Higher-Level Phylogeny of New World Vireos (Aves: Vireonidae) Based on Sequences of Multiple Mitochondrial DNA Genes

Molecular Phylogenetics and Evolution Vol. 20, No. 1, July, pp. 27– 40, 2001 doi:10.1006/mpev.2001.0944, available online at http://www.idealibrary.com on

Higher-Level Phylogeny of New World Vireos (Aves: Vireonidae) Based on Sequences of Multiple Mitochondrial DNA Genes Carla Cicero* and Ned K. Johnson* ,† *Museum of Vertebrate Zoology and †Department of Integrative Biology, University of California, Berkeley, California 94720-3160 Received February 25, 2000; revised January 18, 2001; published online June 6, 2001

recent analyses have employed various molecular techniques to resolve higher-level relationships among passerine and nonpasserine birds (Mindell, 1997). The work of Sibley and Ahlquist (1990), who presented a classification of living birds based on DNA–DNA hybridization data (Sibley and Monroe, 1990; Monroe and Sibley, 1993), is exemplary in this regard. Despite methodological problems and short branch lengths between many internodes (Lanyon, 1992; Sheldon and Gill, 1996), this classification has served as an important starting point for further testing of phylogenetic hypotheses with other kinds of molecular data (e.g., Helm-Bychowski and Cracraft, 1993; Sheldon and Gill, 1996; Chikuni et al., 1996; Groth, 1998). The avian family Vireonidae contains at least 52 species in four genera (Monroe and Sibley, 1993), all with New World distributions. Intergeneric and interfamilial relationships of vireos have puzzled evolutionary biologists for over a century, leading to an unstable taxonomy for this group (Sibley and Ahlquist, 1982). Phylogenetic hypotheses based on morphology (e.g., Mayr and Amadon, 1951; Wetmore, 1960) have allied vireos primarily with New World wood warblers (Parulidae) or with shrikes (Laniidae), the latter family restricted to the Old World except for 2 species. Two other groups, Old World whistlers (Pachycephalidae) and monarchs (Monarchidae), also have been proposed as possible relatives based on morphological similarities (Naumburg, 1925; Beecher, 1953). Because we lack evidence that vireos ever occupied the Old World, hypotheses of their Old World origin present a biogeographic enigma. Traditional classifications that place vireos near wood warblers are based on similar small body size, coloration, and behavior and on a reduction of the outer (10th) primary feather in “typical” vireos (genus Vireo; Mayr and Amadon, 1951). The latter character has especially seized the attention of systematists because of its approach to the wing configuration of the 9-primaried oscines, a well-defined subdivision of birds that includes wood warblers and other New World groups such as tanagers, cardinals, buntings, blackbirds, and sparrows (see Groth, 1998; Ericson et al., 2000). Vireos

Interfamilial relationships of the New World songbird family Vireonidae are uncertain. Thus, we sequenced 3069 bp of four mitochondrial genes (cyt b, ND2, ND3, COI) from 19 taxa in five families and two outgroups, to examine higher-level alliances with proposed relatives. We also sequenced cyt b and ND2 from an additional five vireonids to examine intergeneric relationships within the Vireonidae and incorporated 14 sequences of cyt b from GenBank to test the effects of taxon sampling on gene tree resolution. Families appeared monophyletic in all analyses, and the affinity of vireonids to Old World corvoids was corroborated. However, relationships among the Vireonidae and other families were not resolved. Sequences of vireonids revealed high levels of divergence within and between genera, with either Cyclarhis or Vireolanius positioned basally, depending on the analysis. On the basis of mitochondrial DNA and biogeographic evidence, vireonids represent a deep lineage derived from an Old World ancestor that colonized the New World, most likely via Beringia, with subsequent radiation in the Middle American tropics. We hypothesize postcolonization dispersal of the ancestor into Middle America, followed by extinction of the ancestor in North America. This extinction event left the North Temperate Zone unoccupied by any vireonid until northward reinvasion by some species of Vireo. Although the closest living relative of vireonids remains unidentified, broad-scale sequencing of additional extant corvoids with multiple molecular markers should further elucidate Old World alliances. © 2001 Academic Press Key Words: vireos; corvoids; mitochondrial DNA; sequence evolution; phylogenetics; biogeography.

INTRODUCTION Oscine passerines (songbirds) comprise nearly half of all avian species, yet relationships among the different families remain poorly understood. A major obstacle for systematic studies of oscines with traditional methods is their anatomic similarity and the paucity of informative morphologic characters (Ames, 1971; Beecher, 1953; Mayr, 1958). Because of this problem, 27

1055-7903/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

28

CICERO AND JOHNSON

and warblers also share similar breeding and wintering distributions, and the majority of temperate-breeding species in both families are Neotropical migrants. Reduction or loss of the outer primary feather apparently is correlated with long-distance migratory behavior (Averill, 1925; Hamilton, 1958), a trait that distinguishes species of Vireo from other nonmigratory, tropical vireonids. The alliance of vireos to shrikes, which belong to the 10-primaried oscines, is based on their shared shrikelike bill with a hooked tip. This similarity is most apparent in the peppershrikes (Cyclarhis) and shrike– vireos (Vireolanius) and has led to alternative placements of vireos within the Laniidae and in separate families, i.e., Vireonidae (Vireo and Hylophilus [greenlets]), Vireolaniidae, and Cyclarhidae (see Sibley and Ahlquist, 1982). Cyclarhis and Vireolanius also differ from Vireo in having a more developed 10th primary and more strongly developed jaw musculature (as in shrikes; Beecher, 1953). However, myological (Beecher, 1953; Raikow, 1978; Orenstein and Barlow, 1981), behavioral (Barlow and James, 1975), and genetic (Johnson et al., 1988) evidence argue for confamilial status. Myological data (Beecher, 1953; Raikow, 1978) also refute the traditional alliance of vireos with the 9-primaried oscines. Recent taxonomic authorities have included all four genera within the Vireonidae, either in separate subfamilies (Vireoninae, Vireolaniinae, Cyclarhinae; American Ornithologists’ Union, 1983) or without subfamilial distinction (American Ornithologists’ Union, 1998). The first molecular evidence for relationships of the Vireonidae was provided by DNA–DNA hybridization (Sibley and Ahlquist, 1982), which showed that vireos are a monophyletic clade related to a “corvine assemblage” of primarily Old World taxa (parvorder Corvida) and not to an assemblage that includes both 9-primaried and 10-primaried oscines (parvorder Passerida). Additional data based on DNA hybridization (Sheldon and Gill, 1996; Sibley and Ahlquist, 1990) showed a similar relationship. Furthermore, the basic subdivision of oscines into the Corvida and Passerida lineages (Sibley and Ahlquist, 1990) has been confirmed independently by both DNA hybridization (Sheldon and Gill, 1996) and nuclear data (Ericson et al., 2000). Within the Corvida, vireos are placed in a superfamily Corvoidea that includes shrikes, jays, birds-of-paradise, whistlers, monarchs, and other groups with a dominant Old World distribution (Sibley and Ahlquist, 1990; Monroe and Sibley, 1993). Although DNA hybridization data also suggested that Cyclarhis is basal to other genera of vireonids (Sibley and Ahlquist, 1982); this result is tentative because Vireolanius was excluded from the analysis. Johnson et al. (1988) used allozymes to examine relationships within the Vireonidae, using as outgroups two members of the Corvidae and two Parulidae. These

