- Email: [email protected]
PS1 mice
Behavioural Brain Research 383 (2020) 112503
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Research report
Hippocampal overexpression of SGK1 ameliorates spatial memory, rescues Aβ pathology and actin cytoskeleton polymerization in middle-aged APP/ PS1 mice
T
Biyao Liana,1, Mengying Liub,c,1, Zhen Lanb, Tao Sunb, Zhaoyou Mengb, Qing Changa, Zhi Liud, Jiqiang Zhangb,*, Chengjun Zhaoa,* a
Department of Histology and Embryology, Ningxia Medical University, Yinchuan, 750004, China Department of Neurobiology, Third Military Medical University, Chongqing, 400038, China The 305 Hospital of PLA, 100017, Beijing, China d Department of Histology and Embryology, Third Military Medical University, Chongqing 400038, China b c
A R T I C LE I N FO
A B S T R A C T
Keywords: SGK1 APP/PS1 mice Hippocampus Spatial memory Dendritic spine Rictor
The increasing occurrence and ineffective treatment of Alzheimer’s disease (AD) has become one of the major challenges of the world. Limited studies have shown that serum- and glucocorticoid-inducible kinase 1 (SGK1) is involved in spatial memory formation and consolidation, but its role in AD-like spatial memory impairment and the related mechanisms are not clear. In this study, we first examined the age-related changes of SGK1 in the hippocampus of female APP/PS1 (AD) mice. Based on the finding and our previous finding that significant spatial memory impairment was detected in 8-month old AD mice, SGK1-overexpressing AAV (oSGK1) was constructed and injected into the hippocampus of 9-month old AD mice. One month later, the behavior alterations, Aβ production and deposit as well as changes of CA1 spine density and selected actin polymerization remodeling proteins were examined. The results showed that significant decrease of SGK1 was detected in 10month old AD mice. The spatial memory impairment, the production and deposit of Aβ were reversed by oSGK1. Levels of hippocampal ADAM10 (α-secretase) and IDE (Aβ degradase), actin remodeling related proteins Rictor, Rac1, Cdc42 and Profilin-1 were significantly increased after oSGK1 treatment while hippocampal BACE1 (γsecretase) and Cofilin remained unchanged. Taken together, our findings demonstrated a pivotal role of SGK1 in the treatment of AD-related memory impairment through upregulation of non- amyloidogenic processing of APP and degradation of Aβ, increase in spine plasticity related proteins, indicating increase in hippocampal SGK1 may be a potent therapeutic target against AD.
1. Introduction The hippocampus is one of the most studied brain structures and crucial in forming new memories quickly and automatically but does not keep them for long [1] thus plays important roles for learning, memory formation and consolidation and cognition [2]. Accumulated evidences have shown that the structure and function of hippocampus could be regulated by many factors. For example, it is seriously affected by Alzheimer’s disease (AD) [3–5]. Hippocampal neurogenesis has been shown to be regulated by stress and treatment with glucocorticoid hormones [6], fluctuation of estrogens such as estrus cycle [7], ovariectomy [8–11] and/or estrogen synthase (aromatase) inhibition [9]. Serum- and glucocorticoid-inducible kinase 1 (SGK1) is a member of
the Ser/Thr protein kinase family. An early study by Warntges et al. localized SGK1 mRNA in the rat hippocampus and many other brain nuclei using Northern blot; further they used in situ hybridization and immunohistochemistry and found that in the hippocampus, an increased expression of SGK1 in neurons of the hippocampal area CA3 after dehydration [12]. Since hippocampus is the center for learning and memory and is one of the most important targets of AD [13], several pilot studies explored the role of SGK1 in hippocampus-dependent memory. The fast-learning rats showed significant higher expression of SGK1 when compared with slow-learning rats [14]. Inhibition of laminin-β1, one isoform of laminin, enhanced spatial learning but it was blocked by co-transfection with SGK1 siRNA [15], and dominant negative mutant SGK1 markedly impaired spatial
⁎
Corresponding authors. E-mail addresses: [email protected], [email protected] (J. Zhang), [email protected] (C. Zhao). 1 These authors contributed equally to this study. https://doi.org/10.1016/j.bbr.2020.112503 Received 6 November 2019; Received in revised form 30 December 2019; Accepted 21 January 2020 Available online 22 January 2020 0166-4328/ © 2020 Elsevier B.V. All rights reserved.
