- Email: [email protected]
Highly expressed EGFR in pearl sac may facilitate the pearl formation in the pearl oyster, Pinctada fucata
Gene 566 (2015) 201–211
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Highly expressed EGFR in pearl sac may facilitate the pearl formation in the pearl oyster, Pinctada fucata Wenjie Zhu a,b, Sigang Fan a, Guiju Huang a, Dongling Zhang c, Baosuo Liu a, Xiaomin Bi a,b, Dahui Yu a,⁎ a Key Laboratory of South China Sea Fishery Resources Exploitation & Utilization, Ministry of Agriculture and Division of Aquaculture and Biotechnology, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, China b College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China c Fisheries College of Jimei University, Xiamen 361021, China
a r t i c l e
i n f o
Article history: Received 2 February 2015 Received in revised form 16 April 2015 Accepted 17 April 2015 Available online 18 April 2015 Keywords: Pearl oyster Pearl sac EGFR Expression profiles Pearl formation Larval metamorphosis
a b s t r a c t Epidermal growth factor receptor (EGFR) plays an important role in cell growth, proliferation, differentiation and migration. Yet whether it functions in pearl formation or not is not reported. In this study, EGFR was cloned from the pearl oyster Pinctada fucata (named as Pf-EGFR) and its expression profiles were investigated. The cDNA was 2156 bp long with an ORF of 1017 bp encoding 338 amino acid residues. The deduced polypeptide contained an L domain and a cysteine-rich domain, consistent with the characteristics of ErbB family. The sequence of Pf-EGFR shared 22.78–56.71% identity with other EGFRs. The genomic sequence of Pf-EGFR consisted of six exons and five introns, being 5190 bp in total length, and expressed in all the tested tissues with a higher expression level in the pearl sac (P b 0.05). In situ hybridization showed that Pf-EGFR was specifically expressed on both the inner side of the outer fold and the outer side of the inner fold of the mantle, as well as on the whole pearl sac including the connective tissues. In addition, Pf-EGFR was markedly increased at larval metamorphosis, significantly higher than other development periods (P b 0.05). These results indicated that the Pf-EGFR may facilitate pearl formation as well as larval metamorphosis. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Epidermal growth factor receptor (EGFR), a transmembrane glycoprotein, belongs to a large family of cell surface receptors with intrinsic protein tyrosine kinase (PTK) activity (Bogdan and K.C., 2001), which consisted of an external growth factor binding domain, a transmembrane domain, and an internal tyrosine kinase domain (Yarden and Ullrich, 1988). EGFR can be activated by binding of ligands, for example, epidermal growth factor (EGF), transforming growth factor (TGF)-α, heparin-binding (HB)-EGF, amphiregulin, betacellulin and epiregulin, leading to the activation of the intrinsic kinase domain which triggers a series of signal transduction, and thus inducing cell proliferation, migration, differentiation and apoptosis (Olayioye et al., 2000; Schlessinger, 2000; Yarden and Sliwkowski, 2001; Citri and Yarden, Abbreviations: EGFR, epidermal growth factor receptor; Pf-EGFR, the EGFR gene from Pinctada fucata; ORF, open reading frame; PTK, protein tyrosine kinase; EGF, epidermal growth factor; TGF, transforming growth factor; qRT-PCR, quantitative realtime polymerase chain reaction; RACE, rapid-amplification of cDNA ends; PKC, protein kinase C; GRAVY, grand average of hydropathicity; ISH, in situ hybridization; DIG, digoxigenin; PFA, paraformaldehyde. ⁎ Corresponding author at: Key Laboratory of South China Sea Fishery Resources Exploitation & Utilization, Ministry of Agriculture, Guangzhou 510300, China. E-mail address: [email protected] (D. Yu).
http://dx.doi.org/10.1016/j.gene.2015.04.046 0378-1119/© 2015 Elsevier B.V. All rights reserved.
2006). It regulates normal physiological processes such as embryonic development, wound healing, tooth growth, eyelid opening in newborn, development of hair follicles, and mammary gland morphogenesis (Goishi et al., 2003). In addition, EGFR also contributes to pathology. For example, amplification and inappropriate activation of EGF receptor family members are associated with tumor growth (Blume-Jensen and Hunter, 2001; Yarden and Sliwkowski, 2001), psoriasis (Jost et al., 2000) and cardiomyopathy (Asakura et al., 2002; Crone et al., 2002). Yet its functions in mollusk are less reported. EGFR has been cloned from many species, such as Homo sapiens (Ullrich et al., 1984), Gallus gallus (Lax et al., 1988), Rattus norvegicus (Petch et al., 1990), Danio rerio (Goishi et al., 2003) and so on. However, information on molecular and functional characteristics of EGFR in mollusks is rare. In mollusks, EGFR was identified in Lymnaea stagnalis (van Kesteren et al., 2008), Apostichopus japonicus (Li et al., 2012), Haliotis diversicolor (Bai and Ke, 2012), Crassostrea angulata (Qin et al., 2010) and Crassostrea gigas (Sun et al., 2014), respectively. EGFR plays an important role in innate immunity and differentiation (Bai and Ke, 2012) and is mainly expressed in metamorphosis stage (Han et al., 2012) and might function in the cell proliferation and migration during wound healing (Sun et al., 2014). The genomic structure was investigated in H. sapiens (Collins et al., 2004), D. rerio (Howe et al., 2013), and Drosophila melanogaster (Hoskins et al., 2007), but rare in aquatic
202
W. Zhu et al. / Gene 566 (2015) 201–211
invertebrates. So it is very important to isolate and characterize more EGFR genes from other aquatic invertebrates to understand the evolution of EGFR genomic structure. Pearls are gemstones produced by shellfish, such as pearl oysters (Pinctada fucata), and have long been prized worldwide because of their rarity and beauty. Pearl culture is an important industry in China and many other countries in the world (Masaoka et al., 2013). Pearl culture contains four steps: 1) pre-operative conditioning, 2) nucleus implantation, 3) post-operative care, and 4) culturing and harvest (Wada, 1999; Lucas and Southgate, 2008). Nucleus implantation (at the beginning of the culturing process) is the most important step; the pearl oyster is forced open, and a nucleus is implanted into the gonad with a mantle graft. Around the nucleus, a pearl sac (PS) is formed by proliferation of the outer mantle epithelial cells of the mantle graft (Inoue et al., 2010). Mantle tissue in bivalves has a wide array of functions including nutrient storage, direction of feeding currents and sensorial capacity (Zandee et al., 1980). Among others, a major function of the mantle is biomineralization in which specialized secretory cells produce the shell (Simkiss and Wilbur, 1989). It is the biomineralization that makes it possible to culture pearls artificially. The P. fucata shell consists of two mineralized layers: a nacreous layer made from aragonite, and a prismatic layer made from calcite. The nacreous and prismatic layers are formed in the mantle center (MC) and mantle edge (ME), respectively, by epithelial cell secretion (Sudo et al., 1997; Wada, 1999). So mantle and pearl sac play an important role in pearl formation. Since the mantle and pearl sac consisted mainly of epithelial cells, then what functions the EGFR plays during the pearl culture are worth studying. In this study, the cDNA sequence and the genomic structure of EGFR in pearl oyster were investigated and its expression profile in different tissues was analyzed as well. The precise positions of the gene expressions in the mantle—the main tissue responsible for shell formation, and pearl sac—the main organ responsible for pearl formation, were detected via in situ hybridization to see whether EGFR relates to pearl formation or not. Finally, to better understand its potential roles in larval development, its expression levels in different developmental stages of the pearl oyster were investigated. 2. Materials and methods 2.1. Sample preparation Healthy pearl oysters aged 1–2 years old with a shell length range of 60–70 mm, shells of about 50–60 mm in height and 40–50 g in wet mass were obtained from the pearl oyster culture base of the South China Sea Fisheries Research Institute (Xincun Port, Hainan Province, China). Nuclear implantation was carried out by experienced technicians in June 2013 with similar method used in conventional pearl culture. A total of 20 implanted oysters were sampled in September 2014. The twenty individuals were kept in an 80 l aerated sand-filtered seawater at 25 °C and fed twice daily with Chlorella vulgaris for one week before dissection. For expression analysis, various tissues including mantle, adductor muscle, gill, hepatopancreas, pearl sac, intestine and gonad were separately sampled from three individuals out of the twenty and preserved in 2.0 ml tubes with sample protector (TaKaRa, Dalian, China) until RNA extraction. Among others, the pearl sacs were excised from host oysters by removing the outer layers with a surgical blade until a thin (b0.5 mm) layer tissue surrounding the pearls remained. All samples were immediately protected in sample protector and taken to the laboratory in Guangzhou and stored in −80 °C. All larval stages of oysters were reared in 4 m × 6 m × 1.6 m concrete tanks, with temperature maintained between 25 °C and 30 °C, and salinity at 25.0 to 28.9. The veliger larvae were fed a mixture of Platymonas subcordiformis and Dicrateria zhanjiangenis. The following stages were collected: trochophore (8 h after fertilization); D-veliger larvae (24 h after fertilization); umbo veliger larvae (10 days after fertilization);
pediveliger larvae (17 days after fertilization); and larvae during metamorphosis (24 h after settlement). Different stage larvals were observed under binocular microscope to determine the exact stage and harvested using a 40 μm nylon mesh membrane, larval samples were washed with 1 × PBS (phosphate-buffered saline) and immediately protected in 2.0 ml tube with sample protector (TaKaRa, Dalian, China) until RNA extraction. Adductor muscle was collected and kept in 100% ethanol for DNA extraction. Mantle and pearl sac were removed from the adult P. fucata in similar process above and immediately fixed in 4% paraformaldehyde in 0.2 M PBS overnight for in situ hybridization. 2.2. RNA isolation and first-strand synthesis Total RNA was extracted from each tissue of four adult oysters with the TRIzol RNA isolation kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA integrity was determined by separating on a 1.2% formaldehyde-denatured agarose gel. The quantity of RNA was determined by measuring at an OD of 260 nm with a NanoDrop ND-1000 UV–Visible Spectrophotometer. Then 1 μg of total RNA from each tissue was used as the template for the reverse transcription reaction with a Prime ScriptII 1st strand cDNA Synthesis kit (Takara, Dalian, China). The first-strand cDNA was synthesized and used as the template for further PCR analysis. 2.3. cDNA cloning of the Pf-EGFR from P. fucata cDNA sequence of EGFR gene was obtained from the transcriptome sequences, through BlastX search with the NCBI database (http:// www.ncbi.nlm.nih.gov/BLAST). The accuracy of Pf-EGFR sequence was confirmed by using two pairs of gene-specific primers EGFR-F1/EGFRR1 and EGFR-F2/EGFR-R2 (Table 1), and the full length of the cDNA was cloned using 3′RACE method with TAKARA 3′-Full RACE Core Set with PrimerScript™ RTase (TaKaRa, Dalian, China) and two pairs of gene specific nested primers (Table 1). The RACE PCR was performed in a 20 μl reaction volume, containing 2 μl of 10 × Ex Taq buffer, 1.6 μl of dNTP Mix (2.5 mmol l− 1), 0.8 μl of each primer (10 mmol l− 1), 13.8 μl of double-distilled water, 0.2 μl of Ex Taq (TaKaRa, Dalian, China) and 0.8 μl of cDNA as template. The PCR program was as follows: 95 °C for 5 min; 35 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; a final elongation step of 72 °C for 10 min. The PCR products were isolated using DNA Gel Extraction Kit (OMEGA, USA) and cloned into PMD18T vector (TaKaRa, Dalian, China). The recombinant vector was transformed into competent Escherichia coli DH5a cells and sequenced after recombinant identification. Table 1 Primers used for cloning and characterization of Pf-EGFR gene. Primer name
Sequences (5′-3′)
Application
EGFR-F1 EGFR-R1 EGFR-F2 EGFR-R2 EGFR-3′-GSP1 EGFR-3′-GSP2 3′Adaptor outer 3′Adaptor inner gEGFR-F1 gEGFR-R1 gEGFR-F2 gEGFR-R2 gEGFR-F3 gEGFR-R3 qEGFR-F1 qEGFR-R1 18 s-rRNA-F 18 s-rRNA-R YEGFR-F1 YEGFR-R1
CGCTAGGCAAACCCTTAAA CAATCGTTCGGGAGGTAGT GATGCGTTCCTTCGTGTCC CAGACGAATCATCGGCTCA AAAGCAACTTGATCCCTCG TGACTCGGGTTCCATCCAT TACCGTCGTTCCACTAGTGATTT CGCGGATCCTCCACTAGTGATTTCACTATAGG TCGTAAGAACGGAAAGATGCG CAATCCCAGAAGCACATAACCA CGCATCGACCATCGTGTT CTCCGAAAATAACAGGGTA GGAGAGAATGCTTATGACAA AAAGTGAGGAAGGCAAACC CGTGGAAGGAAACTTAGAG ATCCCAGAAGCACATAACC TGTCTGCCCTATCAACTTTC TGTGGTAGCCGTTTCTCA CCCGATTACCACTATGAGATG CAACAATAAGGTTTACCGTCC
cDNA cloning cDNA cloning cDNA cloning cDNA cloning 3′RACE 3′RACE 3′RACE 3′RACE Genome cloning Genome cloning Genome cloning Genome cloning Genome cloning Genome cloning qRT-PCR qRT-PCR qRT-PCR qRT-PCR ISH ISH
W. Zhu et al. / Gene 566 (2015) 201–211
203
Fig. 1. Nucleotide and deduced amino acid sequences of Pf-EGFR. The deduced amino acid sequences are shown above the cDNA sequences. The initiation codon and stop codon are in blue. Short dash sequence is the deduced signal peptide. L domain is underlined. PKC phosphorylation sites are shaded red with black lettering, N-myristoylation sites are shaded black with white lettering, N-glycosylation site is shaded gray with white lettering, casein kinase II phosphorylation sites are shaded gray with black lettering.