data supported the vireo– corvid alliance and confirmed that Cyclarhis and Vireolanius belong within the Vireonidae. Furthermore, the separation of genera into different subfamilies was not supported by genetic distances. Whereas this study provided several hypotheses of species-level relationships, affinities among genera were not established. During the past decade, mitochondrial DNA (mtDNA) sequence data have been used extensively at all levels to examine systematic relationships of birds. In one study, Helm-Bychowski and Cracraft (1993) analyzed sequences of the cytochrome b (cyt b) gene, in addition to cranial osteological characters, to assess relationships among birds-of-paradise (Paradisaeidae), bowerbirds (Ptilonorhynchidae), and other putative members of the corvine assemblage, including one representative each of a vireo (Vireo), shrike (Lanius), and jay (Cyanocitta). Different analyses yielded incongruent topologies, and the phylogenetic positions of the vireo and shrike were unresolved relative to each other and to the other corvoids. Because this study did not include any 9-primaried oscines as outgroups, the affinity of the vireonid to the corvines could not be corroborated. Groth (1998) used cyt b to assess relationships among 9-primaried oscines and rooted the tree at a “presumed monophyletic corvoid outgroup” that included a vireo, shrike, jay, and bird-of-paradise. Although parulids were distant from these taxa in all trees, the position of the vireo and shrike again failed to show a consistent arrangement. In view of the lack of a systematic, higher-level analysis of vireonids based on DNA nucleotides, we sequenced multiple mtDNA genes from two members of each genus plus numerous outgroups to test hypotheses of intergeneric and interfamilial relationships. We also used sequences from GenBank to increase taxon sampling. This study is part of a series of molecular phylogenetic analyses aimed at understanding relationships of vireos at different taxonomic scales (e.g., Cicero and Johnson, 1998 and unpublished). Our objectives were threefold: (1) to test the DNA hybridization evidence that vireonids are corvoids, (2) to assess the cohesiveness and monophyly of the family, and (3) to analyze the effects of taxon sampling and different phylogenetic methods on resolution of intergeneric and interfamilial relationships. Results of this study will serve as the foundation for sampling of characters and outgroups in a molecular phylogeny of vireos at the generic and specific levels (C. Cicero and N. K. Johnson, unpublished). MATERIALS AND METHODS Taxa and Genes Examined Proper sampling of taxa (Poe, 1998; Rannala et al., 1998) and selection of outgroups (Smith, 1994) are critical to accurate phylogenetic estimation. Because

29

HIGHER-LEVEL PHYLOGENY OF VIREONIDS

TABLE 1 Tissue Samples of 19 Ingroup and 2 Outgroup Taxa Used in Sequencing of Four mtDNA Genes (3069 bp) Taxon Tyrannidae (outgroup) Empidonax hammondii Empidonax minimus Vireonidae Cyclarhis gujanensis Hylophilus ochraceiceps Vireolanius leucotis Vireo solitarius (eye-ringed) Vireo gilvus (eye-lined) Corvidae Aphelocoma californica Corvus brachyrhynchos Cyanocitta stelleri Gymnorhinus cyanocephalus Pica hudsonia Laniidae Lanius ludovicianus Lanius excubitor Parulidae Vermivora celata Dendroica coronata Parula pitiayumi Geothlypis aequinoctialis Basileuterus culicivorus Passeridae Passer domesticus Passer montanus

Locality

Specimen No. a

Ravalli Co., Montana Hubbard Co., Minnesota

MVZ 168969 MVZ 168722

Depto. La Paz, Bolivia Depto. Beni, Bolivia Prov. Morona-Santiago, Ecuador Cook Co., Minnesota Cameron Parish, Louisiana

LSUMZ 103262 LSUMZ 125496 ANSP 177004 b MVZ 168741 LSUMZ 112170

Mineral Co., Nevada Thompkins Co., New York Klamath Co., Oregon Inyo Co., California Lemhi Co., Idaho

MVZ 166923 CU 48424 MVZ 177328 MVZ 166795 MVZ 168978

Alameda Co., California Cook Co., Minnesota

MVZ 177536 BMNH 42321

San Benito Co., California San Benito Co., California Depto. Itapua´, Paraguay Depto. Itapua´, Paraguay Depto. Itapua´, Paraguay

MVZ MVZ MVZ MVZ MVZ

Napa Co., California North-West Frontier Prov., Pakistan

MVZ 177233 FMNH 347952

169123 170226 168912 168913 168916

a Numbers refer to voucher specimens. Tissues housed at same institution except for Vireolanius leucotis. MVZ, Museum of Vertebrate Zoology, University of California, Berkeley; LSUMZ, Louisiana State University Museum of Natural Science; ANSP, Academy of Natural Sciences of Philadelphia; CU, Cornell University; BMNH, Bell Museum of Natural History, University of Minnesota; FMNH, Field Museum of Natural History. b Tissue housed at LSU (tissue sample number B-6062). Voucher permanently deposited in Museo Ecuatoriano de Ciencias Naturales.

the number of potential taxa for this study is enormous, we focused our sampling on (1) groups that traditionally have been considered close relatives of the Vireonidae, i.e., members of the Parulidae and Laniidae, and (2) discrete groups that are undisputed members of the Corvida and Passerida (families Corvidae and Passeridae, respectively). To obtain a broad representation of taxa within these oscine families, and to minimize problems with long branches (Lyons-Weiler and Hoelzer, 1997), we sequenced at least two individuals per family and, where possible, included representatives of different genera or clades (e.g., eye-ringed and eye-lined clades of Vireo; Murray et al., 1994; Cicero and Johnson, 1998 and unpublished). Eye-ringed and eye-lined vireos have been recognized as separate subgenera (American Ornithologists’ Union, 1983), although this distinction was not supported by allozymes (Johnson et al., 1988; American Ornithologists’ Union, 1998). Two suboscine flycatchers (family Tyrannidae) were analyzed as outgroups to the oscines. The cytochrome b gene has served as a standard molecular marker in avian systematic studies, includ-

ing those at the generic and familial levels (e.g., Edwards et al., 1991; Helm-Bychowski and Cracraft, 1993; Chikuni et al., 1996; Groth, 1998). Thus, we conducted a preliminary analysis based on complete sequences of cyt b for 19 focal taxa from five families plus the two suboscine outgroups (Table 1). Because this analysis failed to resolve relationships among families, we expanded the data set by sequencing three other mtDNA protein-coding genes (total of 3069 bp), including all of NADH 2 (ND2; 1041 bp) and NADH 3 (ND3; 351 bp) and part of cytochrome oxidase I (COI; 534 bp). We also sequenced cyt b and ND2 (total of 2184 bp) for the following additional samples of vireos, primarily to assess intergeneric relationships within the Vireonidae: Cyclarhis gujanensis, Depto. Itapua´, Paraguay (MVZ 168919); Hylophilus ochraceiceps, Depto. San Martin, Peru (LSUMZ 117664); Vireolanius leucotis, Depto. Beni, Bolivia (LSUMZ 125495); Vireo plumbeus (eye-ringed clade), Powder River Co., Montana (MVZ 168625); and Vireo leucophyrys (eye-lined clade), Depto. Pasco, Peru (LSUMZ 129461). These genes have proven informative as mtDNA markers in

30

CICERO AND JOHNSON

TABLE 2 Locations and Sequences of Primers Used for Amplification and Sequencing of Four mtDNA Genes Gene

Primer location a

Primer sequence b

ND2

L5204 L5494 H5578 L5809 H6034 H6312 L10701 H11289 L14851 L14987 L15236 H15304 L15557 L15661 H15706 H15916 H16065 L7327 H7827

GCTAACAAAGCTATCGGGCCCAT AATGCATGATCCACCGGCCAATGAGA CCTTGGAGTACTTCTGGGAATCAGA GCCTTCTCATCCATCTCCCACCTAGGATGAAT TTGGTTAGTTCTTGGATAATGAGTCA CTTATTTAAGGCTTTGAAGGCC CTCTACACAACCATCTACTGATGAGG GATAGTATTATGCTTTCTAGGCA CCTACTTAGGATCATTCGCCCT CCATCCAACATCTC[A/T]GC[A/T]TGATG TACCTAAACAAAGAAAC[G/T/C]TG[G/A]AA GTAGCACCTCAGAA[G/T/C]GATATTTG GACTGTGACAAAATCCC[G/A/T/C]TTCCA ACCTCCTAGGAGA[C/T]CCAGA[C/A/T]AA[C/T]T TATGCGAATAGGAA[G/A]TA[T/C]CA[T/C]TC ATGAAGGGATGTTCTACTGGTTG GGTCTTCATCT[C/T][C/T/A]GG[T/C]TTACAAGAC CCTGCAGGAGGAGGAGA[T/C]CC CCAGAGATTAGAGGGAATCAGTG

ND3 Cyt b

COI

a Letters refer to light (L) and heavy (H) strands. Numbers correspond to location on the chicken (Gallus) sequence (Desjardins and Morais, 1990) of the 3⬘ end of the primer sequence. b All primers are listed in the 5⬘ to 3⬘ direction. Degenerate sites are indicated by brackets. Sequences of ND2 and ND3 primers were provided by Jeffrey G. Groth of the American Museum of Natural History.