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
staining to show dendritic spine (n = 3).
memory formation [16]. Thus, SGK1 contributed to memory consolidation [17] and spatial memory formation [18]. Additionally, SGK1 markedly increased the activity of the neuronal K + channel Kv1.3 that has been related to neuronal excitability [12]. It increased dendritic growth of primary hippocampal neurons through microtubule depolymerization, SGK1 transfection significantly increased the number of primary neurites and shortened the length of the total process in cultured hippocampal neurons [19]. But the role of SGK1 in AD related spatial memory impairment is not elucidated. Accumulation and aggregation of β-amyloid (Aβ) induce neuronal death and cognitive dysfunction seen in AD [20]. Aβ is resulted from a sequential cleavage by β-secretase (beta-site amyloid precursor protein cleaving enzyme 1, BACE1) and γ–secretase through proteolytic processing of amyloid precursor protein (APP) [21,22]. While ADAM10, the disintegrin metalloproteinase 10, is the main α-secretase responsible for the non-amyloidogenic processing of APP [23] thus preventing Aβ generation [24]. Additionally, insulin-degrading enzyme (IDE) has been shown to degrade Aβ [22]. Rictor (rapamycin-insensitive companion of mTOR) functions to control the actin cytoskeleton polymerization that involves Rho small GTPases family members and its downstream effector profilin-1 (induces actin polymerization) and cofilin (induces actin depolymerization) [25–27]; and Rictor conditional knockout selectively impaired long-term memory and the late long-term potentiation, indicating the importance of Rictor in the regulation of spatial memory [28]. Although SGK1 has been shown to play a role in memory formation and consolidation [16–18] as well as Aβ production [29], its effects on AD-related behavior and pathologies as well the related mechanisms are far from clear. Therefore, in this study, we overexpressed SGK1 in the hippocampus of middle-aged APP/PS1 AD model mice, examined the changes of learning and memory behavior, Aβ production and senile plaque deposit; meanwhile, changes of CA1 dendritic spine density and hippocampal actin cytoskeleton polymerization related proteins were also investigated.
2.2. SGK1 overexpressing AAV vector construction, stereotaxic injection and verification The sgk1 overexpression (oSGK1) adeno-associated virus (AAV) vector (pAAV [Exp]-CMV > mSgk1 [NM_001161845.2] (ns):T2A:EGFP) and the empty control virus vector (pAAV[Exp]CMV > EGFP) were provided by Cyagen Biology (Guangzhou, China). The stereotaxic injection was performed essentially in accordance with our previously reports [8,31]. In brief, the animals were anaesthetized with Isoflurane and then mounted onto a stereotaxic apparatus (Stoelting Instruments, Wood Dale, IL, USA), the oSGK1 or empty vector was infused into the bilateral CA1 of the hippocampus (0.5 μl each; AP: -2.00 mm, ML: +/-1.40 mm, DV:-1.00 mm, relative to Bregma). The speed of injection was performed at a rate of 0.1 μl/min using an injection pump (Harvard Apparatus, Holliston, MA, USA) equipped with a 1-μl Hamilton syringe. The syringe was stayed for five minutes after injection. For the overexpressing efficacy analysis, immunofluorescence and qPCR were employed (n = 3 each). For the behavior test, Morris water maze was used (n = 10 in each group). 2.3. Morris water maze test The classic Morris water maze test was used to evaluate the effects of hippocampus specific overexpression of SGK1 on spatial learning and memory according to our previous report [8]. During the 5 d place learning, the mice were placed on the submerged platform in white opaque pool, the test started randomly in one of the four quadrants (L: the left quadrant; R: the right quadrant; T: the target quadrant; O: the opposite quadrant). On day 6, the memory test, the platform was removed and the test was started usually at the opposite quadrant and lasted for 60 s; the time to find the target quadrant and the times to cross the platform were recorded by a tracking system connected to the image analyzer (HVSImage, Hampton, UK). The swim speed and traveled distance were also automatically recorded with the same system.
