High-salt brines compromise autoinducer-mediated bacteriocinogenic Lactobacillus plantarum survival in Spanish-style green olive fermentations

Food Microbiology 33 (2013) 90e96

Contents lists available at SciVerse ScienceDirect

Food Microbiology journal homepage: www.elsevier.com/locate/fm

High-salt brines compromise autoinducer-mediated bacteriocinogenic Lactobacillus plantarum survival in Spanish-style green olive fermentations Belén Caballero-Guerrero, Helena Lucena-Padrós, Antonio Maldonado-Barragán, José Luis Ruiz-Barba* Departamento de Biotecnología de Alimentos, Instituto de la Grasa, Consejo Superior de Investigaciones Científicas (CSIC), Avda. Padre García Tejero 4, Aptdo. 1078, 41012 Sevilla, Spain

a r t i c l e i n f o

a b s t r a c t

Article history: Received 11 April 2012 Received in revised form 4 September 2012 Accepted 7 September 2012 Available online 17 September 2012

The effect of NaCl on plantaricin production by five Lactobacillus plantarum strains was investigated. Plantaricin production in these strains was found to be regulated by three-component regulatory systems ruled by two different autoinducer peptides (AIPs), either PLNC8IF or Plantaricin A. Bacteriocin activity exhibited by these strains came to a halt in liquid medium containing NaCl concentrations of or above 2%. In contrast, bacteriocin activity was still observed when the producing strains were growing on solid medium containing up to 4% NaCl. Bacteriocin activity in liquid medium containing up to 2% NaCl could be restored by coculturing the producing strains with a selected plantaricin-production inducing strain of Lactococcus lactis. Growth of these bacteriocinogenic L. plantarum strains was monitored in traditional Spanish-style green olive fermentations. Survival of these strains could not be enhanced when provided with a range of plantaricin-production inducing mechanisms previously described, such as constitutive AIP production or coinoculation with a specific bacteriocin-production inducing strain of L. lactis. Our results suggest that it is advisable the use of constitutive bacteriocin producers, or at least non-AIP-dependant ones, as starters for olive fermentations due to the intrinsic physical characteristics of this food fermentation, especially the high salt concentration of the brines currently used. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Lactobacillus plantarum Bacteriocin Autoinduction Induction Coculture Olive fermentation

1. Introduction Bacteriocin production appears to confer a selective advantage to lactic acid bacteria (LAB) in natural environments and also when used as starter cultures in food fermentations (Buckenhüskes, 1993; Ruiz-Barba et al., 1994; Settanni and Corsetti, 2008). As many bacteriocins are produced by food-grade LAB, it offers the possibility of deliberately manipulating food microbial ecosystems (Cotter et al., 2005). In this sense, bacteriocins can potentially be used as a form of innate immunity in food to influence the final population in complex food systems (Cotter et al., 2005). This is fully applicable to the Spanish-style green olive fermentations, where the fruits can not be sterilised prior to brining and the fermentation is open to the growth of spontaneous microorganisms which contaminate the processing factories. In the past, inoculation with selected bacteriocin-producing strains of Lactobacillus plantarum demonstrated its benefits to olive fermentations, while showing that bacteriocin production itself provides a selective advantage over an isogenic non-bacteriocin-producing strain

* Corresponding author. Tel.: þ34 54 69 08 50; fax: þ34 54 69 12 62. E-mail address: [email protected] (J.L. Ruiz-Barba). 0740-0020/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fm.2012.09.002

(Ruiz-Barba et al., 1994). In this case, bacteriocin production by L. plantarum LPCO10 was shown to proceed constitutively both in synthetic (Jiménez-Díaz et al., 1993) and natural media (Leal et al., 1998). More recently, bacteriocin production in several L. plantarum strains was found to be regulated via a three-component system including a specific autoinducing peptide (AIP), a cognate histidine protein kinase (HK) and, at least, one response regulator (RR) (for a review see Diep et al., 2009). So far, three different two-peptide bacteriocins have been reported to be regulated in this way in L. plantarum: plantaricin EF, JK and NC8ab (Nes and Eijsink, 1999; Maldonado et al., 2004b). These L. plantarum strains can be divided into two groups attending to the specific AIP used, either PLNC8IF or Plantaricin A (PlnA), as well as to the dedicated HK which senses the external autoinducing signal provided by the cognate AIP. In addition, we found that bacteriocin production in the strain L. plantarum NC8 could be also induced by coculture with specific bacterial strains (Maldonado et al., 2003), and that this induction was mediated by the regulatory system controlled by PLNC8IF (Maldonado et al., 2004a and 2004b). Since then, other L. plantarum strains whose bacteriocin production is induced through coculture have been described, such as L. plantarum J23 (Rojo-Bezares et al., 2007) and L. plantarum LPT70/3 and LB6 in our laboratory (this work). Recently, we showed that coculture with specific bacteria