other systematic studies of birds (Hackett, 1996; Johnson and Sorenson, 1998; Johnson and Lanyon, 1999; Omland et al., 1999; DeFilippis and Moore, 2000; Johnson and Clayton, 2000). All sequences, referenced to their vouchers and full localities, are deposited in GenBank (Accession Nos. AF081992, AF081964, AF081958 –AF081960, and AY030103–AY030190). To assess the affects of taxon sampling on resolution of interfamilial relationships, we searched GenBank for sequences of other taxa in the Corvida (Monroe and Sibley, 1993). Because avian sequences in GenBank are overwhelmingly dominated by cyt b, and to provide as many characters as possible for comparison, we limited our analysis to complete or nearly complete sequences of this gene. A total of 14 sequences were used: Old World corvids (Corvidae), Cyanolyca viridicyana (Accession No. U77333), Cyanocorax chrysops (U77334), Calocitta formosa (U77336), Garrulus glandarius (U86034), Urocissa erythrorhyncha (U86038), Perisoreus infaustus (U86042); whistlers (Pachycephalidae), Turnagra capensis (U51734), Pachycephala pectoralis (U51735); monarchs (Monarchidae), Terpsiphone paradisi (AF096466), Terpsiphone viridis (AF094616); birds-of-paradise (Paradisaeidae), Paradisaea rudolphi (U15203), Lophorina superba (U25733); and bowerbirds (Ptilonorhynchidae), Ptilonorhynchus violaceus (X74256), Ailuroedus melanotus (X74257). Laboratory Procedures Whole genomic DNA was extracted from frozen tissue with either a 5% chelex solution (Walsh et al.,

1991) or a DNeasy extraction kit (Qiagen). Different combinations of primers (Table 2) then targeted specific genes or fragments for amplification by polymerase chain reaction (PCR). Double-stranded PCRs were performed in 25-␮l volumes containing 3–5 ␮l of extract and 20 –22 ␮l of a mix that included a Tris–MgCl 2 buffer (pH of buffers ranged from 8.3 to 8.8; MgCL 2 concentrations varied from 1.5 to 2 mM), unincorporated dNTPs, equal concentrations of each primer, Taq polymerase, and double-distilled water [see Cicero and Johnson (1995), p. 549 for final mix concentrations]. PCRs involved initial denaturation at 93°C for 5 min, followed by 30 –35 cycles of denaturation (93°C for 30 – 60 s), annealing (45–50°C for 30 – 60 s), and extension (72°C for 45–90 s), and a final extension after the last cycle at 72°C for 3 min. Thermal cycling used either a PHC-2 (Techne) or a PTC-100 (MJ Research) programmable thermocycler; in the case of the former, each reaction volume contained a drop of mineral oil to prevent evaporation. Extractions and PCRs included at least one negative control, and products were examined on agarose gels stained with ethidium bromide. Double-stranded products were cleaned with a Qiaquick-spin PCR Purification Kit (Qiagen) and then cycle-sequenced with fluorescent dye-labeled terminators (ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA Polymerase, FS; Perkin–Elmer). Sequencing reactions were performed in 10-␮l volumes for 24 cycles under the following conditions: 30 s at 96°C, 15 s at 50°C, and 4 min at

31

HIGHER-LEVEL PHYLOGENY OF VIREONIDS

60°C. After the sequencing, the DNA was ethanolprecipitated, vacuum-dried, and resuspended in formamide/blue dextran (5:1) by being heated at 90°C for 2 min. Samples were run for 7 h on a 4.8% Page Plus (Amaresco) acrylamide gel using an ABI Prism 377 automated sequencer. Overlapping fragments were sequenced in both directions for verification. Difficult samples were reextracted, reamplified, and/or resequenced until unambiguous results were obtained. All final sequences were clean, with no evidence of nuclear copies. Phylogenetic Analyses Sequences for each fragment were aligned (clustal method), checked against electropherograms with Sequence Navigator (version 1.0.1; Applied Biosystems, Perkin–Elmer), and then joined and translated with MacDNASYSIS Pro (version 1.0; Hitachi Software Engineering Ltd., 1991). Sequences were analyzed with PAUPⴱ (Swofford, 1999) with the beta test version 4.064a, on both Power Macintosh and Windows operating systems. Uncorrected pairwise divergence (p) was plotted against the proportion of transition and transversion substitutions at each codon position to examine possible saturation and sequence homoplasy (Hillis et al., 1996; Broughton et al., 2000) in the four genes. In addition, to compare rates of divergence between the different genes, p values for ND2, ND3, and COI were regressed against those for cyt b for all codon positions and substitution types; this also enabled comparison with published studies that have examined the relative utility of cyt b versus other mtDNA markers in phylogenetic analyses (e.g., ND2: Hackett, 1996; Johnson and Lanyon, 1999; Omland et al., 1999). To test for incongruent phylogenetic signal between genes, we performed partition homogeneity tests (Farris et al., 1995) using the heuristic method with 10 random addition replicates and 1000 iterations. Different character sets (i.e., genes) and taxa were included, depending on the analysis. These tests all resulted in nonsignificant differences (P ⬎ 0.05), and thus phylogenetic analyses were performed for combined data sets and separately for different genes. Tree topologies were generated with maximum-parsimony and maximum-likelihood methods. Because saturation plots showed evidence of “multiple hits” at third position transitions, we downweighted these characters (weight ⫽ 0) in phylogenetic reconstructions. Parsimony analyses involved 1000 bootstrap replications with full heuristic searches, with the TBR branchswapping algorithm and random addition of taxa (10 replicates per iteration). In addition, parsimony analysis with jackknifing of taxa was performed on the expanded cyt b data set (including GenBank sequences) to systematically assess the effects of taxon sampling on gene tree resolution. In this analysis, in-

dividual taxa were sequentially removed (i.e., jackknifed; Lanyon, 1985) and the resulting data set of n-1 taxa was reanalyzed with heuristic parsimony (TBR) with 10 random addition replicates and strict consensus of trees. PAUP code for the jackknife analysis was provided by S. M. Lanyon (in litt.). Jackknife values were determined manually by comparison of the nodes in each consensus tree with those in the bootstrapped parsimony tree with all taxa included. For maximum-likelihood, a starting tree was obtained by parsimony (same criteria as above), and the data and tree topology were subjected to several rounds of likelihood analysis until a stable tree and log likelihood value was obtained (see procedure outlined by Huelsenbeck (1998), p. 528). The HKY85 model (Hasegawa et al., 1985; Hillis et al., 1996, p. 434) which incorporates two substitution types and unequal, empirical base frequencies was used, with two parameters estimated from the data set: transition/transversion ratio and shape of the gamma distribution of rate change at different sites. The proportion of invariant sites (i.e., those unable to accept substitutions) was assumed to be zero. This iterative method reduces computational difficulties associated with maximum-likelihood, especially for large data sets and complex models of DNA substitution that incorporate among-site rate variation and a transition–transversion rate bias (Huelsenbeck, 1998; Huelsenbeck and Crandall, 1997). RESULTS Length Variation in Cytochrome b Sequences of cyt b contained 1143 bp for all taxa except Passer montanus, which showed an extra CAA (glutamine) codon at positions 1141–1143 and a stop codon (TAA) at positions 1144 –1146. Because of this unusual result, we obtained a second sample of P. montanus from Mongolia (Burke Museum, Univ. of Washington, Specimen No. 58052) and sequenced the last third of the gene for verification (primers L15557 and H16065). This sequence matched that of the other P. montanus sample and that of a sample of the same species from Singapore that was sequenced independently in another lab (Groth, 1998). Thus, it appears that the inserted glutamine codon is a characteristic of P. montanus from widely disparate geographic areas. In contrast, the sample of P. domesticus that we sequenced lacked the extra codon. The only other bird species reported to have a cyt b sequence of 1146 bp (vs 1143 bp), with an identical inserted codon in the same position, is Petronia pyrgita (Groth, 1998), also in the family Passeridae. Sequence Variation within and between Genes Of the 3069 total bp sequenced, 54.5% were variable, 38.6% were parsimony informative, and 9.4% had at

