High species richness of Northwest Pacific deep-sea amphipods revealed through DNA barcoding

Progress in Oceanography 178 (2019) 102184

Contents lists available at ScienceDirect

Progress in Oceanography journal homepage: www.elsevier.com/locate/pocean

High species richness of Northwest Pacific deep-sea amphipods revealed through DNA barcoding

T

Anna Maria Jażdżewska , Tomasz Mamos ⁎

Department of Invertebrate Zoology and Hydrobiology, Faculty of Biology and Environmental Protection, University of Lodz, 12/16 Banacha st., 90-237 Lodz, Poland

ARTICLE INFO

ABSTRACT

Keywords: Kuril-Kamchatka Trench Abyssal Hadal Amphipoda DNA barcoding Molecular diversity Species distribution

Although deep sea has become a subject of intense studies in the recent years, our knowledge of the diversity of benthic organisms, especially at the molecular level, is far from complete. In the present study we focused on Amphipoda, known to be an abundant and diverse component of the marine zoobenthos. COI barcoding of an extensive collection of abyssal and hadal amphipods from the Kuril-Kamchatka Trench (KKT) area revealed 133 Molecular Operational Taxonomical Units (MOTUs). The richness of species varied between stations, with the highest observed in the areas where high organic carbon (Corg) content was recorded. Among the recognized MOTUs as many as 42% were singletons and only 28 were found at three or more stations. Their distribution was variable with seven taxa occurring at the most distant stations situated across the KKT. This shows that the trench does not constitute a barrier for the distribution of certain species. However, it may limit the gene flow in the case of others. The most common MOTUs were divided into three bathymetric categories: typically abyssal and hadal species as well as eurybathic ones inhabiting both the abyssal and hadal depth zones.

1. Introduction Although the deep sea is the World's largest ecosystem hosting important biological as well as mineral resources and the knowledge of this vast environment has grown rapidly in the last decades, our understanding of its diversity and functioning is still far from complete (Ramirez-Llodra et al., 2010). The ideas about the biodiversity of the deep sea have been changing for years, fluctuating between initial assumptions of an underwater desert (Anderson and Rice, 2006) and subsequent anticipation of harbouring a “hyper diverse” fauna (Hessler and Sanders, 1967). Moreover, it was proposed that the bathymetric distribution of benthic diversity pattern was unimodal, with the highest richness observed in the lower bathyal, decreasing towards the abyssal (Gray, 2001). Rex et al. (2005) suggested the “source-sink hypothesis” explaining that the abyssal fauna was derived from and constituted a subset of the bathyal fauna. This statement has already been challenged in certain cases. For example, in the Southern Ocean a very high diversity of abyssal macrobenthic organisms was observed also confirming the specificity of this fauna (Brandt et al., 2007). A study of the megafauna in the Porcupine Abyssal Plain indicated a potentially higher diversity in the deep sea than previously expected due to the presence of abyssal hills which increase local habitat complexity (Durden et al., 2015). In summary, it can be said that “the deep sea is

⁎

Corresponding author. E-mail address: [email protected] (A.M. Jażdżewska).

https://doi.org/10.1016/j.pocean.2019.102184

Available online 12 September 2019 0079-6611/ © 2019 Elsevier Ltd. All rights reserved.

unquestionably diverse but the question how diverse remains unresolved” (Ramirez-Llodra et al., 2010). Another issue of deep-sea fauna concerns biogeographic distribution of species. It has been proposed that stable environmental conditions allow the organisms to inhabit large areas and that physiographic barriers (like underwater ridges or trenches) do not strongly affect taxa distribution (e.g. Brix et al., 2011, 2015; Etter et al., 2011; Baco et al., 2016). However, the ranges of deep-sea invertebrates, especially those inhabiting abyssal and hadal depths, are still rarely studied using molecular methods (Taylor and Roterman, 2017). Amphipoda, belonging to the peracarid crustaceans, are speciose and abundant in all marine habitats from the Equator to the poles and from coastal waters till the deepest trenches (e.g., Brandt et al., 2007; Plaisance et al., 2009; Jamieson et al., 2011). In the deep sea amphipod diversity and abundance is known to be high in the bathyal, decreasing towards abyssal and hadal depths where they are surpassed in diversity by another peracarid order, the Isopoda (Lörz et al., 2013; Frutos et al., 2017; Golovan et al., 2019). The number of hitherto known deep-sea benthic amphipod species (recorded below 2000 m) is 400. This number, however, is much lower than the real deep-sea amphipod species richness. For example, from only three deep-sea Antarctic cruises there are ca. 500 species new to science still waiting to be described (Jażdżewska, 2015, updated). Another characteristic of the

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

deep-sea amphipod fauna is its uniqueness because many of the species are known only from original descriptions and have never been resampled. So far, within the described deep-sea amphipod species only ten have a wide geographic distribution (Brandt et al., 2012; Jażdżewska, 2015). Our knowledge about deep-sea Amphipoda is also biased by the differences in the intensity of studies of various ecological groups. Amphipods inhabiting hydrothermal vents have received some attention (e.g., France et al., 1992; Cuvelier et al., 2011). The best but still incompletely studied group is the scavenger guild and several publications based on the baited trap samples were presented up to now (reviewed by Havermans and Smetacek, 2018). In contrast, the abyssal benthic amphipod fauna that is not attracted by bait has almost not been studied at all. In the recent years the quantification of biodiversity has been sped up thanks to DNA barcoding (Pecnikar and Buzan, 2014). Within marine and deep sea Peracarida this technique, when associated with morphological studies, often revealed hidden diversity, including the recognition of cryptic or pseudocryptic species (e.g. Bober et al., 2018b; Havermans, 2016; Verheye et al., 2016). It has also shed new light onto the knowledge about the species distribution, proving that several taxa considered as widely distributed are species complexes of much narrower ranges (e.g., Lörz et al., 2009; Havermans, 2016). First biological investigations in the Kuril-Kamchatka Trench (KKT) area date back to the 50-ties of 20th century when several oceanographic cruises on the RV Vityaz were performed. Based on these expeditions and some additional occasional studies a list of 53 deep-sea benthic and bentho-pelagic amphipod species (known from the depths below 2000 m) from NW Pacific was assembled (Jażdżewska, 2015; Lörz et al., 2018a, updated and corrected). However, the gears used during Vityaz cruises were suitable to collect only larger macrofauna and megafauna so it was suggested that the actual diversity of these waters was largely underestimated (Birstein, 1963). In the last ten years two German-Russian expeditions to KKT and the adjacent abyssal plain with RV Sonne were conducted (KurileKamchatka Biodiversity Studies, KuramBio I and II, 2012 and 2016). These expeditions, together with another two Russian-German cruises, SoJaBio (Sea of Japan Biodiversity Studies) in 2010 and SokhoBio (Sea of Okhotsk Biodiversity Studies) in 2015, aimed to study the

biodiversity and biogeography as well as trophic characteristics of the benthic organisms in these different Northwest Pacific deep-sea environments (Brandt et al., 2019). The samples were collected using several gears according to standardised protocols, allowing to obtain extensive comparative collections of invertebrates from all deep-sea habitats which were also suitable for molecular studies. Both KuramBio expeditions sampled 39 stations in the depth range of 4900–9500 m. Amphipoda proved to be an abundant peracarid group in all samples, constituting the second most abundant crustacean order after Isopoda (Brandt et al., 2015, 2019). The morphological study of the collection from the abyssal plain adjacent to the KKT revealed 79 morphospecies 28 of which are new to science (Jażdżewska, 2015; Golovan et al., 2019). As it has already been noted, exclusively morphological analyses may cause some part of the diversity to be overlooked, especially when cryptic species are taken into consideration. The main goal of this paper is to identify the biodiversity of deep-sea amphipods in the KurilKamchatka Trench area and to recognize the underlying geographical patterns. To achieve this goal, the following questions will be answered: 1. Does a stable deep-sea environment limit species richness? 2. Do the abyssal and hadal benthic amphipods from the KKT area have large geographic ranges? 3. Does the KKT constitute a barrier for abyssal benthic species dispersion? An additional goal of the study is to provide the barcode reference library for further morphological and ecological studies. 2. Material and methods 2.1. Study area The Kuril-Kamchatka Trench (Fig. 1) was formed as a result of the subduction of the Pacific Plate beneath the Okhotsk Plate. The process caused submarine uplift and is also responsible for the formation of the Kuril islands arc as well as the Kamchatka volcanic arc. The trench

Fig. 1. Localization of sampling stations. 2

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Table 1 Stations where individuals for the present work were collected; KBI – KuramBio I, KBII – KuramBio II, No of ind. – number of individuals taken for genetic analyses. Expedition

KBI KBI KBI KBI KBI KBI KBI KBI KBI KBI KBI KBI KBI KBII KBII KBII KBII KBII KBII KBII KBII KBII KBII KBII KBII KBII KBII KBII

Station code

1–10 2–9 3–9 4–3 5–9 6–11 7–9 8–9 9–9 10–9 11–9 12–4 12–5 10 17 19 28 30 40 42 52 55 77 85 87 89 97 102