B. Caballero-Guerrero et al. / Food Microbiology 33 (2013) 90e96

enhanced survival of L. plantarum NC8 in olive fermentations (RuizBarba et al., 2010). However, although the results were very clear when fermentations were set up without salt, this was not the case when the usual 4%-NaCl brines were used, suggesting that salt could somehow interfere with plantaricin production. We hypothesised that this interference could be focused on either the regulatory autoinduction mechanism, i.e. the binding of PLNC8IF to its cognate HK, or the actual cell-to-cell interaction that takes place in the case of the bacteriocin-production inducing cocultures. The aim of this work is to find out how salt affects AIP-regulated plantaricin production and whether this fact can actually compromise bacteriocinogenic L. plantarum survival in traditionally brined green olive fermentations. To achieve these goals, we have investigated the effect of two different NaCl concentrations, i.e. 2 and 4% NaCl, in bacteriocin production by five AIP-regulated bacteriocinogenic L. plantarum strains, three of them regulated by PLNC8IF and two of them by PlnA. In addition, we used the recombinant plasmid pSIG308 (Maldonado et al., 2004b) to confer constitutive PLNC8IF production to the relevant strains as well as coculture with a strain of Lactococcus lactis found to induce bacteriocin production in some of these strains. Finally, we set up traditional Spanish-style green olive fermentations which were inoculated with the different bacteriocinogenic L. plantarum strains tested in this study. In this way, the effects of constitutive AIP production and coculture with a bacteriocin-production inducing bacteria on L. plantarum survival could be assessed. A non-bacteriocin-producing KO mutant derived from L. plantarum NC8 (Maldonado-Barragán et al., 2009) was used as a negative control. Also, in these fermentations, the two bacteriocinogenic L. plantarum strains regulated by PlnA were used to

91

check their survival capabilities and compare to the PLNC8IFregulated ones. 2. Materials and methods 2.1. Bacterial strains, culture media and growth conditions Bacterial strains used in this study are described in Table 1. L. plantarum strains were grown in MRS broth or agar (Biokar Diagnostics, Beauvais, France). For selective counting, L. plantarum wild-type strains were transformed with plasmid pIL252 (Simon and Chopin, 1988), conferring erythromycin resistance. To achieve constitutive PLNC8IF, and therefore plantaricin production, wildtype strains were transformed with plasmid pSIG308 (Maldonado et al., 2004b). Plasmid transformation was carried out as described by Aukrust and Blom (1992). Transformed L. plantarum strains were grown in MRS containing 10 mg/ml erythromycin and 100 mg/ml lincomycin. L. lactis MG1614-RifR was obtained by sequential selection of the parental strain on GM17 agar (M17 agar [Oxoid] plus 1% w/v glucose) containing increasing concentrations of rifampin in the range from 0.5 up to 60 mg/ml, which was the final selective antibiotic concentration used. Plasmid or antibioticresistance stability tests were carried out in all of the strains used as inocula by daily subculturing in non-selective medium (MRS or GM17) for one week (ca. 100 generations) and subsequent plating on non-selective and antibiotic-containing medium. Percentage of antibiotic-resistance retention ranged from 84 to 92% for plasmidassociated resistance, being 100% for the chromosomal rifampin resistance of L. lactis MG1614-RifR. Before inoculation, all the strains

Table 1 Bacterial strains, plasmids and oligonucleotides used in this study. Bacterial strain

Features

AIPa

Reference

Lactobacillus plantarum NC8 (pIL252)

EmR Bacþ; parental strainb isolated from grass silage AIP and coculture-inducible plantaricins (PLNC8ab, PlnEF, PlnJK) producer EmR Bacþ, constitutive PLNC8IF and plantaricins producer EmR Bac, derivative of L. plantarum NC8 lacking the operon plNC8If-plNC8Hk-plnD EmR Bac, derivative of L. plantarum NC8-KO1 harbouring the plasmid pSIG308 conferring constitutive PLNC8IF production EmR Bacþ; parental strainc isolated from wine fermentation; AIP and coculture-inducible plantaricins (PlnEF and PlnJK) producer EmR Bacþ; constitutive PLNC8IF and plantaricins producer EmR Bacþ; parental strain isolated from Spanish-style green olive fermentation; AIP and coculture-inducible plantaricins producer EmR Bacþ; constitutive PLNC8IF and plantaricins producer EmR Bacþ; parental straind isolated from Spanish-style green olive fermentation; AIP-inducible plantaricins (PlnEF and PlnJK) producer Bacþ; isolated from Spanish-style green olive fermentation AIPinducible plantaricins (PlnEF and PlnJK) producer EmR Bacþ; parental strain isolated from Spanish-style green olive fermentation; AIP-inducible plantaricins (PlnEF and PlnJK) producer RifR; Inducer strain for plantaricin-production by coculture Indicator strain for plantaricins EF and JK production Indicator strain for plantaricin PLNC8ab production

