- Email: [email protected]
Hippocampal GR- and CB1-mediated mGluR5 differentially produces susceptibility and resilience to acute and chronic mild stress in rats
Accepted Manuscript Hippocampal GR- and CB1-mediated mGluR5 differentially produces susceptibility and resilience to acute and chronic mild stress in rats Hongli Sun, Rujuan Su, Xiaoxiao Zhang, Jun Wen, Dan Yao, Xinru Gao, Zhongliang Zhu, Hui Li PII: DOI: Reference:
S0306-4522(17)30415-3 http://dx.doi.org/10.1016/j.neuroscience.2017.06.017 NSC 17829
To appear in:
Neuroscience
Received Date: Accepted Date:
5 December 2016 9 June 2017
Please cite this article as: H. Sun, R. Su, X. Zhang, J. Wen, D. Yao, X. Gao, Z. Zhu, H. Li, Hippocampal GR- and CB1-mediated mGluR5 differentially produces susceptibility and resilience to acute and chronic mild stress in rats, Neuroscience (2017), doi: http://dx.doi.org/10.1016/j.neuroscience.2017.06.017
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1
Hippocampal
GR-
and
CB1-mediated
mGluR5
differentially
produces susceptibility and resilience to acute and chronic mild stress in rats Hongli Suna,b, Rujuan Suc, Xiaoxiao Zhangd, Jun Wena , Dan Yaoa, Xinru Gaoa, Zhongliang Zhue, Hui Lia,f* a
Department of Neonatology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an,
86-710061, P. R. China b
Shaanxi Institute of Pediatric Diseases, Affiliated Children’s Hospital of Xi’an Jiaotong
University, Xi’an, 86-710003, P. R. China c
Department of Oncology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 86-710061,
P. R. China d
College of Life Sciences, Shaanxi Province Biomedicine Key Laboratory, Northwest University,
Shaanxi, 86-710069, P. R. China e
College of Life Sciences, Shaanxi Province Biomedicine Key Laboratory, Northwest University,
Shaanxi, 86-710069, P.R. China f
Department of Neonatology, Affiliated Children’s Hospital of Xi’an Jiaotong University, Xi’an,
86-710061, P. R. China *Hongli Sun and Rujuan Su contributed to this work equally. *Correspondence author: Hui Li, Department of Neonatology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 86-710061, P. R. China Tel.: +86-29-85323825. E-mail address: [email protected]
Abstract The molecular mechanism of individual response of susceptibility and resilience under psychological stress remains controversial and unclear. The present study aimed to explore the relationship of metabotropic glutamate receptor 5 (mGluR5) with glucocorticoid receptor (GR) or
2
cannabinoid receptor (CB1) and further indicate the molecular mechanism of susceptibility and resilience to acute stress (AS) and chronic mild stress (CMS). Sucrose preference test and open field test were used to evaluate the response of susceptibility and resilience under stress in rats. The mRNA levels and protein expressions of mGluR5, GR, and CB1 were detected. AS induced a 35% reduction in the sucrose intake of rats, and these rats were considered as susceptible to stress; 21% of the rats showed resilience to the stress. Thirty-three percent of rats in the CMS group showed reduced sucrose water intake and were considered susceptible, while 20% of rats were considered resilient. Hippocampal mGluR5 mRNA and protein levels were increased in the susceptible rats. Pharmacological testing showed that GR was positively associated with mGluR5 in susceptible rats in the CMS group, while CB1 was negatively related to mGluR5 in susceptible rats in the AS group. The results suggested that GR and CB1 in the hippocampus might regulate mGluR5 protein and mRNA levels, which might be related to individual responses of susceptibility and resilience under AS and CMS. Keywords: Susceptibility; Resilience; Glucocorticoid receptor; CB1; mGluR5; Stress
3
Hippocampal
GR-
and
CB1-mediated
mGluR5
differentially
produces susceptibility and resilience to acute and chronic mild stress in rats Introduction Stress is everywhere in life. It can greatly perturb one’s internal environment homeostasis (Franklin et al., 2012) and cause severe abnormal behavior and induce stress-related mental diseases such as depression and anxiety disorder (Sandi and Haller, 2015). However, individuals who display a susceptibility response under stress often difficultly adapt to stressors and exert a poor adaptive capacity before overt manifestations of affective disorders. In contrast, individuals displaying resilience responses under stress can commendably manage themselves even when facing severe stressors and develop an active process
involving
psychological
and
physiological
adaptations
(Wilkinson et al., 2009). Therefore, it is important to understand the mechanisms of responses of susceptibility and resilience under stress for evaluating the risks of progressing into a stress response. Metabotropic glutamate receptor 5 (mGluR5) belongs to group I mGluRs, which are family C G-protein-coupled receptors, has an important function in modulating glutamate neurotransmitters. mGluR5 is also known to play an important role in the pathophysiology of depression. A previous work exhibited that mGluR5 protein expression and bonding
4
levels reduced in the hippocampus of postmortem depression patients and the depression group (Deschwanden et al., 2011). Another study reported that chronic mild stress (CMS) upregulated mGluR5 protein expression in CA1 but downregulated mGluR5 in the CA3 region of the rat hippocampus (Wierońska et al., 2001). Exposed to various stressful stimuli, mGluR5−/− mice revealed more depression-like behaviors than the control mice (Li et al., 2006, Shin et al., 2015). Pharmacological testing showed that 2-methyl-6-(phenylethynyl)-pyridine (MPEP), an mGluR5 antagonist, exerted antidepressant-like effects in the mouse following the forced swim test, whereas it exerted no influence on mGluR5 knockout mice (Tatarczy et al., 2001). Although those findings suggested an essential role of mGluR5 in depression-like behaviors, the underlying mechanisms remain unclear. Glucocorticoid receptor (GR) has been widely studied because of its significant influence on depression (Pariante and Miller, 2001, Zunszain et al., 2011). GR gene and protein expression are rich in the hippocampus (Chao et al., 1989, Spencer et al., 1990). When exposed to acute and mild psychogenic stressors, the mice forebrain GR exerts an essential property in negative feedback (Furay et al., 2008). Previous studies indicated that cannabinoids act as pivotal characters in modulating the HPA axis (Ganonelazar and Akirav, 2012, Ganonelazar and Akirav, 2013). Cannabinoids display central and peripheral regulation effects through
5
cannabinoid receptor type 1 (CB1) that is abundant in the hippocampus (Mackie, 2005). A previous work found that acute stress (AS) could disrupt CB1 transmission, which then activated the HPA axis response (Steiner and Wotjak, 2008). Expression of CB1 protein was involved in the pathology of mental diseases, including major depression and bipolar disorder (Koethe et al., 2007). CB1 also mediated the damaging effects of AS on memory retrieval in rats (Mohammadmirzaei et al., 2016). Regulators of WIN55,212-2 (a CB1 receptor agonist), and RU-38486 (a GR antagonist) can relieve the memory damage caused by stress (Ganonelazar and Akirav, 2013). However, the relationship between GR and CB1 in the hippocampus in susceptibility and resilience under AS and CMS remains unknown. The present study used the sucrose preference test to divide rats into groups of susceptibility and resilience under stress conditions and further used the open field test to evaluate susceptibility and resilience responses of the rats under stress. The mRNA levels and protein expression of mGluR5 and the protein expression of GR and CB1 in the hippocampus under AS or CMS conditions were determined. The affection of GR antagonist and CB1 receptor agonist on susceptibility responses under AS and CMS was tested. Experimental procedures Animals
6
Male Sprague–Dawley rats were maintained at 22±2°C with 60% humidity on a standard 12-h light/dark cycle. When the animal weighted approximately 200 g, adaptive sugar water (1.5%) preference experiments were initiated, and the stress protocol started when the animal weighted approximately 350 g. Food and water were given ad libitum except when one of these parameters was used as a stress measure. Before the sucrose preference test, food and water were restricted for 14 h, and the rats were allowed 1 h for adapting to the sucrose solution. All procedures were approved by animal care and use ethics committee of Xi’an Jiaotong University. Every effort was made to minimize pain or discomfort. Experimental design The total number of rats used in this study was 200. They were divided into the control, CMS, and AS groups (n=20, 90, and 90, respectively). The number of animals in each group and for each separate procedure was 10 for statistical analysis. Depending on the criteria of behavior testing during stress measures, rats in the CMS or AS group were grouped into three categories: susceptibility, resilience, and intermediate. The susceptive rats were administered the GR antagonist RU-38486 or CB1 receptor agonist WIN55,212-2 (for CMS or AS group, respectively). The matched controls were treated with normal saline. Drugs RU-38486 and WIN55,212-2 were purchased from Sigma Company, and
7
