Highly sensitive amperometric detection of cardiac troponin I using sandwich aptamers and screen-printed carbon electrodes

Talanta 165 (2017) 442–448

Contents lists available at ScienceDirect

Talanta journal homepage: www.elsevier.com/locate/talanta

Highly sensitive amperometric detection of cardiac troponin I using sandwich aptamers and screen-printed carbon electrodes Hunho Joa, Jin Hera, Heehyun Leeb, Yoon-Bo Shimc, Changill Bana, a b c

MARK

⁎

Department of Chemistry, Pohang University of Science and Technology, 77, Cheongam-Ro, Nam-Gu, Pohang, Gyeongbuk 790-784, South Korea Department of Life Science, Pohang University of Science and Technology, 77, Cheongam-Ro, Nam-Gu, Pohang, Gyeongbuk 790-784, South Korea Department of Chemistry, Pusan National University, Keumjeong-Ku, Busan 609-735, South Korea

A R T I C L E I N F O

A BS T RAC T

Keywords: Screen-printed carbon electrode Cardiac troponin I Aptamer Chronoamperometry Hydrazine Diagnosis

In this study, we developed a sandwich aptamer-based screen-printed carbon electrode (SPCE) using chronoamperometry for the detection of cardiac troponin I (cTnI), one of the promising biomarkers for acute myocardial infarction (AMI). Disposable three-electrode SPCEs were manufactured using a screen printer, and various modifications such as electrodeposition of gold nanoparticles and electropolymerization of conductive polymers were performed. From the bare electrode to the aptamer-immobilized SPCE, all processes were monitored and analyzed via various techniques such as cyclic voltammetry, electrochemical impedance spectroscopy, and X-ray photoelectron spectroscopy. The quantification of cTnI was conducted based on amperometric signals from the catalytic reaction between hydrazine and H2O2. The fabricated aptasensor in a buffer, as well as in a serum-added solution, exhibited great analytical performance with a dynamic range of 1– 100 pM (0.024–2.4 ng/mL) and a detection limit of 1.0 pM (24 pg/mL), which is lower than the existing cutoff values (40–700 pg/mL). Furthermore, the developed sensor showed high sensitivity to cTnI over other proteins. It is anticipated that this potable SPCE aptasensor for cTnI will become an innovative diagnostic tool for AMI.

1. Introduction Point-of-care testing (POCT) has been great attention because of several advantages over traditional diagnostic techniques, such as a broad availability to diagnosis, easy accessibility, rapid quantification, and minimal required sample volumes [1–3]. Among diverse POCT devices, screen-printed carbon electrodes (SPCEs), which are fabricated by printing several types of inks on a specific substrate have been considered superior because of the low cost of carbon, the good reproducibility of the results, the rapid responses to analytes, disposability, and surface functionalizations [4,5]. Such SPCEs have been recently employed as diagnostic tools for food poisoning, diseases, and environmental pollutants [6–8]. A number of investigations for the early diagnosis of acute myocardial infarction (AMI), one of the foremost causes of death, have been carried out based on specific biomarkers [9,10]. Since cardiac troponins (cTnI and cTnT) have shown the high sensitivity and selectivity toward AMI, they have been targeted to many diagnostic investigations. In particular, cTnI and cTnT are superior diagnostic markers for early AMI presenters and late presenters, respectively [11]. To this end, on-site POCT techniques and devices have been developed

for AMI biomarkers including the isoform of creatine kinase, myoglobin, and the cardiac troponins (cTnI and cTnT) [3,12,13]. However, since all current assays are based on antibody-antigen interactions, there are some limitations related to the antibodies, such as poor stability, relatively high cost, and long incubation time. Aptamers, oligonucleic acids or peptides with high sensitivity and selectivity toward target molecules have been considered as excellent substitutes for antibodies; they have also shown benefits compared to antibodies, such as easy functionalization, high stability in harsh conditions, and rapid production [14–16]. In particular, aptamerbased electrical biosensors have been used to many clinical applications because of lots of superiorities such as relative stability of electroactive labels, promising speed, and low cost [17–19]. We have recently screened cTnI-specific aptamers showing high selectivity and sensitivity toward only cTnI, which is a promising AMI biomarker among currently available markers [20]. Among various biomarkers for AMI such as the isoform of creatine kinase, myoglobin, and lactate dehydrogenase, cTnI have been shown to be a valuable biomarker for AMI because of its high specificity and long residence time [21,22]. Based on diverse advantages of cTnI-specific aptamer, the accurate and precise diagnosis for AMI could be achieved.