PLNC8IF

This study

PLNC8IF PLNC8IF

Maldonado et al., 2004b Maldonado-Barragán et al., 2009

PLNC8IF

Maldonado-Barragán et al., 2013

PLNC8IF

This study

PLNC8IF PLNC8IF

This study This study

PLNC8IF PlnA

This study This study

PlnA

Garrido-Fernández et al., 2010

PlnA

This study

e e e

This study Maldonado et al., 2003 Ruiz-Barba et al., 2010

L. plantarum NC8 (pSIG308) L. plantarum NC8-KO1 L. plantarum NC8-KO1 (pSIG308) L. plantarum LB6 (pIL252) L. plantarum LB6 (pSIG308) L. plantarum LPT70/3 (pIL252) L. plantarum LPT70/3 (pSIG308) L. plantarum 37A (pIL252)

L. plantarum LPT57/1 L. plantarum LPT57/1 (pIL252) Lactococcus lactis MG1614-Rif Pediococcus pentosaceus FBB63 Lactobacillus pentosus 128/2 Plasmid

Features

Reference

pIL252 pSIG308

Low-copy-number Gram positive cloning vector; 4.8 kb; EmR pIL252 containing the P59:plNC8IF gene fusion expressing constitutive PLNC8IF production; EmR

Simon and Chopin, 1988 Maldonado et al., 2004b

Oligonucleotide

Sequence (50 e30 )

Reference

EcoNC8IF-rev erm-HindIII

CGCGGAATTCTAATGATGGCCTCCAAG CGCGAAGCTTTAGTAACGTGTAACTTTCC

Maldonado et al., 2004b This work

Bacþ/-: bacteriocin producing/non-producing strain. a AIP: specific autoinducer peptide used to autoinduce plantaricin production in that strain. b Kindly provided by Lars Axelsson from MATFORSK, Norwegian Food Research Institute, Osloveien, Norway. c Kindly provided by Sergi Ferrer and Isabel Pardo from Universidad de Valencia, Burjassot, Spain. d Kindly provided by Cidália Peres from ITQB, Oeiras, Portugal.

92

B. Caballero-Guerrero et al. / Food Microbiology 33 (2013) 90e96

were adapted to salt by cultivating them twice in the corresponding broth containing 4% (w/v) NaCl. All bacteria were grown at 30  C anaerobically using a DG250 Anaerobic Workstation (Don Whitley Scientific Ltd., Shipley, West Yorkshire, UK) with a gas mixture consisting of 10% H2e10% CO2e80% N2. 2.2. Bacteriocin assays Bacteriocin activity was assayed both in solid and broth cultures. Detection in solid media was done by overlaying isolated colonies of the tested strain of L. plantarum, grown for 24 h anaerobically at 30  C in MRS-agar plates, with a lawn of ca.104 CFU/ml of the indicator strain. These plates were further incubated for 24 h and the presence of inhibition halos around the isolated colonies was examined. Detection of bacteriocin activity in broth cultures was done by spotting 10-ml drops of the corresponding filter-sterilised cell-free supernatant (CFS) on the surface of MRS-agar plates seeded with a lawn of the indicator strain. These plates were further incubated for 24 h and the presence of inhibition halos and their diameter was recorded. Three sampling points were checked for every broth culture: at O.D.600nm 1 and 2, and overnight (ca. 18 h of incubation). Quantitative assays of bacteriocin-active CFSs were carried out by the microtiter plate system as described in Maldonado-Barragán et al. (2013). Lactobacillus pentosus 128/2 and Pediococcus pentosaceus FBB63 were used as the indicator strains for Plantaricin NC8ab and Plantaricin EFeJK activities, respectively. All the titrations were made in duplicates and averaged. 2.3. Bacteriocin-production induction assays Induction of bacteriocin production through cocultivation was achieved as follows: fresh MRS broth was inoculated with a 2% inoculum of each of the tested L. plantarum strain obtained from overnight cultures; then, another 2% inoculum obtained from an overnight culture of L. lactis MG1614-Rif was added. The mixed cultures were incubated at 30  C anaerobically and samples were withdrawn when the O.D.600nm was 1 and 2, and also overnight. The CFSs of the different mixed cultures were assayed for bacteriocin activity as described above. Pure cultures of all of the bacterial strains used were also set up in the same way and their CFSs obtained and assayed. Autoinduction assays were performed using semi-purified PLNC8IF or PlnA obtained as described below. For this, 50-ml aliquots of semi-purified PLNC8IF or PlnA were added to 1 ml of MRS broth inoculated with a 2% inoculum of the L. plantarum strain to be tested and incubated anaerobically at 30  C. CFSs of these cultures were examined for bacteriocin activity at O.D.600nm of 1 and 2, and overnight. Titration of all these CFSs was carried out as described above. 2.4. Source of autoinducing molecules To obtain a homogeneous source of PLNC8IF, we used a semipurified supernatant of the strain L. plantarum NC8-KO1 (pSIG308) as described in Maldonado-Barragán et al. (2013). Semi-purified PlnA was obtained from the CFS of a bacþ L. plantarum LPT57/1 processed as described by Maldonado-Barragán et al. (2009). To verify the presence of the relevant AIP, MALDI-TOF mass spectrometric analysis was carried out. 2.5. Molecular techniques Total DNA from L. plantarum to be used in PCR was extracted from isolated colonies by the small-scale fast chloroform method as previously described (Ruiz-Barba et al., 2005). PCR analysis of potential pSIG308 transformants was done using the oligonucleo-