RU-38486 was dissolved in 2% ethanol and 98% saline. WIN55,212-2 was dissolved in 1% DMSO, 1% Tween-80, and 98% saline. Drug doses used were the same as reported (Segev and Akirav, 2016), and the drug or saline was microinjected into the hippocampus 20 min before the stress protocol. Microinjection Rats were anesthetized with 4.8 ml/kg equithesin, head-fixed in a stoelting stereotaxic frame, and then received microinjection aimed at the hippocampus (AP, −3.8 mm; lateral, +2.8 mm; and ventral, −2.2 mm,
with the incisor bar positioned at −2.5 mm) (Paxinos and Watson, 1986). The cannulae was set with acrylic dental cement and fixed using two skull screws. A stylus was set to the guide cannula to avoid blocking. Rats were given 1 week to recover before experiments. Microinjections into the hippocampus were performed using 33 gauge needles that were 1 mm longer than the respective guide cannulae. A needle was linked to a 2-µl syringe through PE-10 tubing and discreetly plugged into the guide cannula. RU-38486 or WIN55,212-2 (0.5 µL) was microinjected into each side of the hippocampus of the stressed rats, while the same volume of saline was microinjected into the control rats. All microinjections were implemented bilaterally. Stress protocol Rats were under CMS condition for 8 weeks. Briefly, this stress
8
procedure included seven different stress conditions, and each condition lasted 10–14 h. The seven stress conditions were as follows: switching time of intermittent light, stroboscopic light, crowding, lack food or water, dirty cage, 45° cage incline, and no stressor (Nieto-Gonzalez et al., 2015). Rats in the AS group were placed on an open elevated platform of 12 × 12 cm size for 30 min in a peaceful room. The stress responses were defined as the presence of freezing behavior for up to 10 min along with defecation and urination (Maroun and Akirav, 2008, Ganonelazar and Akirav, 2009). Rats in the AS group were sacrificed at 1, 3, and 24 h after exposure to AS. Sucrose preference test Rats were adapted to consume sucrose (1.5%). The sucrose preference test persisted 5 weeks. In the first 3 weeks, the sucrose test was conducted twice a week. In the last 2 weeks, the sucrose test was conducted once a week. The amount of water and sucrose consumed during the 1 h was measured, and the sucrose consumption was calculated as follows: sucrose preference = sucrose consumption/(water consumption + sucrose consumption) × 100%. The average baseline sucrose consumption (means ± SD) was calculated from the values of all rats during sucrose tests conducted before stress initiation. To reduce experimental errors, rats with a sucrose consumption value more than twofold the average SD was excluded from the test. The operational cut-off for the susceptible rats
9
was more than 30% decrease in sucrose consumption, and that for resilient rats was less than 10% decrease in sucrose consumption, while intermediate values not corresponding to either he susceptible or resilient criterion were excluded from the test (Henningsen et al., 2012). Open field test Open field test was implemented to confirm susceptibility or antidepressant responses to stress. The modified version of the open field test (Rees et al., 2006) was conducted in a quiet room 24 h following the sucrose preference test. The open field contains an opaque plastic box (150 cm × 150 cm × 49.5 cm; black acrylic walls, green floor) divided into a 5×5 grid of equally sized squares by using white tape. The central region has 3×3=9 squares in the central box. Animals were placed in the center box and allowed to move freely for 5 min under quiet condition. A video tracking system (BanVision, China) was applied to record the time spent in the center and the number of crossing counts (squares crossed with all four paws). The open field arena was fully wiped with 70% ethanol after each test. Real-time PCR Rats were sacrificed after behavioral experiments. The brain was removed quickly after decapitation and placed on an ice glass dish. Total RNA was extracted from frozen hippocampus samples by using the RNeasy Mini-kit (Qiagen, Valencia, USA) for mGluR5 analysis. RNA
10
concentrations were ascertained by absorbance at 260 nm, and the purity was evaluated from the A260/A280 ratio value by using Nanodrop spectrophotometer (Wilmington, DE). RNA (1000 ng) from each sample was reverse transcribed to cDNA by using RevertAid™ First Strand cDNA Synthesis Kit (#K1621, Formentas, USA) according to the manufacturer instructions. RT-PCR was performed in a Bio-Rad IQ™ system (Bio-Rad, Hercules, USA) by using SYBR Green Q-PCR analysis. Primer sequences were listed in Table 1. The relative mGluR5 gene level was normalized for each well of the GAPDH mRNA calculated by the 2-∆∆Ct method (Zhu et al., 2016). Each sample was analyzed in triplicate. Western blotting Western blotting was used to test the protein levels of GR, CB1, and mGluR5 and β-actin in the hippocampus of rats. Western blotting was proceeded as described previously (Zhang et al., 2013). Briefly, the hippocampus sample was homogenized in 1000 µL Tris-HCl buffer (10 mM, pH 7.4). Protein concentration was assayed using a NanoDrop spectrophotometer (ND-1000, Nano Drop, USA), and equivalent amounts of total protein were applied for each immunoblot. The eluted samples were separated by 10% SDS-PAGE and then transferred onto 0.45 µm pore size polyvinylidene fluoride membranes (Millipore, USA). Western blot was performed using antibodies for GR, CB1, mGluR5 (1:1000,
11
Abcam, USA), and β-actin (1:2000, Abcam, USA) and then incubated with anti-mouse secondary antibodies (1:8000) with gentle shaking. The gray value of immune reactivity was imaged and calculated using BioRad's Image Lab 4.1 software. Statistical analysis All data are presented as means ± SD. For statistical analysis, significant differences were determined using one-way ANOVA analysis by using the SPSS17 software program. Data were tested for normality. The equality of variances between the groups was assessed using Levene’s test. Tukey post-hoc comparisons were analyzed when significant difference was observed between groups. Statistical significance was set at p<0.05. Results Experiment 1: Behavioral tests for distinction of susceptible or resilient rats Sucrose preference test (Figure 1A) was applied to estimate susceptibility and resilience to AS and CMS. Significant difference was observed in sucrose consumption between the groups (F(4,35)=52.352, p<0.001). Rats in the AS group showed a 35% reduction in sucrose consumption and were verified as susceptible to the stress, while 21% of rats showed a trend of higher amount of sucrose intake and were designated as resilient to the stress. Thirty-three percent of rats in the CMS group reduced
12
sucrose consumption and were verified as susceptible to the stress, while 20% of rats showed higher sucrose intake than that of the controls and were designated as resilient to stress. To confirm whether the reduction in sucrose intake was related to susceptibility and resilience to the stress, the open field test evaluated the time spent in the center and the number of crossing counts in the susceptible and resilient rats. Figure 1B and 1C show that there was a significant difference in time spent at the center (F(4,35)=110.809, p<0.001) and reduced crossing counts (F(4,35)=150.111, p<0.001) between the groups. The results of Tukey post-hoc indicated that susceptible rats in the AS and CMS groups spent less time in the center (p<0.001) and showed decreased number of crossing counts (p<0.001) compared with the controls. However, resilient rats showed similar results to that of the controls (all p>0.05). Experiment 2: Expression of mGluR5 after acute and chronic stress exposure Significant difference was observed in levels of mGluR5 mRNA (F(6,49)=32.231, p<0.001) and protein (F(6,49)=96.555, p<0.001) between the groups. The results of Tukey post-hoc indicated that hippocampal mGluR5 mRNA level in the susceptible rats was significantly higher than that in the controls (all AS-S groups vs. CON: p<0.001; CMS-S vs. CON: p=0.019,) (Figure 2A). mGluR5 protein levels were increased in the
13
susceptible rats compared to that in the controls (all p<0.001) (Figure 2B). Both mGluR5 mRNA and protein in the resilient rats were unchanged compared with the controls (all p>0.05). Experiment 3: Reversal of chronic stress by glucocorticoid receptor blockade To explore how mGluR5 expression was altered under AS and CMS conditions, we focused on glucocorticoid and CB1 receptors in the hippocampus because glucocorticoids and cannabinoids are both primary response systems in stress responses. Figure 3A shows that there was a significant difference in the GR protein levels between the groups (F(4,35)=122.478, p<0.001). The results of Tukey post-hoc indicated that GR protein levels were higher in the susceptible rats in the CMS group than those in the control group (p<0.001). GR protein levels in the hippocampus of AS rats were not significantly changed compared to the control rats at three different sacrifice points (all p>0.05). Following treatment with the GR antagonist RU-38486, the susceptible rats under CMS showed a similar reduced GR protein level to that of the controls (p=1.00) (Figure 3B). RU-38486 also normalized mGluR5 expression in the susceptible rats under CMS (CMS-S+RU vs. CON: p=0.806; CMS-S+RU vs. CMS-S+NS: p<0.001) (Figure 3C). Furthermore, RU-38486 also reversed the reduction of sucrose intake by CMS (CMS-S+RU vs. CON: p=0.631; CMS-S+RU vs.