⁎

Corresponding author. E-mail addresses: [email protected] (H. Jo), [email protected] (J. Her), [email protected] (H. Lee), [email protected] (Y.-B. Shim), [email protected] (C. Ban). http://dx.doi.org/10.1016/j.talanta.2016.12.091 Received 13 October 2016; Received in revised form 30 December 2016; Accepted 30 December 2016 Available online 31 December 2016 0039-9140/ © 2017 Elsevier B.V. All rights reserved.

Talanta 165 (2017) 442–448

H. Jo et al.

Fig. 1. Schematic illustration for the fabrication processes of the sensor and the detection of cTnI. (A) A three-electrode SPCE was manufactured using a typical printing system. AuNPs were electrically deposited on the working electrode, and then, a TTCA monomer was electrically polymerized. After EDC/NHS activation, the amine-modified aptamer was covalently immobilized on the SPCE. (B) Various concentrations of cTnI were incubated with the SPCE, followed by washing with DW. The hydrazine-modified aptamer was then incubated with the electrode, and the amperometric signals were recorded in a 10 mM H2O2 solution (AuNPs: gold nanoparticles; TTCA: 5,2′:5′2′′-terthiophene-3′-carboxylic acid; Tro4 aptamer: capture probe; Tro6 aptamer: detecting probe).

For the accurate monitoring of target molecules, the detection techniques are exceedingly important. Numerous detection systems based on colorimetry, fluorometry, and electrochemistry have been carried out to measure target-probe interaction. In particular, chronoamperometry have been received great attention and applied in many fields because of various superiorities like high-speed, simplicity, and high signal to noise ratio [23–25]. In the present study, we designed aptamer-based SPCEs for the early diagnosis of AMI using chronoamperometry and aptamer sandwich assays, for the first time (Fig. 1). These SPCE sensors exhibit high sensitivity and selectivity toward cTnI in buffer conditions as well as in a serum-supplemented solution.

vigorous stirring [27]. After the stirring for 1 min, 2 mL of 38.8 mM trisodium citrate was added, and the solution was incubated for 1 min. And then, 1 mL of 0.075% (w/v) sodium borohydride was slowly supplemented to the mixture. The concentration of the AuNPs was measured via UV–VIS spectroscopy (Libra S22, Biochrom). The spectroscopic and morphological characteristics were analyzed by UV–VIS spectroscopy and transmission electron microscopy (TEM) imaging with a JEM-1011 instrument (JEOL, Tokyo, Japan), respectively.

2. Materials and methods

The pET-28a plasmid containing Troponin I was transformed into E. coli strain BL21 (DE3), and one positive clone was obtained from independent plaques. The transformed E. coli cells were grown in LB broth at 37 °C until the absorbance at 600 nm reached 0.6. The expression of cTnI was induced by an addition of IPTG at a final concentration of 0.2 mM. After incubating the cells at 18 °C overnight, they were harvested by centrifugation at 5000 rpm at 4 °C for 20 min, and washed once with phosphate-buffered saline (PBS). The cTnIexpressing cells were resuspended in a lysis buffer (20 mM Tris, pH 8.0, 500 mM NaCl, 0.5 mM β-mercaptoethanol, and 0.1% Tween 20) and disrupted by sonication on ice. After the centrifugation of the cell lysate at 15,000 rpm for 30 min, the supernatant was filtered through a 0.45 µm membrane filter. The supernatant was applied to a Ni-NTA column pre-equilibrated with the lysis buffer. After binding, the protein was eluted by increasing the concentration of imidazole from 0 to 300 mM with an elution buffer (20 mM Tris, pH 8.0, 500 mM NaCl, 0.5 mM β-mercaptoethanol, 0.1% Tween 20, and 300 mM imidazole). In addition, the eluted protein was applied to a desalting column to remove imidazole and was further purified using a Superdex peptide gel filtration column (GE Healthcare, USA). The purified cTnI was stored in a final buffer (20 mM Tris, pH 8.0, 300 mM NaCl, 5 mM βmercaptoethanol, and 0.1% Tween 20) at a concentration of 20 μM.