tide primer pair EcoNC8IF-rev/erm-HindIII (Table 1). Amplification of DNA was performed in 25-ml reaction mixtures containing 2.5 mM MgCl, 1 reaction buffer, 100 mM each of the deoxynucleoside triphosphates, 100 pmol of each primer, 5 U of Taq DNA polymerase (Promega), and 5 ml of total DNA, prepared as described above, as the template. A PTC-100 Thermal Cycler was used with the following conditions: denaturation at 94  C for 2 min, followed by 30 cycles of denaturation at 94  C for 15 s, annealing at 60  C for 30 s, and polymerization at 72  C for 2 min, plus a final polymerization step at 72  C for 4 min. 2.6. Olive fermentation set up The standard Spanish-style green olive brining procedure was followed (Fernández-Díez, 1983). Briefly, Manzanilla var. whole green olives (80 kg) were treated with 2% (w/v) NaOH for 5.5 h at room temperature (ca. 20  C) and washed twice with tap water for 10 min and 24 h consecutively to eliminate the excess of alkali. At this stage, the treated olives were dispensed into thirty-nine 8-L polyethylene jars, which were used as fermentors, in ca. 2-kg aliquots and were covered with brine (10% NaCl, w/v; ca. 3 L per fermentor). After 4 days, the fermentors were inoculated in triplicates with the relevant single or combined bacterial strains so that final concentration was ca. 5  105 CFU/ml of each strain. Inoculation pattern was as follows: i) L. plantarum strains listed in Table 1 as single cultures (27 fermentors); ii) coculture-inducible L. plantarum strains listed in Table 1 plus L. lactis MG1614-Rif (9 fermentors); iii) uninoculated control fermentations (3 fermentors). Fermentors were left at room temperature (18e22  C) and samples were taken along the fermentation at the sampling points indicated in Fig. 2. Samples were analysed for microbial and physical evolution for ca. 4 months. 2.7. Microbiological and physical analyses of olive fermentations Samples were serially diluted in sterile 0.1% (w/v) peptone water and plated in duplicates onto the different media with the help of a WASP2 Spiral Plater (Don Whitley Scientific Ltd.). Inoculated L. plantarum strains were enumerated in MRSeazide (0.02% [w/v] sodium azide) containing erythromycin (10 mg/ml) and lincomycin (100 mg/ml), at 30  C. Total LAB were enumerated in MRSeazide at 30  C. L. lactis MG1614-Rif was enumerated in GM17 containing rifampin (60 mg/ml). Titratable acidity, expressed as % (w/v) lactic acid, and pH were measured using a Metrohm 670 Titroprocessor (Herisau, Switzerland). Salt concentration was determined by titration with AgNO3 and expressed as % (w/v) NaCl. 2.8. Statistical analyses Analysis of variance was carried out using IBM SPSS Statistics v.19 programme. Statistically significant differences in the growth curves of the inoculated L. plantarum strains and total LAB were assessed using a permutation test developed to make pair-wise comparisons between groups of growth curves. The test was applied to the relevant CFU/ml at each sampling point over the entire period of the experiment. This was done using the programme Testing Between Curves at http://bioinf.wehi.edu.au/software/russell/ perm/, a web page that uses the Compare Growth Curves function from the Statistical Modelling Package Statmod, available from the R Project for Statistical Computing (http://wwww.r-project.org). Using a permutation test, set by default at 10,000 runs, this program examines the possibility of a significant difference between two curves or groups of curves, allowing also ranking the growth curves under comparison. A pair-wise comparison was considered significant when the p-value was <0.05.