14
CMS-S+NS: p<0.001) (Figure 3D). The results suggested that GR was one of the factors that modulate mGluR5 expression in the hippocampus of rats exposed to CMS. Experiment 4: Reversal of acute stress by CB1 receptor activation Figure 4A shows that significant difference was observed in CB1 protein levels between the groups (F(4,35)=12.227, p<0.001). The results of Tukey post-hoc indicated that CB1 receptor protein levels were decreased in the susceptible rats sacrificed at 3 h after exposure to AS (p<0.001). No significant differences were observed between any other groups (all, p>0.05). CB1 receptor agonist WIN55,212-2 showed similar increased CB1 expression levels compared to the controls (p>0.05) in the rats sacrificed 3 h after exposure to AS, while CB1 expression in the AS-S3+NS group rats have a lower level than that in the controls (Figure 4B). WIN55,212-2 also normalized mGluR5 expression in the susceptible rats from AS (AS-S3+WIN vs. CON: p=0.992; AS-S3+WIN vs. AS-S3+NS: p<0.001) (Figure 4C). In addition, WIN55,212-2 also reversed the reduction of sucrose intake by AS (AS-S3+WIN vs. CON: p=0.941; AS-S3+WIN vs. AS-S3+NS: p<0.001) (Figure 4D). Those results manifested that CB1 receptors were one of the factors that modulate mGluR5 expression in the hippocampus of rats exposed to the AS. Discussion
15
The sucrose preference test is widely applied to assess the susceptibility and resilience of animals exposed to stress. The results of Kim Henningsen et al. indicated that 43% of the stressed rats showed susceptible behavior, and 23% of the rats exposed to stress showed resilient behavior in the sucrose preference test (Henningsen et al., 2012). In the present study, rats in the AS group showed \35% susceptibility and 21% resilience under stress. Rats in the CMS group presented 33% susceptibility and 20% resilience under stress. To confirm the results, the open field test evaluated the time spent at the center and the crossing counts in susceptible and resilient rats. The open field test is a classics instrument for assessing emotional behaviors in rodents. The indices of time spent at the center and crossing counts reflect exploratory behavior and general activity in animals. Our results manifested that susceptible rats in the AS and CMS groups showed significantly reduced time at the center and decreased crossing counts compared with the controls. In contrast, the resilient rats demonstrated similar results to that of the controls. Hippocampal mGluR5 protein and mRNA levels in the susceptible and resilient rats were detected in the present work. We found an increased hippocampal mGluR5 protein and mRNA levels in the susceptible rats, but not in the resilient rats. A previous study showed that the noncompetitive
mGluR5
antagonist
MPEP
prevented
behavioral
16
sensitization in mice under social defeat stress (Yap et al., 2005). Other works indicated that reduced vesicular glutamate transporter 1 (VGLUT1) expression was involved in the enhanced stress susceptibility in rats and VGLUT1-heterozygous mice (Lominac et al., 2006, Palmfeldt et al., 2016). Those alterations suggested that glutamatergic systems were involved in stress susceptibility and resilience. To explore the underlying mechanism of the increasing mGluR5 protein and mRNA levels in the susceptible rats, we measured the GR and CB1 protein expressions. Our results showed that GR protein expression was higher of the susceptible rats in the CMS group, while CB1 receptor protein level was reduced in the susceptible rats sacrificed 3 h following exposure to AS. These affections were reversed by treatments with the GR antagonist RU-38486 or CB1 receptor agonist WIN55,212-2. Furthermore, mGluR5 protein and sucrose intake were resumed after the treatment of GR antagonist and CB1 receptor agonist in the susceptible rats. This result suggested that hippocampal mGluR5 might mediate susceptibility response under AS and CMS conditions, which was partially regulated by GR and CB1. A previous work showed that expressions of cytosolic and nuclear GRs were elevated in the hippocampus in the CMS rats (Mizoguchi et al., 2003). In addition, Fride et al. found that neuroendocrine responses were reduced under CMS. There was no significant effects on behavioral responses under acute moderate stress in CB1–/–mice (Fride et al., 2005).
17
However, another work reported that CB1 receptor deficiency induced persistent abnormal behavior under repeated stress or AS conditions (Fride et al., 2005). These studies manifested GR and CB1 differential responses to AS and CMS. To our knowledge, this is the first report that GR and CB1 differentially regulated behavioral responses under AS and CMS in rats, which was related to hippocampal mGluR5 protein and mRNA levels in susceptibility and resilience response under stress. Conclusions The present study indicated that hippocampal mGluR5 mRNA and protein levels were increased in the susceptible rats. In addition, GR was positively associated with mGluR5 in susceptible rats in the CMS group, whereas CB1 was negatively related to mGluR5 in susceptible rats in the AS group. These new data suggested that the changes of mGluR5 was associated with GR or CB1, which was a new molecular mechanism of susceptibility and resilience under AS and CMS conditions. Title page information Hongli Suna,b, Rujuan Suc, Xiaoxiao Zhangd, Jun Wena , Dan Yaoa, Xinru Gaoa, Zhongliang Zhuf, Hui Lia,e* a
Department of Neonatology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an,
86-710061, P. R. China b
Shaanxi Institute of Pediatric Diseases, Affiliated Children’s Hospital of Xi’an Jiaotong
University, Xi’an, 86-710003, P. R. China c
Department of Oncology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 86-710061,
P. R. China
18
d
College of Life Sciences, Shaanxi Province Biomedicine Key Laboratory, Northwest University,
Shaanxi, 86-710069, P. R. China e
Department of Neonatology, Affiliated Children’s Hospital of Xi’an Jiaotong University, Xi’an,
86-710061, P. R. China f
College of Life Sciences, Shaanxi Province Biomedicine Key Laboratory, Northwest University,
Shaanxi, 86-710069, P.R. China *Hongli Sun and Rujuan Su contributed to this work equally. *Correspondence author: Hui Li, Department of Neonatology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 86-710061, P. R. China Tel.: +86-29-85323825. E-mail address: [email protected]
Abstract The molecular mechanism of individual response of susceptibility and resilience under psychological stress remains controversial and unclear. The present study aimed to explore the relationship of metabotropic glutamate receptor 5 (mGluR5) with glucocorticoid receptor (GR) or cannabinoid receptor (CB1) and further indicate the molecular mechanism of susceptibility and resilience to acute stress (AS) and chronic mild stress (CMS). Sucrose preference test and open field test were used to evaluate the response of susceptibility and resilience under stress in rats. The mRNA levels and protein expressions of mGluR5, GR, and CB1 were detected. AS induced a 35% reduction in the sucrose intake of rats, and these rats were considered as susceptible to stress; 21% of the rats showed resilience to the stress. Thirty-three percent of rats in the CMS group showed reduced sucrose water intake and were
19
considered susceptible, while 20% of rats were considered resilient. Hippocampal mGluR5 mRNA and protein levels were increased in the susceptible rats. Pharmacological testing showed that GR was positively associated with mGluR5 in susceptible rats in the CMS group, while CB1 was negatively related to mGluR5 in susceptible rats in the AS group. The results suggested that GR and CB1 in the hippocampus might regulate mGluR5 protein and mRNA levels, which might be related to individual responses of susceptibility and resilience under AS and CMS. Keywords: Susceptibility; Resilience; Glucocorticoid receptor; CB1; mGluR5; Stress Funding This study was supported by the international scientific and technological cooperation and exchange program in Shaanxi province, China (No.2016KW-018). Declaration of interest The authors declare that there is no conflict of interest. Figure and Table Captions Figure 1. Sucrose preference test and open field test were applied to estimate susceptibility and resilience to AS and CMS. Figure 1A. Sucrose consumption in the sucrose preference test. Figure 1B. The time spent in the center in the open field test. Figure 1C. The number of crossing counts in the open field test. Values represent means ± SD. n=10 per
20
group. *p<0.05 vs. CON. Figure 2A. Susceptible rats show increased mGluR5 protein level in the hippocampus compared with the control rats. Figure 2B. Susceptible rats show increased mGluR5 mRNA level in the hippocampus compared with the control rats. Values represent means ± SD. n=10. *p< 0.05 vs. CON. Figure 3A. Susceptible rats in the CMS group show increased GR protein level in the hippocampus compared with the control rats. Figure 3B. The effect of RU-38486 on the GR protein level in the susceptible rats in the hippocampus compared with the control rats. Figure 3C. The effect of RU-38486 on mGluR5 protein expression in the susceptible rats in the CMS group compared with the control rats. Figure 3D. The effect of RU-38486 on the sucrose intake in the susceptible rats in the CMS group compared with the control rats. Values represent means ± SD. n=10. *p < 0.05 vs. CON; #p < 0.05 vs. CMS-S+NS. Figure 4A. Susceptible rats sacrificed 3 h after AS show a decreased CB1 protein level in the hippocampus compared with the control rats. Figure 4B. The effect of WIN55,212-2 on CB1 protein level in the susceptible rats in the hippocampus compared with the control rats. Figure 4C. The effect of WIN55,212-2 on mGluR5 protein expression in the susceptible rats in the AS group compared with the control rats. Figure 4D. The effect of WIN55,212-2 on the sucrose intake in the susceptible rats in the AS group compared with the control rats. Values represent means ± SD. n=10.