2.3. Expression and purification of cTnI

2.1. Materials Gold (III) chloride trihydrate, human serum albumin (HSA), human serum (human male AB plasma), bovine serum albumin (BSA), sodium borohydride, and adipic acid dihydrazide were bought from Sigma-Aldrich (St. Louis, MO, USA). Trisodium citrate dehydrate was purchased from Wako Pure Chemical Industries (Osaka, Japan). Carbon ink, silver ink, and insulation paint were obtained from Jujo Chemical (Tokyo, Japan). The 5′-amine modified Tro4 aptamer (5′amine-CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTA-3′) and 5′-phosphate modified Tro6 aptamer (5′-phosphateCGCATGCCAAACGTTGCCTCATAGTTCCCTCCCCGTGTCC) were synthesized by Cosmo Genetech (Seoul, Korea). The 5,2′:5′2′′-terthiophene-3′-carboxylic acid (TTCA) was newly synthesized by Shim's group following their previous report [26]. Interleukin 13 receptor (IL-13R), interleukin 5 receptor (IL-5R), cluster of differentiation 4 (CD4), and CD166 were acquired from Sino Biological (Beijing, China). Lysozyme was bought from Bio Basic (Markham, Ontario, Canada). The BL21 (DE3) Escherichia coli strain was purchased from Invitrogen (USA). Luria Bertani (LB) was obtained from Merck (Kenilworth, NJ, USA). Isopropyl-β-D-1-thiogalactopyranoside (IPTG) was purchased from Calbiochem (San Diego, CA, USA).

2.4. Fabrication of SPCEs All experiments were carried out in a three-electrode cell utilizing an all-in-one SPCE. The SPCEs were manufactured on the polyethylene-based film using a screen printer (BANDO industrial, Korea). First of all, silver was coated on the film as conductor, and then carbon was printed as working and counter electrodes. Finally, insulator was also covered on the top of the film. The cleaning using 0.1 M HNO3 was

2.2. Preparation of gold nanoparticles Prior to the synthesis, all of the glassware was washed with a 3:1 mixture of HCl:HNO3 and rinsed with deionized water (DW). For the synthesis of gold nanoparticles (AuNPs) having a size 5 nm, 1 mL of 1% (w/v) gold(III) chloride solution was added to 90 mL of DW under 443

Talanta 165 (2017) 442–448

H. Jo et al.

Fig. 2. Analysis of each modification step. (A) Cyclic voltammograms for the modification processes. CV was carried out in PBS at scan rate of 100 mV/s. (B) Nyquist plots of the modification processes. Impedance was measured in PBS containing 5 mM [Fe(CN)6]3-/4-. (C) XPS analysis of each surface (Bare: bare SPCE; AuNPs: AuNP-deposited SPCE; Polymer: TTCA-deposited SPCE; Aptamer: Tro4 aptamer-immobilized SPCE).

aptamer was purified by the chromatographic method using a final buffer (10 mM sodium phosphate, 150 mM NaCl, 10 mM ethylenediaminetetraacetic acid, pH 7.2).

carried out by cycling the electrode potential between +0.2 V and +0.6 V at a 100 mV/s scan rate for 5 cycles. The performance of the fabricated SPCEs was confirmed with the glassy carbon electrode. As shown in Fig. 1A, it was composed of a working carbon electrode, a Ag/ AgCl reference electrode, and a carbon counter electrode [28]. To modify the surface of the working electrode, 1 μL of 5 mM AuNPs was dropped on each surface of SPCEs and the AuNPs were electrically deposited on the working electrode by cycling the electrode potential between +0.1 V and +1.6 V at a 50 mV/s scan rate for 10 cycles. After washing with 0.5 M H2SO4 through five CV cycles, 0.4 μL of 1 mM TTCA in a 1:1 mixture of tripropylene glycol methyl ether and dipropylene glycol methyl ether was dropped on the electrode and electrically polymerized via CV (0 – 1.5 V, 100 mV/s, and 3 cycles) [29]. The 5′-amine modified Tro4 aptamer (capture probe) was immobilized on the working electrode through 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC)/ N-hydroxysuccinimide (NHS) coupling between a carboxylic acid of polymer and amine (Fig. 1A). Each modification step was verified via CV, electrochemical impedance spectroscopy (EIS), and X-ray photoelectron spectroscopy (XPS).