2. Material and method 2.1. Animal and treatment
2.4. Immunohistochemistry (IHC) and immunofluorescence (IF) The female APP/PS1 mice and the sex- and age-matched wild type C57BL/6 mice (C57) were obtained from the Model Animal Research Centre of Nanjing. All animal-related experiments were conducted in accordance with Approved Institutional Animals Care and Use protocols of Third Military Medical University. The mice were randomly grouphoused, raised in an environment where they could eat water and food freely and maintained on a 12-h light, 12-h dark cycle. Before sacrifice, the vaginal smears of the mice were prepared and the cycling of all the animals was examined by Tar purple staining. In order to make the circulating levels of estrogens comparable among the animals, only the diestrus mice were used for further experiments. To examine the age-related (4-, 6-, 8-, 10-month old) changes of hippocampal SGK1 expression, the tissue preparation for immunohistochemistry (n = 3 in each group) was conducted as reported by a previous report [30]. For the Quantitative real-time PCR (qPCR) analysis of hippocampal SGK1 expression in these mice, the protocols were described below (n = 3 in each group). These mice were sacrificed at the pre-defined time-point. For virus injection experiments, 10month old female C57 mice were used as the control (C57; n = 10), 10 female APP/PS1 mice of 9-month old were used for empty virus vector injection (APP/PS1; n = 10) and another 10 female APP/PS1 mice of the same age were used for SGK1 overexpressing virus injection (oSGK1; n = 10). One month after virus injection, the learning and memory behavior of these virus-treated mice and the corresponding control C57 mice were examined with the 6 d Morris water maze, then they were sacrificed for Western blot analysis (n = 3), immunohistochemistry and immunofluorescence staining to show Aβ and Congo Red staining to show senile plaque (n = 4), and Golgi-cox
For all the staining-related experiments, mice were deeply anesthetized with an injection of sodium pentobarbital (i.p) and transcardially perfused with saline and 4 % paraformaldehyde in PBS. The brains were dissected and the dehydration was conducted with 30 % sucrose solution, the brain was cut into 25-μm-thick sections with a cryostat (CM1900, Leica Microsystems, Heidelberger, Germany). The sections were collected with 24-well plate containing 4 % paraformaldehyde until use. IHC and IF were performed to examine the changes of hippocampal SGK1 and β-Amyloid (Aβ). The procedure used was similar to our previous report [32]. For IHC, the sections were washed with PBS and quenched for 15 min with 3 % H2O2 and blocked with sheep serum (ZLI-9022, Zhongshan Biotech, Beijing, China) for 20 min; then the sections were incubated overnight at 4 °C with the primary antibodies against SGK1 or Aβ (see Table 1) prepared with the antibody diluent (ZLI-9028, Zhongshan). After washing with PBS, the sections were incubated with a corresponding biotinylated secondary antibody (1:200, goat-anti-rabbit, ZB-2010; 1:200, goat-anti-mouse, ZB-2094; Zhongshan) at room temperature for 1 h. Then, Sections were washed with PBS again and incubated with the HRP-labeled streptavidin (1:200, ZB2404, Zhongshan) for 1 h and then visualized using a DAB-nickel chromogen kit (SK-4100, Vector Laboratories Inc., Burlingame, USA) for 5 min at room temperature. The slides were air-dried, cleared with xylene, and mounted. Finally, the slides were imaged with an Olympus microscope (BX60, Olympus, Tokyo, Japan), the optical density was analyzed using Image-Pro Plus software 6.0 (Media Cybernetics, Rockville, USA). 2
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Table 1 The primary antibodies used for WB and/or IHC/IF in this study. Name
Mol. Weight
Specificity
Dilution IHC/IF
ADAM10 BACE1 Cdc42 Confilin IDE Profilin-1 Rac1 Rictor SGK1 β-actin β-Amyloid
100kDa 70kDa 21kDa 19kDa 55kDa 21kDA 21kDa 200kDa 70kDa 42kDa
rabbit monoclonal rabbit monoclonal rabbit polyclonal rabbit polyclonal mouse monoclonal rabbit polyclonal mouse monoclonal rabbit polyclonal rabbit polyclonal mouse monoclonal mouse monoclonal
Source
ab124695 ab108394 2462 3318 sc-393887 3237 ab33186 2140 210735 AA128 A5213
Abcam Abcam Cell Signaling Cell Signaling Santa Cruz Cell Signaling Abcam Cell Signaling Sigma Beyotime Sigma
WB 1:500 1:1000 1:800 1:800 1:500 1:800 1:800 1:800 1:500 1:1000
1:200
Cat No.