21
*p < 0.05 vs. CON; #p < 0.05 vs. AS-S+NS. Table 1. Primer sequences of mGluR5 and GAPDH for PCR REFERENCES Chao HM, Choo PH, Mcewen BS (1989), Glucocorticoid and mineralocorticoid receptor mRNA expression in rat brain. Neuroendocrino 50:365-371. Deschwanden A, Karolewicz B, Feyissa AM, Treyer V, Ametamey SM, Johayem A, Burger C, Auberson YP, Sovago J, Stockmeier CA (2011), Reduced metabotropic glutamate receptor 5 density in major depression determined by [(11)C]ABP688 PET and postmortem study. Am J Psychiat 168:727-734. Franklin TB, Saab BJ, Mansuy IM (2012), Neural mechanisms of stress resilience and vulnerability. Neuron 75:747-761. Fride E, Suris R, Weidenfeld J, Mechoulam R (2005), Differential response to acute and repeated stress in cannabinoid CB1 receptor knockout newborn and adult mice. Behav Pharmacol 16:431-440. Furay AR, Bruestle AE, Herman JP (2008), The Role of the Forebrain Glucocorticoid Receptor in Acute and Chronic Stress. Endocrinology 149:5482-5490. Ganonelazar E, Akirav I (2013), Cannabinoids and traumatic stress modulation of contextual fear extinction
and
GR
expression
in
the
amygdala-hippocampal-prefrontal
circuit.
Psychoneuroendocrino 38:1675-1687. Ganonelazar E, Akirav I (2009), Cannabinoid receptor activation in the basolateral amygdala blocks the effects of stress on the conditioning and extinction of inhibitory avoidance. J Neurosci 29:11078-11088. Ganonelazar E, Akirav I (2012), Cannabinoids prevent the development of behavioral and endocrine alterations in a rat model of intense stress. Neuropsychopharmacology 37:456-466. Henningsen K, Palmfeldt J, Christiansen S, Baiges I, Bak S, Jensen ON, Gregersen N, Wiborg O (2012), Candidate hippocampal biomarkers of susceptibility and resilience to stress in a rat model of depression. Mol Cell Proteomics 11:3929-3936. Koethe D, Llenos IC, Dulay JR, Hoyer C, Torrey EF, Leweke FM, Weis S (2007), Expression of CB1 cannabinoid receptor in the anterior cingulate cortex in schizophrenia, bipolar disorder, and major depression. J Neural Transm 114:1055-1063. Li X, Need AB, Baez M, Witkin JM (2006), Metabotropic Glutamate 5 Receptor Antagonism Is Associated with Antidepressant-Like Effects in Mice. J Pharmacol Exp Ther 319:254-259. Lominac KD, Oleson EB, Pava M, Klugmann M, Schwarz MK, Seeburg PH, During MJ, Worley PF, Kalivas PW, Szumlinski KK (2006), Distinct roles for different Homer1 isoforms in behaviors and associated prefrontal cortex function. J Neurosci 25:11586-11594. Mackie K (2005) Distribution of Cannabinoid Receptors in the Central and Peripheral Nervous System, vol 168, pp 299-325. Springer Berlin Heidelberg. Maroun M, Akirav I (2008), Arousal and Stress Effects on Consolidation and Reconsolidation of Recognition Memory. Neuropsychopharmacology 33:394-405. Mizoguchi K, Ishige A, Aburada M, Tabira T (2003), Chronic stress attenuates glucocorticoid negative feedback: involvement of the prefrontal cortex and hippocampus. Neuroscience
22
119:887-897. Mohammadmirzaei N, Rezayof A, Ghasemzadeh Z (2016), Activation of cannabinoid CB1 receptors in the ventral hippocampus improved stress-induced amnesia in rat. Brain Res 1646:219-226. Nieto-Gonzalez JL, Holm MM, Vardya I, Christensen T, Wiborg O, Jensen K (2015), Presynaptic plasticity as a hallmark of rat stress susceptibility and antidepressant response. PloS one 10:e0119993. Palmfeldt J, Henningsen K, Eriksen SA, Muller HK, Wiborg O (2016), Protein biomarkers of susceptibility and resilience to stress in a rat model of depression. Mol Cell Neurosci 74:87-95. Pariante CM, Miller AH (2001), Glucocorticoid receptors in major depression: relevance to pathophysiology and treatment. Biol Psychiatry 49:391-404. Paxinos G, Watson C (1986) - The Rat Brain in Stereotaxic Coordinates: Academic Press. Rees SL, Steiner M, Fleming AS (2006), Early deprivation, but not maternal separation, attenuates rise in corticosterone levels after exposure to a novel environment in both juvenile and adult female rats. Behav Brain Res 175:383-391. Sandi C, Haller J (2015), Stress and the social brain: behavioural effects and neurobiological mechanisms. Nat Rev Neurosci 16:290-304. Segev A, Akirav I (2016), Cannabinoids and Glucocorticoids in the Basolateral Amygdala Modulate Hippocampal-Accumbens Plasticity After Stress. Neuropsychopharmacology 41:1066-1079. Shin S, Kwon O, Kang JI, Kwon S, Oh S, Choi J, Kim CH, Kim DG (2015), mGluR5 in the nucleus accumbens is critical for promoting resilience to chronic stress. Nat Neurosci 18:1017-1024. Spencer RL, Young EA, Choo PH, Mcewen BS (1990), Adrenal steroid type I and type II receptor binding: estimates of in vivo receptor number, occupancy, and activation with varying level of steroid. Brain Res 514:37-48. Steiner MA, Wotjak CT (2008), Role of the endocannabinoid system in regulation of the hypothalamic-pituitary-adrenocortical axis. Prog Brain Res 170:397-432. Tatarczy E, #x, ska, K A, #x, odzi, #x, ska, Chojnacka-Wójcik E, Pa A, #x, ucha, Gasparini F, Kuhn R, Pilc A (2001), Potential anxiolytic- and antidepressant-like effects of MPEP, a potent, selective and systemically active mGlu5 receptor antagonist. Br J Pharmacol 132:1423-1430. Wierońska JM, Brański P, Szewczyk B, Pałucha A, Papp M, Gruca P, Moryl E, Pilc A (2001), Changes in the expression of metabotropic glutamate receptor 5 (mGluR5) in the rat hippocampus in an animal model of depression. Pol J Pharmacol 53:659-662. Wilkinson MB, Xiao G, Kumar A, Laplant Q, Renthal W, Sikder D, Kodadek TJ, Nestler EJ (2009), Imipramine Treatment and Resiliency Exhibit Similar Chromatin Regulation in the Mouse Nucleus Accumbens in Depression Models. J Neurosci 29:7820-7832. Yap JJ, Iii HEC, Gale MC, Datta R, Miczek KA (2005), Behavioral sensitization due to social defeat stress in mice: antagonism at mGluR5 and NMDA receptors. Psychopharmacology 179:230-239. Zhang XH, Jia N, Zhao XY, Tang GK, Guan LX, Wang D, Sun HL, Li H, Zhu ZL (2013), Involvement of pGluR1, EAAT2 and EAAT3 in offspring depression induced by prenatal stress. Neuroscience 250:333-341. Zhu Z, Sun H, Gong X, Li H (2016), Different effects of prenatal stress on ERK2/CREB/Bcl-2 expression in the hippocampus and the prefrontal cortex of adult offspring rats. Neuroreport 27(8):600. Zunszain PA, Anacker C, Cattaneo A, Carvalho LA, Pariante CM (2011), Glucocorticoids, cytokines and brain abnormalities in depression. Prog Neuropsychopharmacol Biol Psychiatry 35:722-729.
23
24
25
26
27
Table 1 Primer sequences used for real-time PCR. Target
Forward primer
Reverse primer
Production lengths
mGluR5 GAPDH
TGAGAGGAAGTGTGGTGCAG
CAAGTGTGATGTTGGGCAAG
CAAGGTCATCCATGACAACTTG
GTCCACCACCCTGTTGCTGTAG
116 496
28
Highlights
GR was associated with the lower mGluR5 mRNA and protein in susceptibility rats of CMS group.