2.6. Electrochemical detection of cTnI The detections were performed as presented in Fig. 1B. cTnI was incubated with the Tro4 aptamer-functionalized working electrode at RT, and then washed with DW. A hydrazine-modified aptamer was successively treated at RT, and washed with DW, followed by the detection of cTnI in PBS. Prior to the quantification of cTnI in buffer, various factors such as incubation time (reaction between Tro4 aptamer and cTnI), detecting time (reaction between cTnI and Tro6 aptamer), pH, the concentration of Tro6 aptamer, and voltage of chronoamperometry were optimized. In the buffer condition, amperometric signals from hydrazine were recorded, and quantification of cTnI was achieved based on those signals (40 points/s). For the construction of the calibration curve, the current differences between blank signals and sandwich detection signals were used.

2.5. Synthesis of hydrazine-modified Tro6 aptamer 2.7. Specificity test of the designed sensor

To induce a sandwich aptamer reaction, hydrazine, which is an electrocatalyst for the reduction of H2O2, was labeled on the Tro6 aptamer (detecting probe) via phosphoramidate linkage between the 5′-phosphate modified Tro6 aptamer and adipic acid dihydrazide [30]. The 5′-phosphate modified Tro6 aptamer (7.5 μL, 100 μM) was incubated with 5 μL of 0.25 M adipic acid dihydrazide in 0.1 M imidazole (pH 6.0). After vigorous shaking, 20 μL of 0.1 M imidazole (pH 6.0) was added to the solution, and then, the reaction mixture was incubated at room temperature (RT) for 2 h. The resulting Tro6

The availability of the sensor was also demonstrated using nontarget proteins. Various proteins such as BSA, HSA, IL-13R, IL-5R, CD4, CD166, and lysozyme were applied to this platform at a concentration of 50 pM, and the amperometric signals were obtained. In addition, the detection of cTnI was also carried out in a human serum-spiked solution to validate the clinical availability of the sandwich assay. 444

Talanta 165 (2017) 442–448

H. Jo et al.

Fig. 3. Application of the SPCE to detect cTnI. (A) Cyclic voltammograms for cTnI-treated SPCE and Tro6 aptamer-treated SPCE. (B) Optimization of the applied potential for chronoamperometry. Incubation time for all incubations was set as 20 min.

Fig. 4. Optimization of various parameters. (A) Incubation time for interaction between capture probe (Tro4 aptamer) and cTnI. Incubation time for interaction between cTnI and detecting probe (Tro6 aptamer) was set as 20 min. (B) Incubation time for interaction between cTnI and detecting probe (Tro6 aptamer). Incubation time for interaction between capture probe (Tro4 aptamer) and cTnI was set as 20 min. (C) Optimization of pH. (D) Optimization of concentration of detecting probe (Tro6 aptamer).

greater than 98%. In addition, AuNPs were synthesized using sodium citrate and sodium borohydride, and characterized via TEM imaging, dynamic light scattering (DLS), ultraviolet-visible spectroscopy, and zeta potential measurements. Synthesized AuNPs exhibited quite uniform globular shape (Fig. S2A). The average size of particles was demonstrated via DLS (Fig. S2B, 5.67 ± 0.36 nm). Furthermore, the surface charge of AuNPs was measured as −3.91 ± 0.81 mV, indicating that the AuNPs were homogeneously well synthesized. In addition, as

3. Results and discussion 3.1. Design of sandwich aptamer-based detection system for cTnI Prior to the fabrication of aptasensor, recombinant cTnI and AuNPs were freshly prepared. cTnI was overexpressed utilizing a bacterial expression system and purified via fast protein liquid chromatography. As shown in Fig. S1, its purity was analyzed by SDS-PAGE and was

445

Talanta 165 (2017) 442–448

H. Jo et al.

amine and the TTCA's carboxylic acid. The O1s spectra also displayed the C–O–H bond peak at 532.1 eV and the C˭O bond peak at 530.9 eV. In particular, the C˭O bond peak was only present in the aptamermodified SPCE, because of the amide bond. These results demonstrate that consecutive modifications were successfully carried out and the SPCE-aptasensor was well fabricated.

