb) from YAC 34A10; E9 (1.6 kb) from YAC 2D8; E10 (135 bp) from BAC 245c12. E5 contains D6Umi2, E8 contains D6Umi4, and E9 contains D6Umi5. Sequencing of the smooth muscle g actin cDNA. The Actg cDNA and the 59 and 39 UTRs of the gene were isolated by RT-PCR and PCR, respectively. Reverse transcription was carried out on 5 mg of total intestinal RNA from strains C57BL/6J and mnd2/mnd2 that was primed with a specific oligonucleotide from the 39UTR of the g actin cDNA. The complete g actin cDNA was amplified by PCR with primers provided by Dr. James Lessard (Kim et al., 1989; Szucsik and Lessard, 1995; and unpublished results) and sequenced at the University of Michigan Sequencing Core (R. Lyons, Director). Exon amplification. DNA from P1 clones 3, 4, 5, and 7 was digested with BamHI, BglII, NsiI, and/or PstI and cloned into the vector pSPL3 (Gibco BRL). Exon amplification was carried out as described (Church et al., 1994). Exon clones were picked into nine 96-well microtiter plates. Inserts were amplified by PCR using the new primers EX-F and EX-R (Table 1), designed from the pSPL3 sequence to minimize the vector sequences in amplified products. The PCR products were analyzed by Southern blotting to eliminate clones containing sequences from Dctn1, Actg2, Aup1, or the pSPL3 vector. Redundant clones were identified by hybridization of the blots in succession with three pools of four clones each. Unique clones that hybridized back to the original P1 were sequenced.
Affected animals can be recognized at 2 to 3 weeks of age by their unsteady gait and growth retardation and do not survive beyond 6 weeks. In the later stages of the disease, there is severe muscle atrophy, hunched posture, and wasted appearance (Fig. 1). Behavioral abnormalities include loss of balance and generalized seizures that increase in frequency. No body fat is detectable on dissection. Regression of the spleen and thymus was previously described (Jones et al., 1993). High-Resolution Genetic Map Defines an mnd2 Nonrecombinant Region of 0.2 6 0.1 cM Genomic DNA from 1126 F2 animals from the cross (C57BL/6J-mnd2/1 3 CAST/Ei) was typed for markers flanking the mnd2 locus (Fig. 1). The first 342 animals were typed for D6Mit5 and D6Mit6, the next 749 animals were typed for D6Mit5 and D6Mit21, and the final 33 animals were typed for D6Mit164 and D6Mit21. The proportion of homozygotes and heterozygotes among the 1097 nonrecombinant F2 animals was consistent with the expected ratio of 1:2:1. The 29 animals with recombination breakpoints between the flanking markers were typed for additional microsatellite markers from the region (Dietrich et al., 1994). The genotypes of these animals define an mnd2 nonrecombinant region of 0.7 6 0.2 cM between D6Mit164 and D6Mit21 (recombination frequency, 16/2248) (Fig. 2). The nonrecombinant interval was reduced to 0.2 6 0.1 cM by one recombinant between mnd2 and D6Mit128, 189, and 211 that occurred in a test cross between an unaffected recombinant F2 animal (I-1) and a heterozygous mnd2/1 F1 animal (I-2) (Fig. 3). The observation of two affected individuals among the eight offspring of this cross demonstrated that individual I-1 was a heterozygous carrier, mnd2/1. Each of the affected offspring carried one additional recombination breakpoint in the mnd2 region (Fig. 2, arrows). These recombinations could have occurred in the germline of (I-1) or (I-2). The recombinant genotypes of the two affected offspring were confirmed by analysis of several additional genetic markers (see below).
FIG. 2. Genotypes of F2 progeny from the cross C57BL/6J-mnd2/1 3 CAST/Ei. The number of animals with each genotype is indicated below each column. Nonrecombinant animals were typed for flanking markers only, as described in the text. Solid symbol, C57BL/6J homozygote; open symbol, CAST homozygote; striped symbol, heterozygote.