Gear

EBS EBS EBS EBS EBS EBS EBS EBS EBS EBS EBS EBS AGT EBS EBS EBS EBS EBS EBS EBS EBS EBS EBS EBS EBS EBS EBS EBS

Date

2012-07-30 2012-08-02 2012-08-05 2012-08-12 2012-08-11 2012-08-15 2012-08-17 2012-08-20 2012-08-23 2012-08-26 2012-08-30 2012-09-01 2012-09-01 2016-08-20 2016-08-22 2016-08-23 2016-08-25 2016-08-27 2016-08-29 2016-08-30 2016-09-06 2016-09-06 2016-09-13 2016-09-15 2016-09-16 2016-09-16 2016-09-18 2016-09-20

Position start

Position start

Latitude

Longitude

Latitude

Longitude

43°58.35′N 46°14.78′N 47°14.66′N 46°58.34′N 43°34.46′N 42°28.61′N 43°01.78′N 42°14.32′N 40°34.51′N 41°12.80′N 40°12.49′N 39°42.78°N 39°43.09′N 43°49.43′N 45°52.04′N 45°52.02′N 45°54.43′N 45°56.38′N 45°38.00′N 45°39.62′N 45°29.77′N 45°29.24′N 45°13.71′N 45°02.26′N 45°00.76′N 44°40.12′N 44°05.68′N 44°11.99′N

157°18.23′E 155°32.63′E 154°42.88′E 154°33.03′E 153°58.13′E 153°59.68′E 152°58.61′E 151°42.68′E 150°59.92′E 150°6.162′E 148°05.40′E 147°09.55′E 147°9.86′E 151°46.96′E 153°51.39′E 153°51.15′E 152°47.02′E 152°56.70′E 152°55.95′E 152°56.39′E 153°12.16′E 153°13.46′E 152°51.21′E 151°02.14′E 151°05.53′E 151°27.35′E 151°24.88′E 150°34.07′E

43°58.33′N 46°14.92′N 47°14.76′N 46°58.46′N 43°34.30′N 42°28.47′N 43°01.49′N 42°14.27′N 40°34.25′N 41°13.01′N 40°12.37′N 39°42.49′N 39°42.80′N 43°48.45′N 45°51.40′N 45°51.41′N 45°54.52′N 45°56.83′N 45°40.83′N 45°40.26′N 45°29.18′N 45°29.58′N 45°14.21′N 45°01.64′N 45°01.65′N 44°39.05′N 44°06.94′N 44°12.00′N

157°17.97′E 155°32.57′E 154°43.03′E 154°33.39′E 153°58.16′E 153°59.66′E 152°58.36′E 151°42.49′E 150°59.91′E 150°05.652′E 148°05.43′E 147°09.37′E 147°9.68′E 151°47.17′E 153°50.41′E 153°50.21′E 152°47.20′E 152°50.93′E 152°57.68′E 152°57.63′E 153°11.13′E 153°12.24′E 152°49.95′E 151°03.68′E 151°05.52′E 151°27.34′E 151°24.88′E 150°32.74′E

extends from the southeast coast of Kamchatka in parallel to the Kuril Islands chain to meet the Japan Trench east of Hokkaido. It separates the abyssal seafloor of the NW Pacific Basin from the Kuril slope. The hydrography of the KKT area is complex with bottom currents deriving from the northward flowing Lower Circumpolar Deep Water (Kawabe and Fujio, 2010; Takeuchi et al., 2016). The local seafloor topography contributes to the formation of a southward-flowing deep western boundary current (Uehara and Miyake, 1999). Additionally, near the Bussol' Strait various anticyclonic eddies were observed (Rabinovich et al., 2002).

Depth [m]

No of ind.

5419–5422 4866–4862 4987–4992 5741–5732 5378–5376 5290–5305 5222–5521 5125–5216 5400–5399 5249–5249 5347–5350 5223–5219 5226–5225 5119–5104 8185–8183 8192–8187 6050–6047 6228–6163 7300–7055 7110–7119 8704–8698 8743–8735 9427–9582 4903–5265 5475–5477 8227–8216 6440–6560 9547–9473

58 72 190 36 61 26 61 83 86 44 74 112 24 38 7 13 2 6 37 3 2 4 4 1 1 8 10 4

Database (Horton et al., 2019). Due to difficulties with differentiation of Amphipoda from the families Lysianassidae, Uristidae and Tryphosidae, representatives of these three taxa were combined in one group – Lysianassoidea. 2.4. Molecular procedures For each recognized morphospecies and each station at most ten individuals were chosen for genetic analyses resulting in 1067 specimens studied. In the case of amphipods collected during the KuramBio I expedition (13 stations, 927 individuals) a standard phenol-chloroform method following Hillis et al. (1996) was used. Air-dried DNA pellets were eluted in 100 μl TE buffer, pH 8.00, stored at 4 °C until amplification, and subsequently at −20 °C for long-term storage. The DNA extraction from the individuals collected during KuramBio II expedition (15 stations, 140 individuals) was performed on board with 100 μl InstaGene™ Matrix (BIO-RAD). The digestion was done at 56 °C for 40 min. The DNA barcoding fragment of Cytochrome-c-Oxidase subunit I gene (COI; ca. 670 bp) was amplified using a combination of several forward and reverse primers (Table 2) with DreamTaq Green PCR Mastermix (Thermo Scientific) and reaction conditions following Hou et al. (2007). Sequences were obtained using BigDye sequencing protocol (Applied Biosystems 3730xl) by Macrogen Inc., Korea (sequencing was performed either one or two ways). Sequences were edited using Geneious 10.1.2 leading to 510 sequences of 576–657 bp (excluding primers). At least one representative of each recognized Molecular Operational Taxonomical Unit (MOTU, see below) was taken for 16S gene analysis. It was amplified using the primer pair 16SFt_amp/16SRt_amp2 in the conditions presented by Lörz et al. (2018a,b)). Sequencing and editing was performed the same way as for COI resulting in 169 sequences of 339–435 bp (excluding primers). All sequences were deposited in GenBank with the accession numbers: MH272100–MH272127, MK402296–MK402312, MN346193–MN346657 (COI) and MH27209699, MK402295, MN228697–MN228842 (16S) (Table S1). Relevant

2.2. Sampling The samples for the present study (Table 1) were taken by two types of epibenthic-sledge described in Brenke (2005) and Brandt et al. (2015, 2013). Both gears are equipped with supra- and epibenthic samplers possessing two plankton nets (500 μm) on top of each other leading to two cod ends (300 μm mesh size). The details of the deployment procedure of the EBS and sample treatment are presented in Brandt et al. (2019). On board all samples were fixed in precooled (−20 °C) undenatured 96% ethanol and treated as described in Riehl et al. (2014). Large amphipod specimens were immediately sorted on deck, fixed in −20° precooled 98% ethanol and later transferred to 96% ethanol. One additional sample of Amphipoda used in the study comes from the Agassiz trawl (AGT). 2.3. Morphological study Prior to the DNA extraction amphipods were sorted and identified on the basis of their morphological characters to the lowest level possible using a Nikon SMZ800 dissecting microscope and a Nikon Eclipse compound microscope. The recognized groups that form phenotypic clusters without overlap between them are henceforth called “morphospecies”. The classification used in the present study follows Lowry and Myers (2017) publicly available through the World Amphipoda 3

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Table 2 Summary of the primers used in the present study. Gene

Name

Sequence 5′-3′

Direction

Reference

COI

LCO1490 LCO1490-JJ UCOIR HCO2198 HCO2198-JJ UCOIF HCOout HCOoutout 16SFt_amp 16SRt_amp2

GGTCAACAAATCATAAAGATATTGG CHACWAAYCATAAAGATATYGG ACWAAYCAYAAAGAYATYGG TAAACTTCAGGGTGACCAAAAAATCA AWACTTCVGGRTGVCCAAARAATCA TAWACTTCDGGRTGRCCRAAAAAYCA CCAGGTAAAATTAAAATATAAACTTC GTAAATATATGRTGDGCTC GCRGTATIYTRACYGTGCTAAGG CTGGCTTAAACCGRTYTGAACTC

Forward Forward Forward Reverse Reverse Reverse Reverse Reverse Forward Reverse

Folmer et al., 1994 Astrin and Stüben, 2008 Costa et al., 2009 Folmer et al., 1994 Astrin and Stüben, 2008 Costa et al., 2009 Carpenter and Wheeler, 1999 Prendini et al., 2005 Lörz et al., 2018b Lörz et al., 2018b

16S

Table 3 Number of individuals studied (No of ind.), COI and 16S sequences, Barcode Index Numbers (BINs), Molecular Operational Taxonomic Units (MOTUs) based on ABGD and morphospecies (morph) recognized in each family as well as the reference to the figure with NJ tree and distribution map (tree & map). Systematic division based on Myers and Lowry (2017), available online in World Amphipoda Database (Horton et al., 2019).

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31.

Suborder

Parvorder

Superfamily

Taxon

No of ind.