32

CICERO AND JOHNSON

TABLE 3 Properties of Four mtDNA Genes Sequenced for 21 Taxa in Table 1

% % % %

Variable sites Parsimony-informative sites A a Parsimony-informative sites B a Nonsynonymous sites b a b

Cyt b

ND2

ND3

COI

Combined

43.7 36.3 35.7 8.7

54.2 47.7 46.0 14.5

47.6 38.7 37.3 9.1

31.1 25.7 25.3 3.4

54.5 38.6 37.5 9.4

A, all positions included; B, third position transitions excluded. Proportion of sites resulting in nonsynonymous substitutions.

least one nonsynonymous substitution across all taxa and characters (Table 3). ND2 had the largest percentage of variable, parsimony-informative, and nonsynonymous sites, followed by ND3, cyt b, and COI. Cytochrome b and ND3 were approximately equivalent in levels of sequence variation. Differences in rates of variation among the four genes are illustrated in Fig. 1. Whereas ND3 had slightly higher rates than cyt b at all levels of divergence, ND2 and COI diverged in opposite directions from cyt b in more distant taxonomic comparisons (slopes ⫽ 1.25 and 0.59, respectively). Uncorrected pairwise sequence divergence (p) at different taxonomic levels and for each of the four genes is given in Table 4. Mean values in congeneric comparisons for the different genes ranged from 6.8 to 9.7%. The most similar taxa were Lanius excubitor and L. ludovicianus (2.9 to 4.3%), followed by the two species of Empidonax (6.9 to 8.9%) and Passer (7.1 to 10.9%); mean values across the four genes for these three pairs of congeners were 3.8, 8.6, and 8.1%, respectively. Within Vireo, comparisons of the two species sequenced for all four genes revealed values ranging from 9.4% (cyt b and COI) to 14.8% (ND2), with a mean of 11.2% across genes. Pairwise comparisons of additional taxa of Vireonidae for cyt b and ND2 also showed high levels of sequence divergence within genera and even between subspecies of species as currently defined (Table 5). The most similar taxa were Hylophilus ochraceiceps viridior and H. o. ferrugineifrons (mean ⫽ 1 to 1.4% for cyt b and ND2, respectively). Cychlarhis guganensis gujanensis and C. g. ochrocephala were 6.6% (cyt b) to 12.2% (ND2) different, Vireolanius leucotis leucotis and V. l. bolivianus differed at 6.1 to 6.5%, and species of Vireo were divergent at values ranging from 2.7–3.2% (V. solitarius vs V. plumbeus) to 8.0 –15.6% (eye-ringed vs eyelined representatives). Mean levels of sequence divergence between genera of vireonids varied from 10.4% for cyt b and 18.2% for ND2 (Table 5) to 9.3% for COI and 15.0% for ND3. Intergeneric comparisons within the Parulidae and Corvidae for each gene resulted in mean values of 8.6 to 10.3% and 10.3 to 14.3%, respectively. For all four genes combined, the average pairwise difference be-

FIG. 1. Comparison of percentage sequence difference in cytochrome b (abscissa) versus three other mtDNA genes (ordinate) for the 21 taxa in Table 1. Light gray line in each plot shows equal rates of variation among cyt b and ND2, ND3, and COI, respectively. Note the different scale for ND2 compared to that of the other two genes.

33

HIGHER-LEVEL PHYLOGENY OF VIREONIDS

TABLE 4 Uncorrected Pairwise Sequence Divergence (p) at Different Taxonomic Levels for Four mtDNA Genes (Mean ⴞ SD, Range in Parentheses) Comparison (n) a Interspecific/intrageneric (4) Intergeneric/intrafamilial (29) Interfamilial-oscines (140) Vireonidae vs Laniidae (10) Vireonidae vs Corvidae (25) Vireonidae vs Parulidae (25) Vireonidae vs Passeridae (10) Empidonax vs oscines (38)

Cyt b

ND2

ND3 b

COI

0.068 ⫾ 0.028 (0.029–0.094) 0.106 ⫾ 0.013 (0.077–0.134) 0.161 ⫾ 0.015 (0.124–0.198) 0.153 ⫾ 0.007 (0.143–0.161) 0.153 ⫾ 0.009 (0.132–0.165) 0.158 ⫾ 0.010 (0.137–0.183) 0.157 ⫾ 0.010 (0.146–0.175) 0.204 ⫾ 0.010 (0.184–0.223)

0.096 ⫾ 0.044 (0.042–0.148) 0.141 ⫾ 0.034 (0.089–0.197) 0.222 ⫾ 0.018 (0.174–0.260) 0.232 ⫾ 0.015 (0.211–0.250) 0.212 ⫾ 0.008 (0.197–0.226) 0.236 ⫾ 0.009 (0.219–0.257) 0.226 ⫾ 0.008 (0.214–0.235) 0.281 ⫾ 0.010 (0.266–0.305)

0.097 ⫾ 0.012 (0.089–0.111) 0.126 ⫾ 0.030 (0.071–0.174) 0.183 ⫾ 0.023 (0.131–0.231) 0.159 ⫾ 0.017 (0.131–0.174) 0.191 ⫾ 0.017 (0.165–0.231) 0.167 ⫾ 0.013 (0.142–0.194) 0.181 ⫾ 0.012 (0.165–0.197) 0.222 ⫾ 0.014 (0.197–0.242)

0.069 ⫾ 0.021 (0.043–0.094) 0.094 ⫾ 0.013 (0.070–0.122) 0.121 ⫾ 0.011 (0.095–0.157) 0.122 ⫾ 0.004 (0.116–0.129) 0.112 ⫾ 0.007 (0.101–0.123) 0.115 ⫾ 0.010 (0.095–0.142) 0.121 ⫾ 0.004 (0.112–0.127) 0.158 ⫾ 0.012 (0.133–0.181)

a

Includes only taxa sequenced for all four genes (Table 1). See Table 5 for comparisons of additional taxa within Vireonidae (cyt b and ND2). b Excludes Lanius excubitor because numerous attempts at sequencing gave ambiguous results.

tween genera of vireonids (13.2%) and corvids (12.6%) was higher than that observed among genera of parulid warblers (9.4%). Sequence divergence among the five oscine families varied from a mean of 12.1 to 22.2%, depending on the gene sequenced (Table 4). For comparisons involving the Vireonidae, average values ranged from 11.2% in COI (Vireonidae vs Corvidae) to 23.6% in ND2 (Vireonidae vs Parulidae). ND2 had the highest levels of divergence (21.2 to 23.6%) between vireonids and other families, which was expected given its faster rate of divergence at deep taxonomic levels (Fig. 1). Inter-

familial differences in cyt b were essentially identical in all comparisons with the vireonids (15.3 to 15.8%), as were divergences averaged across all four genes (Vireonidae vs Laniidae, 16.7%; Vireonidae vs Corvidae, 16.7%; Vireonidae vs Parulidae, 16.9%; Vireonidae vs Passeridae, 17.1%). Evidence of Sequence Saturation Transition and transversion substitutions increased linearly with percentage sequence divergence at first and second positions in all four genes, indicating that changes at these sites are not saturated. In contrast,

TABLE 5 Uncorrected Pairwise Sequence Divergence (p) within and between Genera of Vireonidae Taxon a

1

2

3

4

5

6

7

8

9

10

1. C. gujanensis (Bolivia) 2. C. gujanensis (Paraguay) 3. H. ochraceiceps (Bolivia) 4. H. ochraceiceps (Peru) 5. V. leucotis (Ecuador) 6. V. leucotis (Bolivia) 7. V. solitarius (ER) b 8. V. plumbeus (ER) 9. V. gilvus (EL) b 10. V. leucophrys (EL)

— 0.122 0.181 0.184 0.197 0.189 0.180 0.184 0.180 0.179

0.066 — 0.183 0.182 0.204 0.202 0.190 0.192 0.197 0.193

0.095 0.100 — 0.014 0.192 0.192 0.160 0.168 0.176 0.155

0.098 0.099 0.010 — 0.192 0.195 0.164 0.170 0.173 0.150

0.110 0.106 0.117 0.116 — 0.065 0.182 0.187 0.181 0.179

0.116 0.109 0.123 0.120 0.061 — 0.179 0.186 0.180 0.176

0.105 0.102 0.095 0.098 0.106 0.117 — 0.027 0.148 0.150

0.097 0.105 0.097 0.099 0.110 0.122 0.032 — 0.156 0.155

0.103 0.103 0.098 0.095 0.111 0.097 0.094 0.098 — 0.092

0.105 0.098 0.089 0.089 0.102 0.106 0.080 0.086 0.057 —

Note. Values above the diagonal are for cyt b; values below the diagonal are for ND2. a Subspecific designations: 1, Cyclarhis gujanensis gujanensis; 2, C. g. ochrocephala; 3, Hylophilus ochraceiceps viridior; 4, H. o. ferrugineifrons; 5, Vireolanius leucotis leucotis; 6, V. l. bolivianus; 7, Vireo solitarius solitarius; 8, V. plumbeus plumbeus; 9, V. gilvus gilvus; 10, V. leucophrys leucophrys. b ER, eye-ringed clade of Vireo; EL, eye-lined clade of Vireo (Murray et al., 1994; Cicero and Johnson, 1998; C.Cicero and N. K. Johnson, unpublished).