110
WEBER ET AL.
recombinant region is spanned by a minimum tiling path containing two BAC clones and three P1 clones that provide a resource for isolation of the mnd2 gene (Fig. 4B). Based on the clone sizes, the length of the nonrecombinant interval is estimated to be between 360 and 500 kb. DNA from P1 clones 3, 4, 5, and 7 was used for exon amplification. Identification of the Novel WD Repeat Protein D6Mm3e
FIG. 3. Two recombination events observed in a test cross. An unaffected F2 male (I-1) with a recombination between D6Mit164 and D6Mit70 was test-crossed to a known mnd/1 heterozygous F1 female (I-2). (The microsatellite genotypes of I-2 are inferred.) The observation of two affected progeny demonstrated that I-1 was heterozygous mnd2/1. The genotypes of individuals II-1 and II-2 define two new recombination events (arrows), one of which reduced the size of the nonrecombinant region. Solid symbol, affected; open symbol, unaffected.
The genetic map of the mnd2 region was derived from the 31 recombinants in Figs. 2 and 3, as well as two previously reported F2 recombinants (Jones et al., 1993) and one new recombinant from a small backcross containing 46 animals. Genomic DNA from the 34 recombinant animals was typed by PCR and Southern blotting for 27 markers including polymorphic microsatellites and subclones from the physical contig (described below). The observed mnd2 nonrecombinant interval is defined by the recombination frequency of 5/2294 between D6Mit164 and D6Mit128 (Fig. 4A). This interval is predicted to contain approximately 400 kb of genomic DNA. The gene order observed in the genetic map in Fig. 4A is consistent with the physical map described below. Genetic Mapping of Four Positional Candidate Genes Four genes had been previously mapped to the mnd2 region of mouse chromosome 6 or the corresponding region of human chromosome 2p13: muscle hexokinase II, dynactin I, b-adducin, and smooth muscle g actin. F2 animals were genotyped for these five loci by analysis of RFLPs (Table 2). Twenty nonrecombinant affected F2 animals were first tested and found to be homozygous for the C57BL/6J alleles at all of these loci (data not shown), confirming the map assignments to this region. Analysis of 17 recombinant animals demonstrated that muscle hexokinase II is proximal to D6Mit164, b-adducin is distal to Mit128, and dynactin I (Dctn1) and smooth muscle g actin (Actg2) are located within the nonrecombinant interval (Fig. 4A). A Clone Contig of the Nonrecombinant Region Overlapping YAC, BAC, and P1 clones were isolated as described under Materials and Methods. The non-
Database searches using the BLAST program (Altschul et al., 1990) identified matches between two putative exons amplified from clone P1-7 and EST sequences from human and mouse. One exon matched the 59 end of IMAGE clone 24339 (GenBank Accession No. T78227), and the other matched the 39 end of the same clone (GenBank Accession No. R37876), indicating that both exons are derived from the same cDNA. This mouse gene was designated D6Mm3e. We isolated the cDNA by a combination of 59 RACE and screening of a neonatal mouse brain cDNA library (Stratagene). The 1230 sequence includes 194 bp of 59 UTR, an open reading frame of 1002 bp, and 34 bp of 39 UTR (GenBank Accession No. AF053618) (Fig. 5). The encoded amino acid sequence of D6Mm3e contains two transmembrane domains predicted by the TMpred program, one leucine zipper motif identified by the PROCITE program, and two WD-40 repeat domains (Neer et al., 1994) identified by ProfileScan search (Fig. 5). The 50 amino acids between residues 230 and 279 are related to the b-subunit (Gb) of the heterotrimeric bovine GTP-binding protein (GenBank Accession No. M15369), with 30% sequence identity and 50% sequence conservation. The D3Mme3 cDNA hybridizes with a 1.2-kb transcript in total brain RNA, indicating that the isolated cDNA is nearly complete (not shown). Transcripts were also detected by RT-PCR in muscle, spinal cord, testis, and E8.5 embryos. Matching ESTs in the databases were isolated from heart, lymphoid tissue, uterus, and placenta. A transcript lacking nucleotides 54 –122 was detected by RT-PCR and is also represented by several EST sequences in the databases. The origin of this transcript is unclear, since nucleotides 1–193 are contiguous in genomic DNA and the variable 69 bp are not flanked by consensus splice sites (Fig. 5). Rhotekin and Dok Are Located in the mnd2 Nonrecombinant Region Partial sequencing of the clone P1-3 identified a region with 94% identity to nucleotides 1158 to 1610 of the mouse p62Dok cDNA (GenBank Accession No. U78818). p62Dok is a rasGAP-binding protein involved in tyrosine kinase signaling. Tyrosine phosphorylation of p62Dok increases its binding affinity for rasGAP. Mouse and human cDNAs have been cloned (Carpino et al., 1997; Yamanashi and Baltimore, 1997) but the chromosomal location of the Dok gene was not previously known.