CB1 was related to the lower mGluR5 mRNA and protein in susceptibility rats of AS group.
Glucocorticoid and cannabinoid systems in hippocampus may regulate susceptibility and resilience to stress.
S0306-4522(17)30415-3 http://dx.doi.org/10.1016/j.neuroscience.2017.06.017 NSC 17829
To appear in:
Neuroscience
Received Date: Accepted Date:
5 December 2016 9 June 2017
Please cite this article as: H. Sun, R. Su, X. Zhang, J. Wen, D. Yao, X. Gao, Z. Zhu, H. Li, Hippocampal GR- and CB1-mediated mGluR5 differentially produces susceptibility and resilience to acute and chronic mild stress in rats, Neuroscience (2017), doi: http://dx.doi.org/10.1016/j.neuroscience.2017.06.017
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
1
Hippocampal
GR-
and
CB1-mediated
mGluR5
differentially
produces susceptibility and resilience to acute and chronic mild stress in rats Hongli Suna,b, Rujuan Suc, Xiaoxiao Zhangd, Jun Wena , Dan Yaoa, Xinru Gaoa, Zhongliang Zhue, Hui Lia,f* a
Department of Neonatology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an,
86-710061, P. R. China b
Shaanxi Institute of Pediatric Diseases, Affiliated Children’s Hospital of Xi’an Jiaotong
University, Xi’an, 86-710003, P. R. China c
Department of Oncology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 86-710061,
P. R. China d
College of Life Sciences, Shaanxi Province Biomedicine Key Laboratory, Northwest University,
Shaanxi, 86-710069, P. R. China e
College of Life Sciences, Shaanxi Province Biomedicine Key Laboratory, Northwest University,
Shaanxi, 86-710069, P.R. China f
Department of Neonatology, Affiliated Children’s Hospital of Xi’an Jiaotong University, Xi’an,
86-710061, P. R. China *Hongli Sun and Rujuan Su contributed to this work equally. *Correspondence author: Hui Li, Department of Neonatology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 86-710061, P. R. China Tel.: +86-29-85323825. E-mail address: [email protected]
Abstract The molecular mechanism of individual response of susceptibility and resilience under psychological stress remains controversial and unclear. The present study aimed to explore the relationship of metabotropic glutamate receptor 5 (mGluR5) with glucocorticoid receptor (GR) or
2
cannabinoid receptor (CB1) and further indicate the molecular mechanism of susceptibility and resilience to acute stress (AS) and chronic mild stress (CMS). Sucrose preference test and open field test were used to evaluate the response of susceptibility and resilience under stress in rats. The mRNA levels and protein expressions of mGluR5, GR, and CB1 were detected. AS induced a 35% reduction in the sucrose intake of rats, and these rats were considered as susceptible to stress; 21% of the rats showed resilience to the stress. Thirty-three percent of rats in the CMS group showed reduced sucrose water intake and were considered susceptible, while 20% of rats were considered resilient. Hippocampal mGluR5 mRNA and protein levels were increased in the susceptible rats. Pharmacological testing showed that GR was positively associated with mGluR5 in susceptible rats in the CMS group, while CB1 was negatively related to mGluR5 in susceptible rats in the AS group. The results suggested that GR and CB1 in the hippocampus might regulate mGluR5 protein and mRNA levels, which might be related to individual responses of susceptibility and resilience under AS and CMS. Keywords: Susceptibility; Resilience; Glucocorticoid receptor; CB1; mGluR5; Stress
3
Hippocampal
GR-
and
CB1-mediated
mGluR5
differentially
produces susceptibility and resilience to acute and chronic mild stress in rats Introduction Stress is everywhere in life. It can greatly perturb one’s internal environment homeostasis (Franklin et al., 2012) and cause severe abnormal behavior and induce stress-related mental diseases such as depression and anxiety disorder (Sandi and Haller, 2015). However, individuals who display a susceptibility response under stress often difficultly adapt to stressors and exert a poor adaptive capacity before overt manifestations of affective disorders. In contrast, individuals displaying resilience responses under stress can commendably manage themselves even when facing severe stressors and develop an active process
involving
psychological
and
physiological
adaptations
(Wilkinson et al., 2009). Therefore, it is important to understand the mechanisms of responses of susceptibility and resilience under stress for evaluating the risks of progressing into a stress response. Metabotropic glutamate receptor 5 (mGluR5) belongs to group I mGluRs, which are family C G-protein-coupled receptors, has an important function in modulating glutamate neurotransmitters. mGluR5 is also known to play an important role in the pathophysiology of depression. A previous work exhibited that mGluR5 protein expression and bonding
4
levels reduced in the hippocampus of postmortem depression patients and the depression group (Deschwanden et al., 2011). Another study reported that chronic mild stress (CMS) upregulated mGluR5 protein expression in CA1 but downregulated mGluR5 in the CA3 region of the rat hippocampus (Wierońska et al., 2001). Exposed to various stressful stimuli, mGluR5−/− mice revealed more depression-like behaviors than the control mice (Li et al., 2006, Shin et al., 2015). Pharmacological testing showed that 2-methyl-6-(phenylethynyl)-pyridine (MPEP), an mGluR5 antagonist, exerted antidepressant-like effects in the mouse following the forced swim test, whereas it exerted no influence on mGluR5 knockout mice (Tatarczy et al., 2001). Although those findings suggested an essential role of mGluR5 in depression-like behaviors, the underlying mechanisms remain unclear. Glucocorticoid receptor (GR) has been widely studied because of its significant influence on depression (Pariante and Miller, 2001, Zunszain et al., 2011). GR gene and protein expression are rich in the hippocampus (Chao et al., 1989, Spencer et al., 1990). When exposed to acute and mild psychogenic stressors, the mice forebrain GR exerts an essential property in negative feedback (Furay et al., 2008). Previous studies indicated that cannabinoids act as pivotal characters in modulating the HPA axis (Ganonelazar and Akirav, 2012, Ganonelazar and Akirav, 2013). Cannabinoids display central and peripheral regulation effects through
5
cannabinoid receptor type 1 (CB1) that is abundant in the hippocampus (Mackie, 2005). A previous work found that acute stress (AS) could disrupt CB1 transmission, which then activated the HPA axis response (Steiner and Wotjak, 2008). Expression of CB1 protein was involved in the pathology of mental diseases, including major depression and bipolar disorder (Koethe et al., 2007). CB1 also mediated the damaging effects of AS on memory retrieval in rats (Mohammadmirzaei et al., 2016). Regulators of WIN55,212-2 (a CB1 receptor agonist), and RU-38486 (a GR antagonist) can relieve the memory damage caused by stress (Ganonelazar and Akirav, 2013). However, the relationship between GR and CB1 in the hippocampus in susceptibility and resilience under AS and CMS remains unknown. The present study used the sucrose preference test to divide rats into groups of susceptibility and resilience under stress conditions and further used the open field test to evaluate susceptibility and resilience responses of the rats under stress. The mRNA levels and protein expression of mGluR5 and the protein expression of GR and CB1 in the hippocampus under AS or CMS conditions were determined. The affection of GR antagonist and CB1 receptor agonist on susceptibility responses under AS and CMS was tested. Experimental procedures Animals
6
Male Sprague–Dawley rats were maintained at 22±2°C with 60% humidity on a standard 12-h light/dark cycle. When the animal weighted approximately 200 g, adaptive sugar water (1.5%) preference experiments were initiated, and the stress protocol started when the animal weighted approximately 350 g. Food and water were given ad libitum except when one of these parameters was used as a stress measure. Before the sucrose preference test, food and water were restricted for 14 h, and the rats were allowed 1 h for adapting to the sucrose solution. All procedures were approved by animal care and use ethics committee of Xi’an Jiaotong University. Every effort was made to minimize pain or discomfort. Experimental design The total number of rats used in this study was 200. They were divided into the control, CMS, and AS groups (n=20, 90, and 90, respectively). The number of animals in each group and for each separate procedure was 10 for statistical analysis. Depending on the criteria of behavior testing during stress measures, rats in the CMS or AS group were grouped into three categories: susceptibility, resilience, and intermediate. The susceptive rats were administered the GR antagonist RU-38486 or CB1 receptor agonist WIN55,212-2 (for CMS or AS group, respectively). The matched controls were treated with normal saline. Drugs RU-38486 and WIN55,212-2 were purchased from Sigma Company, and
7
