Highly thermostable chitinase from pineapple: Cloning, expression, and enzymatic properties

Process Biochemistry 46 (2011) 695–700

Contents lists available at ScienceDirect

Process Biochemistry journal homepage: www.elsevier.com/locate/procbio

Highly thermostable chitinase from pineapple: Cloning, expression, and enzymatic properties Shoko Onaga a , Kohta Chinen b,1 , Susumu Ito b , Toki Taira b,∗ a b

United Graduate School of Agricultural Sciences, Kagoshima University, Kagoshima, Kagoshima 890-0065, Japan Department of Bioscience and Biotechnology, University of the Ryukyus, Nishihara, Okinawa 903-0213, Japan

a r t i c l e

i n f o

Article history: Received 17 September 2010 Received in revised form 23 November 2010 Accepted 23 November 2010 Keywords: Class III chitinase Pineapple Cloning Thermostability Glycoside hydrolase family 18

a b s t r a c t A complementary DNA encoding the thermostable chitinase of pineapple (Ananas comosus), designated PLChiA, was cloned, sequenced, and expressed in Escherichia coli cells. The determined nucleotide sequence of the gene revealed an 882-bp open reading frame that encoded a putative signal sequence (25 amino acids) and a mature protein (268 amino acids, 27,757 Da). Based on the amino acid sequence homology, PLChiA belongs to the class III chitinases in glycoside hydrolase family 18. The recombinant enzyme was purified to homogeneity by a single-step column chromatography. The purified enzyme displayed optimal catalytic activity at pH 3.0 and 70 ◦ C and had a molecular mass of 27.8 kDa on SDS gel. Strikingly, the half-life was more than 5.2 days when heated at pH 7.0 and 75 ◦ C. The half-lives at pH 7.0 were 4.5 h at 80 ◦ C and 27 min at 85 ◦ C. Even at 80 ◦ C, the half-life was 65 min at pH 4.0. Hence, PLChiA is the most thermostable chitinase reported to date from land plants. © 2010 Elsevier Ltd. All rights reserved.

1. Introduction Chitin, a ␤-1,4-linked homopolymer of N-acetyl-d-glucosamine (GlcNAc), is the major structural polysaccharide present in the shells of crustaceans, exoskeletons of insects, and cell walls of fungi. It is the second largest biomass after cellulose [1,2], and the annual production of chitin is estimated to be 1011 tons in the aquatic biosphere alone [3]. Cody et al. [4] emphasized the potential for the bioconversion of chitin into ethanol. The physicochemical properties of chitin and its derivatives (including oligomers) in linked forms are also suited for a wide range of biotechnological applications in the agricultural, food, cosmetics, pharmaceutical, and medical industries. Currently, chitin polymers and/or oligomers are used as immunoadjuvants, flocculants of wastewater sludge, agrochemicals, and dietary fiber, and systems for drug delivery and wound healing [5,6]. GlcNAc has been used as a food supplement [7] and is a precursor of anti-flu, anti-cancer, and anti-inflammatory agents [8]. Chitin oligomers and GlcNAc have been produced from chitins by chemical acid hydrolysis. Alternatively, with respect to envi-

Abbreviations: PLChiA, pineapple leaf chitinase A; GlcNAc, N-acetyl-dglucosamine; GH, glycoside hydrolase; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis. ∗ Corresponding author. Tel.: +81 98 895 8802; fax: +81 98 895 8802. E-mail address: [email protected] (T. Taira). 1 Present address: Soil and Environment Section, Okinawa Prefectural Agricultural Research Center, Itoman, Okinawa 901-0336, Japan. 1359-5113/$ – see front matter © 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.procbio.2010.11.015