34

CICERO AND JOHNSON

FIG. 2. Proportion of transition and transversion substitutions at third positions versus total percentage sequence divergence for four mtDNA genes. Dots represent pairwise comparisons for the 19 ingroup taxa in Table 1. Open circles represent pairwise comparisons between these taxa and the Empidonax outgroups. Note the different scales (abscissa and ordinate) for the various genes.

whereas third position transversions also appeared unsaturated, “multiple hits” were evident at third position transitions (Fig. 2). Cyt b and ND3 showed evidence of saturation at similar levels of sequence divergence (10 –15%), whereas ND2 did not become saturated until higher levels (ca. 15–20% divergence). COI appeared to be less saturated than the other genes in both ingroup and outgroup comparisons. Because saturation was evident at the moderate to deep levels of divergence considered in this study, the sequence data were partitioned by the elimination of third position transitions. Gene Trees, Taxon Sampling, and Interfamilial Relationships Gene trees were derived for cyt b, ND2, and COI with sequences from the 19 ingroup taxa plus two outgroups listed in Table 1. In addition, two other trees were

obtained for cyt b and ND2 by expansion of the data set to include the same 21 taxa plus another five vireonids sequenced for those genes (see Materials and Methods and Table 5). A gene tree for ND3 was not obtained because of missing sequence for Lanius excubitor (see Table 4), which left only a single representative of the Laniidae that could confound the analysis due to the problem of long-branch attraction. Families appeared monophyletic in each of these trees (Fig. 3) and in those generated by maximumlikelihood. Bootstrap support, however, varied depending on the gene sequenced. Support for monophyly of families was highest in the cyt b and ND2 trees (91– 100%), whereas COI gave values ranging from 21% (Corvidae) to 100% (Laniidae). Vireonids had moderately high support in the COI tree (70%). The lower resolution of COI was unsurprising, given that this gene had substantially fewer variable and parsimonyinformative sites than cyt b and ND2 (Table 3). In contrast to the relatively tight grouping of taxa at the family level, deeper nodes were not well supported and different gene trees varied in arrangement of families (Fig. 3). Maximum-likelihood analysis showed the same pattern as parsimony. For both methods, the only consistent grouping included the two families of Passerida (Passeridae, Parulidae), which were separate from the Vireonidae and other members of the Corvida (Corvidae, Laniidae). Although inclusion of additional vireos for cyt b and ND2 did not affect these main results, it did alter tree topologies and bootstrap values on the deeper branches (Fig. 3A vs Fig. 3B; Fig. 3C vs Fig. 3D). This was especially evident in the ND2 tree, in which support for deeper nodes in the Corvida clade dropped from 72–75% to 29 – 46%. Such a result is consistent with the finding of high genetic divergence within vireonids, especially in ND2 (Table 5), which would tend to shorten the branch leading to Vireonidae (i.e., lower the support) as more taxa are included that contain synapomorphies within the family. The addition of taxa from GenBank in the cyt b tree (Fig. 4) yielded a result similar to that of the other gene trees: strong support for monophyly of families based on the taxa sampled (except for Pachycephalidae) and low support for relationships among families. Maximum-parsimony and maximum-likelihood produced comparable results, as did bootstrapping and jackknifing. On the basis of all analyses, the Passeridae and Parulidae consistently allied together, although their placement relative to families of Corvida was not resolved. Two other groups of families that showed fairly consistent arrangements were (1) monarchs (Monarchidae) and birds-of-paradise (Paradisaeidae), which allied together in 100% of jackknife replicates (bootstrap support was lower at 56%), and (2) bowerbirds (Ptilonorhynchidae) and one representative of the whistlers (Pachycephalidae, Turnagra capensis), which also came out in 100% of jackknife trees (boot-

HIGHER-LEVEL PHYLOGENY OF VIREONIDS

35

FIG. 3. Gene trees based on maximum-parsimony analysis, third position transitions excluded, for cyt b, ND2, and COI. (A, C, E) Based on 19 ingroup taxa from Table 1; (B, D) based on the same ingroup taxa plus five additional vireonids (see Materials and Methods); COI was not sequenced for these other taxa. Two Empidonax sequences were used as outgroups in all analyses. Because the families consistently appeared monophyletic, branches were collapsed within families for illustration. Numbers above the branches represent bootstrap values for 1000 replicates. Tree statistics: (A) length ⫽ 826, CI ⫽ 0.464, RI ⫽ 0.652, RC ⫽ 0.302; (B) length ⫽ 2575, CI ⫽ 0.534, RI ⫽ 0.665, RC ⫽ 0.355; (C) length ⫽ 997, CI ⫽ 0.495, RI ⫽ 0.664, RC ⫽ 0.329; (D) length ⫽ 2583, CI ⫽ 0.532, RI ⫽ 0.663, RC ⫽ 0.353; (E) length ⫽ 193, CI ⫽ 0.446, RI ⫽ 0.626, RC ⫽ 0.279.

strap value ⫽ 66%). Although vireonids grouped with monarchs and birds-of-paradise in the cyt b tree (Fig. 4), this result was not strongly supported by either bootstrapping (26%) or jackknifing (45%). In all analyses, the two “whistlers” (T. capensis and Pachycephala pectoralis) were polyphyletic and, in combination with bowerbirds, appeared distant from other families of Corvida.

higher than that for the other gene trees (79 –96% vs 29 – 69%). Affinities of genera within each family were less well resolved, especially for the Vireonidae and Parulidae. The generally low bootstrap support in these two groups (29 to 76%) is consistent with the evidence of short internodes between long terminal branches.

Combined Analysis of Interfamilial Relationships

In the combined analysis of five vireonids plus 16 taxa in other families (Table 1, Fig. 5), Cyclarhis and Vireolanius fell out basally within the family, with Cyclarhis being most basal (bootstrap support ⫽ 76%). Vireo solitarius also allied with Hylophilus ochraceiceps rather than with V. gilvus, although support for this relationship was low (32–35%). Because we suspected that the alliance of eye-ringed Vireo with Hylo-

Phylogenetic analyses with sequences from all four genes (3069 bp total; Fig. 5) yielded a family-level topology identical to that of the tree obtained with ND2 and the same taxon set (i.e., five vireonids and 16 outgroups; Table 1 and Fig. 3C). Although bootstrap support at deep nodes was similar to that for the comparable ND2 tree (Fig. 3C; ⬎70%), it was notably

Intergeneric Relationships within the Vireonidae

36

CICERO AND JOHNSON

relatively short branches at deep levels in the tree (Fig. 6). Additional taxon sampling is needed to adequately determine the relative position of Cyclarhis and Vireolanius within the Vireonidae and to resolve the relationship among Hylophilus and the two clades of Vireo (C. Cicero and N. K. Johnson, unpublished). DISCUSSION Monophyly and Relationships of Major Oscine Families