3.2. Various optimizations for detection of cTnI Chronoamperometry is a valuable diagnostic tool due to its simplicity, rapid response, and high precision. Since hydrazine has various benefits for amperometry, such as a low molecular weight, low cost, and high stability, it has been frequently applied to many fields as an electrocatalyst for the reduction of H2O2 [33]. In this study, the amperometric detection of cTnI was achieved on the basis of electrocatalytic signals from hydrazine and H2O2. The introduction of hydrazine to capture aptamer was validated by the hydrazine-specific amperometric signal. The cyclic voltammogram of the protein-treated SPCE exhibited a higher current than that of the detecting aptamer-treated SPCE, implying that sandwich aptamer detection was accomplished via a specific interaction between aptamers and cTnI (Fig. 3A). Tro4 and Tro6 aptamers exhibit bivalent binding capacity toward cTnI, indicating that each aptamer is bound to different binding pockets of target molecule (data not shown). For the effective amperometric analysis, the applied voltage for the detection was also optimized and determined as −600 mV (Fig. 3B). Based on the amperometric signal at −600 mV, several parameters such as incubation time, pH, and concentration of aptamer were optimized. First of all, incubation time for interaction between capture probe (Tro4 aptamer) and cTnI was tested while incubation time for interaction between cTnI and detecting probe (Tro6 aptamer) was set as 20 min. As shown in Fig. 4A, there was no remarkable increase in signal after 5 min. Therefore, incubation time for Tro4 aptamer and cTnI was determined as 5 min. Incubation time for interaction between cTnI and Tro6 aptamer was fixed as 5 min in the same manner (Fig. 4B). Since pH could influence the interaction between aptamers and cTnI, the detection was carried out in various pH conditions (Fig. 4C). The high current was observed around pH 7.5, suggesting that PBS buffer is appropriate for the detection of cTnI. Furthermore, the concentration of detecting probe (Tro6 aptamer) was optimized. Even though there was additional increase after 300 nM, the concentration of Tro6 aptamer was set as 500 nM for sufficient incubation and good reproducibility (Fig. 4D). These optimized conditions were applied to further detection of cTnI.

Fig. 5. Calibration curve for cTnI in PBS. The inset represents amperometric response for Tro6 aptamer (cTnI: cTnI-treated SPCE; Tro6 aptamer: Tro6-treated SPCE).

represented in Fig. S2C, AuNPs showed the maximum absorption peak at 510.5 nm, which coincides with the previous result [27]. It is well known that AuNP-deposition enables the extension of dynamic range because of large surface area. Also, TTCA is a valuable candidate as immobilization matrix of biomolecules since it has carboxyl acid groups and exhibits good electrical properties [31]. Therefore, these modifications were applied to this work, and each modification step was confirmed using CV, EIS, and XPS (Fig. 2). In the case of CV, whereas AuNP-deposited and TTCA-functionalized SPCEs exhibited a higher current than the bare SPCE, immobilization of the Tro4 aptamer resulted in a CV current decrease (Fig. 2A). AuNPs and TTCA increase the active surface and the electrical conductivity, respectively; however, the aptamer inhibits electron transfer between electrode and solution [32]. Similar observations are also made on the EIS results (Fig. 2B). EIS is beneficial to monitor specific interactions between immobilized probes on the electrode and analytes in a solution. Changes in the electron transport are recorded as a Nyquist plot and conductivity extents are expressed as charge transfer resistance (Rct) values, the diameters of the semicircles in the Nyquist plot. Serial modification of AuNPs and TTCA resulted in a decrease in the Rct values, but the introduction of the aptamer increased the surface resistance slightly. Furthermore, the electrode surfaces of each modification were thoroughly scrutinized by XPS (Fig. 2C). In C1s peak spectra, although the C–C and C–H bond peaks at 284.6 eV were represented in all types of SPCEs, the C˭O bond peak at 287.8 eV appeared in only polymer-modified SPCEs. Furthermore, a new peak was shown at 285.7 eV due to the amide bond between the aptamer's

Fig. 6. (A) Specificity test for the SPCE (BSA: bovine serum albumin; HSA: human serum albumin; IL: interleukin; CD: cluster of differentiation). Each protein was applied to the sensor at a concentration of 50 pM. (B) Calibration curve for cTnI in human serum-spiked solution.