ronmental compatibility, low cost, and reproducibility, enzymatic hydrolysis of chitin has become more promising in recent years [9]. However, the discovery of a chitinase (EC 3.2.1.14) with high hydrolytic activity and high thermal stability is prerequisite for enzymatic production of bioactive oligomers from chitin. Chitinases are found in a wide variety of organisms, including bacteria, fungi, archea, plants, insects, and animals. Plant chitinases are basically divided into five groups, classes I through V, based on their amino acid sequences [10,11]. According to the classification of glycoside hydrolase (GH) family by Henrissat and Davies [12], class I, II, and IV chitinases are included in GH family 19, and class III and V enzymes are included in GH family 18. Most plant chitinases have an N-terminal signal sequence for transportation to the endoplasmic reticulum. Several class I chitinases have a C-terminal extension, which targets the vacuole [13]. Pineapple (Ananas comosus) is a plant with crassulacean acid metabolism [14], which may be evolutionally adapted to and thrive under extreme environments, including strong UV light, high temperature, and low humidity. Three chitinases from pineapple leaf, designated PL Chi-A, -B, and -C, have been purified and well characterized [15]. Here we report on the cloning and sequencing of the complementary DNA (cDNA) of PL Chi-A (hereafter named PLChiA) which is distributed in all pineapple tissues, including the fruit [16] and on a simple purification procedure for recombinant PLChiA expressed in Escherichia coli cells. We also examined the thermostability of the enzyme under various heating conditions for the evaluation of versatile industrial applications.

696

S. Onaga et al. / Process Biochemistry 46 (2011) 695–700

2. Materials and methods 2.1. Materials Leaves of pineapple (A. comosus cv. N67-10) were harvested at the Nago Agricultural Experiment Station (Okinawa, Japan). Native PLChiA was prepared as described previously [15]. Chitin was purchased from Seikagaku Kogyo (Tokyo, Japan). Glycol chitin used for the enzyme assay was prepared by the method of Yamada and Imoto [17]. E. coli Origami (DE3) cells and expression vector pET-22b were purchased from Novagen. All other reagents were of analytic grade. 2.2. Analysis of internal amino acid sequence by trypsin digestion After native PLChiA was digested with trypsin, the amino acid sequences of two of the fragments formed were determined by Edman degradation coupled with a protein sequencer (Model PPSQ; Shimadzu, Japan). They were YGGIMLWNR and YYDVQNGYSA, and the latter was used to design primer P2 for polymerase chain reaction (PCR) (see Table 1). 2.3. cDNA cloning The sequences of primers used are presented in Table 1. Total RNA was isolated from leaves of A. comosus using an RNeasy kit (Qiagen). First-strand cDNA was synthesized with 5 ␮g of total RNA using a GeneRacer kit (Invitrogen) and an oligo(dT) adapter primer. The resultant cDNA was used as a template with degenerate primers for PCR. The first PCR was performed with forward primer P1 (designed on the basis of the N-terminal amino acid sequence of purified PLChiA, Ile3–Gly8) and reverse primer P2 (Tyr254–Gly259), and nested PCR with forward primer P3 (designed on the basis of the N-terminal sequence of purified PLChiA, Gln9–Gly14) and the reverse primer P2. The nested PCR products were then cloned into a pGEM-T vector (Promega) and sequenced using the ABI Prism system (Model 3130, Applied Biosystems). The full-length cDNA of PLChiA was obtained by rapid amplification of cDNA ends (RACE) and PCR procedures with a GeneRacer kit, according to the manufacturer’s instructions. The gene-specific primers P4 (first PCR) and P5 (nested PCR) were used for the 5 RACE and the gene-specific primers P6 (first PCR) and P7 (nested PCR) for the 3 RACE. Finally, a 1177-bp cDNA fragment that included the coding region of PLChiA was PCR-amplified using forward primer P8 (designed from the 5 RACE product) and reverse primer P9 (designed from the 3 RACE product). The sequences of the resultant PCR products were analyzed as mentioned above.

removed by centrifugation at 10,000 × g for 15 min, the supernatant was again dialyzed against 10 mM sodium acetate buffer (pH 5.0) at 4 ◦ C overnight. The retentate was applied to a column of Mono-Q (0.5 cm × 5 cm; GE Healthcare) equilibrated with the same buffer. The column was washed with the equilibration buffer, and adsorbed proteins were eluted with a linear gradient of NaCl from 0 to 0.2 M in the buffer in a total volume of 20 ml (the elution profile is shown in Supplementary Fig. 1). The active fractions, which showed a single band of protein by SDS-PAGE, were combined and used as a final preparation of purified enzyme. 2.6. Electrophoresis SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was done by the method of Laemmli [18] using a 12.5% (w/v) acrylamide gel. Proteins in the gel were stained with Coomassie Brilliant Blue R250. The molecular mass was determined using a molecular mass marker kit (Fermentas). 2.7. Assay of chitinase activity Chitinase activity was measured routinely with glycol chitin as the substrate. Ten microliters of suitably diluted enzyme solution was added to 250 ␮l of 0.2% (w/v) glycol chitin in 0.1 M glycine–HCl buffer (pH 3.0). After incubation at 60 ◦ C for 15 min, the reducing power of the reaction mixture was measured by the color reaction with the ferri-ferrocyanide reagent [19]. One unit of enzyme activity was defined as the amount of enzyme that released 1 ␮mol of GlcNAc per min. The kinetic parameter values were estimated by the conventional double reciprocal plot method. The pH and thermal stabilities of the enzymes were assessed by measuring the residual activities after incubation in 10 mM buffers at various pH values and at various temperatures for appropriate lengths of time. Their residual activities were measured under the standard conditions of enzyme assay. Protein concentrations were measured with a BCA protein assay kit (Thermo Fisher Scientific) with bovine serum albumin as the standard. 2.8. Nucleotide sequence accession number The gene sequence data of PLChiA has been submitted to the DDBJ/EMBL/ GenBank DNA databases under the accession no. AB438977.