204
W. Zhu et al. / Gene 566 (2015) 201–211
W. Zhu et al. / Gene 566 (2015) 201–211
205
Fig. 3. Phylogenetic tree of Pf-EGFR. The phylogenetic tree was constructed using MEGA software 5.05 by the neighbor-joining method and 1000 replications of bootstrap. The scale bar indicated a branch length of 0.2. Amino acid sequences of EGFR are obtained from invertebrate and vertebrate animals. The protein sequences used for phylogenetic analysis include the following: Pinctada fucata EGFR (KP027299), Crassostrea angulata EGFR (ACU33974.1), Lottia gigantean EGFR (ESP04264.1), Mus musculus EGFR (AAA17899.1), Homo sapiens EGFR (NP_005219.2), Taeniopygia guttata EGFR (XP_002196468.2), Xenopus tropicalis EGFR (XP_002939960.2), Danio rerio EGFR (NP_919405.1), Xiphophorus xiphidium EGFR (AAD10500.2), Nasonia vitripennis EGFR (XP_001602830.2), Gryllus bimaculatus EGFR (BAG65666.1), Drosophila melanogaster EGFR (AAR85245.1), Lymnaea stagnalis EGFR (ABQ10634.1), Haliotis diversicolor EGFR (AFM78688.1), Caenorhabditis elegans EGFR (P24348.3).
2.4. Genome DNA extraction and cloning Total genomic DNA was extracted from 25 mg of adductor muscle using Marine Animals DNA kit (TIANGEN, Beijing, China). DNA quality and quantity were determined by spectrophotometry and agarose gel electrophoresis. Pf-EGFR cDNA sequence was aligned with P. fucata genome data. Genomic sequences were amplified with the gene specific primers gEGFR-F1/R1, gEGFR-F2/R2 and gEGFR-F3/R3 (Table 1) in a 20 μl reaction volume, containing 2 μl of 10 × Ex Taq buffer, 1.6 μl of dNTP Mix (2.5 mmol l−1), 0.8 μl of each primer (10 mmol l−1), 13.8 μl of double-distilled water, 0.2 μl of Ex Taq (TaKaRa, Dalian, China) and 0.8 μl of DNA as template. The PCR cycle condition was one initial denaturation cycle of 95 °C for 5 min, then 35 cycles of 94 °C for 30 s, 56 °C for 45 s, 72 °C for 1 min and a final extension step at 72 °C for 10 min. The final PCR product was separated by 1.2% agarose gel electrophoresis, and then the desired band was excised and purified using a DNA Gel Extraction Kit (OMEGA, USA). Finally, the purified DNA fragments were cloned into the pMD18-T vector (TaKaRa, Dalian, China) and sequenced.
2.5. Sequence analysis The sequences were analyzed using the BLAST algorithm at the National Center for Biotechnology Information database (http://www. ncbi.nlm.nih.gov/blast/) for similarity to known genes. The protein transmembrane domain and signal peptide were predicted by InterProScan 5 (http://www.ebi.ac.uk/Tools/pfa/iprscan5/). The potential N-glycosylation sites were predicted by NetNGlyc1.0. The deduced amino acid sequence was analyzed using the simple modular architecture research tool (SMART) (http://smart.emblheidelberg.de/) and ScanProsite (http://prosite.expasy.org/) to predict conserved domains. The multiple alignments of the EGFR proteins of P. fucata and other
species were performed using the ClustalW2 multiple alignment program (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The phylogenetic tree was reconstructed with MEGA 5.0 based on amino acid sequence alignment using the neighbor-joining (NJ) algorithm and the reliability of the branching was evaluated by the bootstrap method with 1000 pseudo replicates. Genomic and cDNA sequences of Pf-EGFR were aligned using the Spidey program (http://www.ncbi.nlm.nih.gov/IEB/ Research/Ostell/Spidey/) to determine the exon–intron structure of the gene. Other species EGFRs were downloaded from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) database and the genomic structures were analyzed and compared with Pf-EGFR. 2.6. Real-time qRT-PCR The expression levels of Pf-EGFR in different tissues (mantle, muscle, gill, hepatopancreas, pearl sac, intestine, gonad) and at different developmental stages (trochophore, D-veliger, umbo veliger, pediveliger, metamorphosis) were analyzed using real-time quantitative reverse transcription PCR (qRT-PCR). RNA isolation was carried out as described above. The single-strand cDNA was synthesized based on manufacture's instruction of PrimerScript™ 1st strand cDNA synthesis Kit (TaKaRa, Dalian, China) with total RNA as template. cDNA mix was diluted to 1:100 and stored at − 20 °C for subsequent qRT-PCR. Primers used for qRTPCR were shown in Table 1. Quantitative real-time PCR was performed in triplicate for each sample using the CFX96 real-time PCR Detection System (Eppendorf, Germany) in a 20 μl reaction system, following the components: 10 μl of 2 × SYBR Green Real-time PCR Master Mix (TaKaRa, Dalian, China), 0.4 μl of each primer (10 μM), 1.0 μl cDNA and 8.2 μl RNase-free water. The PCR program was as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 30 s. 18S rRNA gene was selected as the reference gene (Miyazaki et al., 2010). Data were
Fig. 2. Multiple sequence alignment of Pf-EGFR and other EGFR genes. Alignment was performed using Clustal W2 and DNAMAN. Identical residues are indicated in black, and similar residues in light gray. Points indicate gaps. Identities are shown as black boxes and shaded boxes represent similar amino acids. Source include: Pf-EGFR, Pinctada fucata (KP027299), Crassostrea angulata EGFR (ACU33974.1), Lottia gigantean EGFR (ESP04264.1), Mus musculus EGFR (AAA17899.1), Homo sapiens EGFR (NP_005219.2), Taeniopygia guttata EGFR (XP_002196468.2), Xenopus tropicalis EGFR (XP_002939960.2), Danio rerio EGFR (NP_919405.1), Xiphophorus xiphidium EGFR (AAD10500.2), Nasonia vitripennis EGFR (XP_001602830.2), Gryllus bimaculatus EGFR (BAG65666.1), Drosophila melanogaster EGFR (AAR85245.1), Lymnaea stagnalis EGFR (ABQ10634.1), Haliotis diversicolor EGFR (AFM78688.1). The EGF receptor, L domain was in red color line. Insulin-like growth factor binding protein, N-terminal was in blue color line.
206
W. Zhu et al. / Gene 566 (2015) 201–211
analyzed with the Realplex2 software (Eppendorf, Germany). To maintain consistency, the baseline was set automatically by the software. The comparative CT method (2−ΔΔCT method) was used to analyze the PfEGFR mRNA expression level. The CT for the target amplified Pf-EGFR and the CT for the 18 s-rRNA gene were determined for each sample. Differences in the CT for the target and the internal control, called ΔCT, were calculated to normalize the differences in the amount of total cDNA added to each reaction and the efficiency of the RT-PCR. The control group was used as the reference sample, called the calibrator. The ΔCT for each sample was subtracted from the ΔCT of the calibrator, the difference was called ΔΔCT. The Pf-EGFR mRNA expression level could be calculated by 2−ΔΔCT and the value stood for an n-fold difference relative to the calibrator (Livak and Schmittgen, 2001).
Sections were then dewaxed in xylene and rehydrated in an alcohol series in preparation for RNA in situ hybridization of Pf-EGFR. In situ hybridization was then carried out according to the instruction of the BIOSENSE-TM Detection Kit (Biosense, Guangdong, China). 2.8. Statistical analysis All data were expressed as mean ± standard deviation (SD). The data from the experiments were analyzed using the analysis of variance (ANOVA) in SPSS 19.0 software (SPSS Inc., Chicago, IL, USA). Differences between means were considered significant at the 95% confidence level (P b 0.05). 3. Results
2.7. In situ hybridization 3.1. Cloning and characterization of Pf-EGFR The primers YEGFR-F1 and YEGFR-R1 were used to amplify Pf-EGFR under the same conditions as described above. Digoxigenin labeled RNA probes were synthesized from the linearized plasmid containing the insertion fragment encoding partial sequence of Pf-EGFR using the DIG RNA Labeling Kit by Biosense Bio-engineering Limited Company (Biosense, Guangdong, China). A rectangular piece of mantle tissue and pearl sac tissue (0.8 × 0.5 cm) was excised with a DEPC-treated scalpel, then immediately fixed in 4% paraformaldehyde containing 0.1% DEPC overnight. Fixed tissue was dehydrated through an alcohol series and embedded in paraffin wax. Tissue blocks were sectioned to 7 μm increments.
By transcriptome sequencing and PCR amplification, a 2156 bp cDNA sequence was obtained with an open reading frame (ORF) of 1017 bp (Fig. 1) and named as Pf-EGFR. The cDNA sequence of PfEGFR has been deposited in GenBank (KP027299). The deduced amino acid (aa) sequence was 338aa long with a predicted molecular mass of 37.5 kDa and pI of 4.54. Sequcence analysis indicated that Pf-EGFR has a putative signal peptide (1-36aa) and a transmembrane region. The grand average of hydropathicity (GRAVY) was − 0.045, stating that Pf-EGFR was a hydrophilic protein. Function analysis predicted that the deduced amino acid sequence included four protein kinase C
Fig. 4. Genomic DNA sequence of Pf-EGFR. Exons and introns were indicated in upper-case letters and lower-case letters, respectively. The consensus GT-AG exon–intron junction sequences were noted in bold. The initiation codon (ATG) and terminator codon (TGA) were shaded.