COI

16S

BINs

MOTUs

morph

Tree & map

Amphilochidea

Amphilochidira

Amphilochoidea

Amphilochidae Stenothoidae Stilipedidae Leucothoidae Eusiridae Liljeborgiidae Phoxocephalidae Alicellidae Parargissidae Valettiopsidae Vemanidae Conicostomatidae Pakynidae Cyphocarididae Hirondelleidae Lysianassoidea Scopelocheiridae Stegocephalidae Oedicerotidae Fam. nov. Atylidae Pardaliscidae Ampeliscidae Synopiidae Hyperiopsidae Dulichiidae Ischyroceridae Photidae Unciolidae Calliopiidae Maeridae Total

1 8 10 3 135 5 206 1 5 4 16 2 2 12 6 108 1 19 37 37 9 205 12 154 4 11 11 4 3 11 25 1067

0 0 9 1 87 2 57 1 4 1 5 1 2 8 6 52 1 3 13 13 8 128 2 60 2 11 3 4 3 5 18 510

0 0 8 1 9 1 17 1 2 1 4 1 2 1 1 29 1 1 8 11 1 24 1 8 1 4 1 1 1 3 2 146

0 0 4 1 14 2 18 1 2 1 1 1 1 2 1 30 1 2 7 2 2 24 2 13 1 5 2 1 1 3 2 147

0 0 4 1 12 2 14 1 2 1 1 1 1 2 1 26 1 2 7 2 2 22 2 12 1 4 2 1 1 3 2 133

1 1 3 1 7 1 7 1 2 1 1 1 1 2 1 8 1 1 5 2 2 11 2 4 1 1 2 1 1 3 2 76

– – Fig. 2

Eusiridira Haustoriidira Lysianassidira

Iphimedioidea Leucothoidea Eusiroidea Liljeborgioidea Haustorioidea Alicelloidea

Aristioidea Lysianassoidea

Oedicerotidira Synopiidira

Stegocephaloidea Oedicerotoidea Dexaminoidea Synopioidea

Hyperiopsidea Senticaudata

Hyperiopsidira Caprellidira

Hyperiopsoidea Caprelloidea Photoidea

Corophiidira Hadziidira

Aorioidea Calliopioidea Hadzioidea

voucher information, taxonomic classifications, and sequences are accessible through the public data set “DS-AMPHIKUK” (doi: dx.doi.org/ 10.5883/DS-AMPHIKUK) in BOLD (www.boldsystems.org) (Ratnasingham and Hebert, 2007). Sequences of two species (Rhachotropis saskia Lörz & Jażdżewska, 2018 and Bathyceradocus hawkingi Jażdżewska & Ziemkiewicz, 2019) described on the basis of the material from KuramBio I and II expeditions were already published (Jażdżewska and Ziemkiewicz, 2019; Lörz et al., 2018a).

Fig. 3 Fig. 4 & Fig. 5

Fig. 3 Fig. 6 Fig. 7 – Fig. 8

collection. Trace files of all obtained sequences were visually inspected in order to identify potential ambiguities and sequencing errors. Multiple sequence alignment and trimming was performed with MAFFT 7 (Katoh et al., 2002; Katoh and Standley, 2013) using the automatic algorithm both for COI and 16S in Geneious. COI sequences were translated in order to ensure their quality. All sequences were positively verified as Amphipoda DNA via BLASTn searches against GenBank (Altschul et al., 1990). Three methods of species delimitation were used. Morphologically, specimens were sorted into phenotypic clusters assuming that conspecificity leads to morphological similarity i.e. “morphospecies”. These were compared to Molecular Operational Taxonomical Units (MOTUs) delimited by two different methods both of which rely on genetic distances: Barcode Index Numbers (henceforward called “BINs”) and barcoding gaps (called “ABGD groups”). The COI sequences were subjected to Barcode Index Number (BIN) System (Ratnasingham and Hebert, 2013) in the Barcoding of Life Data System (BOLD). It

2.5. Data analysis Because barcoding of deep-water invertebrates can be troublesome (e.g. Riehl et al., 2014) we calculated the sequencing success for each identified family. The same measure per station was provided only for the samples collected during KuramBio I expedition becausfe a large proportion of the material collected during the expedition in 2016 still needs to be processed. For the same reason the summary of the species richness recorded at each station was done only for the KuramBio I 4

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Fig. 2. A – Neighbour-joining (NJ) tree of COI sequences of amphipods belonging to the families Eusiridae, Leucothoidae, Liljeborgiidae, and Stilipedidae (parvorders Amphilochidira and Eusiridira). The distances were calculated with Kimura 2-parameter. Triangles indicate the relative number of individuals studied (height) and sequence divergence (width). The numbers in front of the nodes indicate bootstrap support (1000 replicates, only values higher than 50% are presented). The vertical bars represent species delimitations taxonomies obtained from morphology and different species delimitation methods. Only the cases where incongruence between different delimitation methods were observed are shown. Note that this tree is not the reconstruction of evolutionary history of presented taxa. B – Map showing the distribution of the ABGD MOTUs from the NJ tree recorded at three or more stations.

compares newly submitted sequences with the sequences already available in BOLD. They are clustered according to their molecular divergence using algorithms aiming at finding discontinuities between clusters. Each cluster receives an unique and specific code (BIN), either already available or new if submitted sequences do not cluster with already known BINs. Additionally, the Automatic Barcode Gap Discovery (ABGD) software was used for MOTUs delimitation (Puillandre et al., 2012). The ABGD method is based upon pairwise distance measures. With this method the sequences are segregated into MOTUs so that the distance between two sequences from two different groups will always be larger than a given threshold distance (i.e., barcode gap). In order to compare the barcode gap with other papers on marine Amphipoda (e.g. Costa et al., 2007, 2009), also studying distinct taxa, the intraspecific distance of 0.001 to 0.2 was explored with Kimura 2parameter (K2P) molecular distance. We used initial partitions

generated by ABGD as a principal for group definition, as they are stable on a wide range of prior values, minimise the number of false positive (over-split of species) and are usually close to the number of taxa described by taxonomists (Puillandre et al., 2012). In the cases when more than one BIN was associated with single ABGD group the uncorrected p-distance and the Kimura 2-parameter (K2P) (Kimura, 1980) were calculated. For graphic presentation of MOTUs and morphospecies relations Neighbour-Joining (NJ) trees for the whole COI and 16S data sets were generated using K2P distances with 1000 bootstrap replicates (Felsenstein, 1985) in MEGA V7.0.18 (Kumar et al., 2016) treating all alignment gaps as missing data in case of 16S. Additionally, trees using the same approach were generated for families and taxonomic groups. The geographic ranges of ABGD groups were checked and distribution maps were generated for the groups found at least at three 5

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Fig. 3. Neighbour-joining (NJ) tree of COI sequences of amphipods belonging to the Oedicerotidae (A) and the Phoxocephalidae (B). Details about the calculation and presentation of the tree as in Fig. 2A. C – Map showing the distribution of the ABGD MOTUs from the NJ tree recorded at three or more stations.

stations (28) using QGIS (QGIS, 2018). The bathymetric ranges of these 28 groups were also checked and presented.

limitation the identification of the remaining specimens was left at a higher level and concerned mainly the representatives of the Lysianassoidea. Out of more than a thousand individuals taken for DNA extraction 510 sequences were successfully obtained (48%) (Table 3, Supplement 1, Figs S1–S2). No sequences were obtained for the representatives of two identified morphospecies (from the families Amphilochidae and Stenothoidae).

3. Results Morphological identification of the whole collection (1067 ind.) allowed to assign 731 individuals to 76 morphospecies. Due to the time 6

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Table 4 Genetic distances for COI and 16S haplotypes in taxa where the incongruence of molecular delimitation of species was observed. Taxon name

ABGD group

Rhachotropis saskia

Group 48

Harpiniinae sp. 1

Group 31

Harpiniinae sp. 4

Group 11

Leptophoxus sp. 1

Group 4

Lysianassidae sp. 10

Group 18

Lysianassoidea sp. 13 Group 70 Lysianassoidea

Group 109

Pardaliscidae sp. 16

Group 96

Synopiidae

Group 59

Dulichiidae sp. 1

Group 122

Assigned BIN No of COI seq.

No of COI haplotypes

ADF5254 ADH6927 ADH6163 ADF8036 ADR2592 ADF6401 ADF6763 ACZ1846 ACZ1847 ADK9139 ADF7380 ADF7384 ADF7551 ADF7552 ADF7382 ADG6294 ADF6945 ADF5299 ADF5300 ADF5676 ADF5373 ADF5954 ADF6115 ADF6575

2 2 3 2 1 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 3

28 2 6 2 3 3 1 7 8 1 4 2 1 1 1 1 1 7 4 7 2 2 2 4

Distance between COI haplotypes p-distance

S.E.

K2P

S.E.

0.016

0.003

0.016

0.003

0.018

0.004

0.018

0.005

0.018

0.004

0.019

0.004

0.024

0.005

0.024

0.005

0.024

0.006

0.025

0.006

0.034

0.006

0.035

0.007

0.041

0.007

0.042

0.008

0.025

0.005

0.026

0.005

0.019

0.004

0.019

0.004

0.019

0.004

0.02

0.004

No of 16S seq.

No of 16S haplotypes

2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 – – 1 1

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 – – 1 1

Distance between 16S haplotypes p-distance

S.E.

K2P

S.E.