3. Results and discussion

2.4. Plasmid construction Recombinant mature PLChiA (Gly1–Val268) was expressed in E. coli cells. The corresponding cDNA region was PCR-amplified using PLChiA cDNA as the template with forward primer P10 and reverse primer P11, which contained NdeI and BamHI recognition sites, respectively. The amplified DNA fragment was digested with NdeI and BamHI and ligated into an expression vector pET-22b previously digested with the same enzymes. The construct obtained was designated pET-PLChiA. 2.5. Expression and purification of recombinant PLChiA pET-PLChiA was introduced into E. coli Origami (DE3). The transformant was then cultivated at 37 ◦ C in Luria–Bertani broth (200 ml) supplemented with ampicillin (100 ␮g/ml) to an absorbance at 600 nm of 0.6, and incubation was continued at 18 ◦ C for 24 h in the presence of 0.1 mM isopropyl-␤-d-thiogalactopyranoside. The expressed protein was detected as both soluble and insoluble forms inside the cells. The cells were harvested by centrifugation, suspended in 20 mM Tris–HCl buffer (pH 7.5), and disrupted with a sonicator. After cell debris was removed by centrifugation (10,000 × g, 10 min), the supernatant obtained was dialyzed against 10 mM sodium acetate buffer (pH 4.0) at 4 ◦ C overnight. After the insoluble proteins formed were

3.1. Cloning and sequence of PLChiA cDNA The full-length PLChiA cDNA consisted of 1177 nucleotides and encoded an open reading frame of 293 amino acid residues, as shown in Fig. 1. The N-terminal sequence (Gly1–Cys20) of the purified native protein was found in the amino acid sequence deduced from the open reading frame of the cDNA. Thus, the N-terminal 25 amino acids of purified protein were suggested to be a signal peptide, being consistent with the theoretical signal peptide Met(-25)–Gly(-1) predicted using the SignalP server (http://www.cbs.dtu.dk/services/SignalP/). Therefore, the remaining 268 amino acids (Gly1–Val268) were considered to constitute the mature PLChiA protein. Theoretical values of molecular mass and isoelectric point of the mature enzyme were calculated to be 27,757 Da and pH 4.25, respectively, when using the ExPASy server (http://www.expasy.ch/tools/pi tool.html).

Table 1 Primers for PCR, RACE, and expression. Primer

Sequence (5 → 3 )

P1a P2a P3a P4 P5 P6 P7 P8 P9 P10b P11b

ATHGCNGTNTAYTGGGC TARTANCKRTTCCANARCAT CARAAYGGNAAYGARGG GGCGAGGTCATCATAGTGGG GTTCCACAGGTAGTCGGCGAC GCCCACTATGATGACCTCGC CTCAGTGCGTGTACCCTGAC AATGGCCTACAAGAAGCCT CATCTGAAATCCCACAGATG CATATGGGCAGCATTGCCGTGTACTG GGATCCTCACACGCTGCCATGGAC

a

Degenerate primers. Single and double underlines indicate NdeI and BamHI restriction sites, respectively. b

3.2. Homology of PLChiA with reported chitinases The deduced amino acid sequence of PLChiA (BAG38685) exhibited moderate homology to those of class III chitinases in plants of GH family 18. For example, it shared homology to those of bamboo (Bambusa oldhamii) with 73% (ABW75909) [20], rice (Oryza sativa Japonica) with 68% (BAA77605), soybean seed (Glycine max (L.) Merr.) with 67% (BAA77676) [21], barrel medic root (Medicago truncatula) with 65% (AAQ21404) [22], winged bean (Psophocarpus tetragonolobus) with 64% (BAA08708) [23], azuki bean (Vigna angularis) with 64% (BAA01948) [24], and Koshu grape leaf (Vitis vinifera cv. Koshu) with 64% (BAC65326) [25] identities. Based on the amino acid sequence homology, we concluded that PLChiA belongs to the group of class III chitinase in GH family 18.