W. Zhu et al. / Gene 566 (2015) 201–211
(PKC) phosphorylation sites (145–147aa, 154–156aa, 175–177aa, 320322aa), four N-myristoylation sites (71–76aa, 163–168aa, 174–179aa, 254–259aa), seven casein kinase II phosphorylation sites (52–55aa, 97–100aa, 122–125aa, 170–173aa, 240–243aa, 295–298aa, 320– 323aa), a N-glycosylation site (113–116aa) and a cell attachment sequence (66–68aa). Domain analysis showed that Pf-EGFR contained functional motifs including a L domain of EGF receptor (95–215aa), a N-terminal insulin-like growth factor binding protein (236–329aa), a furin-like cysteine-rich domain (232–328aa) and a furin-like repeat (271–322aa). 3.2. Phylogenetic analysis of Pf-EGFR The deduced amino acid sequences of Pf-EGFR and other species EGFR were aligned by the Clustal W2 program and DNAMAN. Multiple sequence alignment showed that Pf-EGFR shared the highest identity (56.71%) with Crassostrea angulata (Accession No. ACU33974.1) (Fig. 2). The phylogenetic tree was reconstructed based on EGFR protein sequences by using MEGA software 5.0 with the neighbor-joining method and Caenorhabditis elegans as an out-group. Vertebrates and invertebrates were clustered into respective group. For vertebrate group, it was divided into four distinct clades which were mammals, birds, amphibians and fishes, consistent with their classification. In invertebrate cluster, PfEGFR was clustered with C. angulata EGFR and L. gigantean EGFR indicative of the closer evolutionary relationship between them (Fig. 3). 3.3. Genomic structure of Pf-EGFR To study the structure of the Pf-EGFR gene, the whole genomic sequence was cloned using PCR. Genomic sequence of Pf-EGFR was 5190 bp length and submitted to the GenBank under the accession number KP027300. Comparison of the sequences of the genomic DNA and cDNA clones revealed that the Pf-EGFR gene has six exons and five introns. The exon/intron boundaries were consistent with the typical GT/AG rule (Fig. 4). The comparison of genomic structures of available EGFR from vertebrates and invertebrates showed that the lengths of exons and introns were highly variable among different species (Fig. 5).
207
3.4. Tissue expression profile of Pf-EGFR Quantitative RT-PCR analysis was used to determine the expression profile of Pf-EGFR mRNA with 18S-rRNA as an internal control. The mRNA for Pf-EGFR was expressed in all the seven tissues analyzed (mantle, muscle, gill, hepatopancreas, pearl sac, intestine, gonad), which suggested that the Pf-EGFR gene is ubiquitously expressed in adult P. fucata. However, the mRNA expression levels of Pf-EGFR in the pearl sac, mantle and intestine are much higher than other tissues (Fig. 6). 3.5. Expression levels of Pf-EGFR during larval development of the pearl oyster The transcripts levels of Pf-EGFR mRNA from trochophore to metamorphosis were also determined (Fig. 7). Pf-EGFR gene was expressed in each larval developmental stage, but the expression levels were different with the highest at metamorphosis period and lowest in the Dveliger larvae. 3.6. Pf-EGFR expression pattern in P. fucata mantle tissue and pearl sac tissue In situ hybridization was performed to determine the precise location of Pf-EGFR mRNA expression in the mantle and pearl sac of P. fucata (Fig. 8). In the mantle, strong hybridization signals for PfEGFR mRNA were detected in the epidermal cells on both the inner side of the outer fold and the outer side of the inner fold. Slight hybridization signals were founded in the outer epidermal cells of middle fold. In pearl sac, hybridization signals were detected throughout the whole pearl sac including the epidermal cells and the connective tissues. No hybridization signals were detected in negative control. 4. Discussion EGFR is a receptor of intrinsic protein tyrosine kinase (PTK) activity (Boulougouris and Elder, 2001), EGFR signaling controls diverse cellular responses related to animal cell proliferation, differentiation, survival,
Fig. 5. (A) Structure of the genomic Pf-EGFR DNA. (E1–E6) is indicated by amino acid residues and nucleotides. The locations of six exons and five introns are noted. (B) Schematic representation of EGFR genomic structure organization from different species. Exons and UTRs are represented by solid and empty boxes, respectively. Introns are represented by lines in between boxes. Genomic structures were obtained from the NCBI database and accession numbers are Homo sapiens: NM_005228.3, Danio rerio: NC_007113.5, Drosophila melanogaster: NT_033778.4.
208
W. Zhu et al. / Gene 566 (2015) 201–211
Fig. 6. Relative expression levels of Pf-EGFR in various tissues from P. fucata. Higher transcript levels were detected in the mantle, pearl sac and intestine. Three biological replicates were performed for each developmental stage, and three technical replicates were conducted for each PCR reaction. Data are expressed as the mean ±S.D. (N = 3). Different letters indicated significant difference among tissues at P b 0.05.
motility, and apoptosis (Olayioye et al., 2000; Yarden and Sliwkowski, 2001), and the genes involved in this pathway have been extensively studied in both model and economically valuable species, such as D. rerio (Goishi et al., 2003), H. diversicolor (Bai and Ke, 2012), and C. angulata (Qin et al., 2010). In this study, we cloned EGFR gene from P. fucata and found some common functional groups in it as compared with different animal taxa. In Pf-EGFR, we found four protein kinase C (PKC) phosphorylation sites, four N-myristoylation sites and seven casein kinase II phosphorylation sites (Fig. 1) which were also observed in A. japonicus (Li et al., 2012), C. angulata (Qin et al., 2010) and H. sapiens (Ullrich et al., 1984). Besides, Pf-EGFR has an L domain of EGF receptor and a furin-like cysteine-rich domain, consistent with the characteristics of ErbB protein family, indicating that Pf-EGFR
belongs to ErbB protein family. Additionally, the phylogenetic tree showed that Pf-EGFR was grouped in a clade of molluscan sequences, consistent with their classification positions (Fig. 3). However, Pf-EGFR amino acid sequence is much shorter than that of H. sapiens, and the numbers of exons and introns are also much less than that of vertebrates. There were only 5–6 exons and 4–5 introns in D. melanogaster EGFR (Hoskins et al., 2007) and P. fucata EGFR, but 25–27 exons and 24–26 introns in D. rerio (Howe et al., 2013) and H. sapiens EGFR (Collins et al., 2004) (Fig. 5). All of these findings showed that with animals evolving from the lower class to the higher, the structure of EGFR becomes more and more complex to satisfy the requirements of complicated functions of higher class animals, suggesting that EGFR gene plays very important roles in the biological processes. The dramatic increases
Fig. 7. Relative expression levels of Pf-EGFR at different larval stages. The expression levels of Pf-EGFR mRNA in metamorphosis stage were much higher than in other stages. Three biological replicates were performed for each developmental stage, and three technical replicates were conducted for each PCR reaction. Data are expressed as the mean ±S.D. (N = 3). Different letters indicated significant difference among larval development stages at P b 0.05.
W. Zhu et al. / Gene 566 (2015) 201–211
in the numbers of exons and introns from invertebrates to vertebrates also imply that EGFR gene in vertebrates maybe experienced several rounds of duplicates in the course of evolutionary to meet the needs of complicated life. To understand the function of Pf-EGFR, expression pattern in various tissues were investigated using quantitative RT-PCR. Pf-EGFR mRNA was expressed in all the tissues studied. However, the expression levels varied in different tissues. Pf-EGFR was highly expressed in pearl sac, intestine and mantle, meanwhile the expressions in muscle and hepatopancreas were significantly lower (Fig. 6). The previous studies also demonstrated that EGFR transcripts were considerably abundant in mantle of H. diversicolor (Bai and Ke, 2012), similar to our results, but
209
high in the hepatopancreas either, contrast to that in P. fucata. In A. japonicas (Li et al., 2012), the EGFR mRNA was highly expressed in coelomocyte and epidermis. These results demonstrated that EGFR was highly expressed in epithelial cell-riched tissues. Pf-EGFR expressed in different tissues may play different roles. Tice et al. (1999) and Biscardi et al. (1999) discovered that EGFR can promote mitosis in mouse fibroblast, while overexpression will lead to tumor formation (Bao et al., 2003). Further studies showed EGFR provide energy for cell migration and movement (Goi et al., 2000; Uruno et al., 2001). EGFR in D. rerio (Goishi et al., 2003) and D. melanogaster (Ghiglione et al., 2002) probable accelerate oocyte development. EGFR has facilitation of vein in D. melanogaster (Guichard et al., 1999). So we speculated
Fig. 8. Detection of Pf-EGFR mRNA distribution in mantle and pearl sac of P. fucata by in situ hybridization. Frame A, C, D, E and F are positive, B is negative control. C, D, E and F were higher magnifications of A. No signal was observed in negative control. Hybridization signal is indicated in purple blue and arrowheads. IF = inner fold, MF = middle fold, OF = outer fold, oe = outer epithelium, ie = inner epithelium.
210
W. Zhu et al. / Gene 566 (2015) 201–211
Fig. 8 (continued).
that high levels of Pf-EGFR expressions in pearl sac and mantle of P. fucata may be related with activity of biominaeralizing; because the mantle, as the site of shell synthesis, is the most important tissue involved in biomineralization. In the case of a bivalve, this organ is anatomically divided into two regions: the mantle pallial, located proximal to the shell hinge, and the mantle edge, situated distal to the hinge (Gardner et al., 2011). The distal mantle is further characterized by enlargement of the sheath at the shell margin into three terminal folds: the outer fold (OF), middle fold (MF), and the inner fold (IF). Previous studies have revealed that different regions of the mantle are responsible for different roles. The nacreous and prismatic layers are formed in the mantle center (MC) and mantle edge (ME), respectively, by epithelial cell secretion (Sudo et al., 1997; Wada, 1999). Based on the tissue expression result above, we performed in situ hybridization of PfEGFR expression in the mantle and pearl sac for further verification of its function. Strong hybridization signals for Pf-EGFR mRNA were detected on both the inner of the outer fold and the outer side of the inner fold. Slight hybridization signals were founded in the middle fold. The pearl oyster shell typically consists of an outermost organic layer termed the periostracum, and calcium carbonate oriented in two distinct microlaminates, the outer calcite prismatic layer and the inner aragonite nacreous layer (Kennedy et al., 1969). In the early stages of pearl
formation within the pearl sac, the prismatic layer is first formed on the nucleus, and then the nacreous layer onto the prismatic layer. Different mantle zone have different biomineralization function. The nacreous and prismatic layers are formed in the mantle center (MC) and mantle edge (ME), respectively, by epithelial cell secretion. The groove bteween outer fold and middle fold responsible to periostracum formation (Sudo et al., 1997; Wada, 1999; Gardner et al., 2011). So we speculate that EGFR may contribute to periostracum formation. Meanwhile, in pearl sac, hybridization signals were detected throughout the whole pearl sac including the connective tissues (Fig. 8). Due to Ca2 + can only participate in the mineralization through the epidermal cells in pallial chamber (Barry and Diamond, 1971), so EGFR may facilitate Ca2+ transportation in pearl biomineralization. Together with qRT-PCR results, these findings indicated that highly expressed Pf-EGFR in pearl sac and mantle contributes much in some way to the formation of shells and pearls since they are the main organs for shell and pearl formation through biomineralization. In the metamorphosis stage the most important morphologic changes in bivalves are the loss of the velum, the reorientation of the mouth and the foot, and the growth of the labial palps and the gill filaments. All of these changes are accompanied by an increase in complexity of organ systems and by the secretion of the dissoconch (Bayne, 1971).