446

Talanta 165 (2017) 442–448

H. Jo et al.

Although there are some problems, such as the control of homogeneous surface modifications and mass production, the development of POCT devices will be successfully accomplished. It is expected that the developed SPCE-based POCT sensor using aptamer and hydrazine will be a valuable diagnostic platform for numerous diseases including AMI.

3.3. Confirmation of analytical performance of designed aptasensor After optimizing several parameters, the quantification of cTnI was conducted by chronoamperometry and the calibration curve for cTnI was constructed using amperometric signals at 3 s (Fig. 5). The inset shows the current increase caused by hydrazine. We observed a good linear relationship between the cTnI concentration and the chronoamperometric signal, with a high squares of the correlation coefficients greater than 0.98. The developed SPCE sensor demonstrated outstanding analytical performance with a relatively wide dynamic range of 1–100 pM (0.024–2.4 ng/mL) and a detection limit of 1.0 pM (24 pg/mL). This detection limit is much lower than the existing cTnI cutoff levels, which are 70 pg/mL and 400 pg/mL for the 99th percentile and the clinical cutoff values, respectively [34,35]. Therefore, this SPCE is readily applicable to detect and quantify cTnI.

Acknowledgements This research was supported by a grant from the Korea Health Technology R & D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Republic of Korea (grant number: HI12C1852 and HI15C2900). Appendix A. Supplementary material

3.4. Verification of specificity and clinical applicability of developed aptasensor

Supplementary data associated with this article can be found in the online version at doi:10.1016/j.talanta.2016.12.091.

Excellent selectivity is indispensable for target-specific biosensors. The specificity of the fabricated aptasensor toward cTnI was evaluated using commercially available proteins, such as BSA, HSA, IL-13R, IL5R, CD4, CD166, and lysozyme (50 pM). Since the aptamer selectivity was already substantiated in the previous work [20], a detail discussion on this subject is beyond the scope of the present study. As displayed in Fig. 6A, whereas the current increased in the case of cTnI, noticeable current fluctuations were not observed for other control proteins. This result suggests that the newly designed aptasensor can detect only cTnI with great selectivity. To prove the clinical applicability of the sensor, the SPCE was applied to the quantification of cTnI in a human serum-added solution. Commercially available human serum (human male AB plasma, SigmaAldrich) was diluted 10-fold with PBS and various concentrations of cTnI ranging from 1.0 to 100 pM were spiked in this solution. A linear correlation is observed between the concentration of cTnI and the signals (Fig. 6B) with a high squares of the correlation coefficients over 0.98, and a good linear range of 1–100 pM. This result is in accordance with those obtained under buffer conditions, and the detection limit is lower than the existing cutoff values. Even though this measurement was carried in only serum-spiked solution, it is meaningful that direct comparison of detection limit with those of other commercially available POCT kits. Several immunoassay-based POCT kits for cTnI have been utilized, and exhibit good detection limits toward serum samples: 0.05 ng/mL for Cardiac Triple (NanoEnTek, Seoul, South Korea), 1 ng/mL for Troponin I Rapid Card (NanoEnTek, South Korea), 0.3 ng/mL for Elecsys Troponin I assay (Roche, Basel, Switzerland), 0.1 ng/mL for ichromα™ Tn-I (boditech, Gang-won-do, South Korea), and 1.5 ng/mL for lifeSign MI (PBM, NJ, USA). The developed aptamer-based detections system represents pretty good detection limit (0.024 ng/mL) compared to other kits. Above all things, our system has superiority in cost, stability, and novelty. Consequently, the newly designed SPCE aptasensor is considered suitable to evaluate cTnI for the sensitive and selective diagnosis of AMI.