mnd2 REGION OF MOUSE CHROMOSOME 6
111
FIG. 4. (A) High-resolution genetic map of the mnd2 gene region. (B) Physical map of the mnd2 region. Italicized numbers represent Mit microsatellites (Dietrich et al., 1992, 1994). (C) Clone contig and gene map of the mnd2 region. The distance between hexokinase 2 and b-adducin is less than 1 Mb. Based on the sizes of the clones, the length of the nonrecombinant region between D6Mit164 and D6Mit128 is between 360 and 500 kb.
112
WEBER ET AL.
FIG. 5. cDNA and protein sequence of D6Mm3e, a new member of the WD repeat gene family. Boldface plus sign, asparagine glycosylation site; filled circle, myristylation site; solid line, leucine zipper motif; dashed line, transmembrane domain; boxed regions, WD-40 repeat domain; circled P, casein kinase II phosphorylation consensus site; open-face P, protein kinase C phosphorylation consensus site. The underlined 69-bp region (nucleotides 54 –122) is missing in some transcripts.
Database searches using the BLAST program (Altschul et al., 1990) demonstrated that an amplified exon from clone P1-7 was derived from the recently de-
scribed gene rhotekin. Rhotekin was originally isolated on the basis of its ability to bind the protein Rho (Reid et al., 1996). Binding of rhotekin to the GTP-bound
113
mnd2 REGION OF MOUSE CHROMOSOME 6
TABLE 3 Evaluation of Six Candidate Genes in the mnd2 Nonrecombinant Region Gene
mRNA (kb)
Northern blot RNA
RT-PCR products for sequencing
Actg2 Aup1 Dok Dynactin 1 Rhotekin D6Mm3e
1.5 1.5 1.9 4.2 3.0 1.3
Stomach, intestine Brain Muscle Muscle Brain, muscle Muscle
Intestine Brain Muscle Brain Brain Brain
Note. Tissues were obtained from mnd2/mnd2 homozygotes and age-matched C57BL/6J controls at 3– 4 weeks of age. No differences between mutant and wildtype were observed for these genes with regard to transcript size, transcript abundance, or transcript sequence including the complete open reading frame and portions of the 59 UTR and 39 UTR.
form of Rho inhibits GTPase activity. Southern blot analysis of clone P1-7 with the full-length rhotekin cDNA demonstrated that the entire rhotekin gene is contained in this clone (Jang et al., 1997a). Identification of the Novel Genes Aup1 and D6Mm5e The sequence of end clone E5 from P1-1 matches several ESTs corresponding to the Aup1 gene (Jang et al., 1996). Aup1 encodes a ubiquitously expressed 46-kDa protein with 35% amino acid sequence identity to the Caenorhabditis elegans hypothetical protein F44b9.5 (GenBank Accession No. L23648). The gene D6Mm5e was also represented by one amplified exon. D6Mm5e spans more than 80 kb of the nonrecombinant region and has not been completely characterized. The positions of Rhotekin, Dok, D6Mm3e, and D6Mm5e on the physical map are shown in Fig. 4C. Evaluation of Seven Genes as Candidates for mnd2 Seven genes were mapped into the mnd2 nonrecombinant region: Actg2, Aup1, dynactin 1, p62Dok, rhotekin, D6Mm3e, and D6Mm5e (Fig. 4C). The expression of each of these was compared in wildtype C57BL/6J mice and homozygous mnd2 mice. Northern blots containing RNA from wildtype C57BL/6J mice and homozygous mnd2 mice were hybridized with each cDNA probe. No differences in the size or abundance of transcripts were observed for six of these genes (Table 3); the abundance of the D6Mm5e transcript was below the level of detection on Northern blots (Jang, 1998). The full-length coding sequence of each cDNA was determined. Overlapping cDNA fragments were generated by RT-PCR amplification of total RNA from the tissues indicated in Table 3. We obtained the complete coding sequences of the 1.9-kb Dok transcript, the 1.5-kb Actg2 transcript, and the 1.3-kb D6Mm3e transcript, from wildtype and mutant tissues. No differences in nucleotide sequence of these cDNAs were observed between the strain of origin, C57BL/6J, and the mnd2 mutant. The cDNA sequences of the 1.5-kb Aup1