W. Zhu et al. / Gene 566 (2015) 201–211
As shown in Fig. 7, with the larvae developing from trochophore to metamorphosis stage, the mRNA level of Pf-EGFR was increased gradually and reached the highest in metamorphosis stage. In C. angulata, EGFR mRNA was also expressed highly in metamorphosis (Han et al., 2012). Okazaki and Shizuri (2000) found that EGFR tyrosine kinase inhibitors can effectively inhibit larval attachment and metamorphosis of Barnacle amphitrite. These results indicated that EGFR plays an important role during early larval development in mollusk. In summary, we successfully cloned and sequenced the EGFR gene from the pearl oyster P. fucata for the first time. The structural analysis of the Pf-EGFR genomic sequence suggests that the Pf-EGFR gene has six exons and five introns, extending approximately 5.19 kb in length. Furthermore, we analyzed the mRNA expression pattern of Pf-EGFR in different tissues and different larval stages. More importantly, we determined the precise location of Pf-EGFR gene expression in mantle and pearl sac via in situ hybridization. This information suggests that PfEGFR plays diverse roles in many biological processes, and may especially facilitate shell formation. Yet, detailed pathways in it need to be studied further. Conflict of interest We declare that there is no conflict of interest. Acknowledgments This work was funded by the NNSFC (31372525), the Earmarked Fund for China Agriculture Research System (CARS-48), Guangdong Provincial Marine Fisheries Science & Technology Promotion Special Projects (A201201A08, A201301A02, A201301A08, B201300B08) and Guangdong Provincial Science and Technology Project (2012B050700004). References Asakura, M., Kitakaze, M., Takashima, S., Liao, Y., Ishikura, F., Yoshinaka, T., Ohmoto, H., Node, K., Yoshino, K., Ishiguro, H., Asanuma, H., Sanada, S., Matsumura, Y., Takeda, H., Beppu, S., Tada, M., Hori, M., Higashiyama, S., 2002. Cardiac hypertrophy is inhibited by antagonism of ADAM12 processing of HB-EGF: metalloproteinase inhibitors as a new therapy. Nat. Med. 8, 35–40. Bai, R., Ke, C., 2012. Molecular cloning and expression analysis of epidermal growth factor receptor (EGFR) from small abalone, Haliotis diversicolor. Biochem. Biotechnol. 5 (Chinese). Bao, J., Gur, G., Yarden, Y., 2003. Src promotes destruction of c-Cbl: implications for oncogenic synergy between Src and growth factor receptors. Proc. Natl. Acad. Sci. U. S. A. 100, 2438–2443. Barry, P.H., Diamond, J.M., 1971. A theory of ion permeation through membranes with fixed neutral sites. J. Membr. Biol. 4, 295–330. Bayne, B.L., 1971. Some morphological changes that occur at the metamorphosis of the larvae of Mytilus edulis. Proc 4th Eur, mar Biol Symp, pp. 259–280. Biscardi, J.S., Maa, M.-C., Tice, D.A., Cox, M.E., Leu, T.-H., Parsons, S.J., 1999. c-Src-mediated phosphorylation of the epidermal growth factor receptor on Tyr845 and Tyr1101 is associated with modulation of receptor function. J. Biol. Chem. 274, 8335–8343. Blume-Jensen, P., Hunter, T., 2001. Oncogenic kinase signalling. Nature 411, 355–365. Bogdan, S., K.C., 2001. Epidermal growth factor receptor signaling. Curr. Biol. 11, 292–295. Boulougouris, P., Elder, J., 2001. Epidermal growth factor receptor structure, regulation, mitogenic signalling and effects of activation. Anticancer Res. 21, 2769–2775. Citri, A., Yarden, Y., 2006. EGF-ERBB signalling: towards the systems level. Nat. Rev. Mol. Cell Biol. 7, 505–516. Collins, F.S., Lander, E.S., Rogers, J., Waterston, R.H., Int Human Genome Sequencing, C., 2004. Finishing the euchromatic sequence of the human genome. Nature 431, 931–945. Crone, S.A., Zhao, Y.Y., Fan, L., Gu, Y.S., Minamisawa, S., Liu, Y., Peterson, K.L., Chen, J., Kahn, R., Condorelli, G., Ross, J., Chien, K.R., Lee, K.F., 2002. ErbB2 is essential in the prevention of dilated cardiomyopathy. Nat. Med. 8, 459–465. Gardner, L.D., Mills, D., Wiegand, A., Leavesley, D., Elizur, A., 2011. Spatial analysis of biomineralization associated gene expression from the mantle organ of the pearl oyster Pinctada maxima. BMC Genomics 12. Ghiglione, C., B.E.A., Paraiso, Y., et al., 2002. Mechanism of activation of the Drosophila EGF receptor by the TGFalpha ligand Gurken during oogenesis. Development 129, 175–186. Goi, T., Shipitsin, M., Lu, Z.M., Foster, D.A., Klinz, S.G., Feig, L.A., 2000. An EGF receptor/RalGTPase signaling cascade regulates c-Src activity and substrate specificity. EMBO J. 19, 623–630.
211
Goishi, K., Lee, P., Davidson, A.J., Nishi, E., Zon, L.I., Klagsbrun, M., 2003. Inhibition of zebrafish epidermal growth factor receptor activity results in cardiovascular defects. Mech. Dev. 120, 811–822. Guichard, A., Biehs, B., Sturtevant, M.A., Wickline, L., Chacko, J., Howard, K., Bier, E., 1999. Rhomboid and star interact synergistically to promote EGFR/MAPK signaling during Drosophila wing vein development. Development 126, 2663–2676. Han, G., Yang, B., Ke, C., 2012. Prokaryotic expression and mRNA expression analysis of epidermal growth factor receptor during attachment and metamorphosis from Crassostrea gigas angulata. J. Xiamen Univ. (Nat. Sci.) 51, 263–266 (Chinese). Hoskins, R.A., Carlson, J.W., Kennedy, C., Acevedo, D., Evans-Holm, M., Frise, E., Wan, K.H., Park, S., Mendez-Lago, M., Rossi, F., Villasante, A., Dimitri, P., Karpen, G.H., Celniker, S.E., 2007. Sequence finishing and mapping of Drosophila melanogaster heterochromatin. Science 316, 1625–1628. Howe, K., Clark, M.D., Torroja, C.F., Torrance, J., Berthelot, C., Muffato, M., Collins, J.E., Humphray, S., McLaren, K., Matthews, L., 2013. The zebrafish reference genome sequence and its relationship to the human genome. Nature 496 (7446), 498–503. Inoue, N., Ishibashi, R., Ishikawa, T., Atsumi, T., Aoki, H., Komaru, A., 2010. Gene expression patterns and pearl formation in the Japanese pearl oyster (Pinctada fucata): a comparison of gene expression patterns between the pearl sac and mantle tissues. Aquaculture 308, S68–S74. Jost, M., Kari, C., Rodeck, U., 2000. The EGF receptor — an essential regulator of multiple epidermal functions. Eur. J. Dermatol. 10, 505–510. Kennedy, W.J., Taylor, J.D., Hall, A., 1969. Environmental and biological controls on bivalve shell mineralogy. Biol. Rev. 44, 499–530. Lax, I., Johnson, A., Howk, R., 1988. Chicken epidermal growth factor (EGF) receptor: cDNA cloning, expression in mouse cells, and differential binding of EGF and transforming growth factor alpha. Mol. Cell. Biol. 8, 1970–1978. Li, X., Wang, X., Yanjie, Q., Liu, Y., Zhou, Y., 2012. Cloning and expression analysis of EGFR gene in Apostichopus japonicus. Med. Chem. Res. 36, 46–49 (Chinese). Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Lucas, J.S., Southgate, P.C., 2008. The Pearl Oyster. Elsevier Science & Technology. Masaoka, T., Samata, T., Nogawa, C., Baba, H., Aoki, H., Kotaki, T., Nakagawa, A., Sato, M., Fujiwara, A., Kobayashi, T., 2013. Shell matrix protein genes derived from donor expressed in pearl sac of Akoya pearl oysters (Pinctada fucata) under pearl culture. Aquaculture 384, 56–65. Miyazaki, Y., Nishida, T., Aoki, H., Samata, T., 2010. Expression of genes responsible for biomineralization of Pinctada fucata during development. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 155, 241–248. Okazaki, Y., Shizuri, Y., 2000. Effect of inducers and inhibitors on the expression of bcs genes involved in cypris larval attachment and metamorphosis of the barnacles Balanus amphitrite. Int. J. Dev. Biol. 44, 451–456. Olayioye, M.A., Neve, R.M., Lane, H.A., Hynes, N.E., 2000. The ErbB signaling network: receptor heterodimerization in development and cancer. EMBO J. 19, 3159–3167. Petch, L., Harris, J., Raymond, V., Blasband, A., Lee, D., Earp, H.S., 1990. A truncated, secreted form of the epidermal growth factor receptor is encoded by an alternatively spliced transcript in normal rat tissue. Mol. Cell. Biol. 10, 2973–2982. Qin, J., Xu, Q., Ke, C., 2010. Cloning and expression of EGFR in embryos and larvae of Crassostrea angulata. 46, 756–762 (Chinese). Schlessinger, J., 2000. Cell signaling by receptor tyrosine kinases. Cell 103, 211–225. Simkiss, K., Wilbur, K., 1989. Biomineralization: Cell Biology and Mineral Deposition. Academic Press,c1989, San Diego, CA 92101. Sudo, S., Fujikawa, T., Nagakura, T., Ohkubo, T., Sakaguchi, K., Tanaka, M., Nakashima, K., Takahashi, T., 1997. Structures of mollusc shell framework proteins. Nature 387, 563–564. Sun, L., Huan, P., Wang, H., Liu, F., Liu, B., 2014. An EGFR gene of the Pacific oyster Crassostrea gigas functions in wound healing and promotes cell proliferation. Mol. Biol. Rep. 41, 2757–2765. Tice, D.A., Biscardi, J.S., Nickles, A.L., Parsons, S.J., 1999. Mechanism of biological synergy between cellular Src and epidermal growth factor receptor. Proc. Natl. Acad. Sci. 96, 1415–1420. Ullrich, A., Coussens, L., Hayflick, J.S., 1984. Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells. Nature 309, 418–424. Uruno, T., Liu, J.L., Zhang, P.J., Fan, Y.X., Egile, C., Li, P., Mueller, S.C., Zhan, X., 2001. Activation of Arp2/3 complex-mediated actin polymerization by cortactin. Nat. Cell Biol. 3, 259–266. Van Kesteren, R.E., Gagatek, J.S., Hagendorf, A., Gouwenberg, Y., Smit, A.B., Syed, N.I., 2008. Postsynaptic expression of an epidermal growth factor receptor regulates cholinergic synapse formation between identified molluscan neurons. Eur. J. Neurosci. 27, 2043–2056. Wada, K., 1999. Science of the pearl oyster. Shinju Shinbunsha, Tokyo (336 pp (in Japanese)). Yarden, Y., Sliwkowski, M.X., 2001. Untangling the ErbB signalling network. Nat. Rev. Mol. Cell Biol. 2, 127–137. Yarden, Y., Ullrich, A., 1988. Growth factor receptor tyrosine kinases. Annu. Rev. Biochem. 57, 443–478. Zandee, D.I., K.J.H., Zurburg, W., et al., 1980. Seasonal variations in biochemical composition of Mytilus edulis with reference to energy metabolism and gametogenesis. Neth. J. Sea Res. 14, 1–29.