1:200
IHC: immunohistochemistry. IF: immunofluorescence. WB: Western blot.
2.7. Western blot
For IF, the sections were washed with PBS and blocked with sheep serum (ZLI-9022, Zhongshan Biotech) for 20 min then incubated overnight at 4 °C with the primary antibodies (see Table1) prepared with the antibody diluent (ZLI-9028, Zhongshan). After washed with PBS and incubated with a corresponding fluorescent secondary antibodies (1:200, A10040, Alexa Fluor 546, donkey-anti-rabbit IgG, Thermo Fisher Scientific; A10037 Alexa Fluor 568 donkey-anti-mouse IgG, Thermo Fisher) diluted 1:200 with PBS for 1.5 h at room temperature and the sections were washed with PBS again and counterstained with DAPI (C1005, Beyotime). Finally, the slides were washed for 5 min with PBS and mounted with fluorescence quenching agent (P0176-3, Beyotime). The pictures were obtained with the same Olympus microscope as mentioned above; the optical density was measured and analyzed with Image-J software.
Western blot analysis was conducted according to our previous reports [8,33]. Briefly, the hippocampi of each group were dissected, pooled and lysed with RIPA buffer (P0013B, Beyotime Biotech, Beijing, China) containing 1 % PMSF (ST506, Beyotime). The protein concentration was measured with a BCA Assay Kit (P0010, Beyotime) then the protein was diluted with loading buffer and ddH2O. After SDSPAGE, the separated proteins were transferred to PVDF membrane and blocked with 5 % nonfat dry milk dissolved in TBST for 2 h at room temperature, then PVDF membrane was cut into small strips according to the molecular weight of individual target protein, and the strips were incubated with specific antibodies (see Table 1) overnight at 4 °C. After washing with TBST, the stripes were incubated with goat-anti-mouse secondary antibody (1:2000, ZB-2305, Zhongshan), and goat-antirabbit secondary antibody (1:2000; ZB-2301, Zhongshan), respectively. Finally, the blots were developed with a chemiluminescent HRP kit (WBKLS0100, Merk Millipore, Massachusetts, USA) and visualized with Western Lighting-ECL (Bio-Rad, Hercules, USA). The Quantity One software (Bio-Rad) was used to measure the optical density of each band and β-actin was used as an internal control. All of these experiments were repeated at least three times.
2.5. Congo red staining Congo Red staining was used to examine the changes of Aβ senile plaques in the hippocampus. The tissue sections were washed with PBS three times for 5 min, then the sections were transferred to pre-heated (70℃) EP tube containing FD Congo Red solution (PS108, FD Neurotechnologies Inc., Columbia, MD, USA) for 20 min. The sections were then dipped into 80 % ethanol containing 0.2 % NaOH three times. Finally, the positive materials were photographed with the same Olympus microscope as mentioned above and the number of plaques and the area percentage of plaques (area %) were measured and analyzed with Image-J software.
2.8. Golgi-Cox staining Golgi-Cox staining was performed with a FD Rapid Golgi Stain Kit (PK401, FD NeuroTechnologies, Columbia, USA) according to the manufacturer’s instructions and our previous report [34]. The brains of each group were dissected quickly, washed with dd-H2O and then impregnated in the Golgi-Cox solution (Solution A: B = 1:1) with one change on the next day. These brains were stored at room temperature in dark for 2 weeks, and then each sample was transferred into Solution C in darkness for 7 days at room temperature. The brains were then cut into 200-μm-thick slices with a vibratome (Microslicer DTK- 600, Dosaka EM, Tokyo, Japan) and mounted on gelatin-coated slides and airdried in a dark place for 2 weeks. The slices were the incubated with a mixture of Solution D, Solution E, and distilled water (1:1:2) for 10 min; and then dehydrated with 50 %, 75 %, 95 %, and 100 % alcohol. Finally, the sections were cleaned, mounted, and photographed with an Olympus microscope (100× oil immersion lens). The number of dendritic spines along the secondary branching of the dendrites of CA1 pyramidal neurons was measured double-blindly with Image-Pro Plus software (Media Cybernetics), and the number of dendritic spines per 20 μm was counted and used for further analysis.