B. Caballero-Guerrero et al. / Food Microbiology 33 (2013) 90e96

3. Results and discussion 3.1. Effect of NaCl on plantaricin production and induction in L. plantarum When AIP-regulated bacteriocinogenic L. plantarum strains were grown on solid medium all of them produced inhibition halos around their colonies, regardless the NaCl concentration of that medium, i.e. 0, 2 or 4% NaCl (not shown). In contrast, bacteriocin production came to a halt in broth cultures containing 4% NaCl, while those containing 2% NaCl offered a variety of results depending on the strain and the induction conditions, as we show in Fig. 1 and discuss below. In liquid cultures, NaCl over a certain concentration threshold abolishes plantaricin production. This effect could be due to interference with the autoinducing mechanism provided by the extracellular part of the autoinducing circuit, which is composed by the specific AIP and its cognate HK, but other explanations, such as the consequences of salt-induced stress responses, are also possible. Why bacteriocin production is not affected by NaCl when L. plantarum is growing as an isolated colony on the surface of an agar plate can be due to several reasons, included the obviously much reduced diffusion rate of the specific AIP in the agar than in broth. Also concentration of bacteria in a colony is far higher than what can be achieved in broth cultures so that more AIP (and bacteriocin) is produced in the vicinity of the colony than in broth. Other authors observed that environmental factors such as low pH or the presence of ethanol or NaCl negatively influence the binding of the AIP to its cognate receptor, i.e. its specific HK (Nilsen et al., 1998; Verluyten et al., 2004). It is known that the actual ionic strength of the environment affects the interaction of the external stimulus which activates HK reception and subsequent signal transduction (Mascher et al., 2006). Nilsen et al. (1998) needed 300 times more EntF, the AIP of Enterococcus faecium CTC492 that regulates enterocin A and B production, to obtain detectable bacteriocin production in the presence of 6.5% NaCl. These authors concluded that NaCl interferes with the binding of the AIP to its receptor HK so that higher concentrations of the AIP are necessary to sustain bacteriocin production. Having this in mind, we looked at different possibilities to enhance plantaricin-production inducing activity in the broth cultures of bacteriocinogenic L. plantarum strains. The relevant experiments and the results obtained are described below, including i) transformation of the parental strains with a recombinant plasmid enabling constitutive PLNC8IF production; ii) addition of the relevant AIP to the broth culture; and iii) use of cocultures with a specific bacterial strain of L. lactis that promotes induction of plantaricin production in L. plantarum. Fig. 1 shows the bacteriocin activity detected in the CFSs of the five L. plantarum strains used in this study growing in MRS broth under different conditions. Only pure cultures of strains harbouring the recombinant plasmid pSIG308 or those regulated by PlnA, i.e. strains 37A and LPT57/1, were able to produce plantaricin activity in their CFSs in the absence of NaCl (Fig. 1, panels B, D, F, G and H). Plantaricin production appeared to be much more tightly regulated in PLNC8IF-regulated strains than in PlnA-regulated ones. In the latter strains, antimicrobial activity is detected late in the growth curve, i.e. when a certain population threshold is reached, reflecting the quorum sensing mechanism involved in the regulation of plantaricin production. In the presence of 2% NaCl, only the strains LB6 (pSIG308) and LPT57/1 (pIL252) were still able to produce plantaricins (Fig. 1, panels F and H). In the absence of NaCl, addition of the relevant AIP promoted plantaricin production in those strains which were not producing as non-induced cultures, i.e. NC8 (pIL252), LPT70/3 (pIL252) and LB6 (pIL252) (Fig. 1, panels A, C and E). In contrast, when NaCl was