transcript, the 4.2-kb dynactin 1 transcript, and the 3-kb rhotekin were previously reported, with no differences observed between transcripts from mnd2 and wildtype (Jang et al., 1996, 1997a, b). In view of their normal abundance and sequence, we have eliminated six of these genes from further consideration as candidates for mnd2. The analysis of D6Mm5e is still incomplete, since the 59 end of the open reading frame has not been identified. No mutation has been detected in the identified exons of this gene. DISCUSSION
We have generated a high-resolution genetic map of the 2-cM region surrounding the neuromuscular disease mutant mnd2. This map resolved the order of 14 microsatellite markers that were previously grouped into two bins (Dietrich et al., 1994). Screening YAC libraries with the MIT markers D6Mit70, 128, and 164 generated a YAC contig that spanned the nonrecombinant region. YAC clones provided additional markers in the nonrecombinant region, by IRS-PCR and isolation of end fragments. A BAC and P1 contig of the nonrecombinant region provided genomic DNA for gene identification. A novel member of the WD repeat protein family, D6Mm3e, was isolated from the mnd2 nonrecombinant region. Members of this family contain highly conserved repeating units usually ending with Trp-Asp (WD) (Neer et al., 1994). They are found in all eukaryotes but not in prokaryotic organisms. Specific members of this gene family have been shown to regulate cell functions such as cell division, cell-fate determination, gene transcription, and transmembrane signaling. The b-subunit (Gb) of the heterotrimeric GTP-binding protein is a member of this family. The detection of transcripts in several tissues is consistent with a role for D6Mm3e in basic cell biology. The physical maps of the YAC, BAC, and P1 clones allowed us to determine the order of markers and genes. Hexokinase II and D6Mm4e (IMAGE 22590) are located within the YAC contig, but genetic recombination placed them outside the nonrecombinant region. The genes Actg2, Aup1, Rtkn, D6Mm3e, D6Mm5e, Dctn1, and Dok are located in the nonrecombinant region. Several of these could account for the observed muscle atrophy in mnd2 mice, most notably Dctn1, which is involved in axon transport. Nonetheless, no differences in coding sequence or mRNA length or abundance were observed in mutant mice. The 59 exon of D6Mm5e, a large gene that spans 80 kb of the nonrecombinant region, has not been identified, but no mutations have been detected in the portion of the gene that has been characterized. Of the 32 recombination events observed in this study, 4 breakpoints were located in BAC clone B211L20 (0.2 cM in 0.15 Mb) and 11 breakpoints were located within the YAC clone 2D8 (0.5 cM in 0.5 Mb). The recombination rate within these clones is roughly twice as high as the average of 0.5 cM/Mb for the
114
WEBER ET AL.
mouse genome (1400 cM in 3000 Mb). If the breakpoints are clustered within these clones, they could represent hotspots for recombination. Future characterization of these breakpoints could contribute to defining the sequences involved in mammalian recombination. With an average gene density of 1 per 30 kb in the mammalian genome, the mnd2 nonrecombinant region is expected to contain approximately 12 genes. We have analyzed seven genes and obtained approximately 13 kb of cDNA sequence from mutant and wildtype tissues, without detection of the mutation responsible for the mnd2 disorder. The clones described here provide starting material for two additional approaches that will be pursued in the future. Largescale sequencing is a powerful method for identification of additional genes, especially when combined with comparative analysis of the corresponding human genomic sequencing. We will also attempt to rescue mnd2 homozygotes by introduction of BAC and P1 clones as transgenes. These methods should result in the identification of the gene responsible for the severe neuromuscular disorder of mnd2 mice. Genes on human chromosome band 2p13 are distributed in two conserved linkage groups in the mouse. The conserved