2.6. Quantitative real-time PCR (qPCR) To quantify the levels of SGK1 mRNA, the hippocampal of selected mice in each group were collected, and the total RNA of each group was extracted with Trizol method (15596018, Invitrogen, Shanghai, China); the A260/A280 was 1.8–2.0, and the mass fraction was > 90 %. Reverse transcription into complementary deoxyribonucleic acid (cDNA) was conducted using the ReverTra Ace qPCR RT Kit (FSQ-101, Toyobo Life Science, Osaka, Japan). The used primers were: SGK1 forward: GCCAAACCCTCCGACTTTCAC; reverse: CTTGTGCCTAGCCA GAAGAACC. The reaction system and conditions were carried out according to the instructions provided by the SYBR Green Real-Time PCR Master Mix Kit (QPK-212, Toyobo Life Science). The relative level of GAPDH gene was used as internal control (forward: CGTGTTCCTACC CCCAATGT; reverse: TGTCATCATACTTGGCAGGTTTCT), and the relative expression levels of the target gene were calculated using the 2−ΔΔCt model.
2.9. Statistical analysis The results were presented as the mean ± S.E. and the data were 3
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Fig. 1. Age-related changes of SGK1 in the hippocampus of APP/PS1 mice. A: IF showed significantly lower levels of SGK1 protein were detected at 10-month age (10 M) in APP/PS1 mice. B: qPCR showed significantly lower levels of SGK1 mRNA were detected at 10 M in APP/PS1 mice. Data were shown as mean ± SEM. **: p < 0.01; one-way ANOVA and Tukey test. Bar = 500 μm.
C57 (p > 0.05 for Day 1; p ＜ 0.01 for Day 2; p < 0.01 for Day 3; p < 0.05 for Day 4; p < 0.01 for Day 5) as well as oSGK1 and C57 (p > 0.05 for Day 1; p＜0.01 for Day 2; p < 0.05 for Day 3; p ＞0.05 for Day 4; p < 0.05 for Day 5). In detail, there were no significant differences among the treatments on day 1. From day 2, APP/PS1 and oSGK1 mice showed significantly longer escape latency than C57 mice, indicating impaired learning in APP/PS1 mice. However, this difference was substantially reversed by oSGK1 at day 4 compared to C57 (p > 0.05). On day 5, the analysis revealed that the escape latencies did not show statistical differences between the APP/PS1 and oSGK1, but oSGK1 mice still showed shorter latencies compared to C57 mice. For the memory test on day 6, there were general differences among C57, APP/PS1 and oSGK1 (F (2, 27) = 7.719, p < 0.01, Fig. 3B and D). For the time the animals spent in the target quadrant within the 60 s test, it was 41.83 % (24.77 ± 4.10 s) for the C57 mice, 30.5 % (18.30 ± 3.18 s) for the APP/PS1 mice, 39.77 % (23.86 ± 4.56 s) for the oSGK1 mice. In detail, the APP/PS1 mice spent significantly shorter time in the target quadrant when compared to the C57 (p < 0.01), and this was reversed by SGK1 overexpression treatment (p < 0.01). Additionally, the APP/PS1 mice showed a significant decrease in the number of times crossing the platform location than C57 mice, and this was reversed by SGK1 overexpression treatment (F (2, 27) = 27.458, p < 0.01, Fig. 3C), but there were no statistical differences between C57 and oSGK1 (p > 0.05). Moreover, the swimming speed and total distance traveled showed no statistical differences among the three groups (F(2, 27) = 0.476, p > 0.05 for swimming speed; F(2, 27) = 0.559, p > 0.05 for distance traveled; Fig. 3E-F).