S. Onaga et al. / Process Biochemistry 46 (2011) 695–700

697

Fig. 1. Nucleotide and deduced amino acid sequences of PLChiA. Amino acid residues are shown in the single-letter codes beneath the corresponding codons of the nucleotide sequence. The N-terminal amino acid sequence of the purified native enzyme [15] is underlined. The two internal amino acid sequences of tryptic digests, YGGIMLWNR and YYDVQNGYSA, are indicated by dotted underlines. The asterisk (*) indicates the stop codon TGA.

3.3. Alignment of PLChiA with hevamine Mature PLChiA showed 65% amino acid identity to hevamine from Hevea brasiliensis, an enzyme with lysozyme/chitinase activity, of known structure (a (␤/␣)8 fold, PDB code 2HVM; GenBank accession no. AAB19633) [26]. As judged by secondary structure prediction and alignment with hevamine, PLChiA appeared to have a (␤/␣)8 core structure, as shown in Fig. 2. The conserved six Cys residues at positions 20, 50, 57, 67, 154, and 183 (in PLChiA numbering) were suggested to form three intramolecular disulfide bonds between Cys20 and Cys67, Cys50 and 57, and Cys154 and Cys183, all of which are conserved in the crystal structure of hevamine [27]. The consensus sequence, DXDXE, conserved in GH family 18 chitinases [28], also locates as DFDIE at positions from 123 to 127 in both

sequences, where Glu127 (like hevamine) is a putative catalytic residue in the active site [26,29]. 3.4. Physicochemical and catalytic properties of recombinant PLChiA The molecular masses of purified native and recombinant enzymes were determined by SDS-PAGE to be 27.8 kDa, both values very close to the 27,757 Da deduced from the amino acid sequence of the native enzyme, as shown in Fig. 3. The purified enzyme obtained from a 200-ml culture was 818 ␮g with an overall yield of 79.4%. The Km and Vmax values toward glycol chitin were 0.703 mg/ml and 1060 units/mg for the native enzyme and those of the recombinant enzyme were

Fig. 2. Amino acid sequence alignment of PLChiA and hevamine. The deduced amino acid sequence of mature PLChiA was suitably aligned with that of hevamine of known structure (2HVM) [26]. The conserved residues are indicated by stars beneath the two sequences. The secondary structure of PLChiA was predicted using the NPSA server (SOPMA) (http://npsa-pbil.ibcp.fr/cgi-bin/npsa automat.pl?page=/NPSA/npsa sopma.html). The structural elements, ␣-helices (solid lines, ␣1–␣8) and ␤-strands (dotted lines, ␤1–␤8), of the enzymes are shown above the respective sequence. Boxed C indicates conserved cysteine residues, which may form disulfide bonds in class III plant chitinases. The conserved DXDXE motif found only in GH family 18 enzymes is also boxed, and the Glu in the box indicated by closed triangle is the putative catalytic residue in the active site.

S. Onaga et al. / Process Biochemistry 46 (2011) 695–700

A

Relative activity (%)

698

100 80 60 40 20 0 0

20

40

60

80

100

B

Fig. 3. SDS-PAGE of native and recombinant enzymes. Lane M, standard marker proteins (in kDa); lane 1, 0.8 ␮g of native enzyme; lane 2, 0.8 ␮g of recombinant enzyme.

80 60 40 20 0

1

3

5

7

9

11

13

Fig. 4. Profiles of temperature- and pH-activity curves of native and recombinant enzymes. Closed (䊉) and open () circles indicate the results of native and recombinant enzymes, respectively. (A) The effect of temperature on activity was examined after incubation for 15 min in 0.1 M glycine–HCl buffer (pH 3.0). The values are shown as percentages of the maximal activity observed at 70 ◦ C for each enzyme, which is taken as 100%. (B) The effect of pH on activity was examined after incubation at 37 ◦ C for 15 min in 0.1 M buffers. The buffers used were as follows: HCl, pH 1.0; glycine–HCl, pH 2 and 3; sodium acetate, pH 4 and 5; sodium phosphate, pH 6 and 7; Tris–HCl, pH 8 and 9; glycine–NaOH, pH 10–12. The values are shown as percentages of the maximum activity observed at pH 3.0 for each enzyme, which is taken as 100%.