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Highly expressed EGFR in pearl sac may facilitate the pearl formation in the pearl oyster, Pinctada fucata Wenjie Zhu a,b, Sigang Fan a, Guiju Huang a, Dongling Zhang c, Baosuo Liu a, Xiaomin Bi a,b, Dahui Yu a,⁎ a Key Laboratory of South China Sea Fishery Resources Exploitation & Utilization, Ministry of Agriculture and Division of Aquaculture and Biotechnology, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, China b College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China c Fisheries College of Jimei University, Xiamen 361021, China
a r t i c l e
i n f o
Article history: Received 2 February 2015 Received in revised form 16 April 2015 Accepted 17 April 2015 Available online 18 April 2015 Keywords: Pearl oyster Pearl sac EGFR Expression profiles Pearl formation Larval metamorphosis
a b s t r a c t Epidermal growth factor receptor (EGFR) plays an important role in cell growth, proliferation, differentiation and migration. Yet whether it functions in pearl formation or not is not reported. In this study, EGFR was cloned from the pearl oyster Pinctada fucata (named as Pf-EGFR) and its expression profiles were investigated. The cDNA was 2156 bp long with an ORF of 1017 bp encoding 338 amino acid residues. The deduced polypeptide contained an L domain and a cysteine-rich domain, consistent with the characteristics of ErbB family. The sequence of Pf-EGFR shared 22.78–56.71% identity with other EGFRs. The genomic sequence of Pf-EGFR consisted of six exons and five introns, being 5190 bp in total length, and expressed in all the tested tissues with a higher expression level in the pearl sac (P b 0.05). In situ hybridization showed that Pf-EGFR was specifically expressed on both the inner side of the outer fold and the outer side of the inner fold of the mantle, as well as on the whole pearl sac including the connective tissues. In addition, Pf-EGFR was markedly increased at larval metamorphosis, significantly higher than other development periods (P b 0.05). These results indicated that the Pf-EGFR may facilitate pearl formation as well as larval metamorphosis. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Epidermal growth factor receptor (EGFR), a transmembrane glycoprotein, belongs to a large family of cell surface receptors with intrinsic protein tyrosine kinase (PTK) activity (Bogdan and K.C., 2001), which consisted of an external growth factor binding domain, a transmembrane domain, and an internal tyrosine kinase domain (Yarden and Ullrich, 1988). EGFR can be activated by binding of ligands, for example, epidermal growth factor (EGF), transforming growth factor (TGF)-α, heparin-binding (HB)-EGF, amphiregulin, betacellulin and epiregulin, leading to the activation of the intrinsic kinase domain which triggers a series of signal transduction, and thus inducing cell proliferation, migration, differentiation and apoptosis (Olayioye et al., 2000; Schlessinger, 2000; Yarden and Sliwkowski, 2001; Citri and Yarden, Abbreviations: EGFR, epidermal growth factor receptor; Pf-EGFR, the EGFR gene from Pinctada fucata; ORF, open reading frame; PTK, protein tyrosine kinase; EGF, epidermal growth factor; TGF, transforming growth factor; qRT-PCR, quantitative realtime polymerase chain reaction; RACE, rapid-amplification of cDNA ends; PKC, protein kinase C; GRAVY, grand average of hydropathicity; ISH, in situ hybridization; DIG, digoxigenin; PFA, paraformaldehyde. ⁎ Corresponding author at: Key Laboratory of South China Sea Fishery Resources Exploitation & Utilization, Ministry of Agriculture, Guangzhou 510300, China. E-mail address: [email protected] (D. Yu).
http://dx.doi.org/10.1016/j.gene.2015.04.046 0378-1119/© 2015 Elsevier B.V. All rights reserved.
2006). It regulates normal physiological processes such as embryonic development, wound healing, tooth growth, eyelid opening in newborn, development of hair follicles, and mammary gland morphogenesis (Goishi et al., 2003). In addition, EGFR also contributes to pathology. For example, amplification and inappropriate activation of EGF receptor family members are associated with tumor growth (Blume-Jensen and Hunter, 2001; Yarden and Sliwkowski, 2001), psoriasis (Jost et al., 2000) and cardiomyopathy (Asakura et al., 2002; Crone et al., 2002). Yet its functions in mollusk are less reported. EGFR has been cloned from many species, such as Homo sapiens (Ullrich et al., 1984), Gallus gallus (Lax et al., 1988), Rattus norvegicus (Petch et al., 1990), Danio rerio (Goishi et al., 2003) and so on. However, information on molecular and functional characteristics of EGFR in mollusks is rare. In mollusks, EGFR was identified in Lymnaea stagnalis (van Kesteren et al., 2008), Apostichopus japonicus (Li et al., 2012), Haliotis diversicolor (Bai and Ke, 2012), Crassostrea angulata (Qin et al., 2010) and Crassostrea gigas (Sun et al., 2014), respectively. EGFR plays an important role in innate immunity and differentiation (Bai and Ke, 2012) and is mainly expressed in metamorphosis stage (Han et al., 2012) and might function in the cell proliferation and migration during wound healing (Sun et al., 2014). The genomic structure was investigated in H. sapiens (Collins et al., 2004), D. rerio (Howe et al., 2013), and Drosophila melanogaster (Hoskins et al., 2007), but rare in aquatic
202
W. Zhu et al. / Gene 566 (2015) 201–211
invertebrates. So it is very important to isolate and characterize more EGFR genes from other aquatic invertebrates to understand the evolution of EGFR genomic structure. Pearls are gemstones produced by shellfish, such as pearl oysters (Pinctada fucata), and have long been prized worldwide because of their rarity and beauty. Pearl culture is an important industry in China and many other countries in the world (Masaoka et al., 2013). Pearl culture contains four steps: 1) pre-operative conditioning, 2) nucleus implantation, 3) post-operative care, and 4) culturing and harvest (Wada, 1999; Lucas and Southgate, 2008). Nucleus implantation (at the beginning of the culturing process) is the most important step; the pearl oyster is forced open, and a nucleus is implanted into the gonad with a mantle graft. Around the nucleus, a pearl sac (PS) is formed by proliferation of the outer mantle epithelial cells of the mantle graft (Inoue et al., 2010). Mantle tissue in bivalves has a wide array of functions including nutrient storage, direction of feeding currents and sensorial capacity (Zandee et al., 1980). Among others, a major function of the mantle is biomineralization in which specialized secretory cells produce the shell (Simkiss and Wilbur, 1989). It is the biomineralization that makes it possible to culture pearls artificially. The P. fucata shell consists of two mineralized layers: a nacreous layer made from aragonite, and a prismatic layer made from calcite. The nacreous and prismatic layers are formed in the mantle center (MC) and mantle edge (ME), respectively, by epithelial cell secretion (Sudo et al., 1997; Wada, 1999). So mantle and pearl sac play an important role in pearl formation. Since the mantle and pearl sac consisted mainly of epithelial cells, then what functions the EGFR plays during the pearl culture are worth studying. In this study, the cDNA sequence and the genomic structure of EGFR in pearl oyster were investigated and its expression profile in different tissues was analyzed as well. The precise positions of the gene expressions in the mantle—the main tissue responsible for shell formation, and pearl sac—the main organ responsible for pearl formation, were detected via in situ hybridization to see whether EGFR relates to pearl formation or not. Finally, to better understand its potential roles in larval development, its expression levels in different developmental stages of the pearl oyster were investigated. 2. Materials and methods 2.1. Sample preparation Healthy pearl oysters aged 1–2 years old with a shell length range of 60–70 mm, shells of about 50–60 mm in height and 40–50 g in wet mass were obtained from the pearl oyster culture base of the South China Sea Fisheries Research Institute (Xincun Port, Hainan Province, China). Nuclear implantation was carried out by experienced technicians in June 2013 with similar method used in conventional pearl culture. A total of 20 implanted oysters were sampled in September 2014. The twenty individuals were kept in an 80 l aerated sand-filtered seawater at 25 °C and fed twice daily with Chlorella vulgaris for one week before dissection. For expression analysis, various tissues including mantle, adductor muscle, gill, hepatopancreas, pearl sac, intestine and gonad were separately sampled from three individuals out of the twenty and preserved in 2.0 ml tubes with sample protector (TaKaRa, Dalian, China) until RNA extraction. Among others, the pearl sacs were excised from host oysters by removing the outer layers with a surgical blade until a thin (b0.5 mm) layer tissue surrounding the pearls remained. All samples were immediately protected in sample protector and taken to the laboratory in Guangzhou and stored in −80 °C. All larval stages of oysters were reared in 4 m × 6 m × 1.6 m concrete tanks, with temperature maintained between 25 °C and 30 °C, and salinity at 25.0 to 28.9. The veliger larvae were fed a mixture of Platymonas subcordiformis and Dicrateria zhanjiangenis. The following stages were collected: trochophore (8 h after fertilization); D-veliger larvae (24 h after fertilization); umbo veliger larvae (10 days after fertilization);
pediveliger larvae (17 days after fertilization); and larvae during metamorphosis (24 h after settlement). Different stage larvals were observed under binocular microscope to determine the exact stage and harvested using a 40 μm nylon mesh membrane, larval samples were washed with 1 × PBS (phosphate-buffered saline) and immediately protected in 2.0 ml tube with sample protector (TaKaRa, Dalian, China) until RNA extraction. Adductor muscle was collected and kept in 100% ethanol for DNA extraction. Mantle and pearl sac were removed from the adult P. fucata in similar process above and immediately fixed in 4% paraformaldehyde in 0.2 M PBS overnight for in situ hybridization. 2.2. RNA isolation and first-strand synthesis Total RNA was extracted from each tissue of four adult oysters with the TRIzol RNA isolation kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA integrity was determined by separating on a 1.2% formaldehyde-denatured agarose gel. The quantity of RNA was determined by measuring at an OD of 260 nm with a NanoDrop ND-1000 UV–Visible Spectrophotometer. Then 1 μg of total RNA from each tissue was used as the template for the reverse transcription reaction with a Prime ScriptII 1st strand cDNA Synthesis kit (Takara, Dalian, China). The first-strand cDNA was synthesized and used as the template for further PCR analysis. 2.3. cDNA cloning of the Pf-EGFR from P. fucata cDNA sequence of EGFR gene was obtained from the transcriptome sequences, through BlastX search with the NCBI database (http:// www.ncbi.nlm.nih.gov/BLAST). The accuracy of Pf-EGFR sequence was confirmed by using two pairs of gene-specific primers EGFR-F1/EGFRR1 and EGFR-F2/EGFR-R2 (Table 1), and the full length of the cDNA was cloned using 3′RACE method with TAKARA 3′-Full RACE Core Set with PrimerScript™ RTase (TaKaRa, Dalian, China) and two pairs of gene specific nested primers (Table 1). The RACE PCR was performed in a 20 μl reaction volume, containing 2 μl of 10 × Ex Taq buffer, 1.6 μl of dNTP Mix (2.5 mmol l− 1), 0.8 μl of each primer (10 mmol l− 1), 13.8 μl of double-distilled water, 0.2 μl of Ex Taq (TaKaRa, Dalian, China) and 0.8 μl of cDNA as template. The PCR program was as follows: 95 °C for 5 min; 35 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; a final elongation step of 72 °C for 10 min. The PCR products were isolated using DNA Gel Extraction Kit (OMEGA, USA) and cloned into PMD18T vector (TaKaRa, Dalian, China). The recombinant vector was transformed into competent Escherichia coli DH5a cells and sequenced after recombinant identification. Table 1 Primers used for cloning and characterization of Pf-EGFR gene. Primer name
Sequences (5′-3′)
Application
EGFR-F1 EGFR-R1 EGFR-F2 EGFR-R2 EGFR-3′-GSP1 EGFR-3′-GSP2 3′Adaptor outer 3′Adaptor inner gEGFR-F1 gEGFR-R1 gEGFR-F2 gEGFR-R2 gEGFR-F3 gEGFR-R3 qEGFR-F1 qEGFR-R1 18 s-rRNA-F 18 s-rRNA-R YEGFR-F1 YEGFR-R1
CGCTAGGCAAACCCTTAAA CAATCGTTCGGGAGGTAGT GATGCGTTCCTTCGTGTCC CAGACGAATCATCGGCTCA AAAGCAACTTGATCCCTCG TGACTCGGGTTCCATCCAT TACCGTCGTTCCACTAGTGATTT CGCGGATCCTCCACTAGTGATTTCACTATAGG TCGTAAGAACGGAAAGATGCG CAATCCCAGAAGCACATAACCA CGCATCGACCATCGTGTT CTCCGAAAATAACAGGGTA GGAGAGAATGCTTATGACAA AAAGTGAGGAAGGCAAACC CGTGGAAGGAAACTTAGAG ATCCCAGAAGCACATAACC TGTCTGCCCTATCAACTTTC TGTGGTAGCCGTTTCTCA CCCGATTACCACTATGAGATG CAACAATAAGGTTTACCGTCC
cDNA cloning cDNA cloning cDNA cloning cDNA cloning 3′RACE 3′RACE 3′RACE 3′RACE Genome cloning Genome cloning Genome cloning Genome cloning Genome cloning Genome cloning qRT-PCR qRT-PCR qRT-PCR qRT-PCR ISH ISH
W. Zhu et al. / Gene 566 (2015) 201–211
203
Fig. 1. Nucleotide and deduced amino acid sequences of Pf-EGFR. The deduced amino acid sequences are shown above the cDNA sequences. The initiation codon and stop codon are in blue. Short dash sequence is the deduced signal peptide. L domain is underlined. PKC phosphorylation sites are shaded red with black lettering, N-myristoylation sites are shaded black with white lettering, N-glycosylation site is shaded gray with white lettering, casein kinase II phosphorylation sites are shaded gray with black lettering.