FIG. 4. Maximum-parsimony tree of cyt b sequences, third position transitions excluded, for 38 ingroup taxa plus two outgroups (Empidonax). The ingroup includes 19 taxa from five families listed in Table 1, plus an additional five vireonids and 14 sequences from GenBank (see Materials and Methods). Because taxa from each family were monophyletic (except Pachycephalidae), branches within families were collapsed for illustration. “Pachycephalidae 1” and “Pachycephalidae 2” are Turnagra capensis and Pachycephala pectoralis, respectively. Numbers above the branches represent bootstrap values for 1000 replicates; numbers below the branches represent the proportion of consensus trees with jackknifed taxa that contained a particular node. Tree statistics: length ⫽ 2968, CI ⫽ 0.308, RI ⫽ 0.462, RC ⫽ 0.142.

philus was a taxon sampling problem, and to better understand intergeneric relationships within the Vireonidae, we added cyt b and ND2 sequences for another five vireo samples and reanalyzed the data for these two genes with a pair of corvids and shrikes as outgroups. Parsimony trees for ND2 or combined sequences gave the same topology (Fig. 6), and the addition of other outgroups (three corvids plus Passeridae and Parulidae; Table 1) did not affect these results. Cyclarhis and Vireolanius again appeared basal to Hylophilus and Vireo, but, in contrast to the findings indicated in Fig. 5, Vireolanius emerged as the most basal taxon. These trees also showed strong support for each genus except Vireo, for which bootstrap values were high (100%) for the eye-ringed and eye-lined clades but not for the genus itself (36 – 60%). Maximum-likelihood analysis for the ND2 data set gave an identical result, whereas that for the combined analysis agreed in the relative position of Cyclarhis and Vireolanius but placed Hylophilus as the sister taxon to the eye-ringed clade of Vireo (similar to the result in Fig. 5). Parsimony and likelihood analyses of cyt b, on the other hand, placed Vireolanius in a clade with Vireo, although support for this relationship was low (bootstrap ⫽ 18%). This lack of resolution of generic relationships within Vireonidae is consistent with the

The most consistent finding in all analyses was the relatively strong support for groupings of taxa within each family. For the sequences analyzed, only the Pachycephalidae emerged as paraphyletic based on cytochrome b. Analyses of multiple mtDNA genes further supported the basic subdivision of oscine passerines into two clades (Corvida and Passerida; Sibley and Ahlquist, 1990), although inclusion of additional taxa with only cyt b sequences (especially Ptilonorhynchidae and Pachycephalidae) failed to recover this phylogeny. Within the Corvida, the mtDNA data did not indicate a close relationship between vireonids and any other family included in the analyses. Monophyly of the passerines as a whole, and of oscines in particular, has been well established with molecular (Mindell et al., 1997; Sheldon and Bledsoe, 1993; Sibley and Ahlquist, 1990) and morphological (Raikow, 1982) characters. Furthermore, anatomical study of over 600 oscine species representing all traditional families provided evidence for the monophyly of most groupings (Beecher, 1953). Recent molecular analyses based on a broad sampling of taxa have corroborated the morphologic and anatomical evidence for monophyly in many cases (e.g., Helm-Bychowski and Cracraft, 1993; Chikuni et al., 1996; Sheldon and Gill, 1996; Groth, 1998; Voelker and Edwards, 1998; Cibois and Pasquet, 1999; this study). A notable exception is the Old World leaf-warblers (Sylviidae), a large radiation of over 200 species in 36 genera (Monroe and Sibley, 1993), which is paraphyletic on the basis of both mtDNA sequences (Chikuni et al., 1996) and DNA hybridization data (Sheldon and Gill, 1996). Despite both traditional and molecular evidence for monophyletic oscine families, resolution of interfamilial relationships continues to plague avian systematists. This difficulty stems from the lack of discrete breaks between groups and the tendency for independent evolution of morphological, behavioral, or ecological traits in unrelated oscine lineages (e.g., Beecher, 1953; Sheldon and Gill, 1996; Raikow, 1986). As noted by Beecher (1953), “the real problem in the oscines [is the lack of] characters for showing the relation of the families to each other.” Although molecular techniques potentially can resolve many of these relationships, studies to date generally have failed to provide consis-

HIGHER-LEVEL PHYLOGENY OF VIREONIDS

37

FIG. 5. Bootstrapped parsimony tree for combined sequences of four mtDNA genes, third position transitions excluded, for 19 taxa from five families (Table 1); two Empidonax sequences were used as outgroups. For Lanius excubitor, the data set consisted of cyt b, ND2, and COI, with the lack of sequence for ND3 (see Table 4) treated as missing data. Species of Vireo in the eye-ringed and eye-lined clades are designated ER and EL, respectively. A partition homogeneity test (Farris et al., 1995) showed that the four genes exhibit congruent phylogenetic signal (P ⫽ 0.124). Numbers above the branches represent bootstrap values for 1000 replicates. Maximum-likelihood analysis of the data set resulted in the same topology. Tree statistics: length ⫽ 2340, CI ⫽ 0.471, RI ⫽ 0.644, RC ⫽ 0.304.

tent support for interfamilial affinities. One reason for this is the bush-like nature (i.e., short internodes) of many higher-level oscine phylogenies (Groth, 1998; Sheldon and Gill, 1996; Voelker and Edwards, 1998), which apparently result from starburst branching events within the oscine radiation (Sheldon and Gill, 1996). Such an explanation may account for the poor resolution of family relationships examined in the current study. Alternatively, this result could be an artifact of incomplete sampling of families with closer phylogenetic ties to the groups examined. Molecular Hypotheses for Origin and Diversification of the Vireonidae Several lines of evidence support the hypothesis that New World vireos are allied with Old World groups: palate and jaw musculature (Beecher, 1953), DNA hybridization curves (Sibley and Ahlquist, 1982, 1990), and mtDNA sequences (this study). Beecher (1953)

proposed that vireos descended from an Old World insectivorous ancestor that colonized the New World via the Bering land bridge, subsequently became isolated as the corridor was submerged or the climate became too cold, and then gave rise to the entire 9-primaried assemblage. He further hypothesized that vireos represent a very old lineage and that the 9-primaried radiation coincided with the origin and diversification of flowering plants. Finally, he suggested that the lower diversity of vireonids relative to the 9-primaried oscines (e.g., wood warblers, tanagers), despite the older age of the vireo lineage, is attributed to the greater adaptability of the latter groups in exploiting new niches offered by flowering plants. Beecher’s hypotheses can be tested with molecular phylogenetic evidence. First, the supposed relationship of vireos to the 9-primaried oscines is not supported by either allozymes (Johnson et al., 1988; Avise et al.,

38

CICERO AND JOHNSON

FIG. 6. Bootstrapped tree for combined sequences of cyt b and ND2 for 10 taxa of Vireonidae, with two Corvidae and two Laniidae as outgroups. The eye-lined and eye-ringed clades of Vireo are designated as EL and ER, respectively. Subspecific designations of taxa are given in Table 5. The same topology was obtained with ND2 alone. Numbers above the branches represent bootstrap values for 1000 replicates with third position transitions excluded (cyt b ⫹ ND2/ND2, respectively). A partition homogeneity test (Farris et al., 1995) for this data set showed that the two genes exhibit congruent phylogenetic signal (P ⫽ 0.434). Tree statistics: length ⫽ 981, CI ⫽ 0.637, RI ⫽ 0.697, RC ⫽ 0.444.