0.001

0.001

0.001

0.001

0.016

0.006

0.016

0.006

0.038

0.01

0.039

0.01

0.007

0.003

0.007

0.003

0.011

0.005

0.011

0.005

0.017

0.005

0.017

0.005

0.025

0.007

0.026

0.008

0.009

0.004

0.009

0.003

– – 0.018

– – 0.007

– – 0.019

– – 0.007

highest number of individuals was collected and studied. Two stations where the number of individuals was lower, but the taxon richness was similarly high, were 7–9 and 1–10 (21, and 20 taxa, respectively). The geographic distribution of the ABGD groups did not show a clear pattern (Figs. 2, 3, 5–8). Within each family there were species restricted only to the ocean side of the KKT while others were recorded on its both sides. The most widely distributed ABGD groups (recorded at stations with greatest distance from each other: 3–9 and 12–4, additionally separated by KKT) included: Caleidoscopsis sp. 1 (ACZ2374), Harpiniinae sp. 4, Synopiidae sp. 10 (ADF7680), Vemana sp., Lysianassoidea sp. 13 (ADF7555), Rhachotropis saskia, and Eusirus sp. 1. The ABGD groups were divided into three bathymetric categories (Fig. 10). The first, restricted to the abyssal depths, consisted of 21 species, the second grouped four species (R. saskia, Lysianassoidea sp. 13 [ADF7555], Lepechinella cf. ultraabyssalis, and Synopiidae [ADF6294]) recorded in the abyssal but extending their range into the hadal. The third set of taxa (four species: Hirondellea gigas, Princaxelia cf. jamiesoni, Halice quarta, and Halice sp. 1) was collected only at hadal stations.

A discrepancy between morphological identification and molecular delimitation based on ABGD was recorded in six cases (Figs. 2, 3, 6). The highest number (four) was recorded within the Phoxocephalidae, single case occurred both in the Stilipedidae and in the Pardaliscidae. The number of ABGD groups recorded for single morphospecies varied from two (Astyroides cf. carinatus, Harpiniinae sp. 1, Harpiniinae sp. 5, Phoxocephalinae sp. 2) to seven (Caleidoscopsis sp. 1) indicating cryptic diversity. No unification of different morphospecies after the molecular analysis was recorded. The BOLD analysis resulted in the ascription of 147 Barcode Identity Numbers (BINs) (Tables 3, S1). 142 of them were unique for the database and were added to the BOLD for the first time. Two of the latter are associated with the known species names (Hirondellea gigas and Bathycallisoma schellenbergi), while another three were identified to genus level (Cyphocaris, Halice and Paralicella). The initial partitions of ABGD method resulted in stable division into 133 molecular groups within a wide range of P values (0.001–0.09) providing a clear barcoding gap (Fig. S3). The incongruence between the two methods of molecular species delimitation was observed within ten taxa: in six cases there were two BINs associated with a single ABGD group, in another four cases three BINs characterized a single ABGD group (Table 4, Figs. 2–4, 6–8). In the cited cases the intraspecific distance of the COI gene varied from 0.016 to 0.041 for p-distance (0.016–0.042 for K2P), while the 16S p-distance and K2P-distance equalled 0.001–0.038 and 0.001–0.039, respectively. Among the 133 MOTUs revealed by the ABGD method 42% were singletons and 26 taxa (19%) were represented by two sequences. Thirteen MOTUs (10% of all delimited ones) were represented by ten or more sequences. The Lysianassoidea was the most diverse group with 26 MOTUs recognized (Table 3). The second in terms of richness was the Pardalisicidae (21 MOTUs), followed by the Phoxocephalidae (14 MOTUs). The Eusiridae and the Synopiidae were represented by 12 MOTUs each. The analysis of 16S marker showed similar results (Figs. S4-S8). The number of families per station varied from two (6–11) to 14 (3–9) while the number of ABGD groups varied from two to 30 (Fig. 9). The highest number of MOTUs was recorded at the stations 12–4 and 3–9 (30 and 29, respectively). These were also the stations where the

4. Discussion In the current studies we have used barcoding in order to identify biodiversity of deep-sea amphipods in the KKT area and recognize geographical patterns behind it. The use of barcodes is presented as very promising in biodiversity assessments, ecological and monitoring studies (reviewed by Kress et al., 2015). The creation of barcode library associated with species identified by the taxonomic specialist was the idea behind the Barcode of Life Data System, as well as the BIN system to recognize putative species (Ratnasingham and Hebert, 2007, 2013). In the present study almost 100% of the sequences had not been published before thus underlining how poor the knowledge of the deep-sea fauna still is. It is worth noting that molecular studies on deep-sea organisms are challenging. The reasons include difficulties in obtaining sufficient quantities of individuals and difficulties with extraction and amplification of DNA (e.g. Raupach et al., 2004; Brix et al., 2011, Błażewicz pers. comm.). The overall sequencing success in the present study was close to 50%, that is lower than observed for some deep-sea 7

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Fig. 4. Neighbour-joining (NJ) tree of COI sequences of amphipods belonging to the parvorder Lysianassidira (for families see Table 3). Details about the calculation and presentation of the tree as in Fig. 2A.

isopods (Riehl et al., 2014) and Antarctic amphipods (Havermans et al., 2018) but higher than noted for abyssal Pacific Polychaeta and Isopoda from the Clarion Clipperton Zone (41% and 31%, respectively) (Janssen et al., 2015).

et al., 2018; Verheye et al., 2016). In our study we have applied two methods of species delimitation based on genetic data (BIN and ABGD) and in ten cases discrepancies were revealed. While BIN algorithm assumes species threshold at ca. 2% (Ratnasingham and Hebert, 2013) a general threshold suggested for crustaceans, including marine amphipods, was considered to be 3% or 4% of K2P distance (e.g. Costa et al., 2007, 2009; Raupach et al., 2015; Lobo et al., 2017). However, a study on deep-sea Phoxocephalidae already indicated a species threshold at 6% K2P within this group (Knox et al., 2012). A recent study by Tempestini et al. (2018) on different families of marine Amphipoda

4.1. Species delimitation of marine amphipods using molecular methods Molecular methods offer a powerful tool for species delimitation but it has been already noted that different algorithms may result in different numbers of recognized MOTUs (e.g. Brix et al., 2018a; Kaiser 8

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Fig. 5. Map showing the distribution of the ABGD MOTUs from the NJ tree of the Lysianassidira recorded at three or more stations.

representative of this family, Astyra abyssi, in Icelandic waters, where two lineages recognized at similar level of molecular divergence inhabited different depth zones (shelf vs. bathyal) (Jażdżewska et al., 2018). In both cases the low number of available individuals and the molecular divergence that only slightly exceeds the universal threshold value used to separate crustacean species (cf. Costa et al., 2007, 2009) and is below the threshold proposed by Tempestini et al. (2018), do not allow to finally decide if these are two different species or they represent single units.

found that 7% of p-distance is a robust threshold value to delineate species within Amphipoda. These thresholds are congruent with the wide gap of ca. 2–15% K2P presently observed (Fig. S3). However, it needs highlighting that this wide gap is probably an effect of the specificity of our data that contain distinct, insufficiently sampled taxa (e.g. Wiemers and Fiedler, 2007). In the future, studies focused on particular families based on more comprehensive sampling will undoubtedly provide taxon specific, narrow barcoding gaps. To solve problems with species delimitation other genes than COI, for example 16S, can be applied. Despite being also mtDNA gene it evolves more slowly, therefore it holds some potential for better resolution of problematic taxa (e.g. Lörz et al., 2018b). In the cases where more than one BIN was associated with a single ABGD group the results from 16S supported unification of taxa in four cases, while in the remaining six such decision could not be made (Table 4). Further studies using nuclear genes and including more individuals for morphological analyses are required to strengthen the assumption about unification or split of the problematic taxa. An important limitation here is the patchiness of deep-sea fauna distribution (e.g. Kaiser et al., 2007) that together with still insufficient sampling cause that many taxa are singletons (i.e. represented by single individuals) or occur only at single stations (e.g. Błażewicz-Paszkowycz et al., 2015; Elsner et al., 2015; Janssen et al., 2015; Kamenev, 2015). Based on the obtained barcode sequences an incongruence between morphological and molecular species discovery was observed. The most striking example in the studied collection is the morphospecies Caleidoscopsis sp. 1, where as many as seven clearly separated, partially sympatric lineages were distinguished. However, the detailed morphological study required for proper taxonomic descriptions of the recognized ABGD groups was not the scope of this study. The morphospecies Astyroides cf. carinatus belonging to the Stilipedidae is also an interesting case. Within this morphospecies two groups were recognized by both the ABGD method and BINs having ca. 6% of K2P and 5.5% of p-distance between them. The two groups seem to have distinct depth distributions with one found at two abyssal stations on both sides of the KKT while the other was recovered from two hadal stations. It may be assumed that they are two sibling species that inhabit different depth zones. Similar separation was observed for another

4.2. Taxonomic richness of Amphipoda from Northwest Pacific A previous study analyzing diversity of Peracarida from the KKT region, based on the material from KuramBio I and only on morphological data, indicated that among 79 reported species about one third is new to science (Jażdżewska, 2015; Golovan et al., 2019). In the present work the molecular delimitation of species indicated that there were many more species that had formerly been overlooked in the studied area. Given that only half of the individuals chosen for genetics could be successfully amplified, the amphipod diversity shown here may still be underestimated. Nevertheless, some interesting patterns were observed. The highest diversity of ABGD groups was observed at two stations situated on both sides of KKT (3–9 and 12–4). These were the stations with high abundances of macrofauna and meiofauna (Brandt et al., 2015; Schmidt and Martínez Arbizu, 2015). When considering the whole macrofauna no clear differences in taxonomic richness between stations was noticed (Brandt et al., 2015) and different crustacean groups showed different species richness patterns (Elsner et al., 2015; Malyutina and Brandt, 2015; Golovan et al., 2019). The lowest number of putative species of Amphipoda was recorded at station 6–11, the station that showed low abundance and diversity of several groups (Alalykina, 2015; Brandt et al., 2015; Fischer and Brandt, 2015; Malyutina and Brandt, 2015). Interestingly, a completely opposite pattern of taxonomic richness than observed for Amphipoda was recorded for bivalves (Kamenev, 2015). An initial study of Amphipoda from the abyssal plain of the KurilKamchatka area confirmed high taxon richness on the continental side of the KKT and low abundances as well as low species richness at station 9

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Fig. 6. A – Neighbour-joining (NJ) tree of COI sequences of amphipods belonging to the families Atylidae, Pardaliscidae and the new family (superfamily Dexaminoidea). Details about the calculation and presentation of the tree as in Fig. 2A. B – Map showing the distribution of the ABGD MOTUs from the NJ tree recorded at three or more stations.