RU-38486 was dissolved in 2% ethanol and 98% saline. WIN55,212-2 was dissolved in 1% DMSO, 1% Tween-80, and 98% saline. Drug doses used were the same as reported (Segev and Akirav, 2016), and the drug or saline was microinjected into the hippocampus 20 min before the stress protocol. Microinjection Rats were anesthetized with 4.8 ml/kg equithesin, head-fixed in a stoelting stereotaxic frame, and then received microinjection aimed at the hippocampus (AP, −3.8 mm; lateral, +2.8 mm; and ventral, −2.2 mm,
with the incisor bar positioned at −2.5 mm) (Paxinos and Watson, 1986). The cannulae was set with acrylic dental cement and fixed using two skull screws. A stylus was set to the guide cannula to avoid blocking. Rats were given 1 week to recover before experiments. Microinjections into the hippocampus were performed using 33 gauge needles that were 1 mm longer than the respective guide cannulae. A needle was linked to a 2-µl syringe through PE-10 tubing and discreetly plugged into the guide cannula. RU-38486 or WIN55,212-2 (0.5 µL) was microinjected into each side of the hippocampus of the stressed rats, while the same volume of saline was microinjected into the control rats. All microinjections were implemented bilaterally. Stress protocol Rats were under CMS condition for 8 weeks. Briefly, this stress
8
procedure included seven different stress conditions, and each condition lasted 10–14 h. The seven stress conditions were as follows: switching time of intermittent light, stroboscopic light, crowding, lack food or water, dirty cage, 45° cage incline, and no stressor (Nieto-Gonzalez et al., 2015). Rats in the AS group were placed on an open elevated platform of 12 × 12 cm size for 30 min in a peaceful room. The stress responses were defined as the presence of freezing behavior for up to 10 min along with defecation and urination (Maroun and Akirav, 2008, Ganonelazar and Akirav, 2009). Rats in the AS group were sacrificed at 1, 3, and 24 h after exposure to AS. Sucrose preference test Rats were adapted to consume sucrose (1.5%). The sucrose preference test persisted 5 weeks. In the first 3 weeks, the sucrose test was conducted twice a week. In the last 2 weeks, the sucrose test was conducted once a week. The amount of water and sucrose consumed during the 1 h was measured, and the sucrose consumption was calculated as follows: sucrose preference = sucrose consumption/(water consumption + sucrose consumption) × 100%. The average baseline sucrose consumption (means ± SD) was calculated from the values of all rats during sucrose tests conducted before stress initiation. To reduce experimental errors, rats with a sucrose consumption value more than twofold the average SD was excluded from the test. The operational cut-off for the susceptible rats
9
was more than 30% decrease in sucrose consumption, and that for resilient rats was less than 10% decrease in sucrose consumption, while intermediate values not corresponding to either he susceptible or resilient criterion were excluded from the test (Henningsen et al., 2012). Open field test Open field test was implemented to confirm susceptibility or antidepressant responses to stress. The modified version of the open field test (Rees et al., 2006) was conducted in a quiet room 24 h following the sucrose preference test. The open field contains an opaque plastic box (150 cm × 150 cm × 49.5 cm; black acrylic walls, green floor) divided into a 5×5 grid of equally sized squares by using white tape. The central region has 3×3=9 squares in the central box. Animals were placed in the center box and allowed to move freely for 5 min under quiet condition. A video tracking system (BanVision, China) was applied to record the time spent in the center and the number of crossing counts (squares crossed with all four paws). The open field arena was fully wiped with 70% ethanol after each test. Real-time PCR Rats were sacrificed after behavioral experiments. The brain was removed quickly after decapitation and placed on an ice glass dish. Total RNA was extracted from frozen hippocampus samples by using the RNeasy Mini-kit (Qiagen, Valencia, USA) for mGluR5 analysis. RNA
10
concentrations were ascertained by absorbance at 260 nm, and the purity was evaluated from the A260/A280 ratio value by using Nanodrop spectrophotometer (Wilmington, DE). RNA (1000 ng) from each sample was reverse transcribed to cDNA by using RevertAid™ First Strand cDNA Synthesis Kit (#K1621, Formentas, USA) according to the manufacturer instructions. RT-PCR was performed in a Bio-Rad IQ™ system (Bio-Rad, Hercules, USA) by using SYBR Green Q-PCR analysis. Primer sequences were listed in Table 1. The relative mGluR5 gene level was normalized for each well of the GAPDH mRNA calculated by the 2-∆∆Ct method (Zhu et al., 2016). Each sample was analyzed in triplicate. Western blotting Western blotting was used to test the protein levels of GR, CB1, and mGluR5 and β-actin in the hippocampus of rats. Western blotting was proceeded as described previously (Zhang et al., 2013). Briefly, the hippocampus sample was homogenized in 1000 µL Tris-HCl buffer (10 mM, pH 7.4). Protein concentration was assayed using a NanoDrop spectrophotometer (ND-1000, Nano Drop, USA), and equivalent amounts of total protein were applied for each immunoblot. The eluted samples were separated by 10% SDS-PAGE and then transferred onto 0.45 µm pore size polyvinylidene fluoride membranes (Millipore, USA). Western blot was performed using antibodies for GR, CB1, mGluR5 (1:1000,
11
Abcam, USA), and β-actin (1:2000, Abcam, USA) and then incubated with anti-mouse secondary antibodies (1:8000) with gentle shaking. The gray value of immune reactivity was imaged and calculated using BioRad's Image Lab 4.1 software. Statistical analysis All data are presented as means ± SD. For statistical analysis, significant differences were determined using one-way ANOVA analysis by using the SPSS17 software program. Data were tested for normality. The equality of variances between the groups was assessed using Levene’s test. Tukey post-hoc comparisons were analyzed when significant difference was observed between groups. Statistical significance was set at p<0.05. Results Experiment 1: Behavioral tests for distinction of susceptible or resilient rats Sucrose preference test (Figure 1A) was applied to estimate susceptibility and resilience to AS and CMS. Significant difference was observed in sucrose consumption between the groups (F(4,35)=52.352, p<0.001). Rats in the AS group showed a 35% reduction in sucrose consumption and were verified as susceptible to the stress, while 21% of rats showed a trend of higher amount of sucrose intake and were designated as resilient to the stress. Thirty-three percent of rats in the CMS group reduced
12
sucrose consumption and were verified as susceptible to the stress, while 20% of rats showed higher sucrose intake than that of the controls and were designated as resilient to stress. To confirm whether the reduction in sucrose intake was related to susceptibility and resilience to the stress, the open field test evaluated the time spent in the center and the number of crossing counts in the susceptible and resilient rats. Figure 1B and 1C show that there was a significant difference in time spent at the center (F(4,35)=110.809, p<0.001) and reduced crossing counts (F(4,35)=150.111, p<0.001) between the groups. The results of Tukey post-hoc indicated that susceptible rats in the AS and CMS groups spent less time in the center (p<0.001) and showed decreased number of crossing counts (p<0.001) compared with the controls. However, resilient rats showed similar results to that of the controls (all p>0.05). Experiment 2: Expression of mGluR5 after acute and chronic stress exposure Significant difference was observed in levels of mGluR5 mRNA (F(6,49)=32.231, p<0.001) and protein (F(6,49)=96.555, p<0.001) between the groups. The results of Tukey post-hoc indicated that hippocampal mGluR5 mRNA level in the susceptible rats was significantly higher than that in the controls (all AS-S groups vs. CON: p<0.001; CMS-S vs. CON: p=0.019,) (Figure 2A). mGluR5 protein levels were increased in the
13
susceptible rats compared to that in the controls (all p<0.001) (Figure 2B). Both mGluR5 mRNA and protein in the resilient rats were unchanged compared with the controls (all p>0.05). Experiment 3: Reversal of chronic stress by glucocorticoid receptor blockade To explore how mGluR5 expression was altered under AS and CMS conditions, we focused on glucocorticoid and CB1 receptors in the hippocampus because glucocorticoids and cannabinoids are both primary response systems in stress responses. Figure 3A shows that there was a significant difference in the GR protein levels between the groups (F(4,35)=122.478, p<0.001). The results of Tukey post-hoc indicated that GR protein levels were higher in the susceptible rats in the CMS group than those in the control group (p<0.001). GR protein levels in the hippocampus of AS rats were not significantly changed compared to the control rats at three different sacrifice points (all p>0.05). Following treatment with the GR antagonist RU-38486, the susceptible rats under CMS showed a similar reduced GR protein level to that of the controls (p=1.00) (Figure 3B). RU-38486 also normalized mGluR5 expression in the susceptible rats under CMS (CMS-S+RU vs. CON: p=0.806; CMS-S+RU vs. CMS-S+NS: p<0.001) (Figure 3C). Furthermore, RU-38486 also reversed the reduction of sucrose intake by CMS (CMS-S+RU vs. CON: p=0.631; CMS-S+RU vs.