93

present at 2% concentration, only three strains were still producing plantaricins, i.e. L. plantarum LPT70/3 (pSIG308), LB6 (pSIG308) and LPT57/1 (pIL252) (Fig. 1, panels D, F and H). All these strains had previously shown to constitutively synthesise their corresponding AIP (data not shown). Interestingly, induction of plantaricin production through coculture with L. lactis did not appear to be significatively affected by NaCl at 2% (Fig. 1, panels AeF). These results indicate that coculture is the most effective method to maintain plantaricin production in non-constitutive, AIP-regulated bacteriocinogenic L. plantarum strains in the presence of a moderate concentration of NaCl such as 2%. In a previous report, we demonstrated that coculture-induced plantaricin production in L. plantarum NC8 was mediated by the three-component regulatory system ruled by PLNC8IF (Maldonado et al., 2004b). However, the primary signal provided by the cell-to-cell interaction between L. plantarum NC8 and the inducing bacterial strain has not been elucidated yet. As coculture-induced plantaricin production appeared to be more resistant to the environmental conditions than the PLNC8IF-mediated one, at least in the presence of moderate concentrations of NaCl, this could mean that the mentioned primary signal is channelled through a parallel mechanism. This primary mechanism is worth to be investigated and it is the focus of our current efforts. 3.2. Growth of AIP-regulated bacteriocinogenic L. plantarum strains in olive fermentations Growth curves of the inoculated L. plantarum strains in olive fermentations, as well as growth of total LAB, are shown in Fig. 2. For every strain tested, pair-wise comparisons did not found any significant difference among the growth curves obtained with the pure cultures (Fig. 2), pSIG308 transformed, L. lactis cocultured or KO mutant inoculations (data not shown). In addition, all inoculated L. plantarum strains were outnumbered by spontaneous LAB after 2 months of fermentation (Fig. 2). These results suggested that none of these strains were suitable for Spanish-style olive fermentation. Also, it seemed that none the plantaricin-production inducing strategies, i.e. constitutive AIP production or coculture induction, appeared to play a significant role at increasing the survival of a specific bacteriocinogenic strain in these fermentations. Bacteriocinogenic strains of L. plantarum demonstrated in the past to be useful to olive fermentations, showing that bacteriocin production itself can provide a selective advantage over isogenic non-bacteriocin-producing strains (Ruiz-Barba et al., 1994). In that case, bacteriocin production proceeded in a constitutive manner (Jiménez-Díaz et al., 1993:Leal et al., 1998, 2002). However, AIPregulated bacteriocin production did not seem to confer a selective advantage to L. plantarum in olive fermentations. This could be the result of failure in the autoinducing mechanism itself due to intrinsic fermentation conditions. Non-AIP-dependant bacteriocin production could prevent this problem. This feature could be achieved either by looking for naturally constitutive bacteriocin producers or by constitutively expressing the bacteriocins of interest through molecular manipulation of their regulated promoters. Current efforts in our group are aimed to obtain constitutive plantaricin-producing L. plantarum strains by way of substituting the wild-type, regulated bacteriocin promoters by constitutive ones in a manner already used to achieve constitutive PLNC8IF production (Maldonado et al., 2004b). Although none of the strains tested in this study showed a special suitability for Spanish-style green olive fermentations, pair-wise comparisons of the growth curves of all of them allowed us to test their relative efficiency in this food fermentation. Remarkably, one of the best scored strains, L. plantarum LB6, was isolated from a wine fermentation (Table 1), a food fermentation

94

B. Caballero-Guerrero et al. / Food Microbiology 33 (2013) 90e96

NC8 (pIL252)

NC8 (pSIG308)

5

5

B

log BU/ml

A 4

4

3

3

2

2

1

1

0

0 pure

+PLNC8IF coculture

pure

0% NaCl

+PLNC8IF coculture

pure

2% NaCl

+PLNC8IF coculture

LPT70/3 (pIL252)

LPT70/3 (pSIG308)

log BU/ml

C

D

4

4

3

3

2

2

1

1 0

0 pure

+PLNC8IF coculture

pure

0% NaCl

+PLNC8IF coculture

pure

+PLNC8IF coculture

pure

0% NaCl

2% NaCl

LB6 (pIL252)

5

+PLNC8IF coculture

2% NaCl

LB6 (pSIG308)

5

E log BU/ml

+PLNC8IF coculture

2% NaCl

5

5

F

4

4

3

3

2

2

1

1

0

0 pure

+PLNC8IF coculture

pure

0% NaCl

+PLNC8IF coculture

pure

+PLNC8IF coculture

pure

0% NaCl

2% NaCl

37A (pIL252)

+PLNC8IF coculture

2% NaCl

LPT57/1 (pIL252)

5

5

G log BU/ml

pure

0% NaCl

H

4

4

3

3

2

2

1

1

0

0 pure

+PlnA

0% NaCl

pure

+PlnA

2% NaCl

pure

+PlnA

0% NaCl

pure

+PlnA

2% NaCl

Fig. 1. Bacteriocin activity detected in the cell-free supernatants (CFSs) of the five L. plantarum strains used in this study growing in MRS broth under different conditions. The actual bacteriocinogenic strain is indicated on top of each panel. NaCl concentration in the experiments is indicated below each panel. For each NaCl concentration, three different growth conditions were used: pure cultures (pure); addition of the relevant autoinducer peptide (PLNC8IF or PlnA); coculture with Lactococcus lactis MG1614 (coculture). For each growth condition, three bacteriocin activities are shown corresponding to CFSs collected, from left to right, at O.D.600nm of 1 and 2, and overnight. Bars indicate standard deviations of triplicate experiments.

B. Caballero-Guerrero et al. / Food Microbiology 33 (2013) 90e96

95

A 10 9 8

log CFU/ml

7 6 5 4 3 2 1

10 5

11 2

11 9

12 6

10 5

11 2

11 9

12 6

98

91

84

77

70

63

56

49

42

35

28

21

14

7

0

Time (days)

NC8

70/3

LB6

37A

57/1

B 10 9 8

log CFU/ml

7 6 5 4 3 2 1

98

91

84

77

70

63

56

49

42

35

28

21

14

7

0

Time (days)