6–11 (Jażdżewska, 2015). Recent analysis of KKT area peracarids showed abundance as positively correlated with an elevated organic carbon (Corg) content in the sediments as well as the near-bottom oxygen concentration. In the same study species richness was negatively correlated with the velocity of the near-bottom current (Golovan et al., 2019). The high Corg observed on both sides of the KKT associated with high productivity of surface waters in these areas (Sattarova and Artemova, 2015) may explain a high number of ABGD groups observed at stations 3–9 and 12–4.

Within particular groups of Amphipoda the ABGD group richness per family observed here partly agrees with the number of known species. The most species rich group appeared to be the Lysianassoidea (but it has to be remembered that this group included the representatives of three families [Lysianassidae, Tryphosidae and Uristidae] collectively considered as one unit) and these three families are the most speciose within the whole order (Horton et al., 2019). Amphipods from the cited families are known to inhabit various marine habitats all over the world, representing diverse feeding types (Barnard 10

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Fig. 7. A – Neighbour-joining (NJ) tree of COI sequences of amphipods belonging to the families Ampeliscidae and Synopiidae (superfamily Synopioidea). Details about the calculation and presentation of the tree as in Fig. 2A. B – Map showing the distribution of the ABGD MOTUs from the NJ tree recorded at three or more stations.

and Karaman, 1991a,b; Brix et al., 2018b). The second in terms of AGBD group numbers appeared to be the Pardaliscidae. With 77 described species (Horton et al., 2019) this family is not listed among the 35 most speciose families within Amphipoda (Arfianti et al., 2018). Its second position in the present study confirms the deep-sea preferences of pardaliscid species (Birstein and Vinogradov, 1962; Brix et al., 2018b). The third was the Phoxocephalidae that comprises abundant and species rich taxa at all depths and latitudes (Brix et al., 2018b; Golovan et al., 2019). The Oedicerotidae proved to be the family for which the AGBD MOTU richness was low in comparison to the known number of species. As is the case with phoxocephalids, this family is well represented in soft bottom habitats in various marine areas and it was already recorded in high numbers in the KKT area (Jażdżewska, 2015; Golovan et al., 2019). The low number of putative species recognized in our case is the result of underrepresentation of this family in the molecular study. Due to the time limitation only 37 individuals out of more than 500 collected were taken for DNA extraction.

4.3. Biogeographic patterns of deep-sea amphipod species distribution We have observed seven ABGD MOTUs (9% of all taxa represented by more than one sequence) that occurred at the most distantly located stations (1000 km distance) which were additionally located across the KKT. It is commonly assumed that abyssal species have wide geographic ranges and the underwater physical barriers have no or only moderate influence on genetic connectivity (Zardus et al., 2006; Brix et al., 2011, 2015; Etter et al., 2011). Recent studies based on isopods, however, indicated that this rule does not have to be as common as previously thought and that the lifestyle of the studied group may influence the geographic range of species (Bober et al., 2018a; Brix et al., 2018a; Riehl et al., 2018). Janssen et al. (2015), who studied abyssal invertebrates in the CCZ, found 28% of taxa within Polychaeta and 7% of taxa within Isopoda distributed over 1300 km distance. This finding confirms that, in contrast to Polychaeta, peracarids, which are generally mobile crustaceans but lacking a larval dispersal stage, are not so 11

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Fig. 8. Neighbour-joining (NJ) tree of COI sequences of amphipods belonging to the families Dulichiidae, Ischyroceridae, Photidae, Unciolidae, Calliopiidae, and Maeridae (suborder Senticaudata). Details about the calculation and presentation of the tree as in Fig. 2A.

extended their bathymetric distributions from abyssal to hadal (Fig. 10). The general bathymetric pattern agrees with the ocean zonation and is commonly known for Amphipoda (Kamenskaya, 1981, 1995; Thurston, 2000). Species that cross the border of a particular depth zone have already been reported, however, in the majority of the cases, these bathymetric ranges were founded on entirely morphological identification (Kamenskaya, 1981, 1995; Lörz et al., 2018a). The recent use of molecular methods rejected the eurybathy of some amphipod species (e.g., Havermans et al., 2013; Eustace et al., 2016; Havermans, 2016). The four ABGD MOTUs from the present study that had a large bathymetric distribution belong to epibenthic taxa regarded as good swimmers (Barnard, 1972; Brix et al., 2018b; Lörz et al., 2018a) which may facilitate inhabiting a wider range. The existence of a transition zone between abyssal and hadal was already suggested (Belyaev, 1966, Belyaev, 1989; Jamieson et al., 2011, Brandt et al., 2019). Kamenskaya (1981, 1995) noticed mixing of the amphipod species from these two zones in the depth range 6000–7000 m. Apart from R. saskia, whose depth range extends to more than 8000 m, the other three species seem to extend their distribution only to the upper hadal. However, due to the fact that only a small part of the hadal samples from KuramBio II has been processed by now, it is too early to decide whether it is a common phenomenon in the studied area.

Fig. 9. Number of sequences, families and ABGD MOTUs recorded at each station.

widely distributed. Brix et al. (2018a) found deep-sea Isopoda to have their ranges around 500 km. Within Amphipoda Brandt et al. (2012) found only ten deep-sea species with very wide geographic ranges and further research that also included molecular methods confirmed a wide distribution of some of them. However, it was also identified that other taxa, formerly treated as single units, were species complexes with separate lineages restricted to particular ocean basins (Havermans et al., 2013; Havermans, 2016; Ritchie et al., 2015, 2017). Another question is if the KKT constitutes the dispersal barrier for abyssal fauna. The available molecular study of Isopoda from the region showed that it was not a barrier for species distribution but it confirmed that the trench may restrict constant gene flow (Bober et al., 2018b). Three out of the seven amphipod taxa with the widest distributions share the same haplotypes between the most distant stations rendering the KKT to be no barrier for population connectivity in these species. Overall, the geographic distribution of deep-sea amphipods seems to be speciesspecific. The study of the bathymetric ranges of ABGD MOTUs allowed to group them into three categories. The majority of them were restricted to a single (abyssal or hadal) zone, however, four putative species

5. Summary The deep sea area of Kuril-Kamchatka Trench appeared to harbour a large number of amphipod species recognized on the basis of ABGD analysis. A high number of MOTUs were singletons but the ranges of the ones that were represented by more individuals appeared to be speciesspecific. Some of the widely distributed abyssal taxa were found across KKT proving that it does not constitute the barrier for gene flow for certain species. Our results confirm high diversity of Amphipoda in the deep sea and provide a baseline for further taxonomical, ecological and biogeographical research. Acknowledgements The authors are very thankful to Prof. Dr. Angelika Brandt, the Chief Scientist of the KuramBio Project, for providing this very interesting amphipod collection. The AGT sample was kindly provided by Dr. 12

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Fig. 10. Depth ranges of ABGD MOTUs recorded at three or more stations. The species are arranged according to the family affiliation and within the families by the shallowest record in the studied area.

Enrico Schwabe, Bavarian State Collection of Zoology (ZSM). Funding for both KuramBio I and II projects was provided by the PTJ (German Ministry for Science and Education) BMBF grants (KuramBio I – #03G0223A, KuramBio II – #03G0250A) to Prof. Dr. Brandt, University of Hamburg (current address Senckenberg Museum, Frankfurt, Germany). Thanks are due to Katarzyna Jedynak MSc. (University of Lodz) who helped technically during part of the laboratory work. The reviewers are greatly appreciated for their constructive comments and suggestions. Funding for the analysis of the material was supported by a Polish National Science Centre (project No. 2014/15/D/NZ8/00289). This is KuramBIO publication # 51.