References [1] P.B. Luppa, C. Muller, A. Schlichtiger, H. Schlebusch, Point-of-care testing (POCT): current techniques and future perspectives, Trends Anal. Chem. 30 (6) (2011) 887–898. [2] Y. Xia, J. Si, Z. Li, Fabrication techniques for microfluidic paper-based analytical devices and their applications for biological testing: a review, Biosens. Bioelectron. 77 (2016) 774–789. [3] S.K. Vashist, P.B. Luppa, L.Y. Yeo, A. Ozcan, J.H. Luong, Emerging Technologies for Next-Generation Point-of-Care Testing, Trends Biotechnol. 33 (2015) 692–705. [4] M. Li, Y.T. Li, D.W. Li, Y.T. Long, Recent developments and applications of screenprinted electrodes in environmental assays–a review, Anal. Chim. Acta 734 (2012) 31–44. [5] E. Sanchez-Tirado, G. Martinez-Garcia, A. Gonzalez-Cortes, P. Yanez-Sedeno, J.M. Pingarron, Electrochemical immunosensor for sensitive determination of transforming growth factor (TGF) - beta1 in urine, Biosens. Bioelectron. 88 (2017) 9–14. [6] A.S. Afonso, C.V. Uliana, D.H. Martucci, R.C. Faria, Simple and rapid fabrication of disposable carbon-based electrochemical cells using an electronic craft cutter for sensor and biosensor applications, Talanta 146 (2016) 381–387. [7] Y. Zhu, W. Choon, A. Koh, Y.B. Shim, An amperometric immunosensor for IgG based on conducting polymer and carbon nanotube-linked hydrazine label, Electroanalysis 22 (2010) 2908–2914. [8] D. Talarico, F. Arduini, A. Amine, I. Cacciotti, D. Moscone, G. Palleschi, Screenprinted electrode modified with carbon black and chitosan: a novel platform for acetylcholinesterase biosensor development, Anal. Bioanal. Chem. 408 (2016) 7299–7309. [9] M. Pawula, Z. Altintas, I.E. Tothill, SPR detection of cardiac troponin T for acute myocardial infarction, Talanta 146 (2016) 823–830. [10] D.X. Zhang, Y. Wang, S.B. Yu, H. Niu, X.J. Gong, X. Miao, Serum relaxin levels as a novel biomarker for detection of acute myocardial infarction, Int. J. Clin. Exp. Med. 8 (2015) 16937–16940. [11] M. Rubini Gimenez, R. Twerenbold, T. Reichlin, K. Wildi, P. Haaf, M. Schaefer, C. Zellweger, B. Moehring, F. Stallone, S.M. Sou, M. Mueller, K. Denhaerynck, T. Mosimann, M. Reiter, B. Meller, M. Freese, C. Stelzig, I. Klimmeck, J. Voegele, B. Hartmann, K. Rentsch, S. Osswald, C. Mueller, Direct comparison of highsensitivity-cardiac troponin I vs. T for the early diagnosis of acute myocardial infarction, Eur. Heart J. 35 (2014) 2303–2311. [12] G.J. Kost, N.K. Tran, Point-of-Care Testing and Cardiac Biomarkers: the Standard of Care and Vision for Chest Pain Centers, Cardiol. Clin. 23 (2005) 467–490. [13] G. Kocak, A. Azak, B. Huddam, F. Yalcin, B. Guven, M. Can, M. Duranay, Influence of intraperitoneal volume on QT dispersion in patients with continuous ambulatory peritoneal dialysis: acute cardiac impact of peritoneal dialysis, Ren. Fail 33 (2011) 568–571. [14] D. Proske, M. Blank, R. Buhmann, A. Resch, Aptamers–basic research, drug development, and clinical applications, Appl. Microbiol. Biotechnol. 69 (2005) 367–374. [15] K.M. Song, S. Lee, C. Ban, Aptamers and their biological applications, Sensors (Basel) 12 (2012) 612–631. [16] H. Jo, C. Ban, Aptamer-nanoparticle complexes as powerful diagnostic and therapeutic tools, Exp. Mol. Med. 48 (2016) e230. [17] R.Y. Lai, K.W. Plaxco, A.J. Heeger, Aptamer-based electrochemical detection of picomolar platelet-derived growth factor directly in blood serum, Anal. Chem. 79 (2007) 229–233. [18] Y. Xiao, A.A. Lubin, A.J. Heeger, K.W. Plaxco, Label-free electronic detection of thrombin in blood serum by using an aptamer-based sensor, Angew. Chem. Int. Ed. Engl. 44 (2005) 5456–5459. [19] A.E. Radi, J.L. Acero Sanchez, E. Baldrich, C.K. O'Sullivan, Reagentless, reusable, ultrasensitive electrochemical molecular beacon aptasensor, J. Am. Chem. Soc. 128