linkage group on mouse chromosome 6 (35–38 cM) includes human MND2 and ACTG2 which has been localized cytogenetically to subband 2p13.1. The conserved linkage group on mouse chromosome 11 (11–13 cM) includes RAB1A, which was cytologically mapped to subband 2p13.3. The radiation hybrid map of chromosome 2 is also consistent with the assignment of the mnd2 linkage group to the proximal portion of band 2p13. The order of three genes from the mnd2 region, hexokinase II, Aup1, and g-actin, is conserved on human chromosome 2p13.1 (Bashir et al., 1996). The muscular dystrophy gene LGMD2B on human 2p13 is centromeric to the mnd2 target region (Bashir et al., 1996), but the 10.3-cM interval containing the PARK3 Parkinson disease gene (Gasser et al., 1998) includes the mnd2 nonrecombinant region. The observation of seizures and ataxia in mnd2 mice suggests that mnd2 could be the mouse orthologue of PARK3. The genes described here can be tested as candidate genes for PARK3 by screening mutations in patients from linked pedigrees. Our data indicate that this portion of mouse chromosome 6 and human 2p13 contains many novel genes and will be a rich substrate for additional genomic analysis. ACKNOWLEDGMENTS Sandra Spilson and David Erdody provided excellent technical assistance. We thank Jane Santoro for invaluable assistance in preparation of the manuscript, Kenneth Abel for assistance with exon amplification, and Kent Hunter for screening the YAC library by hybridization with an IRS probe. H. Ueyama provided the human g actin cDNA, John E. Wilson provided the rat hexokinase II cDNA, and James Lessard provided the mouse actin primers. Erika Holzbaur provided information about the location of the Dynactin I gene prior to publication. J.S.W. was supported by a George Meany Fel-
lowship from the Muscular Dystrophy Association. W.J. acknowledges support from the Organogenesis Center, University of Michigan. This research was supported by a grant from the Muscular Dystrophy Association.
REFERENCES Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. J. Mol. Biol. 215: 403– 410. Bashir, R., Keers, S., Strachan, T., Passos-Bueno, R., Zatz, M., Weissenbach, J., Paslier, D. L., Meisler, M., and Bushby, K. (1996). Genetic and physical mapping at the limp-girdle muscular dystrophy locus (LGMD2B) on chromosome 2p. Genomics 33: 46 –52. Burke, D. T., Rossi, J. M., Leung, J., Koos, D. S., and Tilghman, S. M. (1991). A mouse genomic library of yeast artificial chromosome clones. Mamm. Genome 1: 65. Carpino, N., Wisniewski, D., Strife, A., Marshak, D., Kobayashi, R., Stillman, B., and Clarkson, B. (1997). p62(dok): A constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells. Cell 88: 197–204. Chartier, F. L., Keer, J. T., Sutcliffe, M. J., Henriques, D. A., Mileham, P., and Brown, S. D. M. (1992). Construction of a mouse yeast artificial chromosome library in a recombination-deficient strain of yeast. Nat. Genet. 1: 132–136. Church, G. M., and Gilbert, W. (1984). Genomic sequencing. Proc. Natl. Acad. Sci. USA 81: 1991–1995. Church, D. M., Stotler, C. J., Rutter, J. L., Murrell, J. R., Trofatter, J. A., and Buckler, A. J. (1994). Isolation of genes from complex sources of mammalian genomic DNA using exon amplification. Nat. Genet. 6: 98 –105. Dietrich, W., Katz, H., Lincoln, S. E., Shin, H-S., Friedman, J., Dracopoli, N. C., and Lander, E. S. (1992). A genetic map of the mouse suitable for typing intraspecific crosses. Genetics 131: 423– 447. Dietrich, W. F., Miller, J. C., Steen, R. G., Merchant, M., Damron, D., Nahf, R., and Gross, A. (1994). A genetic map of the mouse with 4,006 simple sequence length polymorphisms. Nat. Genet. 7: 220 – 245. Gasser, T., Muller-Myhsok, B., Wszolek, Z. K., Oehlmann, R., Calne, D. B., Bonifati, V., Bereznai, B., Fabrizio, E., Vieregge, P., and Horstmann, R. D. (1998). A susceptibility locus for Parkinson’s disease maps to chromosome 2p13. Nat. Genet. 