Invertebr. Syst. 22, 503–522. Baco, A.R., Etter, R.J., Ribeiro, P.A., von der Heyden, S., Beerli, P., Kinlan, B.P., 2016. A synthesis of genetic connectivity in deep-sea fauna and implications for marine reserve design. Mol. Ecol. 25, 3276–3298. https://doi.org/10.1111/mec.13689. Barnard, J.L., 1972. A review of the family Synopiidae (=Tironidae) mainly distributed in the Deep Sea (Crustacea: Amphipoda). Smithsonian Contrib. Zool. 124, 1–94. Barnard, J.L., Karaman, G.S., 1991a. The families and genera of marine gammaridean Amphipoda (except marine gammaroids). Part 1. Rec. Aust. Museum, Suppl. 13, 1–417. https://doi.org/10.3853/j.0812-7387.13.1991.91. Barnard, J.L., Karaman, G.S., 1991b. The families and genera of marine gammaridean Amphipoda (except marine gammaroids). Part 2. Rec. Aust. Museum, Suppl. 13, 419–866. Belyaev, G.M., 1966. Bottom fauna of the ultra-abyssal depths of the world ocean. Akad. Nauk SSSR, Trudy Instituta Okeanologii 591, 1–248. Belyaev, G.M., 1989. Glubokovodnye okeanicheskie zheloba i ikh fauna. Nauka, Moscow. Birstein, J.A., 1963. Deep-sea isopods (Crustacea, Isopoda) of the north-western part of the Pacific Ocean. Inst Oceanol, Acad Sci USSR. Moscow 1-214 (in Russian with English summary). Birstein, J.A., Vinogradov, M.E., 1962. Notes on the family Pardaliscidae (Amphipoda) with the description of a new genus. Crustaceana 3 (4), 249–258. Błażewicz-Paszkowycz, M., Pabis, K., Jóźwiak, P., 2015. Tanaidacean fauna of the KurilKamchatka Trench and adjacent abyssal plain – abundance, diversity and rare species. Deep-Sea Res. Part II 111, 325–332. https://doi.org/10.1016/j.dsr2.2014.08. 021. Bober, S., Brix, S., Riehl, T., Schwentner, M., Brandt, A., 2018a. Does the Mid-Atlantic Ridge affect the distribution of abyssal benthic crustaceans across the Atlantic Ocean? Deep-Sea Res. Part II 148, 91–104. https://doi.org/10.1016/j.dsr2.2018.02.007. Brandt, A., Alalykina, I., Brix, S., Brenke, N., Błażewicz, M., Golovan, O.A., Johannsen, N., Hrinko, A.M., Jażdżewska, A.M., Jeskulke, K., Kamenev G.M., Lavrenteva A.V., Malyutina M.V., Riehl, T., Lins, L., 2019. Depth zonation of deep-sea macrofauna of the Northwest Pacific. Prog. Oceanogr. doi: 10.1016/j.pocean.2019.102131. Bober, S., Riehl, T., Henne, S., Brandt, A., 2018b. New Macrostylidae (Isopoda) from the Northwest Pacific Basin described by means of integrative taxonomy with reference to geographical barriers in the abyss. Zool. J. Linn. Soc. 182, 549–603. https://doi. org/10.1093/zoolinnean/zlx042. Brandt, A., Błażewicz-Paszkowycz, M., Bamber, R., Mühlenhardt-Siegel, U., Malyutina, M., Kaiser, S., De Broyer, C., Havermans, C., 2012. Are there widespread peracarid

Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.pocean.2019.102184. References Alalykina, I.L., 2015. Polychaete composition from the abyssal plain adjacent to the KurilKamchatka Trench with the description of a new species of Sphaerephesia (Polychaeta: Sphaerodoridae). Deep-Sea Res. Part II 111, 166–174. https://doi.org/ 10.1016/j.dsr2.2014.09.006. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Anderson, T.R., Rice, T., 2006. Deserts on the sea floor: Edward Forbes and his azoic hypothesis for a lifeless deep ocean. Endeavour 30, 131–137. https://doi.org/10. 1016/j.endeavour.2006.10.003. Arfianti, T., Wilson, S., Costello, M.J., 2018. Progress in the discovery of amphipod crustaceans. PeerJ 6, e5187. https://doi.org/10.7717/peerj.5187. Astrin, J.J., Stüben, P.E., 2008. Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera: Curculionidae).

13

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos species in the deep sea (Crustacea: Malacostraca)? Pol. Polar Res. 33, 139–162. https://doi.org/10.2478/v10183-012-0012-5. Brandt, A., De Broyer, C., De Mesel, I., Ellingsen, K., Gooday, A., Hilbig, B., Linse, K., Thomson, M.R., Tyler, P., 2007. The biodiversity of the deep Southern Ocean benthos. Philos. Trans. R. Soc. B Biol. Sci. 362, 39–66. https://doi.org/10.1098/rstb. 2006.1952. Brandt, A., Elsner, N., Brenke, N., Golovan, O., Malyutina, M.V., Riehl, T., Schwabe, E., Würzberg, L., 2013. Epifauna of the Sea of Japan collected via a new epibenthic sledge equipped with camera and environmental sensor systems. Deep-Sea Res. Part II 86–87, 43–55. https://doi.org/10.1016/j.dsr2.2012.07.039. Brandt, A., Elsner, N.O., Malyutina, M.V., Brenke, N., Golovan, O.A., Lavrenteva, A.V., Riehl, T., 2015. Abyssal macrofauna of the Kuril-Kamchatka Trench area (Northwest Pacific) collected by means of a camera–epibenthic sledge. Deep-Sea Res. Part II 111, 175–187. https://doi.org/10.1016/j.dsr2.2014.11.002. Brenke, N., 2005. An Epibenthic Sledge for Operations on Marine Soft Bottom and Bedrock. Mar. Technol. Soc. J. 39, 10–21. https://doi.org/10.4031/ 002533205787444015. Brix, S., Bober, S., Tschesche, C., Kihara, T.C., Driskell, A., Jennings, R.M., 2018a. Molecular species delimitation and its implications for species descriptions using desmosomatid and nannoniscid isopods from the VEMA fracture zone as example taxa. Deep-Sea Res. Part II 148, 180–207. https://doi.org/10.1016/j.dsr2.2018.02. 004. Brix, S., Leese, F., Riehl, T., Kihara, T.C., 2015. A new genus and new species of Desmosomatidae Sars, 1897 (Isopoda) from the eastern South Atlantic abyss described by means of integrative taxonomy. Mar. Biodivers. 45, 7–61. https://doi.org/ 10.1007/s12526-014-0218-3. Brix, S., Riehl, T., Leese, F., 2011. First genetic data for species of the genus Haploniscus Richardson, 1908 (Isopoda: Asellota: Haploniscidae) from neighbouring deep-sea basins in the South Atlantic. Zootaxa 84, 79–84. Brix, S., Lörz, A.-N., Jażdżewska, A., Hughes, L., Tandberg, A.H., Pabis, K., Stransky, B., Krapp-Schickel, T., Sorbe, J.-C., Hendrycks, E., Vader, W.J.M., Frutos, I., Horton, T., Jażdżewski, K., Peart, R., Beermann, J., Coleman, C.O., Buhl-Mortensen, L., Corbari, L., Havermans, C., Tato, R., Jimenez Campean, A., 2018b. Amphipod family distributions around Iceland. Zookeys 731, 41–53. https://doi.org/10.3897/zookeys. 731.19854. Carpenter, J.M., Wheeler, W.C., 1999. Towards simultaneous analysis of molecular and morphological data in Hymenoptera. Zool. Scr. 28, 251–260. Costa, F.O., deWaard, J.R., Boutillier, J., Ratnasingham, S., Dooh, R.T., Hajibabaei, M., Hebert, P.D.N., 2007. Biological identifications through DNA barcodes: the case of the Crustacea. Can. J. Fish. Aquat. Sci. 64, 272–295. https://doi.org/10.1139/f07008. Costa, F.O., Henzler, C.M., Lunt, D.H., Whiteley, N.M., Rock, J., 2009. Probing marine Gammarus (Amphipoda) taxonomy with DNA barcodes. Syst. Biodivers. 7, 365–379. https://doi.org/10.1017/S1477200009990120. Cuvelier, D., Sarradin, P.M., Sarrazin, J., Colaço, A., Copley, J.T., Desbruyères, D., Glover, A.G., Santos, R.S., Tyler, P.A., 2011. Hydrothermal faunal assemblages and habitat characterisation at the Eiffel Tower edifice (Lucky Strike, Mid-Atlantic Ridge). Mar. Ecol. 32, 243–255. https://doi.org/10.1111/j.1439-0485.2010.00431.x. Durden, J.M., Bett, B.J., Jones, D.O.B., Huvenne, V.A.I., Ruhl, H.A., 2015. Abyssal hills hidden source of increased habitat heterogeneity, benthic megafaunal biomass and diversity in the deep sea. Prog. Oceanogr. 137, 209–218. https://doi.org/10.1016/j. pocean.2015.06.006. Elsner, N.O., Malyutina, M.V., Golovan, O.A., Brenke, N., Riehl, T., Brandt, A., 2015. Deep down: Isopod biodiversity of the Kuril-Kamchatka abyssal area including a comparison with data of previous expeditions of the RV Vityaz. Deep-Sea Res. Part II 111, 210–219. https://doi.org/10.1016/j.dsr2.2014.08.007. Etter, R.J., Boyle, E.E., Glazier, A., Jennings, R.M., Dutra, E., Chase, M.R., 2011. Phylogeography of a pan-Atlantic abyssal protobranch bivalve: implications for evolution in the Deep Atlantic. Mol. Ecol. 20, 829–843. https://doi.org/10.1111/j. 1365-294X.2010.04978.x. Eustace, R.M., Ritchie, H., Kilgallen, N.M., Piertney, S.B., Jamieson, A.J., 2016. Morphological and ontogenetic stratification of abyssal and hadal Eurythenes gryllus sensu lato (Amphipoda: Lysianassoidea) from the Peru-Chile Trench. Deep-Sea Res. Part I 109, 91–98. https://doi.org/10.1016/j.dsr.2015.11.005. Felsenstein, J., 1985. Phylogenies and the Comparative Method. Am. Nat. 125, 1–15. https://doi.org/10.2307/2461605. Fischer, V., Brandt, A., 2015. Composition of the abyssal infauna of the Kuril-Kamchatka area (NW Pacific) collected with a box corer. Deep-Sea Res. Part II 111, 26–33. https://doi.org/10.1016/j.dsr2.2014.10.002. Folmer, O.M., Black, W.H., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from metazoan invertebrates. Mol. Mar. Biol. Biotech. 3, 294–299. France, S.C., Hessler, R.R., Vrijenhoek, R.C., 1992. Genetic differentiation between spatially-disjunct populations of the deep-sea, hydrothermal vent-endemic amphipod Ventiella sulfuris. Mar. Biol. 114, 551–559. https://doi.org/10.1007/BF00357252. Frutos, I., Brandt, A., Sorbe, J.C., 2017. Deep-Sea Suprabenthic Communities: The Forgotten Biodiversity. In: Marine Animal Forests. Springer International Publishing, Cham, pp. 475–503. doi: 10.1007/978-3-319-21012-4_21. Golovan, O.A., Błażewicz, M., Brandt, A., Jażdżewska, A.M., Jóźwiak, P., Lavrenteva, A.V., Malyutina, M.V., Petryashov, V.V., Riehl, T., Sattarova, V.V., 2019. Diversity and distribution of peracarid crustaceans (Malacostraca) from the abyss adjacent to the Kuril-Kamchatka Trench. Mar. Biodivers. 49, 1343–1360. https://doi.org/10. 1007/s12526-018-0908-3. Gray, J.S., 2001. Marine diversity: the paradigms in patterns of species richness examined. Sci. Mar. 65, 41–56. https://doi.org/10.3989/scimar.2001.65s241. Havermans, C., 2016. Have we so far only seen the tip of the iceberg? Exploring species