4. Conclusions In this work, we have designed a sandwich aptamer-based SPCE for a highly sensitive and selective detection of cTnI, an assuring biomarker for AMI. To our knowledge, this is the first try to developing an aptamer-based POCT sensor for AMI. Each modification process was monitored utilizing CV, impedance, and XPS, and the fabricated aptasensor was applied to the detection of cTnI in a buffer as well as in a serum-supplemented solution. This sensor showed extraordinary analytical performance and remarkable specificity toward cTnI. Through cooperation with a company, we have made an effort to develop a chronoamperometric POCT device for the diagnosis of AMI. 447

Talanta 165 (2017) 442–448

H. Jo et al.

(2008) 1969–1974. [28] D.M. Kim, Y.B. Shim, Disposable amperometric glycated hemoglobin sensor for the finger prick blood test, Anal. Chem. 85 (2013) 6536–6543. [29] H.J. Kim, K.S. Lee, M.S. Won, Y.B. Shim, Characterization of protein-attached conducting polymer monolayer, Langmuir 24 (2008) 1087–1093. [30] G.T. Hermanson, Bioconjugate techniques, third edition, Elsevier/AP, London, Waltham, MA, 2013. [31] M.A. Rahman, N.H. Kwon, M.S. Won, E.S. Choe, Y.S. Shim, Functionalized conducting polymer as an enzyme-immobilizing substrate: an amperometric glutamate microbiosensor for in vivo measurements, Anal. Chem. 77 (2005) 4854–4860. [32] Z. Chen, L. Li, H. Zhao, L. Guo, X. Mu, Electrochemical impedance spectroscopy detection of lysozyme based on electrodeposited gold nanoparticles, Talanta 83 (2011) 1501–1506. [33] M.A. Rahman, M.S. Won, Y.B. Shim, The potential use of hydrazine as an alternative to peroxidase in a biosensor: comparison between hydrazine and HRPbased glucose sensors, Biosens. Bioelectron. 21 (2005) 257–265. [34] S. Altinier, M. Mion, A. Cappelletti, M. Zaninotto, M. Plebani, Rapid measurement of cardiac markers on stratus CS, Clin. Chem. 46 (2000) 991–993. [35] J.P. Chapelle, M.C. Aldenhoff, L. Pierard, J. Gielen, Comparison of cardiac troponin I measurements on whole blood and plasma on the stratus CS analyzer and comparison with AxSYM, Clin. Chem. 46 (2000) 1864–1866.

(2006) 117–124. [20] H. Jo, H. Gu, W. Jeon, H. Youn, J. Her, S.K. Kim, J. Lee, J.H. Shin, C. Ban, Electrochemical aptasensor of cardiac troponin I for the early diagnosis of acute myocardial infarction, Anal. Chem. 87 (2015) 9869–9875. [21] K.R. Davies, A.W. Gelb, P.H. Manninen, D.R. Boughner, D. Bisnaire, Cardiac function in aneurysmal subarachnoid haemorrhage: a study of electrocardiographic and echocardiographic abnormalities, Br. J. Anaesth. 67 (1991) 58–63. [22] A. Maznyczka, T. Kaier, M. Marber, Troponins and other biomarkers in the early diagnosis of acute myocardial infarction, Postgrad. Med. J. 91 (2015) 322–330. [23] J.W. Choi, K.W. Oh, J.H. Thomas, W.R. Heineman, H.B. Halsall, J.H. Nevin, A.J. Helmicki, H.T. Henderson, C.H. Ahn, An integrated microfluidic biochemical detection system for protein analysis with magnetic bead-based sampling capabilities, Lab Chip 2 (2002) 27–30. [24] R. Pallela, P. Chandra, H.B. Noh, Y.B. Shim, An amperometric nanobiosensor using a biocompatible conjugate for early detection of metastatic cancer cells in biological fluid, Biosens. Bioelectron. 85 (2016) 883–890. [25] G. Bhanjana, N. Dilbaghi, S. Chaudhary, K.H. Kim, S. Kumar, Robust and direct electrochemical sensing of arsenic using zirconia nanocubes, Analyst 141 (2016) 4211–4218. [26] T.Y. Lee, Y.B. Shim, S.C. Shin, Simple preparation of terthiophene-3′-carboxylic acid and characterization of its polymer, Synth. Met. 126 (2002) 105–110. [27] S. Pramanik, P. Banerjee, A. Sarkar, S.C. Bhattacharya, Size-dependent interaction of gold nanoparticles with transport protein: a spectroscopic study, J. Lumin. 128

448