14
CMS-S+NS: p<0.001) (Figure 3D). The results suggested that GR was one of the factors that modulate mGluR5 expression in the hippocampus of rats exposed to CMS. Experiment 4: Reversal of acute stress by CB1 receptor activation Figure 4A shows that significant difference was observed in CB1 protein levels between the groups (F(4,35)=12.227, p<0.001). The results of Tukey post-hoc indicated that CB1 receptor protein levels were decreased in the susceptible rats sacrificed at 3 h after exposure to AS (p<0.001). No significant differences were observed between any other groups (all, p>0.05). CB1 receptor agonist WIN55,212-2 showed similar increased CB1 expression levels compared to the controls (p>0.05) in the rats sacrificed 3 h after exposure to AS, while CB1 expression in the AS-S3+NS group rats have a lower level than that in the controls (Figure 4B). WIN55,212-2 also normalized mGluR5 expression in the susceptible rats from AS (AS-S3+WIN vs. CON: p=0.992; AS-S3+WIN vs. AS-S3+NS: p<0.001) (Figure 4C). In addition, WIN55,212-2 also reversed the reduction of sucrose intake by AS (AS-S3+WIN vs. CON: p=0.941; AS-S3+WIN vs. AS-S3+NS: p<0.001) (Figure 4D). Those results manifested that CB1 receptors were one of the factors that modulate mGluR5 expression in the hippocampus of rats exposed to the AS. Discussion
15
The sucrose preference test is widely applied to assess the susceptibility and resilience of animals exposed to stress. The results of Kim Henningsen et al. indicated that 43% of the stressed rats showed susceptible behavior, and 23% of the rats exposed to stress showed resilient behavior in the sucrose preference test (Henningsen et al., 2012). In the present study, rats in the AS group showed \35% susceptibility and 21% resilience under stress. Rats in the CMS group presented 33% susceptibility and 20% resilience under stress. To confirm the results, the open field test evaluated the time spent at the center and the crossing counts in susceptible and resilient rats. The open field test is a classics instrument for assessing emotional behaviors in rodents. The indices of time spent at the center and crossing counts reflect exploratory behavior and general activity in animals. Our results manifested that susceptible rats in the AS and CMS groups showed significantly reduced time at the center and decreased crossing counts compared with the controls. In contrast, the resilient rats demonstrated similar results to that of the controls. Hippocampal mGluR5 protein and mRNA levels in the susceptible and resilient rats were detected in the present work. We found an increased hippocampal mGluR5 protein and mRNA levels in the susceptible rats, but not in the resilient rats. A previous study showed that the noncompetitive
mGluR5
antagonist
MPEP
prevented
behavioral
16
sensitization in mice under social defeat stress (Yap et al., 2005). Other works indicated that reduced vesicular glutamate transporter 1 (VGLUT1) expression was involved in the enhanced stress susceptibility in rats and VGLUT1-heterozygous mice (Lominac et al., 2006, Palmfeldt et al., 2016). Those alterations suggested that glutamatergic systems were involved in stress susceptibility and resilience. To explore the underlying mechanism of the increasing mGluR5 protein and mRNA levels in the susceptible rats, we measured the GR and CB1 protein expressions. Our results showed that GR protein expression was higher of the susceptible rats in the CMS group, while CB1 receptor protein level was reduced in the susceptible rats sacrificed 3 h following exposure to AS. These affections were reversed by treatments with the GR antagonist RU-38486 or CB1 receptor agonist WIN55,212-2. Furthermore, mGluR5 protein and sucrose intake were resumed after the treatment of GR antagonist and CB1 receptor agonist in the susceptible rats. This result suggested that hippocampal mGluR5 might mediate susceptibility response under AS and CMS conditions, which was partially regulated by GR and CB1. A previous work showed that expressions of cytosolic and nuclear GRs were elevated in the hippocampus in the CMS rats (Mizoguchi et al., 2003). In addition, Fride et al. found that neuroendocrine responses were reduced under CMS. There was no significant effects on behavioral responses under acute moderate stress in CB1–/–mice (Fride et al., 2005).
17
However, another work reported that CB1 receptor deficiency induced persistent abnormal behavior under repeated stress or AS conditions (Fride et al., 2005). These studies manifested GR and CB1 differential responses to AS and CMS. To our knowledge, this is the first report that GR and CB1 differentially regulated behavioral responses under AS and CMS in rats, which was related to hippocampal mGluR5 protein and mRNA levels in susceptibility and resilience response under stress. Conclusions The present study indicated that hippocampal mGluR5 mRNA and protein levels were increased in the susceptible rats. In addition, GR was positively associated with mGluR5 in susceptible rats in the CMS group, whereas CB1 was negatively related to mGluR5 in susceptible rats in the AS group. These new data suggested that the changes of mGluR5 was associated with GR or CB1, which was a new molecular mechanism of susceptibility and resilience under AS and CMS conditions. Title page information Hongli Suna,b, Rujuan Suc, Xiaoxiao Zhangd, Jun Wena , Dan Yaoa, Xinru Gaoa, Zhongliang Zhuf, Hui Lia,e* a
Department of Neonatology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an,
86-710061, P. R. China b
Shaanxi Institute of Pediatric Diseases, Affiliated Children’s Hospital of Xi’an Jiaotong
University, Xi’an, 86-710003, P. R. China c
Department of Oncology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 86-710061,
P. R. China
18
d
College of Life Sciences, Shaanxi Province Biomedicine Key Laboratory, Northwest University,
Shaanxi, 86-710069, P. R. China e
Department of Neonatology, Affiliated Children’s Hospital of Xi’an Jiaotong University, Xi’an,
86-710061, P. R. China f
College of Life Sciences, Shaanxi Province Biomedicine Key Laboratory, Northwest University,
Shaanxi, 86-710069, P.R. China *Hongli Sun and Rujuan Su contributed to this work equally. *Correspondence author: Hui Li, Department of Neonatology, First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 86-710061, P. R. China Tel.: +86-29-85323825. E-mail address: [email protected]
Abstract The molecular mechanism of individual response of susceptibility and resilience under psychological stress remains controversial and unclear. The present study aimed to explore the relationship of metabotropic glutamate receptor 5 (mGluR5) with glucocorticoid receptor (GR) or cannabinoid receptor (CB1) and further indicate the molecular mechanism of susceptibility and resilience to acute stress (AS) and chronic mild stress (CMS). Sucrose preference test and open field test were used to evaluate the response of susceptibility and resilience under stress in rats. The mRNA levels and protein expressions of mGluR5, GR, and CB1 were detected. AS induced a 35% reduction in the sucrose intake of rats, and these rats were considered as susceptible to stress; 21% of the rats showed resilience to the stress. Thirty-three percent of rats in the CMS group showed reduced sucrose water intake and were
19
considered susceptible, while 20% of rats were considered resilient. Hippocampal mGluR5 mRNA and protein levels were increased in the susceptible rats. Pharmacological testing showed that GR was positively associated with mGluR5 in susceptible rats in the CMS group, while CB1 was negatively related to mGluR5 in susceptible rats in the AS group. The results suggested that GR and CB1 in the hippocampus might regulate mGluR5 protein and mRNA levels, which might be related to individual responses of susceptibility and resilience under AS and CMS. Keywords: Susceptibility; Resilience; Glucocorticoid receptor; CB1; mGluR5; Stress Funding This study was supported by the international scientific and technological cooperation and exchange program in Shaanxi province, China (No.2016KW-018). Declaration of interest The authors declare that there is no conflict of interest. Figure and Table Captions Figure 1. Sucrose preference test and open field test were applied to estimate susceptibility and resilience to AS and CMS. Figure 1A. Sucrose consumption in the sucrose preference test. Figure 1B. The time spent in the center in the open field test. Figure 1C. The number of crossing counts in the open field test. Values represent means ± SD. n=10 per
20
group. *p<0.05 vs. CON. Figure 2A. Susceptible rats show increased mGluR5 protein level in the hippocampus compared with the control rats. Figure 2B. Susceptible rats show increased mGluR5 mRNA level in the hippocampus compared with the control rats. Values represent means ± SD. n=10. *p< 0.05 vs. CON. Figure 3A. Susceptible rats in the CMS group show increased GR protein level in the hippocampus compared with the control rats. Figure 3B. The effect of RU-38486 on the GR protein level in the susceptible rats in the hippocampus compared with the control rats. Figure 3C. The effect of RU-38486 on mGluR5 protein expression in the susceptible rats in the CMS group compared with the control rats. Figure 3D. The effect of RU-38486 on the sucrose intake in the susceptible rats in the CMS group compared with the control rats. Values represent means ± SD. n=10. *p < 0.05 vs. CON; #p < 0.05 vs. CMS-S+NS. Figure 4A. Susceptible rats sacrificed 3 h after AS show a decreased CB1 protein level in the hippocampus compared with the control rats. Figure 4B. The effect of WIN55,212-2 on CB1 protein level in the susceptible rats in the hippocampus compared with the control rats. Figure 4C. The effect of WIN55,212-2 on mGluR5 protein expression in the susceptible rats in the AS group compared with the control rats. Figure 4D. The effect of WIN55,212-2 on the sucrose intake in the susceptible rats in the AS group compared with the control rats. Values represent means ± SD. n=10.