diversity and distribution of the giant amphipod Eurythenes. Biodiversity 17, 12–25. https://doi.org/10.1080/14888386.2016.1172257. Havermans, C., Seefeldt, M.A., Held, C., 2018. A biodiversity survey of scavenging amphipods in a proposed marine protected area: the Filchner area in the Weddell Sea, Antarctica. Polar Biol. 41, 1371–1390. https://doi.org/10.1007/s00300-018-2292-7. Havermans, C., Smetacek, V., 2018. Bottom-up and top-down triggers of diversification: A new look at the evolutionary ecology of scavenging amphipods in the deep sea. Prog. Oceanogr. 164, 37–51. https://doi.org/10.1016/j.pocean.2018.04.008. Havermans, C., Sonet, G., d’Udekem d’Acoz, C., Nagy, Z.T., Martin, P., Brix, S., Riehl, T., Agrawal, S., Held, C., 2013. Genetic and morphological divergences in the cosmopolitan deep-sea amphipod Eurythenes gryllus reveal a diverse abyss and a bipolar species. PLoS ONE 8, e74218. https://doi.org/10.1371/journal.pone.0074218. Hessler, R.R., Sanders, H.L., 1967. Faunal diversity in the deep-sea. Deep Sea Res. Oceanogr. Abstr. 14, 65–78. https://doi.org/10.1016/0011-7471(67)90029-0. Hillis, D.M., Mable, B.K., Moritz, C., 1996. Applications of molecular systematics. In: Hillis, D.M., Moritz, C., Mable, B. (Eds.), Molecular Systematics. Sinauer Associates, Sunderland, pp. 515–543. Horton, T., Lowry, J., De Broyer, C., Bellan-Santini, D., Coleman, C. O., Corbari, L., Costello, M. J., Daneliya, M., Dauvin, J-C., Fišer, C., Gasca, R., Grabowski, M., Guerra-García, J. M., Hendrycks, E., Hughes, L., Jaume, D., Jazdzewski, K., Kim, Y.H., King, R., Krapp-Schickel, T., LeCroy, S., Lörz, A.-N., Mamos, T., Senna, A. R., Serejo, C., Sket, B., Souza-Filho, J. F., Tandberg, A.H., Thomas, J., Thurston, M., Vader, W., Väinölä, R., Vonk, R., White, K., Zeidler, W., 2019. World Amphipoda Database. < http://www.marinespecies.org/amphipoda > (accessed on 201902-07). Hou, Z., Fu, J., Li, S., 2007. A molecular phylogeny of the genus Gammarus (Crustacea: Amphipoda) based on mitochondrial and nuclear gene sequences. Mol. Phylogenet. Evol. 45, 596–611. https://doi.org/10.1016/j.ympev.2007.06.006. Jamieson, A.J., Kilgallen, N.M., Rowden, A.A., Fujii, T., Horton, T., Lörz, A.-N., Kitazawa, K., Priede, I.G., 2011. Bait-attending fauna of the Kermadec Trench, SW Pacific Ocean: evidence for an ecotone across the abyssal–hadal transition zone. Deep-Sea Res. Part I 58, 49–62. https://doi.org/10.1016/j.dsr.2010.11.003. Janssen, A., Kaiser, S., Meißner, K., Brenke, N., Menot, L., Martínez Arbizu, P., 2015. A reverse taxonomic approach to assess macrofaunal distribution patterns in abyssal pacific polymetallic nodule fields. PLoS ONE 10, 1–26. https://doi.org/10.1371/ journal.pone.0117790. Jażdżewska, A., 2015. Kuril-Kamchatka deep sea revisited – insights into the amphipod abyssal fauna. Deep-Sea Res. Part II 111, 294–300. https://doi.org/10.1016/j.dsr2. 2014.08.008. Jażdżewska, A.M., Corbari, L., Driskell, A., Frutos, I., Havermans, C., Hendrycks, E., Hughes, L., Lörz, A.-N., Stransky, B., Tandberg, A.H.S., Vader, W., Brix, S., 2018. A genetic fingerprint of Amphipoda from Icelandic waters – the baseline for further biodiversity and biogeography studies. Zookeys 731, 55–73. https://doi.org/10. 3897/zookeys.731.19931. Jażdżewska, A.M., Ziemkiewicz, A., 2019. A new abyssal amphipod species (Crustacea) from sunken wood described using integrative taxonomy. Prog. Oceanogr. 172, 1–13. https://doi.org/10.1016/j.pocean.2018.12.012. Kaiser, S., Barnes, D.K., Brandt, A., 2007. Slope and deep-sea abundance across scales: Southern Ocean isopods show how complex the deep sea can be. Deep-Sea Res. Part II 54, 1776–1789. https://doi.org/10.1016/j.dsr2.2007.07.006. Kaiser, S., Brix, S., Kihara, T.C., Janssen, A., Jennings, R.M., 2018. Integrative species delimitation in the deep-sea genus Thaumastosoma Hessler, 1970 (Isopoda, Asellota, Nannoniscidae) reveals a new genus and species from the Atlantic and central Pacific abyss. Deep-Sea Res. Part II 148, 151–179. https://doi.org/10.1016/j.dsr2.2017.05. 006. Kamenev, G.M., 2015. Composition and distribution of bivalves of the abyssal plain adjacent to the Kuril-Kamchatka Trench (Pacific Ocean). Deep-Sea Res. Part II 111, 188–197. https://doi.org/10.1016/j.dsr2.2014.08.005. Kamenskaya, O.E., 1981. Amphipody (Amphipoda, Crustacea) glubokovodnykh zhelobov zapadnoj chasti Tikhogo Okeana [The amphipods (Amphipoda, Crustacea) from the deep-sea trenches of the western part of the Pacific Ocean]. Trudy Instituta Okeanologii 115, 94–107. Kamenskaya, O.E., 1995. Gammaridean amphipods from hadal trenches of the Pacific Ocean. Pol. Arch. Hydrobiol. 42 (4), 327–334. Katoh, K., Misawa, K., Kuma, K., Miyata, T., 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30, 3059–3066. https://doi.org/10.1093/nar/gkf436. Katoh, K., Standley, D.M., 2013. MAFFT Multiple Sequence Alignment Software Version 7: improvements in Performance and Usability. Mol. Biol. Evol. 30, 772–780. https:// doi.org/10.1093/molbev/mst010. Kawabe, M., Fujio, S., 2010. Pacific ocean circulation based on observation. J. Oceanogr. 66, 389–403. https://doi.org/10.1007/s10872-010-0034-8. Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. https://doi.org/10.1007/BF01731581. Knox, M.A., Hogg, I.D., Pilditch, C.A., Lörz, A.N., Hebert, P.D.N., Steinke, D., 2012. Mitochondrial DNA (COI) analyses reveal that amphipod diversity is associated with environmental heterogeneity in deep-sea habitats. Mol. Ecol. 21, 4885–4897. https:// doi.org/10.1111/j.1365-294X.2012.05729.x. Kress, W.J., García-Robledo, C., Uriarte, M., Erickson, D.L., 2015. DNA barcodes for ecology, evolution, and conservation. Trends Ecol. Evol. 30, 25–35. https://doi.org/ 10.1016/j.tree.2014.10.008. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. https://doi. org/10.1093/molbev/msw054. Lobo, J., Ferreira, M.S., Antunes, I.C., Teixeira, M.A.L., Borges, L.M.S., Sousa, R., Gomes,