A

3.5. Effects of temperature and pH on activity and stability

100 80 60 40 20 0

0

20

40

60

80

100

Temperature (ºC)

B Residual activity (%)

The optimal temperature and pH for activity of recombinant PLChiA were 70 ◦ C and 3.0, respectively, values identical to those of native enzyme, as shown in Fig. 4. Further, profiles of the temperature- and pH-activity curves coincided well with those of the native enzyme. Most chitinases reported so far have optimal activity at 20–50 ◦ C and are not stable at high temperatures (more than 55 ◦ C) [33]. Many researchers have reported that temperature optima of thermophilic (thermostable) enzymes are generally higher than those of mesophilic enzymes, possibly due to stiff structures that stay folded at higher temperatures than those of mesophilic enzymes [34,35]. Consequently, native and recombinant PLChiA with high optimal temperatures were found to be notably stable up to 70 ◦ C after heating at pH 7.0 for 1 h, as shown in Fig. 5A. Even after heating at 80 ◦ C, both enzymes retained more than 75% of their original activity. Further, both enzymes were stable between pH 3 and pH 12 after incubation at 37 ◦ C for 24 h (Fig. 5B). Then, we further examined the thermostability of recombinant PLChiA. The enzyme retained almost full original activity after a 5-h incubation at 75 ◦ C and at pH 7.0, as shown in Fig. 6A. Strikingly, the half-life at 75 ◦ C and pH 7.0 was determined to be 5.2 days (see the inset of Fig. 6A). At pH 7.0, the half-lives at 80 ◦ C and 85 ◦ C were 4.5 h and 27 min, respectively, as calculated from the data shown in Fig. 6A. When the thermostability of PLChiA was examined at 60 ◦ C, the half-lives were about 3.5 h both at pH 3.0 and at pH 4.0 (Fig. 6B). Even at 80 ◦ C, the half-lives were shown to be about 4.8 min at pH 3, 65 min at pH 4.0, and 4.4 h at pH 7.0 (Fig. 6C). These results indicate

100

pH

Residual activity (%)

0.673 mg/ml and 983 units/mg, respectively. The cleavage patterns of chitin oligomers [(GlcNAc)4 , (GlcNAc)5 , and (GlcNAc)6 ] by the recombinant PLChiA were found to be essentially the same as those reported for the native enzyme [15] (Supplementary Fig. 2). Also, the other catalytic properties of the recombinant enzyme were essentially similar to those of the native enzyme [15]. Oligosaccharides of glycoenzymes are frequently reported to affect their secretion efficiency, molecular weight, protein folding, water solubility, proteolytic digestibility, thermostability, and kinetic parameters [30–32]. However, neither differences in molecular weight and specific activity between native and recombinant enzymes nor N-glycosylation site Asn-X-Ser/Thr (where X is any amino acid except Pro) predicted using the NetNGlyc 1.0 server (http://www.cbs.dtu.dk/services/NetNGlyc/) were found in native PLChiA which is negative to the Periodic acid-Schiff staining [15].

Relative activity (%)

Temperature (ºC)

100 80 60 40 20 0

1

3

5

7

9

11

13

pH Fig. 5. Effects of temperature and pH on stability of native and recombinant enzymes. Closed (䊉) and open () circles indicate the results of native and recombinant PLChiA, respectively. (A) The thermal stability was examined by measuring residual activity after incubation in 10 mM sodium phosphate buffer (pH 7.0) for 1 h. The original activity is taken as 100% for each. (B) The pH stability was assessed by measuring residual activity after incubation at 37 ◦ C for 24 h in buffers with various pH values. The original activity is taken as 100% for each.

that the thermostability of PLChiA is much greater at neutral pH than at acidic pH. Thus, the thermostability of PLChiA is greater than those of other plant chitinases reported in the literature, as summarized in Table 2.