1980) or DNA (Sibley and Ahlquist, 1982, 1990; Groth, 1998; this study). Thus, the similar number of wing primaries in these groups appears to be due to convergence rather than to evolutionary history. This finding is consistent with evidence that, in general, number of wing primaries has limited utility for reconstructing higher-level oscine relationships (Groth, 1998). Second, molecular analyses support an Old World vs New World ancestry for the Vireonidae (Sibley and Ahlquist, 1982, 1990; this study), with subsequent radiation centered in the Middle American tropics (Cicero and Johnson, 1998; also see Mayr, 1946). Of the four genera, only some species of Vireo breed in temperate habitats in North America. More importantly, the two basal genera (Cyclarhis and Vireolanius) and Hylophilus, are restricted to the Neotropics. Three alternative hypotheses may be proposed to account for the phylogenetic history and current geographic distribution of vireonids: (1) origin in Middle America from a corvoid ancestor, itself of ultimate Old World origin; (2) colonization of Middle America by an Old World ancestor via trans-Pacific Ocean dispersal; or (3) colonization

of North America by an Old World ancestor via the Bering land bridge, followed by southward dispersal of the ancestor into Middle America. In view of the absence of vireonids in the Old World, and the lack of close relatives in the New World, all of these hypotheses invoke extinction of the ancestor in the New World. We reject the first hypothesis because it would not offer the potential diversity of corvoid ancestors possible in the Old World. Furthermore, the only extant corvoids in the New World include representatives of the Laniidae and Corvidae, both of which are distant to vireonids (this study). Although the second hypothesis invokes both colonization and radiation in the Neotropics, we also reject this scenario because transoceanic dispersal of a protovireonid is unlikely. The third hypothesis is more complex because it involves extinction of the ancestor in North America after postcolonization dispersal into Middle America, with subsequent reinvasion of the North Temperate Zone by Vireo. Nonetheless, we favor this alternative because Beringia is the most plausible route for colonization of the New World and because occupancy of temperate habitats by Vireo apparently occurred relatively recently (Cicero and Johnson, 1998). Despite our reluctance to calibrate genetic distance with time (for summary of problems, see Avise, 1994; Hillis et al., 1996), the molecular data support Beecher’s (1953) hypothesis that the Vireonidae represents an old lineage. Although relatively short internodes appear to separate vireonids from other groups, and different genera within Vireonidae, both allozymes (Johnson et al., 1988) and mtDNA (Murray et al., 1994; Cicero and Johnson, 1998; this study) have shown exceptionally large divergences—i.e., large genetic distances and long terminal branches—within the family at the species or genus level. This finding is consistent with an early radiation. Additional molecular studies of relationships among vireonids (C. Cicero and N. K. Johnson, unpublished) should further elucidate the evolutionary history of this group. Contrary to prior hypotheses of relationship, the mtDNA sequence data do not support an alliance of vireos to shrikes, whistlers, or monarchs (Naumburg, 1925; Beecher, 1953). Although the goal of this study was not to search for the putative sister taxon of vireonids, such a quest may prove elusive because of the age of the group and because of general difficulties in resolving relationships among oscine families (e.g., Sheldon and Gill, 1996; Helm-Bychowski and Cracraft, 1993; Groth, 1998). Furthermore, extinction likely eliminated the sister taxon. Whereas increasing the amount of sequence can result in stronger support for phylogenetic reconstructions (DeFilippis and Moore, 2000), even more extensive sequencing may not resolve a phylogeny that is characterized by short internodes at deep levels in the tree. Nonetheless, additional molecular analyses are needed to provide a more robust

39

HIGHER-LEVEL PHYLOGENY OF VIREONIDS

hypothesis for the evolutionary origin of vireonids. Such a study should include multiple representatives of all families in the Corvida and sequences from independently evolving mtDNA and nuclear markers. Utility of Different mtDNA Genes in Phylogenetic Reconstruction This study adds to a growing literature that demonstrates the utility of different mtDNA genes in resolving phylogenetic relationships (Graybeal, 1994; Meyer, 1994; Griffiths, 1997; Moore and DeFilippis, 1997). As in other oscine birds (e.g., tanagers, Hackett, 1996; blackbirds, Johnson and Lanyon, 1999; orioles, Omland et al., 1999), ND2 was shown to evolve at a faster rate and to contain a higher proportion of informative characters than either cyt b or the other genes examined. Furthermore, third position transitions appeared to be less saturated in ND2 than in cyt b, especially at higher levels of sequence divergence. Similar findings have been reported for some nonpasserines (e.g., pigeons and doves [Columbidae], Johnson and Clayton, 2000; cuckoos [Cuculidae], Johnson et al., 2000), although dabbling ducks (Anatidae) show fairly uniform substitution rates in cyt b and ND2 (Johnson and Sorenson, 1998). Of the other two genes sequenced, ND3 was most similar to cyt b in levels of sequence variation and saturation. COI, on the other hand, appeared to evolve at a substantially slower rate than cyt b, had fewer parsimony-informative and nonsynonymous sites, and produced a less robust gene tree. A similar rate difference between cyt b and COI has been reported for woodpeckers (Picidae; DeFilippis and Moore, 2000), although the two genes were equivalent in rate when only synonymous substitutions were compared. Studies that incorporate multiple markers can elucidate patterns and processes of molecular evolution in different genes and contribute to an understanding of the phylogenetic history of various groups. ACKNOWLEDGMENTS We thank the following individuals and institutions for generous loans of tissue samples used in this study: Frederick H. Sheldon and Donna L. Dittman (Museum of Natural Science, Louisiana State University), Shannon J. Hackett and David Willard (Field Museum of Natural History), Kevin J. McGowan (Cornell University), Robert M. Zink (Bell Museum of Natural History, University of Minnesota), and Scott V. Edwards and Sharon Birks (Burke Museum, University of Washington). Jeffrey G. Groth kindly provided unpublished sequences of ND2 and ND3 primers. Scott M. Lanyon gave advice and PAUP code for jackknifing of taxa. J. Van Remsen checked subspecific identifications and voucher numbers for LSUMZ samples, and Nathan Rice provided information on the location of a voucher specimen of Vireolanius leucotis. Jerry Yu and Ka Yin (Harold) Fong assisted with laboratory work. Karen Klitz prepared the final illustrations. Three anonymous reviewers provided helpful comments that improved the manuscript. Laboratory expenses were funded by a grant from the Lulu Von Hagen Foundation.

REFERENCES American Ornithologists’ Union. (1983). “Check-List of North American Birds,” 6th ed., American Ornithologists’ Union, Lawrence, KS. American Ornithologists’ Union. (1998). “Check-List of North American Birds,” 7th Ed., American Ornithologists’ Union, Washington, DC. Ames, P. L. (1971). The morphology of the syrinx in passerine birds. Bull. Peabody Mus. Nat. Hist. 37: 1–194. Averill, C.K. (1925). The outer primary in relation to migration in the ten-primaried oscines. Auk 42: 353–358. Avise, J. C. (1994). “Molecular Markers: Natural History and Evolution,” Chapman & Hall, New York. Avise, J. C., Patton, J.C., and Aquadro, C. F. (1980). Evolutionary genetics of birds: Comparative molecular evolution in New World warblers and rodents. J. Hered. 71: 303–310. Barlow, J. C., and James, R. D. (1975). Aspects of the biology of the Chestnut-sided Shrike-Vireo. Wilson Bull. 87: 320 –334. Beecher, W. J. (1953). A phylogeny of the oscines. Auk 70: 270 –333. Broughton, R. E., Stanley, S.E., and Durrett, R. T. (2000). Quantification of homoplasy for nucleotide transitions and transversions and a reexamination of assumptions in weighted phylogenetic analysis. Syst. Biol. 49: 617– 627. Chikuni, K., Minaka, N., and Ikenaga, H. (1996). Molecular phylogeny of some Passeriformes, based on cytochrome b sequences. J. Yamashina Inst. Ornithol. 28: 1– 8. Cibois, A., and Pasquet, E. (1999). Molecular analysis of the phylogeny of 11 genera of the Corvidae. Ibis 141: 297–306. Cicero, C., and Johnson, N. K. (1995). Speciation in sapsuckers (Sphyrapicus): III. Mitochondrial-DNA sequence divergence at the cytochrome-b locus. Auk 112: 547–563. Cicero, C., and Johnson, N. K. (1998). Molecular phylogeny and ecological diversification in a clade of New World songbirds (genus Vireo). Mol. Ecol. 7: 1359 –1370. DeFilippis, V. R., and Moore, W. S. (2000). Resolution of phylogenetic relationships among recently evolved species as a function of amount of DNA sequence: An empirical study based on woodpeckers (Aves: Picidae). Mol. Phylogenet. Evol. 16: 143–160. Desjardins, P., and Morais, R. (1990). Sequence and gene organization of the chicken mitochondrial genome: A novel gene order in higher vertebrates. J. Mol. Biol. 212: 599 – 634. Edwards, S. V., Arctander, P., and Wilson, A. C. (1991). Mitochondrial resolution of a deep branch in the genealogical tree for perching birds. Proc. R. Soc. Lond. B. 243: 99 –107. Ericson, Per G. P., Johansson, U. S., and Parsons, T.J. (2000). Major divisions in oscines revealed by insertions in the nuclear gene c-myc: A novel gene in avian phylogenetics. Auk 117: 1069 –1078. Farris, J. S., Ka¨llersjo¨, M., Kluge, A. G., and Bult, C. (1995). Testing significance of incongruence. Cladistics 10: 315–319. Graybeal, A. (1994). The phylogenetic utility of cytochrome b: Lessons from bufonid frogs. Mol. Phylogenet. Evol. 2: 256 –269. Griffiths, C. S. (1997). Correlation of functional domains and rates of nucleotide substitution in cytochrome b. Mol. Phylogenet. Evol. 7: 352–365. Groth, J. G. (1998). Molecular phylogenetics of finches and sparrows: Consequences of character state removal in cytochrome b sequences. Mol. Phylogenet. Evol. 10: 377–390. Hackett, S. J. (1996). Molecular phylogenetics and biogeography of tanagers in the genus Ramphocelus (Aves). Mol. Phylogenet. Evol. 5: 368 –382. Hamilton, T. H. (1958). Adaptive variation in the genus Vireo. Wilson Bull. 70: 307–346.