14

Progress in Oceanography 178 (2019) 102184

A.M. Jażdżewska and T. Mamos

Neumann, H., Kihara, T.C., Pointner, K., Radulovici, A., Segelken-Voigt, A., Wesse, C., Knebelsberger, T., 2015. The application of DNA barcodes for the identification of marine crustaceans from the North Sea and adjacent regions. PLoS ONE 10, 1–23. https://doi.org/10.1371/journal.pone.0139421. Rex, M.A., McClain, C.R., Johnson, N.A., Etter, R.J., Allen, J.A., Bouchet, P., Warén, A., 2005. A source-sink hypothesis for abyssal biodiversity. Am. Nat. 165 (2), 163–178. https://doi.org/10.1086/427226. Riehl, T., Brenke, N., Brix, S., Driskell, A., Kaiser, S., Brandt, A., 2014. Field and laboratory methods for DNA studies on deep-sea isopod crustaceans. Pol. Polar Res. 35, 203–224. https://doi.org/10.2478/popore-2014-0018. Riehl, T., Lins, L., Brandt, A., 2018. The effects of depth, distance, and the Mid-Atlantic Ridge on genetic differentiation of abyssal and hadal isopods (Macrostylidae). DeepSea Res. Part II 148, 74–90. https://doi.org/10.1016/j.dsr2.2017.10.005. Ritchie, H., Jamieson, A.J., Piertney, S.B., 2015. Phylogenetic relationships among hadal amphipods of the Superfamily Lysianassoidea: Implications for taxonomy and biogeography. Deep-Sea Res. Part I 105, 119–131. https://doi.org/10.1016/j.dsr.2015. 08.014. Ritchie, H., Jamieson, A.J., Piertney, S.B., 2017. Population genetic structure of two congeneric deep-sea amphipod species from geographically isolated hadal trenches in the Pacific Ocean. Deep-Sea Res. Part I 119, 50–57. https://doi.org/10.1016/j.dsr. 2016.11.006. Sattarova, V.V., Artemova, A.V., 2015. Geochemical and micropaleontological character of Deep-Sea sediments from the Northwestern Pacific near the Kuril-Kamchatka Trench. Deep-Sea Res. Part II 111, 10–18. https://doi.org/10.1016/j.dsr2.2014.10. 030. Schmidt, C., Martínez Arbizu, P., 2015. Unexpectedly higher metazoan meiofauna abundances in the Kuril-Kamchatka Trench compared to the adjacent abyssal plains. Deep-Sea Res. Part II 111, 60–75. https://doi.org/10.1016/j.dsr2.2014.08.019. Takeuchi, I., Tomikawa, K., Lindsay, D., 2016. A new genus and species of Phtisicidae (Crustacea: Amphipoda) from abyssal depths in the Japan Trench, with special reference to similarities with Southern Ocean genera. J. Crust. Biol. 36 (4), 469–506. https://doi.org/10.1163/1937240X-00002457. Taylor, M.L., Roterman, C.N., 2017. Invertebrate population genetics across Earth's largest habitat: the deep-sea floor. Mol. Ecol. 26, 4872–4896. https://doi.org/10.1111/ mec.14237. Tempestini, A., Rysgaard, S., Dufresne, F., 2018. Species identification and connectivity of marine amphipods in Canada’s three oceans. PLoS ONE 13, 1–17. https://doi.org/10. 1371/journal.pone.0197174. Thurston, M., 2000. Benthic Gammaridea [Crustacea: Amphipoda] in the deep sea. Pol. Arch. Hydrobiol. 47, 353–377. Uehara, K., Miyake, H., 1999. Deep flows on the slope inshore of the Kuril-Kamchatka trench southeast off Cape Erimo, Hokkaido. J. Oceanogr. 55, 559–573. https://doi. org/10.1023/A:1007828517317. Verheye, M.L., Backeljau, T., d’Udekem d’Acoz, C., 2016. Looking beneath the tip of the iceberg: diversification of the genus Epimeria on the Antarctic shelf (Crustacea, Amphipoda). Polar Biol. 39, 925–945. https://doi.org/10.1007/s00300-016-1910-5. Wiemers, M., Fiedler, K., 2007. Does the DNA barcoding gap exist? – A case study in blue butterflies (Lepidoptera: Lycaenidae). Front. Zool. 4, 8. Zardus, J.D., Etter, R.J., Chase, M.R., Rex, M.A., Boyle, E.E., 2006. Bathymetric and geographic population structure in the pan-Atlantic deep-sea bivalve Deminucula atacellana (Schenck, 1939). Mol. Ecol. 15, 639–651. https://doi.org/10.1111/j.1365294X.2005.02832.x.

P.A., Costa, M.H., Cunha, M.R., Costa, F.O., 2017. Contrasting morphological and DNA barcode-suggested species boundaries among shallow-water amphipod fauna from the southern European Atlantic coast. Genome 60, 147–157. https://doi.org/10. 1139/gen-2016-0009. Lörz, A.-N., Jażdżewska, A.M., Brandt, A., 2018a. A new predator connecting the abyssal with the hadal in the Kuril-Kamchatka Trench, NW Pacific. PeerJ 6, e4887. https:// doi.org/10.7717/peerj.4887. Lörz, A.N., Kaiser, S., Bowden, D., 2013. Macrofaunal crustaceans in the benthic boundary layer from the shelf break to abyssal depths in the Ross Sea (Antarctica). Polar Biol. 36, 445–451. https://doi.org/10.1007/s00300-012-1269-1. Lörz, A.-N., Maas, E., Linse, K., Coleman, C.O., 2009. Do circum-Antarctic species exist in peracarid Amphipoda? A case study in the genus Epimeria Costa, 1851 (Crustacea, Peracarida, Epimeriidae). Zookeys 18, 91–128. https://doi.org/10.3897/zookeys.18. 103. Lörz, A.N., Tandberg, A.H.S., Willassen, E., Driskell, A., 2018b. Rhachotropis (Eusiroidea, Amphipoda) from the North East Atlantic. Zookeys 2018, 75–101. https://doi.org/ 10.3897/zookeys.731.19814. Lowry, J.K., Myers, A.A., 2017. A phylogeny and classification of the Amphipoda with the establishment of the new order Ingolfiellida (Crustacea: Peracarida). Zootaxa. https://doi.org/10.11646/zootaxa.4265.1.1. Malyutina, M.V., Brandt, A., 2015. Composition and distribution of Munnopsidae (Crustacea, Isopoda, Asellota), collected during the KuramBio expedition 2012 from the Kuril-Kamchatka Trench area. Deep-Sea Res. Part II 111, 245–255. https://doi. org/10.1016/j.dsr2.2014.08.016. Pecnikar, F.Z., Buzan, E.V., 2014. 20 years since the introduction of DNA barcoding: from theory to application. J. Appl. Genet. 55, 43–52. Plaisance, L., Knowlton, N., Paulay, G., Meyer, C., 2009. Reef-associated crustacean fauna: biodiversity estimates using semi-quantitative sampling and DNA barcoding. Coral Reefs 28, 977–986. https://doi.org/10.1007/s00338-009-0543-3. Prendini, L., Weygoldt, P., Wheeler, W.C., 2005. Systematics of the Damon variegatus group of African whip spiders (Chelicerata: Amblipygi): evidence for behaviour, morphology and DNA. Org. Divers. Evol. 5, 203–236. Puillandre, N., Lambert, A., Brouillet, S., Achaz, G., 2012. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Mol. Ecol. 21, 1864–1877. QGIS Development Team (2018). QGIS Geographic Information System. Open Source Geospatial Foundation Project. < http://qgis.osgeo.org > . Rabinovich, A.B., Thomson, R.E., Bograd, S.J., 2002. Drifter observations of anticyclonic eddies near Bussol’ strait, the Kuril Islands. J. Oceanogr. 58, 661–671. https://doi. org/10.1023/A:1022890222516. Ramirez-Llodra, E., Brandt, A., Danovaro, R., De Mol, B., Escobar, E., German, C.R., Levin, L.A., Martinez Arbizu, P., Menot, L., Buhl-Mortensen, P., Narayanaswamy, B.E., Smith, C.R., Tittensor, D.P., Tyler, P.A., Vanreusel, A., Vecchione, M., 2010. Deep, diverse and definitely different: Unique attributes of the world’s largest ecosystem. Biogeosciences 7, 2851–2899. https://doi.org/10.5194/bg-7-2851-2010. Ratnasingham, S., Hebert, P., 2007. The Barcode of Life Data System. Mol. Ecol. Notes. doi: 10.1111/j.1471-8286.2006.01678.x. Ratnasingham, S., Hebert, P.D.N., 2013. A DNA-based registry for all animal species: the barcode index number (BIN) system. PLoS ONE 8, e66213. https://doi.org/10.1371/ journal.pone.0066213. Raupach, M.J., Held, C., Wägele, J.-W., 2004. Multiple colonization of the deep sea by the Asellota (Crustacea: Peracarida: Isopoda). Deep-Sea Res. Part II 51, 1787–1795. https://doi.org/10.1016/j.dsr2.2004.06.035. Raupach, M.J., Barco, A., Steinke, D., Beermann, J., Laakmann, S., Mohrbeck, I.,

15