S. Onaga et al. / Process Biochemistry 46 (2011) 695–700

699

Table 2 Thermostabilities of plant chitinases. Plant

Optimal temperature (◦ C)

Optimal pH

A. comosus (PLChiA)

3.0

70

Vitis vinifera cv. Koshu Arachis hypogaea L. Phaseolus limensis Banbusa oldhamii Phaseolus vulgaris Chondrus verrucosus (Chi B)

4.0 5.4 5.4 4.0 5.4 2.0

40 40–50 40–50 70 40–55 80

a b

Thermostability a

◦

4.5 h (80 C, pH 7.0) >5.2 daysa (75 ◦ C, pH 7.0) 3.5 ha (60 ◦ C, pH 3.0) 100%b (40 ◦ C, pH 4.0, 1 h) 36%b (60 ◦ C, pH 5.4, 1 h) 20%b (60 ◦ C, pH 5.4, 30 min) <88%b (70 ◦ C, pH 4.0, 30 min) 100%b (58 ◦ C, pH 5.4, 30 min) 100%b (70 ◦ C, pH 4.5, 1 h)

Reference This study

[25] [36] [37] [20] [38] [39]

Half-life under the conditions in parenthesis. Residual activity (percentage of initial activity) after heating under the conditions in parenthesis.

PLChiA appears to be the most thermostable when compared with the reported land plant chitinases from, for example, Koshu grape leaf (V. vinifera cv. Koshu) [25], peanut (Arachis hypogaea L.) [36], lima bean (Phaseolus limensis) [37], bamboo (B. oldhamii) [20], and Canadian cranberry bean (Phaseolus vulgaris) [38]. Although the heat treatment conditions are different, the thermostability of PLChiA and chitinase-B from the red alga Chondrus verrucosus [39] may be comparable. Almost all the plant chitinases previously reported retain their activities at less than ∼60 ◦ C after a short heating time under defined and limited conditions and, therefore, our

A

0

ln(A/A0)

–1 0

–2

–1

–3

–2

–4

–3

0

2

–5 0

1

2

3

4 Days

4

6

8

5

Incubation time (h)

B

0

results indicate that PLChiA is the most thermostable among them. Although the heating conditions were different, the thermostabilities of fungal and bacterial chitinases are obviously lower than that of PLChiA except for a chitinase from the hyperthermophilic archaeon Thermococcus chitinophagus (half-life = 1 h at 120 ◦ C and pH 7.0) [40]. However, the specific activity of this archaeon is much lower than that of PLChiA, as a possible consequence of overall protein rigidification at extremely high temperature. The reason why the thermostability of PLChiA is greater than those of other plant chitinases has not yet been clarified. Unidentified structural elements may be responsible for the thermostability of this enzyme: for instance, increased numbers of disulfide bonds and salt bridges, hydrogen bonds and aromatic interactions, deletion of exposed loops, and well-packed hydrophobic core structures [41]. We are now crystalizing PLChiA in order to clarify the mechanism(s) of its high thermostability. In summary, this study showed that (1) PLChiA is very thermostable to incubation for long periods in neutral to acidic pH range, (2) a reactor containing all reaction fluids can be sterilized at temperatures between 60 ◦ C and 75 ◦ C without enzyme inactivation, (3) the nonglycosylated enzyme can easily be expressed in E. coli cells on an industrial scale, (4) PLChiA can be purified to homogeneity by very simple procedure, and (5) its intake is safe in that humans and animals have dietary experience with pineapple. Overall, PLChiA is commercially very promising for a wide variety of industrial applications.

ln(A/A0)

–1 –2

Acknowledgments

–3 –4 –5

0

1

2

3

4

5

Incubation time (h)

C

0

Appendix A. Supplementary data

ln(A/A0)

–1

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.procbio.2010.11.015.

–2 –3 –4 –5

This work was supported in part by the Foundation for Research Fellowships of Japan Society for the Promotion of Science for Young Scientists (DC2). We thank M. Takeuchi (Nago Branch, Okinawa Prefectural Agricultural Research Center) for supplying pineapple leaves.

References

0

1

2

3

4

5

Incubation time (h) Fig. 6. Thermostability of recombinant PLChiA. Upper figure (A), thermal stability after heating at 75 ◦ C (䊉), 80 ◦ C () and 85 ◦ C () for the indicated periods in 10 mM sodium phosphate buffer (pH 7.0); middle (B) and lower (C) figures, thermal stability after heating at 60 ◦ C and 80 ◦ C in 10 mM buffers at pH 7.0 (䊉), pH 4 (), and pH 3 (), respectively. The buffers used were the same as those described in Fig. 4. The residual activities were measured under the standard conditions of enzyme assay, with the initial activity (without heating) taken as 100%.