18: 262–265. Hermanson, G. G., Hoekstra, M. F., McElligott, D. L., and Evans, G. A. (1991). Rescue of end fragments of yeast artificial chromosomes by homologous recombination in yeast. Nucleic Acids Res. 19: 4943– 4948. Jang, W. (1998). Transcript characterization in the region of the mouse neuromuscular mutation mnd2. Ph.D. Thesis, University of Michigan. Jang, W., Weber, J. S., Bashir, R., Bushby, K., and Meisler, M. H. (1996). Aup1, a novel gene on mouse chromosome 6 and human chromosome 2p13. Genomics 36: 366 –368. Jang, W., Weber, J. S., Harkins, E., and Meisler, M. H. (1997a). Localization of the rhotekin gene RTKN on the physical maps of mouse chromosome 6 and human chromosome 2p13 and exclusion as a candidate for mnd2 and LGMD2B. Genomics 40: 506 – 507. Jang, W., Weber, J. S., Tokito, M. K., Holzbauer, E. L. F., and Meisler, M. H. (1997b). Mouse p150Glued (Dynactin 1) cDNA sequence and evaluation as a candidate for the neuromuscular disease mutation mnd2. Biochem. Biophys. Res. Commun. 231: 344 –347. Jones, J. M., Albin, R. L., Feldman, E. L., Simin, K., Schuster, T. G., Dunnick, W. A., Collins, J. T., Chrisp, C. E., Taylor, B. A., and Meisler, M. H. (1993). mnd2: A new mouse model of inherited motor neuron disease. Genomics 16: 669 – 677. Kim, E., Waters, S. H., Hake, L. E., and Hecht, N. B. (1989). Identification and developmental expression of a smooth-muscle gactin in postmeiotic male germ cells of mice. Mol. Cell. Biol. 9: 1875–1881.
mnd2 REGION OF MOUSE CHROMOSOME 6 Kusumi, K., Smith, J. S., Segre, J. A., Koos, D. S., and Lander, E. S. (1993). Construction of a large-insert yeast artificial chromosome library of the mouse genome. Mamm. Genome 4: 391–392. Larin, Z., Monaco, A. P., and Lehrach, H. (1991). Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc. Natl. Acad. Sci. USA 88: 4123– 4127. Liu, Y. G., and Whittier, R. F. (1995). Thermal asymmetric interlaced PCR: Automated amplification and sequence of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25: 674 – 681. Miller, S. A., Dykes, D. D., and Polesky, H. F. (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16: 1215. Miwa, T., and Kamada, S. (1990). The nucleotide sequence of a human smooth muscle (enteric type g-actin cDNA. Nucleic Acids Res. 18: 4263. Neer, E. N., Schmidt, C. J., Nambudripad, R., and Smith, T. F. (1994). The ancient regulatory-protein family of WD-repeat proteins. Nature 371: 297–300. Osborn, L., Rosenberg, M. P., Keller, S. A., and Meisler, M. H. (1987). Tissue-specific and insulin-dependent expression of a pancreatic amylase gene in transgene mice. Mol. Cell. Biol. 7: 326 –334. Pierce, P. C., Sternberg, N., and Saur, B. (1992). A mouse genomic library in bacteriophage P1 cloning system: organization and characterization. Mamm. Genome 3: 550 –558.
115
Popp, D., and Murray, J. D. (1991). Single day detection of transgenic mice by PCR of toe-clips. Mouse Genome 89: 279. Reid, T., Furuyashiki, T., Ishizaki, T., Watanabe, G., Watanabe, N., Fujisawa, K., Morii, N., Madaule, P., and Narumiya, S. (1996). Rhotekin, a new putative target for Rho bearing homology to a serine/threonine kinase, PKN, and rhophilin in the Rho-binding domain. J. Biol. Chem. 271: 13556 –13560. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “Molecular Cloning: A Laboratory Manual,” 2nd ed., pp. 9.16 –9.19, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Shizuya, H., Birren, B., Kim, U-J., Mancino, V., Slepak, T., Tachiiri, Y., and Simon, M. (1992). Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc. Natl. Acad. Sci. USA 89: 8794 – 8797. Sternberg, N., Smoller, D., and Braden, T. (1994). Three new developments in P1 cloning. Increased cloning efficiency, improved clone recovery, and a new P1 mouse library. Genet. Anal. Technol. Appl. 11: 171–180. Szucsik, J. C., and Lessard, J. L. (1995). Cloning and sequence analysis of the mouse smooth muscle g-enteric actin gene. Genomics 28: 154 –162. Yamanashi, Y., and Baltimore, D. (1997). Identification of the Abland resFAP-associated 62kDa protein as a docking protein, Dok. Cell 88: 205–211.