40

CICERO AND JOHNSON

Hasegawa, M., Kishino, H., and Yano, T. (1985). Dating the human– ape split by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22: 160 –174. Helm-Bychowski, K., and Cracraft, J. (1993). Recovering phylogenetic signal from DNA sequences: Relationships within the corvine assemblage (Class Aves) as inferred from complete sequences of the mitochondrial DNA cytochrome-b gene. Mol. Biol. Evol. 10: 1196 –1214. Hillis, D. M., Moritz, C., and Mable, B. K. (1996). “Molecular Systematics,” 2nd ed., Sinauer, Sunderland, MA. Hitachi Software Engineering America Ltd. (1991). “Macintosh DNA and Protein Sequence Input and Analysis System, Version 1.0,” San Bruno, CA. Huelsenbeck, J. P. (1998). Systematic bias in phylogenetic analysis: Is the Stripsiptera problem solved? Syst. Biol. 47: 519 –537. Huelsenbeck, J. P., and Crandall, K. A. (1997). Phylogeny estimation and hypothesis testing using maximum likelihood. Annu. Rev. Ecol. Syst. 28: 437– 466. Johnson, K. P., and Clayton, D. H. (2000). A molecular phylogeny of the dove genus Zenaida: Mitochondrial and nuclear sequences. Condor 102: 864 – 870. Johnson, K. P., and Lanyon, S. M. (1999). Molecular systematics of the grackles and allies, and the effect of additional sequence (cyt b and ND2). Auk 116: 759 –768. Johnson, K. P., and Sorenson, M. D. (1998). Comparing molecular evolution in two mitochondrial protein coding genes (cytochrome b and ND2) in the dabbling ducks (Tribe: Anatini). Mol. Phylogenet. Evol. 10: 82–94. Johnson, K. P., Goodman, S. M., and Lanyon, S. M. (2000). A phylogenetic study of the Malagasy couas with insights into cuckoo relationships. Mol. Phylogenet. Evol. 14: 436 – 444. Johnson, N. K., Zink, R. M., and Marten, J. A. (1988). Genetic evidence for relationships in the avian family Vireonidae. Condor 90: 428 – 445. Lanyon, S. M. (1985). Detecting internal inconsistencies in distance data. Syst. Zool. 34: 397– 403. Lanyon, S. M. (1992). Review of “Phylogeny and Classification of Birds: A Study in Molecular Evolution,” by C. G. Sibley and J. E. Ahlquist. Condor 94: 304 –310. Lyons-Weiler, J., and Hoelzer, G. A. (1997). Escaping from the Felsenstein zone by detecting long branches in phylogenetic data. Mol. Phylogenet. Evol. 8: 375–384. Mayr, E. (1946). History of the North American bird fauna. Wilson Bull. 58: 3– 41. Mayr, E. (1958). The sequence of the songbird families. Condor 60: 194 –195. Mayr, E., and Amadon, D. (1951). A classification of recent birds. Am. Mus. Novit. 1496: 1–32. Mayer, A. (1994). The shortcomings of the cytochrome b gene as a molecular marker. Trends Ecol. Evol. 9: 278 –280. Mindell, D.P., Ed. (1997). “Avian Molecular Evolution and Systematics,” Academic Press, San Diego. Mindell, D. P., Sorenson, M. D., Huddleston, C. J., Miranda, H. C., Jr., Knight, A., Sawchuk, S. J., and Yuri, T. (1997). Phylogenetic relationships among and within select avian orders based on mitochondrial DNA. In “Avian Molecular Evolution and Systematics” (D. P. Mindell, Ed.), pp. 213–247. Academic Press, San Diego.

Monroe, B. L., Jr., and Sibley, C. G. (1993). “A World Checklist of Birds,” Yale Univ. Press, New Haven, CT. Moore, W. S., and DeFilippis, V. R. (1997). The window of taxonomic resolution for phylogenies based on mitochondrial cytochrome b. In “Avian Molecular Evolution and Systematics” (D. P. Mindell, Ed.), pp. 84 –119. Academic Press, San Diego. Murray, B. W., McGillivray, W. B., Barlow, J. C., Beech, R. N., and Strobeck, C. (1994). The use of cytochrome B sequence variation in estimation of phylogeny in the Vireonidae. Condor 96: 1037–1054. Naumburg, E. M. B. (1925). A few remarks about Cyclarhis gujanensis cearensis. Auk 42: 341–349. Omland, K. E., Lanyon, S. M., and Fritz, S. J. (1999). A molecular phylogeny of the New World orioles (Icterus): The importance of dense taxon sampling. Mol. Phylogenet. Evol. 12: 224 –239. Orenstein, R. I., and Barlow, J. C. (1981). Variation in the jaw musculature of the avian family Vireonidae. Life Sci. Contrib. R. Ontario Mus. 128. Poe, S. (1998). Sensitivity of phylogeny estimation to taxonomic sampling. Syst. Biol. 47: 18 –31. Raikow, R. J. (1978). Appendicular myology and relationships of the New World nine-primaried oscines (Aves: Passeriformes). Bull. Carnegie Mus. Nat. Hist. 7: 1– 43. Raikow, R. J. (1982). Monophyly of the Passeriformes: Test of a phylogenetic hypothesis. Auk 99: 431– 445. Raikow, R. J. (1986). Why are there so many kinds of passerine birds? Syst. Zool. 35: 255–259. Rannala, B., Huelsenbeck, J. P., Yang, Z., and Nielsen, R. (1998). Taxon sampling and the accuracy of large phylogenies. Syst. Biol. 47: 702–710. Sheldon, F. H., and Bledsoe, A. H. (1993). Avian molecular systematics, 1970s to 1990s. Annu. Rev. Ecol. Syst. 24: 243–278. Sheldon, F. H., and Gill, F. B. (1996). A reconsideration of songbird phylogeny, with emphasis on the evolution of titmice and their sylvioid relatives. Syst. Biol. 45: 473– 495. Sibley, C. G., and Ahlquist, J. E. (1982). The relationships of the vireos (Vireoninae) as indicated by DNA–DNA hybridization. Wilson Bull. 94: 114 –128. Sibley, C. G., and Ahlquist, J. E. (1990). “Phylogeny and Classification of Birds: A Study in Molecular Evolution,” Yale Univ. Press, New Haven, CT. Sibley, C. G., and B. L. Monroe, J. (1990). “Distribution and Taxonomy of Birds of the World,” Yale Univ. Press, New Haven, CT. Smith, A. B. (1994). Rooting molecular trees: Problems and strategies. Biol. J. Linn. Soc. 51: 279 –292. Swofford, D. L. (1999). “PAUPⴱ. Phylogenetic Analysis Using Parsimony, Version 4,” Sinauer, Sunderland, MA. Voelker, G., and Edwards, S. V. (1998). Can weighting improve bushy trees? Models of cytochrome b evolution and the molecular systematics of pipits and wagtails (Aves: Motacillidae). Syst. Biol. 47: 589 – 603. Walsh, P. S., Metzger, D. A., and Higuchi, R. (1991). Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10: 506 –513. Wetmore, A. (1960). A classification for the birds of the world. Smith. Misc. Coll. 139: 1–37.