[1] Khor E. Chitin: a biomaterial in waiting. Curr Opin Solid State Mater Sci 2002;6:313–7. [2] Tharanathan RN, Kittur FS. Chitin: the undisputed biomolecule of great potential. Crit Rev Food Sci Nutr 2003;43:61–87. [3] Haki GD, Rakshit SK. Developments in industrial important thermostable enzymes: a review. Bioresour Technol 2003;89:17–34. [4] Cody RM, Davis ND, Lin J, Shaw D. Screening microorganisms for chitin hydrolysis and production of ethanol from aminosugars. Biomass 1990;21:285–95. [5] Usui T, Matsui H, Isobe K. Enzymatic synthesis of useful chito-oligosaccharides utilizing transglycosylation by chitinolytic enzymes in a buffer containing ammonium sulfate. Carbohydr Res 1990;203:65–77.

700

S. Onaga et al. / Process Biochemistry 46 (2011) 695–700

[6] Muzzarelli RA. Human enzymatic activities related to the therapeutic administration of chitin derivatives. Cell Mol Life Sci 1997;53:131–40. [7] Sashiwa H, Fujishima S, Yamano N, Kawasaki N, Nakayama A, Muraki E, et al. Production of N-acetyl-d-glucosamine from alpha-chitin by crude enzymes from Aeromonas hydrophila H-2330. Carbohydr Res 2002;337:761–3. [8] Tao F, Zhang Y, Ma C, Xu P. Biotechnological production and applications of N-acetyl-d-neuraminic acid: current state and perspectives. Appl Microbiol Biotechnol 2010;87:1281–9. [9] Kadokura K, Rokutani A, Yamamoto M, Ikegami T, Sugita H, Itoi S, et al. Purification and characterization of Vibrio parahaemolyticus extracellular chitinase and chitin oligosaccharide deacetylase involved in the production of heterodisaccharide from chitin. Microbiol Biotechnol 2007;75:357–65. [10] Beintema JJ. Structural features of plant chitinases and chitin-binding proteins. FEBS Lett 1994;350:159–63. [11] Taira T. Structure and antifungal activity of plant chitinases. J Appl Glycosci 2010;57:167–76. [12] Henrissat B, Davies G. Structural and sequence-based classification of glycoside hydrolases. Curr Opin Struct Biol 1997;7:637–44. [13] Neuhaus JM, Sticher L, Meins Jr F, Boller T. A short C-terminal sequence is necessary and sufficient for the targeting of chitinases to the plant vacuole. Proc Natl Acad Sci 1991;88:10362–6. [14] Cushman JC. Crassulacean acid metabolism: a plastic photosynthetic adaptation to arid environments. Plant Physiol 2001;127:1439–48. [15] Taira T, Toma N, Ishihara M. Purification, characterization, and antifungal activity of chitinases from pineapple (Ananas comosus) leaf. Biosci Biotechnol Biochem 2005;69:189–96. [16] Taira T, Toma N, Ichi M, Takeuchi M, Ishihara M. Tissue distribution, synthesis stage, and ethylene induction of pineapple (Ananas comosus) chitinases. Biosci Biotechnol Biochem 2005;69:852–4. [17] Yamada H, Imoto T. A convenient synthesis of glycolchitin, a substrate of lysozyme. Carbohydr Res 1981;92:160–2. [18] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–5. [19] Imoto T, Yagishita K. A simple activity measurement of lysozyme. Agric Biol Chem 1971;33:1154–6. [20] Kuo CJ, Liao YC, Yang JH, Huang LC, Chang CT, Sung HY. Cloning and characterization of an antifungal class III chitinase from suspension-cultured bamboo (Bambusa oldhamii) cells. J Agric Food Chem 2008;56:11507–14. [21] Watanabe A, Nong VH, Zhang D, Arahira M, Yeboah NA, Udaka K, et al. Molecular cloning and ethylene-inducible expression of Chib1 chitinase from soybean (Glycine max (L.) Merr.). Biosci Biotechnol Biochem 1999;63:251–6. [22] Elfstrand M, Feddermann N, Ineichen K, Nagaraj VJ, Wiemken A, Boller T, et al. Ectopic expression of the mycorrhiza-specific chitinase gene Mtchit 3-3 in Medicago truncatula root-organ cultures stimulates spore germination of glomalean fungi. New Phytol 2005;167:557–70. [23] Esaka M, Teramoto T. cDNA cloning, gene expression and secretion of chitinase in winged bean. Plant Cell Physiol 1998;39:349–56. [24] Ishige F, Mori H, Yamazaki K, Imaseki H. Cloning of a complementary DNA that encodes an acidic chitinase which is induced by ethylene and expression of the corresponding gene. Plant Cell Physiol 1993;34:103–11.