LAB-NC8

LAB-70/3

LAB-LB6

LAB-37A

LAB-57/1

LAB-Control

Fig. 2. Growth of the Lactobacillus plantarum strains used as inocula (A) and total lactic acid bacteria (LAB) (B) in Spanish-style green olive fermentations. Data represent average of log10 CFU/ml of triplicate fermentations. Symbol keys are shown below each panel. Notice that all the L. plantarum strains tested contained the plasmid pIL252 to allow selective counting. LAB-control refers to total LAB found in the fermentations which were no inoculated. Bars represent standard deviations. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

where LAB have to cope with stress conditions including, among others, acidic pH and growth-inhibitory phenolic compounds, both also present in olive fermentations. On the other hand, reduction of the lag phase in at least two weeks was observed in all the inoculated fermentations when compared to the control, non-inoculated ones (Fig. 2). Reduction of the lag phase of these fermentations is very important and could help to avoid early colonisation with spoilage or unwanted microorganisms. It also shortens the total time of fermentation required to get good quality products. This is very demanded by the table olive industrial manufacturers, who want to speed the process up before low temperatures during the winter season stop the fermentations. Regarding the physical parameters of the fermentations, after one week of fermentation, NaCl achieved its equilibrium in the brines at an average concentration of 4.03% (w/v; s.d. 0.035). Drop of pH value was quite homogeneous in the different fermentors and no statistically significant differences were found along the complete fermentation. However, pH drop in non-inoculated control fermentations was delayed during the first two weeks, achieving pH values similar to those exhibited by the inoculated fermentations after the third week (data not shown). Titratable acidity at the end of the fermentation was very similar in all of the

fermentors, and averaged 0.91% (w/v as lactic acid) with a s.d. of 0.05. We inoculated Spanish-style green olive fermentations in the hope that some of the conditions provided could promote plantaricin production and, as a consequence, enhance L. plantarum survival in the brines. Coculture with bacteriocin-production inducing bacteria such as L. lactis showed to be the most effective method to promote bacteriocin production, at least in the presence of 2% NaCl in synthetic medium. In traditional olive fermentations, however, NaCl concentration is about 4% at equilibrium, what appeared to be too high to allow proper bacteriocin production by AIP-regulated bacteriocinogenic L. plantarum and subsequent enhancement of its survival. We are currently investigating alternative olive fermentation methods aimed to reduce salt concentration in the brines so that effective bacteriocin production could take place even by AIP-regulated bacteriocinogenic L. plantarum strains. 4. Conclusions Plantaricin production in AIP-regulated L. plantarum strains is severely affected by the NaCl concentration in the culture medium.

96

B. Caballero-Guerrero et al. / Food Microbiology 33 (2013) 90e96

Although production in solid medium is not affected at values up to 4% (w/v) NaCl, in liquid medium no production was detected over 2% NaCl. However, there were differences among the strains used and the way to induce plantaricin production. Coculture with selected inducing bacteria was the most effective method to maintain plantaricin production in non-constitutive, AIP-regulated bacteriocinogenic L. plantarum strains in the presence of a moderate concentration of NaCl in liquid medium. Growth of such L. plantarum strains could not be enhanced in olive fermentations even when provided with different plantaricin-production inducing mechanisms such as constitutive AIP production or coculture with an inducing L. lactis strain. This was most probably due to the presence of 4% NaCl, a non-permissive concentration in liquid cultures. Therefore, it appears to be advisable to use constitutive bacteriocin producers, or at least non-AIP-dependant ones, as starters for olive fermentations. Acknowledgements This research was funded by the Spanish Ministry of Science and Innovation (MICINN) through Project AGL2009-07861, and by the Junta de Andalucía Excellence Project AGR-04621. AMB and HLP were the recipients of grants awarded by the Spanish National Research Council (CSIC) through the JAE Doc and JAE predoctoral Programmes, respectively. References Aukrust, T., Blom, H., 1992. Transformation of Lactobacillus strains used in meat and vegetable fermentations. Food Res. Int. 25, 253e261. Buckenhüskes, H.J., 1993. Selection criteria for lactic acid bacteria to be used as starter cultures for various food commodities. FEMS Microbiol. Rev. 12, 253e 272. Cotter, P.D., Hill, C., Ross, R.P., 2005. Bacteriocins: developing innate immunity for food. Nat. Rev. Microbiol. 3, 777e788. Diep, D.B., Straume, D., Kjos, M., Torres, C., Nes, I.F., 2009. An overview of the mosaic bacteriocin pln loci from Lactobacillus plantarum. A review. Peptides 30, 1562e 1574. Fernández-Díez, M.J., 1983. Olives. In: Reed (Ed.), Food and Feed Production with Microorganisms. Verlag Chemie, Deerfield Beach, Florida, USA, pp. 379e397. Garrido-Fernández, J., Maldonado-Barragán, A., Caballero-Guerrero, B., HorneroMéndez, D., Ruiz-Barba, J.L., 2010. Carotenoid production in Lactobacillus plantarum. Int. J. Food Microbiol. 140, 34e39. Jiménez-Díaz, R., Rios-Sánchez, R.M., Desmazeaud, M., Ruiz-Barba, J.L., Piard, J.C., 1993. Plantaricin S and T, two new bacteriocins produced by Lactobacillus plantarum LPCO10 isolated from a green olive fermentation. Appl. Environ. Microbiol. 59, 1416e1424.