204
W. Zhu et al. / Gene 566 (2015) 201–211
W. Zhu et al. / Gene 566 (2015) 201–211
205
Fig. 3. Phylogenetic tree of Pf-EGFR. The phylogenetic tree was constructed using MEGA software 5.05 by the neighbor-joining method and 1000 replications of bootstrap. The scale bar indicated a branch length of 0.2. Amino acid sequences of EGFR are obtained from invertebrate and vertebrate animals. The protein sequences used for phylogenetic analysis include the following: Pinctada fucata EGFR (KP027299), Crassostrea angulata EGFR (ACU33974.1), Lottia gigantean EGFR (ESP04264.1), Mus musculus EGFR (AAA17899.1), Homo sapiens EGFR (NP_005219.2), Taeniopygia guttata EGFR (XP_002196468.2), Xenopus tropicalis EGFR (XP_002939960.2), Danio rerio EGFR (NP_919405.1), Xiphophorus xiphidium EGFR (AAD10500.2), Nasonia vitripennis EGFR (XP_001602830.2), Gryllus bimaculatus EGFR (BAG65666.1), Drosophila melanogaster EGFR (AAR85245.1), Lymnaea stagnalis EGFR (ABQ10634.1), Haliotis diversicolor EGFR (AFM78688.1), Caenorhabditis elegans EGFR (P24348.3).
2.4. Genome DNA extraction and cloning Total genomic DNA was extracted from 25 mg of adductor muscle using Marine Animals DNA kit (TIANGEN, Beijing, China). DNA quality and quantity were determined by spectrophotometry and agarose gel electrophoresis. Pf-EGFR cDNA sequence was aligned with P. fucata genome data. Genomic sequences were amplified with the gene specific primers gEGFR-F1/R1, gEGFR-F2/R2 and gEGFR-F3/R3 (Table 1) in a 20 μl reaction volume, containing 2 μl of 10 × Ex Taq buffer, 1.6 μl of dNTP Mix (2.5 mmol l−1), 0.8 μl of each primer (10 mmol l−1), 13.8 μl of double-distilled water, 0.2 μl of Ex Taq (TaKaRa, Dalian, China) and 0.8 μl of DNA as template. The PCR cycle condition was one initial denaturation cycle of 95 °C for 5 min, then 35 cycles of 94 °C for 30 s, 56 °C for 45 s, 72 °C for 1 min and a final extension step at 72 °C for 10 min. The final PCR product was separated by 1.2% agarose gel electrophoresis, and then the desired band was excised and purified using a DNA Gel Extraction Kit (OMEGA, USA). Finally, the purified DNA fragments were cloned into the pMD18-T vector (TaKaRa, Dalian, China) and sequenced.
2.5. Sequence analysis The sequences were analyzed using the BLAST algorithm at the National Center for Biotechnology Information database (http://www. ncbi.nlm.nih.gov/blast/) for similarity to known genes. The protein transmembrane domain and signal peptide were predicted by InterProScan 5 (http://www.ebi.ac.uk/Tools/pfa/iprscan5/). The potential N-glycosylation sites were predicted by NetNGlyc1.0. The deduced amino acid sequence was analyzed using the simple modular architecture research tool (SMART) (http://smart.emblheidelberg.de/) and ScanProsite (http://prosite.expasy.org/) to predict conserved domains. The multiple alignments of the EGFR proteins of P. fucata and other
species were performed using the ClustalW2 multiple alignment program (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The phylogenetic tree was reconstructed with MEGA 5.0 based on amino acid sequence alignment using the neighbor-joining (NJ) algorithm and the reliability of the branching was evaluated by the bootstrap method with 1000 pseudo replicates. Genomic and cDNA sequences of Pf-EGFR were aligned using the Spidey program (http://www.ncbi.nlm.nih.gov/IEB/ Research/Ostell/Spidey/) to determine the exon–intron structure of the gene. Other species EGFRs were downloaded from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) database and the genomic structures were analyzed and compared with Pf-EGFR. 2.6. Real-time qRT-PCR The expression levels of Pf-EGFR in different tissues (mantle, muscle, gill, hepatopancreas, pearl sac, intestine, gonad) and at different developmental stages (trochophore, D-veliger, umbo veliger, pediveliger, metamorphosis) were analyzed using real-time quantitative reverse transcription PCR (qRT-PCR). RNA isolation was carried out as described above. The single-strand cDNA was synthesized based on manufacture's instruction of PrimerScript™ 1st strand cDNA synthesis Kit (TaKaRa, Dalian, China) with total RNA as template. cDNA mix was diluted to 1:100 and stored at − 20 °C for subsequent qRT-PCR. Primers used for qRTPCR were shown in Table 1. Quantitative real-time PCR was performed in triplicate for each sample using the CFX96 real-time PCR Detection System (Eppendorf, Germany) in a 20 μl reaction system, following the components: 10 μl of 2 × SYBR Green Real-time PCR Master Mix (TaKaRa, Dalian, China), 0.4 μl of each primer (10 μM), 1.0 μl cDNA and 8.2 μl RNase-free water. The PCR program was as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 30 s. 18S rRNA gene was selected as the reference gene (Miyazaki et al., 2010). Data were
Fig. 2. Multiple sequence alignment of Pf-EGFR and other EGFR genes. Alignment was performed using Clustal W2 and DNAMAN. Identical residues are indicated in black, and similar residues in light gray. Points indicate gaps. Identities are shown as black boxes and shaded boxes represent similar amino acids. Source include: Pf-EGFR, Pinctada fucata (KP027299), Crassostrea angulata EGFR (ACU33974.1), Lottia gigantean EGFR (ESP04264.1), Mus musculus EGFR (AAA17899.1), Homo sapiens EGFR (NP_005219.2), Taeniopygia guttata EGFR (XP_002196468.2), Xenopus tropicalis EGFR (XP_002939960.2), Danio rerio EGFR (NP_919405.1), Xiphophorus xiphidium EGFR (AAD10500.2), Nasonia vitripennis EGFR (XP_001602830.2), Gryllus bimaculatus EGFR (BAG65666.1), Drosophila melanogaster EGFR (AAR85245.1), Lymnaea stagnalis EGFR (ABQ10634.1), Haliotis diversicolor EGFR (AFM78688.1). The EGF receptor, L domain was in red color line. Insulin-like growth factor binding protein, N-terminal was in blue color line.
206
W. Zhu et al. / Gene 566 (2015) 201–211
analyzed with the Realplex2 software (Eppendorf, Germany). To maintain consistency, the baseline was set automatically by the software. The comparative CT method (2−ΔΔCT method) was used to analyze the PfEGFR mRNA expression level. The CT for the target amplified Pf-EGFR and the CT for the 18 s-rRNA gene were determined for each sample. Differences in the CT for the target and the internal control, called ΔCT, were calculated to normalize the differences in the amount of total cDNA added to each reaction and the efficiency of the RT-PCR. The control group was used as the reference sample, called the calibrator. The ΔCT for each sample was subtracted from the ΔCT of the calibrator, the difference was called ΔΔCT. The Pf-EGFR mRNA expression level could be calculated by 2−ΔΔCT and the value stood for an n-fold difference relative to the calibrator (Livak and Schmittgen, 2001).
Sections were then dewaxed in xylene and rehydrated in an alcohol series in preparation for RNA in situ hybridization of Pf-EGFR. In situ hybridization was then carried out according to the instruction of the BIOSENSE-TM Detection Kit (Biosense, Guangdong, China). 2.8. Statistical analysis All data were expressed as mean ± standard deviation (SD). The data from the experiments were analyzed using the analysis of variance (ANOVA) in SPSS 19.0 software (SPSS Inc., Chicago, IL, USA). Differences between means were considered significant at the 95% confidence level (P b 0.05). 3. Results
2.7. In situ hybridization 3.1. Cloning and characterization of Pf-EGFR The primers YEGFR-F1 and YEGFR-R1 were used to amplify Pf-EGFR under the same conditions as described above. Digoxigenin labeled RNA probes were synthesized from the linearized plasmid containing the insertion fragment encoding partial sequence of Pf-EGFR using the DIG RNA Labeling Kit by Biosense Bio-engineering Limited Company (Biosense, Guangdong, China). A rectangular piece of mantle tissue and pearl sac tissue (0.8 × 0.5 cm) was excised with a DEPC-treated scalpel, then immediately fixed in 4% paraformaldehyde containing 0.1% DEPC overnight. Fixed tissue was dehydrated through an alcohol series and embedded in paraffin wax. Tissue blocks were sectioned to 7 μm increments.
By transcriptome sequencing and PCR amplification, a 2156 bp cDNA sequence was obtained with an open reading frame (ORF) of 1017 bp (Fig. 1) and named as Pf-EGFR. The cDNA sequence of PfEGFR has been deposited in GenBank (KP027299). The deduced amino acid (aa) sequence was 338aa long with a predicted molecular mass of 37.5 kDa and pI of 4.54. Sequcence analysis indicated that Pf-EGFR has a putative signal peptide (1-36aa) and a transmembrane region. The grand average of hydropathicity (GRAVY) was − 0.045, stating that Pf-EGFR was a hydrophilic protein. Function analysis predicted that the deduced amino acid sequence included four protein kinase C
Fig. 4. Genomic DNA sequence of Pf-EGFR. Exons and introns were indicated in upper-case letters and lower-case letters, respectively. The consensus GT-AG exon–intron junction sequences were noted in bold. The initiation codon (ATG) and terminator codon (TGA) were shaded.