[25] Ano A, Takayanagi T, Uchibori T, Okuda T, Yokotsuka K. Characterization of a class III chitinase from Vitis vinifera cv. Koshu. J Biosci Bioeng 2003;95: 645–7. [26] Terwisscha van Scheltinga AC, Hennig M, Dijkstra BW. The 1.8 A˚ resolution structure of hevamine, a plant chitinase/lysozyme, and analysis of the conserved sequence and structure motifs of glycosyl hydrolase family 18. J Mol Biol 1996;262:243–57. [27] Jekel PA, Hartmann BH, Beintema JJ. The primary structure of hevamine, an enzyme with lysozyme/chitinase activity from Hevea brasiliensis latex. Eur J Biochem 1991;200:123–30. [28] Watanabe T, Kobori K, Miyashita K, Fujii T, Sakai H, Uchida M, et al. Identification of glutamic acid 204 and aspartic acid 200 in chitinase A1 of Bacillus circulans WL-12 as essential residues for chitinase activity. J Biol Chem 1993;268:18567–72. [29] Terwisscha van Scheltinga AC, Kalk KH, Beintema JJ, Dijkstra BW. Crystal structures of hevamine, a plant defence protein with chitinase and lysozyme activity, and its complex with an inhibitor. Structure 1994;2:1181–9. [30] Mer G, Hietter H, Lefevre JF. Stabilization of proteins by glycosylation examined by NMR analysis of a fucosylated proteinase inhibitor. Nat Struct Biol 1996;3:45–53. [31] Zhu A, Wang ZK, Beavis R. Structural studies of ␣-N-acetylgalactosaminidase: effects of glycosylation on the level of expression, secretion efficiency, and enzyme activity. Arch Biochem Biophys 1998;352:1–8. [32] Lloyd RC, Davis BG, Jones JB. Site-selective glycosylation of subtilisin Bacillus lentus causes dramatic increases in esterase activity. Bioorg Med Chem 2000;8:1537–44. [33] Li DC. Review of fungal chitinases. Mycopathologia 2006;161:345–60. [34] Tomazic SJ, Klivanonov AM. Mechanisms of irreversible thermal inactivation of Bacillus ␣-amylases. J Biol Chem 1988;263:3086–96. [35] Declerch N, Machius M, Chambert R, Wiegand G, Huber R, Gaillardin C. Hyperthermostable mutants of Bacillus licheniformis ␣-amylase: thermodynamic studies and structural interpretation. Protein Eng 1997;10:541–9. [36] Wang SY, Shao B, Ye XY, Rao PF. Purification and characterization of a chitinase from peanut (Arachis hypogaea L.). J Food Biochem 2008;32:32–45. [37] Wang SY, Zhou JJ, Shao B, Lu YJ, Rao PF. A thermostable chitinase with chitinbinding activity from Phaseolus limensis. J Food Sci 2008;73:452–7. [38] Wang S, Shao B, Fu H, Rao P. Isolation of a thermostable legume chitinase and study on the antifungal activity. Appl Microbiol Biotechnol 2009;85: 313–21. [39] Shirota K, Sato T, Sekiguchi J, Miyauchi K, Mochizuki A, Matsumiya M. Purification and characterization of chitinase isozymes from a red algae, Chondrus verrucosus. Biosci Biotechnol Biochem 2008;72:3091–9. [40] Andronopoulou E, Vorgias CE. Purification and characterization of a new hyperthermostable, allosamidin-insensitive and denaturation-resistant chitinase from the hypertherophilic archaeon Thermococcus chitinophagus. Extremophiles 2003;7:43–53. [41] Kumar S, Tsai CJ, Nussinov R. Factors enhancing protein thermostability. Protein Eng 2000;13:179–91.