Leal, M.V., Baras, M., Ruiz-Barba, J.L., Floriano, B., Jiménez-Diaz, R., 1998. Bacteriocin production and competitiveness of Lactobacillus plantarum LPCO10 in olive juice broth, a culture medium obtained from olives. Int. J. Food Microbiol. 43, 129e134. Leal-Sánchez, M.V., Jiménez-Diaz, R., Maldonado-Barragán, A., GarridoFernández, A., Ruiz-Barba, J.L., 2002. Optimization of bacteriocin production by batch fermentation of Lactobacillus plantarum LPCO10. Appl. Environ. Microbiol. 68, 4465e4471. Maldonado, A., Ruiz-Barba, J.L., Jiménez-Díaz, R., 2003. Purification and genetic characterization of plantaricin NC8, a novel coculture-inducible two-peptide bacteriocin from Lactobacillus plantarum NC8. Appl. Environ. Microbiol. 69, 383e389. Maldonado, A., Ruiz-Barba, J.L., Jiménez-Díaz, R., 2004a. Production of plantaricin NC8 by Lactobacillus plantarum NC8 is induced in the presence of different types of Gram-positive bacteria. Arch. Microbiol. 181, 8e16. Maldonado, A., Jiménez-Díaz, R., Ruiz-Barba, J.L., 2004b. Induction of plantaricin production in Lactobacillus plantarum NC8 after coculture with specific Grampositive bacteria is mediated by an autoinduction mechanism. J. Bacteriol. 186, 1556e1564. Maldonado-Barragán, A., Ruiz-Barba, J.L., Jiménez-Díaz, R., 2009. Knockout of threecomponent regulatory systems reveals that the apparently constitutive plantaricin-production phenotype shown by Lactobacillus plantarum on solid medium is regulated via quorum sensing. Int. J. Food Microbiol. 130, 35e42. Maldonado-Barragán, A., Caballero-Guerrero, B., Lucena-Padrós, H., Ruiz-Barba, J.L., 2013. Induction of bacteriocin production by coculture is widespread among plantaricin-producing Lactobacillus plantarum strains with different regulatory operons. Food Microbiol. 33, 40e47. Mascher, T., Helmann, J.D., Unden, G., 2006. Stimulus perception in bacterial signaltransducing histidine kinases. Microbiol. Mol. Biol. Rev. 70, 910e938. Nes, I.F., Eijsink, V.G.H., 1999. Regulation of group II peptide bacteriocin synthesis by quorum sensing mechanisms. In: Dunny, G.M., Winans, S.C. (Eds.), Cell-cell Signaling in Bacteria. American Society for Microbiology Press, Washington DC, pp. 175e192. Nilsen, T., Nes, I.F., Holo, H., 1998. An exported inducer peptide regulates bacteriocin production in Enterococcus faecium CTC492. J. Bacteriol. 180, 1848e1854. Rojo-Bezares, B., Sáenz, Y., Navarro, L., Zarazaga, M., Ruiz-Larrea, F., Torres, C., 2007. Coculture-inducible bacteriocin activity of Lactobacillus plantarum strain J23 isolated from grape must. Food Microbiol. 24, 482e491. Ruiz-Barba, J.L., Cathcart, D.P., Warner, P.J., Jiménez-Díaz, R., 1994. Use of Lactobacillus plantarum LPCO10, a bacteriocin producer, as a starter culture in Spanishstyle green olive fermentations. Appl. Environ. Microbiol. 60, 2059e2064. Ruiz-Barba, J.L., Maldonado, A., Jiménez-Díaz, R., 2005. Small-scale total DNA extraction from bacteria and yeast for PCR applications. Anal. Biochem. 347, 333e335. Ruiz-Barba, J.L., Caballero-Guerrero, B., Maldonado-Barragán, A., Jiménez-Díaz, R., 2010. Coculture with specific bacteria enhances survival of Lactobacillus plantarum NC8, an autoinducer-regulated bacteriocin producer, in olive fermentations. Food Microbiol. 27, 413e417. Settanni, L., Corsetti, A., 2008. Application of bacteriocins in vegetable food biopreservation. Int. J. Food Microbiol. 121, 123e138. Simon, D., Chopin, A., 1988. Construction of a vector plasmid family and its use for molecular cloning in Streptococcus lactis. Biochimie 70, 559e566. Verluyten, J., Messens, W., De Vuyst, L., 2004. Sodium chloride reduces production of Curvacin A, a bacteriocin produced by Lactobacillus curvatus strain LTH 1174, originating from fermented sausage. Appl. Environ. Microbiol. 70, 2271e2278.