W. Zhu et al. / Gene 566 (2015) 201–211
(PKC) phosphorylation sites (145–147aa, 154–156aa, 175–177aa, 320322aa), four N-myristoylation sites (71–76aa, 163–168aa, 174–179aa, 254–259aa), seven casein kinase II phosphorylation sites (52–55aa, 97–100aa, 122–125aa, 170–173aa, 240–243aa, 295–298aa, 320– 323aa), a N-glycosylation site (113–116aa) and a cell attachment sequence (66–68aa). Domain analysis showed that Pf-EGFR contained functional motifs including a L domain of EGF receptor (95–215aa), a N-terminal insulin-like growth factor binding protein (236–329aa), a furin-like cysteine-rich domain (232–328aa) and a furin-like repeat (271–322aa). 3.2. Phylogenetic analysis of Pf-EGFR The deduced amino acid sequences of Pf-EGFR and other species EGFR were aligned by the Clustal W2 program and DNAMAN. Multiple sequence alignment showed that Pf-EGFR shared the highest identity (56.71%) with Crassostrea angulata (Accession No. ACU33974.1) (Fig. 2). The phylogenetic tree was reconstructed based on EGFR protein sequences by using MEGA software 5.0 with the neighbor-joining method and Caenorhabditis elegans as an out-group. Vertebrates and invertebrates were clustered into respective group. For vertebrate group, it was divided into four distinct clades which were mammals, birds, amphibians and fishes, consistent with their classification. In invertebrate cluster, PfEGFR was clustered with C. angulata EGFR and L. gigantean EGFR indicative of the closer evolutionary relationship between them (Fig. 3). 3.3. Genomic structure of Pf-EGFR To study the structure of the Pf-EGFR gene, the whole genomic sequence was cloned using PCR. Genomic sequence of Pf-EGFR was 5190 bp length and submitted to the GenBank under the accession number KP027300. Comparison of the sequences of the genomic DNA and cDNA clones revealed that the Pf-EGFR gene has six exons and five introns. The exon/intron boundaries were consistent with the typical GT/AG rule (Fig. 4). The comparison of genomic structures of available EGFR from vertebrates and invertebrates showed that the lengths of exons and introns were highly variable among different species (Fig. 5).
207
3.4. Tissue expression profile of Pf-EGFR Quantitative RT-PCR analysis was used to determine the expression profile of Pf-EGFR mRNA with 18S-rRNA as an internal control. The mRNA for Pf-EGFR was expressed in all the seven tissues analyzed (mantle, muscle, gill, hepatopancreas, pearl sac, intestine, gonad), which suggested that the Pf-EGFR gene is ubiquitously expressed in adult P. fucata. However, the mRNA expression levels of Pf-EGFR in the pearl sac, mantle and intestine are much higher than other tissues (Fig. 6). 3.5. Expression levels of Pf-EGFR during larval development of the pearl oyster The transcripts levels of Pf-EGFR mRNA from trochophore to metamorphosis were also determined (Fig. 7). Pf-EGFR gene was expressed in each larval developmental stage, but the expression levels were different with the highest at metamorphosis period and lowest in the Dveliger larvae. 3.6. Pf-EGFR expression pattern in P. fucata mantle tissue and pearl sac tissue In situ hybridization was performed to determine the precise location of Pf-EGFR mRNA expression in the mantle and pearl sac of P. fucata (Fig. 8). In the mantle, strong hybridization signals for PfEGFR mRNA were detected in the epidermal cells on both the inner side of the outer fold and the outer side of the inner fold. Slight hybridization signals were founded in the outer epidermal cells of middle fold. In pearl sac, hybridization signals were detected throughout the whole pearl sac including the epidermal cells and the connective tissues. No hybridization signals were detected in negative control. 4. Discussion EGFR is a receptor of intrinsic protein tyrosine kinase (PTK) activity (Boulougouris and Elder, 2001), EGFR signaling controls diverse cellular responses related to animal cell proliferation, differentiation, survival,
Fig. 5. (A) Structure of the genomic Pf-EGFR DNA. (E1–E6) is indicated by amino acid residues and nucleotides. The locations of six exons and five introns are noted. (B) Schematic representation of EGFR genomic structure organization from different species. Exons and UTRs are represented by solid and empty boxes, respectively. Introns are represented by lines in between boxes. Genomic structures were obtained from the NCBI database and accession numbers are Homo sapiens: NM_005228.3, Danio rerio: NC_007113.5, Drosophila melanogaster: NT_033778.4.
208
W. Zhu et al. / Gene 566 (2015) 201–211
Fig. 6. Relative expression levels of Pf-EGFR in various tissues from P. fucata. Higher transcript levels were detected in the mantle, pearl sac and intestine. Three biological replicates were performed for each developmental stage, and three technical replicates were conducted for each PCR reaction. Data are expressed as the mean ±S.D. (N = 3). Different letters indicated significant difference among tissues at P b 0.05.
motility, and apoptosis (Olayioye et al., 2000; Yarden and Sliwkowski, 2001), and the genes involved in this pathway have been extensively studied in both model and economically valuable species, such as D. rerio (Goishi et al., 2003), H. diversicolor (Bai and Ke, 2012), and C. angulata (Qin et al., 2010). In this study, we cloned EGFR gene from P. fucata and found some common functional groups in it as compared with different animal taxa. In Pf-EGFR, we found four protein kinase C (PKC) phosphorylation sites, four N-myristoylation sites and seven casein kinase II phosphorylation sites (Fig. 1) which were also observed in A. japonicus (Li et al., 2012), C. angulata (Qin et al., 2010) and H. sapiens (Ullrich et al., 1984). Besides, Pf-EGFR has an L domain of EGF receptor and a furin-like cysteine-rich domain, consistent with the characteristics of ErbB protein family, indicating that Pf-EGFR
belongs to ErbB protein family. Additionally, the phylogenetic tree showed that Pf-EGFR was grouped in a clade of molluscan sequences, consistent with their classification positions (Fig. 3). However, Pf-EGFR amino acid sequence is much shorter than that of H. sapiens, and the numbers of exons and introns are also much less than that of vertebrates. There were only 5–6 exons and 4–5 introns in D. melanogaster EGFR (Hoskins et al., 2007) and P. fucata EGFR, but 25–27 exons and 24–26 introns in D. rerio (Howe et al., 2013) and H. sapiens EGFR (Collins et al., 2004) (Fig. 5). All of these findings showed that with animals evolving from the lower class to the higher, the structure of EGFR becomes more and more complex to satisfy the requirements of complicated functions of higher class animals, suggesting that EGFR gene plays very important roles in the biological processes. The dramatic increases
Fig. 7. Relative expression levels of Pf-EGFR at different larval stages. The expression levels of Pf-EGFR mRNA in metamorphosis stage were much higher than in other stages. Three biological replicates were performed for each developmental stage, and three technical replicates were conducted for each PCR reaction. Data are expressed as the mean ±S.D. (N = 3). Different letters indicated significant difference among larval development stages at P b 0.05.
W. Zhu et al. / Gene 566 (2015) 201–211
in the numbers of exons and introns from invertebrates to vertebrates also imply that EGFR gene in vertebrates maybe experienced several rounds of duplicates in the course of evolutionary to meet the needs of complicated life. To understand the function of Pf-EGFR, expression pattern in various tissues were investigated using quantitative RT-PCR. Pf-EGFR mRNA was expressed in all the tissues studied. However, the expression levels varied in different tissues. Pf-EGFR was highly expressed in pearl sac, intestine and mantle, meanwhile the expressions in muscle and hepatopancreas were significantly lower (Fig. 6). The previous studies also demonstrated that EGFR transcripts were considerably abundant in mantle of H. diversicolor (Bai and Ke, 2012), similar to our results, but
209
high in the hepatopancreas either, contrast to that in P. fucata. In A. japonicas (Li et al., 2012), the EGFR mRNA was highly expressed in coelomocyte and epidermis. These results demonstrated that EGFR was highly expressed in epithelial cell-riched tissues. Pf-EGFR expressed in different tissues may play different roles. Tice et al. (1999) and Biscardi et al. (1999) discovered that EGFR can promote mitosis in mouse fibroblast, while overexpression will lead to tumor formation (Bao et al., 2003). Further studies showed EGFR provide energy for cell migration and movement (Goi et al., 2000; Uruno et al., 2001). EGFR in D. rerio (Goishi et al., 2003) and D. melanogaster (Ghiglione et al., 2002) probable accelerate oocyte development. EGFR has facilitation of vein in D. melanogaster (Guichard et al., 1999). So we speculated
Fig. 8. Detection of Pf-EGFR mRNA distribution in mantle and pearl sac of P. fucata by in situ hybridization. Frame A, C, D, E and F are positive, B is negative control. C, D, E and F were higher magnifications of A. No signal was observed in negative control. Hybridization signal is indicated in purple blue and arrowheads. IF = inner fold, MF = middle fold, OF = outer fold, oe = outer epithelium, ie = inner epithelium.
210
W. Zhu et al. / Gene 566 (2015) 201–211
Fig. 8 (continued).
that high levels of Pf-EGFR expressions in pearl sac and mantle of P. fucata may be related with activity of biominaeralizing; because the mantle, as the site of shell synthesis, is the most important tissue involved in biomineralization. In the case of a bivalve, this organ is anatomically divided into two regions: the mantle pallial, located proximal to the shell hinge, and the mantle edge, situated distal to the hinge (Gardner et al., 2011). The distal mantle is further characterized by enlargement of the sheath at the shell margin into three terminal folds: the outer fold (OF), middle fold (MF), and the inner fold (IF). Previous studies have revealed that different regions of the mantle are responsible for different roles. The nacreous and prismatic layers are formed in the mantle center (MC) and mantle edge (ME), respectively, by epithelial cell secretion (Sudo et al., 1997; Wada, 1999). Based on the tissue expression result above, we performed in situ hybridization of PfEGFR expression in the mantle and pearl sac for further verification of its function. Strong hybridization signals for Pf-EGFR mRNA were detected on both the inner of the outer fold and the outer side of the inner fold. Slight hybridization signals were founded in the middle fold. The pearl oyster shell typically consists of an outermost organic layer termed the periostracum, and calcium carbonate oriented in two distinct microlaminates, the outer calcite prismatic layer and the inner aragonite nacreous layer (Kennedy et al., 1969). In the early stages of pearl
formation within the pearl sac, the prismatic layer is first formed on the nucleus, and then the nacreous layer onto the prismatic layer. Different mantle zone have different biomineralization function. The nacreous and prismatic layers are formed in the mantle center (MC) and mantle edge (ME), respectively, by epithelial cell secretion. The groove bteween outer fold and middle fold responsible to periostracum formation (Sudo et al., 1997; Wada, 1999; Gardner et al., 2011). So we speculate that EGFR may contribute to periostracum formation. Meanwhile, in pearl sac, hybridization signals were detected throughout the whole pearl sac including the connective tissues (Fig. 8). Due to Ca2 + can only participate in the mineralization through the epidermal cells in pallial chamber (Barry and Diamond, 1971), so EGFR may facilitate Ca2+ transportation in pearl biomineralization. Together with qRT-PCR results, these findings indicated that highly expressed Pf-EGFR in pearl sac and mantle contributes much in some way to the formation of shells and pearls since they are the main organs for shell and pearl formation through biomineralization. In the metamorphosis stage the most important morphologic changes in bivalves are the loss of the velum, the reorientation of the mouth and the foot, and the growth of the labial palps and the gill filaments. All of these changes are accompanied by an increase in complexity of organ systems and by the secretion of the dissoconch (Bayne, 1971).