21
*p < 0.05 vs. CON; #p < 0.05 vs. AS-S+NS. Table 1. Primer sequences of mGluR5 and GAPDH for PCR REFERENCES Chao HM, Choo PH, Mcewen BS (1989), Glucocorticoid and mineralocorticoid receptor mRNA expression in rat brain. Neuroendocrino 50:365-371. Deschwanden A, Karolewicz B, Feyissa AM, Treyer V, Ametamey SM, Johayem A, Burger C, Auberson YP, Sovago J, Stockmeier CA (2011), Reduced metabotropic glutamate receptor 5 density in major depression determined by [(11)C]ABP688 PET and postmortem study. Am J Psychiat 168:727-734. Franklin TB, Saab BJ, Mansuy IM (2012), Neural mechanisms of stress resilience and vulnerability. Neuron 75:747-761. Fride E, Suris R, Weidenfeld J, Mechoulam R (2005), Differential response to acute and repeated stress in cannabinoid CB1 receptor knockout newborn and adult mice. Behav Pharmacol 16:431-440. Furay AR, Bruestle AE, Herman JP (2008), The Role of the Forebrain Glucocorticoid Receptor in Acute and Chronic Stress. Endocrinology 149:5482-5490. Ganonelazar E, Akirav I (2013), Cannabinoids and traumatic stress modulation of contextual fear extinction
and
GR
expression
in
the
amygdala-hippocampal-prefrontal
circuit.
Psychoneuroendocrino 38:1675-1687. Ganonelazar E, Akirav I (2009), Cannabinoid receptor activation in the basolateral amygdala blocks the effects of stress on the conditioning and extinction of inhibitory avoidance. J Neurosci 29:11078-11088. Ganonelazar E, Akirav I (2012), Cannabinoids prevent the development of behavioral and endocrine alterations in a rat model of intense stress. Neuropsychopharmacology 37:456-466. Henningsen K, Palmfeldt J, Christiansen S, Baiges I, Bak S, Jensen ON, Gregersen N, Wiborg O (2012), Candidate hippocampal biomarkers of susceptibility and resilience to stress in a rat model of depression. Mol Cell Proteomics 11:3929-3936. Koethe D, Llenos IC, Dulay JR, Hoyer C, Torrey EF, Leweke FM, Weis S (2007), Expression of CB1 cannabinoid receptor in the anterior cingulate cortex in schizophrenia, bipolar disorder, and major depression. J Neural Transm 114:1055-1063. Li X, Need AB, Baez M, Witkin JM (2006), Metabotropic Glutamate 5 Receptor Antagonism Is Associated with Antidepressant-Like Effects in Mice. J Pharmacol Exp Ther 319:254-259. Lominac KD, Oleson EB, Pava M, Klugmann M, Schwarz MK, Seeburg PH, During MJ, Worley PF, Kalivas PW, Szumlinski KK (2006), Distinct roles for different Homer1 isoforms in behaviors and associated prefrontal cortex function. J Neurosci 25:11586-11594. Mackie K (2005) Distribution of Cannabinoid Receptors in the Central and Peripheral Nervous System, vol 168, pp 299-325. Springer Berlin Heidelberg. Maroun M, Akirav I (2008), Arousal and Stress Effects on Consolidation and Reconsolidation of Recognition Memory. Neuropsychopharmacology 33:394-405. Mizoguchi K, Ishige A, Aburada M, Tabira T (2003), Chronic stress attenuates glucocorticoid negative feedback: involvement of the prefrontal cortex and hippocampus. Neuroscience
22
119:887-897. Mohammadmirzaei N, Rezayof A, Ghasemzadeh Z (2016), Activation of cannabinoid CB1 receptors in the ventral hippocampus improved stress-induced amnesia in rat. Brain Res 1646:219-226. Nieto-Gonzalez JL, Holm MM, Vardya I, Christensen T, Wiborg O, Jensen K (2015), Presynaptic plasticity as a hallmark of rat stress susceptibility and antidepressant response. PloS one 10:e0119993. Palmfeldt J, Henningsen K, Eriksen SA, Muller HK, Wiborg O (2016), Protein biomarkers of susceptibility and resilience to stress in a rat model of depression. Mol Cell Neurosci 74:87-95. Pariante CM, Miller AH (2001), Glucocorticoid receptors in major depression: relevance to pathophysiology and treatment. Biol Psychiatry 49:391-404. Paxinos G, Watson C (1986) - The Rat Brain in Stereotaxic Coordinates: Academic Press. Rees SL, Steiner M, Fleming AS (2006), Early deprivation, but not maternal separation, attenuates rise in corticosterone levels after exposure to a novel environment in both juvenile and adult female rats. Behav Brain Res 175:383-391. Sandi C, Haller J (2015), Stress and the social brain: behavioural effects and neurobiological mechanisms. Nat Rev Neurosci 16:290-304. Segev A, Akirav I (2016), Cannabinoids and Glucocorticoids in the Basolateral Amygdala Modulate Hippocampal-Accumbens Plasticity After Stress. Neuropsychopharmacology 41:1066-1079. Shin S, Kwon O, Kang JI, Kwon S, Oh S, Choi J, Kim CH, Kim DG (2015), mGluR5 in the nucleus accumbens is critical for promoting resilience to chronic stress. Nat Neurosci 18:1017-1024. Spencer RL, Young EA, Choo PH, Mcewen BS (1990), Adrenal steroid type I and type II receptor binding: estimates of in vivo receptor number, occupancy, and activation with varying level of steroid. Brain Res 514:37-48. Steiner MA, Wotjak CT (2008), Role of the endocannabinoid system in regulation of the hypothalamic-pituitary-adrenocortical axis. Prog Brain Res 170:397-432. Tatarczy E, #x, ska, K A, #x, odzi, #x, ska, Chojnacka-Wójcik E, Pa A, #x, ucha, Gasparini F, Kuhn R, Pilc A (2001), Potential anxiolytic- and antidepressant-like effects of MPEP, a potent, selective and systemically active mGlu5 receptor antagonist. Br J Pharmacol 132:1423-1430. Wierońska JM, Brański P, Szewczyk B, Pałucha A, Papp M, Gruca P, Moryl E, Pilc A (2001), Changes in the expression of metabotropic glutamate receptor 5 (mGluR5) in the rat hippocampus in an animal model of depression. Pol J Pharmacol 53:659-662. Wilkinson MB, Xiao G, Kumar A, Laplant Q, Renthal W, Sikder D, Kodadek TJ, Nestler EJ (2009), Imipramine Treatment and Resiliency Exhibit Similar Chromatin Regulation in the Mouse Nucleus Accumbens in Depression Models. J Neurosci 29:7820-7832. Yap JJ, Iii HEC, Gale MC, Datta R, Miczek KA (2005), Behavioral sensitization due to social defeat stress in mice: antagonism at mGluR5 and NMDA receptors. Psychopharmacology 179:230-239. Zhang XH, Jia N, Zhao XY, Tang GK, Guan LX, Wang D, Sun HL, Li H, Zhu ZL (2013), Involvement of pGluR1, EAAT2 and EAAT3 in offspring depression induced by prenatal stress. Neuroscience 250:333-341. Zhu Z, Sun H, Gong X, Li H (2016), Different effects of prenatal stress on ERK2/CREB/Bcl-2 expression in the hippocampus and the prefrontal cortex of adult offspring rats. Neuroreport 27(8):600. Zunszain PA, Anacker C, Cattaneo A, Carvalho LA, Pariante CM (2011), Glucocorticoids, cytokines and brain abnormalities in depression. Prog Neuropsychopharmacol Biol Psychiatry 35:722-729.
23
24
25
26
27
Table 1 Primer sequences used for real-time PCR. Target
Forward primer
Reverse primer
Production lengths
mGluR5 GAPDH
TGAGAGGAAGTGTGGTGCAG
CAAGTGTGATGTTGGGCAAG
CAAGGTCATCCATGACAACTTG
GTCCACCACCCTGTTGCTGTAG
116 496
28
Highlights
GR was associated with the lower mGluR5 mRNA and protein in susceptibility rats of CMS group.
CB1 was related to the lower mGluR5 mRNA and protein in susceptibility rats of AS group.
Glucocorticoid and cannabinoid systems in hippocampus may regulate susceptibility and resilience to stress.