W. Zhu et al. / Gene 566 (2015) 201–211
As shown in Fig. 7, with the larvae developing from trochophore to metamorphosis stage, the mRNA level of Pf-EGFR was increased gradually and reached the highest in metamorphosis stage. In C. angulata, EGFR mRNA was also expressed highly in metamorphosis (Han et al., 2012). Okazaki and Shizuri (2000) found that EGFR tyrosine kinase inhibitors can effectively inhibit larval attachment and metamorphosis of Barnacle amphitrite. These results indicated that EGFR plays an important role during early larval development in mollusk. In summary, we successfully cloned and sequenced the EGFR gene from the pearl oyster P. fucata for the first time. The structural analysis of the Pf-EGFR genomic sequence suggests that the Pf-EGFR gene has six exons and five introns, extending approximately 5.19 kb in length. Furthermore, we analyzed the mRNA expression pattern of Pf-EGFR in different tissues and different larval stages. More importantly, we determined the precise location of Pf-EGFR gene expression in mantle and pearl sac via in situ hybridization. This information suggests that PfEGFR plays diverse roles in many biological processes, and may especially facilitate shell formation. Yet, detailed pathways in it need to be studied further. Conflict of interest We declare that there is no conflict of interest. Acknowledgments This work was funded by the NNSFC (31372525), the Earmarked Fund for China Agriculture Research System (CARS-48), Guangdong Provincial Marine Fisheries Science & Technology Promotion Special Projects (A201201A08, A201301A02, A201301A08, B201300B08) and Guangdong Provincial Science and Technology Project (2012B050700004). References Asakura, M., Kitakaze, M., Takashima, S., Liao, Y., Ishikura, F., Yoshinaka, T., Ohmoto, H., Node, K., Yoshino, K., Ishiguro, H., Asanuma, H., Sanada, S., Matsumura, Y., Takeda, H., Beppu, S., Tada, M., Hori, M., Higashiyama, S., 2002. Cardiac hypertrophy is inhibited by antagonism of ADAM12 processing of HB-EGF: metalloproteinase inhibitors as a new therapy. Nat. Med. 8, 35–40. Bai, R., Ke, C., 2012. Molecular cloning and expression analysis of epidermal growth factor receptor (EGFR) from small abalone, Haliotis diversicolor. Biochem. Biotechnol. 5 (Chinese). Bao, J., Gur, G., Yarden, Y., 2003. Src promotes destruction of c-Cbl: implications for oncogenic synergy between Src and growth factor receptors. Proc. Natl. Acad. Sci. U. S. A. 100, 2438–2443. Barry, P.H., Diamond, J.M., 1971. A theory of ion permeation through membranes with fixed neutral sites. J. Membr. Biol. 4, 295–330. Bayne, B.L., 1971. Some morphological changes that occur at the metamorphosis of the larvae of Mytilus edulis. Proc 4th Eur, mar Biol Symp, pp. 259–280. Biscardi, J.S., Maa, M.-C., Tice, D.A., Cox, M.E., Leu, T.-H., Parsons, S.J., 1999. c-Src-mediated phosphorylation of the epidermal growth factor receptor on Tyr845 and Tyr1101 is associated with modulation of receptor function. J. Biol. Chem. 274, 8335–8343. Blume-Jensen, P., Hunter, T., 2001. Oncogenic kinase signalling. Nature 411, 355–365. Bogdan, S., K.C., 2001. Epidermal growth factor receptor signaling. Curr. Biol. 11, 292–295. Boulougouris, P., Elder, J., 2001. Epidermal growth factor receptor structure, regulation, mitogenic signalling and effects of activation. Anticancer Res. 21, 2769–2775. Citri, A., Yarden, Y., 2006. EGF-ERBB signalling: towards the systems level. Nat. Rev. Mol. Cell Biol. 7, 505–516. Collins, F.S., Lander, E.S., Rogers, J., Waterston, R.H., Int Human Genome Sequencing, C., 2004. Finishing the euchromatic sequence of the human genome. Nature 431, 931–945. Crone, S.A., Zhao, Y.Y., Fan, L., Gu, Y.S., Minamisawa, S., Liu, Y., Peterson, K.L., Chen, J., Kahn, R., Condorelli, G., Ross, J., Chien, K.R., Lee, K.F., 2002. ErbB2 is essential in the prevention of dilated cardiomyopathy. Nat. Med. 8, 459–465. Gardner, L.D., Mills, D., Wiegand, A., Leavesley, D., Elizur, A., 2011. Spatial analysis of biomineralization associated gene expression from the mantle organ of the pearl oyster Pinctada maxima. BMC Genomics 12. Ghiglione, C., B.E.A., Paraiso, Y., et al., 2002. Mechanism of activation of the Drosophila EGF receptor by the TGFalpha ligand Gurken during oogenesis. Development 129, 175–186. Goi, T., Shipitsin, M., Lu, Z.M., Foster, D.A., Klinz, S.G., Feig, L.A., 2000. An EGF receptor/RalGTPase signaling cascade regulates c-Src activity and substrate specificity. EMBO J. 19, 623–630.
211
Goishi, K., Lee, P., Davidson, A.J., Nishi, E., Zon, L.I., Klagsbrun, M., 2003. Inhibition of zebrafish epidermal growth factor receptor activity results in cardiovascular defects. Mech. Dev. 120, 811–822. Guichard, A., Biehs, B., Sturtevant, M.A., Wickline, L., Chacko, J., Howard, K., Bier, E., 1999. Rhomboid and star interact synergistically to promote EGFR/MAPK signaling during Drosophila wing vein development. Development 126, 2663–2676. Han, G., Yang, B., Ke, C., 2012. Prokaryotic expression and mRNA expression analysis of epidermal growth factor receptor during attachment and metamorphosis from Crassostrea gigas angulata. J. Xiamen Univ. (Nat. Sci.) 51, 263–266 (Chinese). Hoskins, R.A., Carlson, J.W., Kennedy, C., Acevedo, D., Evans-Holm, M., Frise, E., Wan, K.H., Park, S., Mendez-Lago, M., Rossi, F., Villasante, A., Dimitri, P., Karpen, G.H., Celniker, S.E., 2007. Sequence finishing and mapping of Drosophila melanogaster heterochromatin. Science 316, 1625–1628. Howe, K., Clark, M.D., Torroja, C.F., Torrance, J., Berthelot, C., Muffato, M., Collins, J.E., Humphray, S., McLaren, K., Matthews, L., 2013. The zebrafish reference genome sequence and its relationship to the human genome. Nature 496 (7446), 498–503. Inoue, N., Ishibashi, R., Ishikawa, T., Atsumi, T., Aoki, H., Komaru, A., 2010. Gene expression patterns and pearl formation in the Japanese pearl oyster (Pinctada fucata): a comparison of gene expression patterns between the pearl sac and mantle tissues. Aquaculture 308, S68–S74. Jost, M., Kari, C., Rodeck, U., 2000. The EGF receptor — an essential regulator of multiple epidermal functions. Eur. J. Dermatol. 10, 505–510. Kennedy, W.J., Taylor, J.D., Hall, A., 1969. Environmental and biological controls on bivalve shell mineralogy. Biol. Rev. 44, 499–530. Lax, I., Johnson, A., Howk, R., 1988. Chicken epidermal growth factor (EGF) receptor: cDNA cloning, expression in mouse cells, and differential binding of EGF and transforming growth factor alpha. Mol. Cell. Biol. 8, 1970–1978. Li, X., Wang, X., Yanjie, Q., Liu, Y., Zhou, Y., 2012. Cloning and expression analysis of EGFR gene in Apostichopus japonicus. Med. Chem. Res. 36, 46–49 (Chinese). Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Lucas, J.S., Southgate, P.C., 2008. The Pearl Oyster. Elsevier Science & Technology. Masaoka, T., Samata, T., Nogawa, C., Baba, H., Aoki, H., Kotaki, T., Nakagawa, A., Sato, M., Fujiwara, A., Kobayashi, T., 2013. Shell matrix protein genes derived from donor expressed in pearl sac of Akoya pearl oysters (Pinctada fucata) under pearl culture. Aquaculture 384, 56–65. Miyazaki, Y., Nishida, T., Aoki, H., Samata, T., 2010. Expression of genes responsible for biomineralization of Pinctada fucata during development. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 155, 241–248. Okazaki, Y., Shizuri, Y., 2000. Effect of inducers and inhibitors on the expression of bcs genes involved in cypris larval attachment and metamorphosis of the barnacles Balanus amphitrite. Int. J. Dev. Biol. 44, 451–456. Olayioye, M.A., Neve, R.M., Lane, H.A., Hynes, N.E., 2000. The ErbB signaling network: receptor heterodimerization in development and cancer. EMBO J. 19, 3159–3167. Petch, L., Harris, J., Raymond, V., Blasband, A., Lee, D., Earp, H.S., 1990. A truncated, secreted form of the epidermal growth factor receptor is encoded by an alternatively spliced transcript in normal rat tissue. Mol. Cell. Biol. 10, 2973–2982. Qin, J., Xu, Q., Ke, C., 2010. Cloning and expression of EGFR in embryos and larvae of Crassostrea angulata. 46, 756–762 (Chinese). Schlessinger, J., 2000. Cell signaling by receptor tyrosine kinases. Cell 103, 211–225. Simkiss, K., Wilbur, K., 1989. Biomineralization: Cell Biology and Mineral Deposition. Academic Press,c1989, San Diego, CA 92101. Sudo, S., Fujikawa, T., Nagakura, T., Ohkubo, T., Sakaguchi, K., Tanaka, M., Nakashima, K., Takahashi, T., 1997. Structures of mollusc shell framework proteins. Nature 387, 563–564. Sun, L., Huan, P., Wang, H., Liu, F., Liu, B., 2014. An EGFR gene of the Pacific oyster Crassostrea gigas functions in wound healing and promotes cell proliferation. Mol. Biol. Rep. 41, 2757–2765. Tice, D.A., Biscardi, J.S., Nickles, A.L., Parsons, S.J., 1999. Mechanism of biological synergy between cellular Src and epidermal growth factor receptor. Proc. Natl. Acad. Sci. 96, 1415–1420. Ullrich, A., Coussens, L., Hayflick, J.S., 1984. Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells. Nature 309, 418–424. Uruno, T., Liu, J.L., Zhang, P.J., Fan, Y.X., Egile, C., Li, P., Mueller, S.C., Zhan, X., 2001. Activation of Arp2/3 complex-mediated actin polymerization by cortactin. Nat. Cell Biol. 3, 259–266. Van Kesteren, R.E., Gagatek, J.S., Hagendorf, A., Gouwenberg, Y., Smit, A.B., Syed, N.I., 2008. Postsynaptic expression of an epidermal growth factor receptor regulates cholinergic synapse formation between identified molluscan neurons. Eur. J. Neurosci. 27, 2043–2056. Wada, K., 1999. Science of the pearl oyster. Shinju Shinbunsha, Tokyo (336 pp (in Japanese)). Yarden, Y., Sliwkowski, M.X., 2001. Untangling the ErbB signalling network. Nat. Rev. Mol. Cell Biol. 2, 127–137. Yarden, Y., Ullrich, A., 1988. Growth factor receptor tyrosine kinases. Annu. Rev. Biochem. 57, 443–478. Zandee, D.I., K.J.H., Zurburg, W., et al., 1980. Seasonal variations in biochemical composition of Mytilus edulis with reference to energy metabolism and gametogenesis. Neth. J. Sea Res. 14, 1–29.