analyzed using SPSS software (version 22.0; IBM; Chicago, IL). Behavioral data were analyzed with repeated two-way mixed ANOVA (day × treatment). Other measurements were analyzed using one-way ANOVA. The Tukey test or t-test were employed for analysis and the statistical significance was defined as p < 0.05. 3. Results 3.1. Age-related changes of hippocampal SGK1 in the APP/PS1 mice We first examined the level of hippocampal SGK1 in the APP/PS1 mice using IHC and qPCR. As illustrated in Fig. 1A-B, one-way ANOVA revealed that there were significant differences among different ages (4−10 M old) of mice (F(3,20) = 23.387, p < 0.01 for IHC; F (3,8) = 20.251, p＜0.01 for qPCR), indicating the levels of SGK1 were changed with aging from 4 to 10 M old. Further analysis revealed that there were no significant differences among 4, 6 and 8 M (p > 0.05), but the levels of hippocampal SGK1 were significantly decreased at 10 M when compared with other checkpoint (p＜0.01). 3.2. Hippocampal oSGK1 ameliorated the behavioral impairment of APP/ PS1 mice According to the above results, we constructed SGK1 overexpressing AAV vector (Fig. 2A and B) and verified the efficacy of oSGK1 AAV using q-PCR and IF. As shown in Fig. 2C and D, qPCR and t-test revealed that the levels of sgk1 mRNA in oSGK1 mice were significantly increased when compare to APP/PS1 mice (p < 0.01) and similar results were also detected with IF (p < 0.01), indicating that SGK1 was successfully overexpressed in the hippocampus of mice. Based on the successful overexpression of SGK1 in middle-aged APP/PS1 mice, we then tested the effects of hippocampal oSGK1 on the learning and memory of these mice. As shown in Fig. 3A, repeated two-way mixed ANOVA revealed that the escape latencies were significantly affected by both day (F (4,108) = 75.478, p < 0.01) and treatment (F (2,27) = 25.457, p < 0.01); but there was no detectable day × treatment interaction (F (8,108) = 1.702, p > 0.05). One-way ANOVA showed that there were general statistical differences among C57, APP/ PS1 and oSGK1 except day 1 (F(2,27) = 1.610, p > 0.05 for Day 1; F (2,27) = 7.132, p＜ 0.01 for Day 2; F(2,27) = 5.951, p < 0.01 for Day 3; F(2,27) = 3.876, p < 0.05 for Day 4; F(2,27) = 13.364, p < 0.01 for Day 5). Similar differences were detected between APP/PS1 and
3.3. Hippocampal oSGK1 inhibited Aβ generation and senile plaques formation IF and IHC were used to examine the effects of oSGK1 on the production of hippocampal Aβ. As shown in Fig. 4A-B, one-way ANOVA revealed that there were general differences among C57, APP/PS1 and oSGK1 (F(2,15) = 101.265, p＜0.01 for IF; F(2,15) = 41.927, p < 0.01 for IHC). The Tukey test of the two experimental methods showed significant more plaques formed in APP/PS1 mice but this was reversed by oSGK1 (p < 0.01) to the control levels (p < 0.01, oSGK1 vs C57). Congo Red staining was used to examine the formation of senile plaques in the hippocampus. As shown in Fig. 4C–E, One-way ANOVA showed that there were significantly differences among C57, APP/PS1 4
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Fig. 2. The construction and verification of SGK1 overexpressing adeno-associated virus. A: SGK1 overexpression virus vector construction strategy. B: The empty virus vector used as control. C: qPCR revealed the levels of SGK1 mRNA in the oSGK1 hippocampus were significantly increased compared to APP/PS1 mice. D: IF revealed that the levels of hippocampal SGK1 in the oSGK1 group were significantly increased compared to APP/PS1 mice. Data were shown as mean ± SEM. **: p < 0.01; t-test. Bar = 500 μm.
C57 mice, in which no senile plaques were detected.
and oSGK1 (F(2,15) = 62.936, p < 0.01 for the number of senile plaques; F(2.15) = 79.138, p < 0.01 for the area (%) of senile plaques). The Tukey test indicated that the number and area (%) of senile plaques of oSGK1 group was significantly lower than APP/PS1 group (p < 0.01), although they were still higher than that detected in the
Fig. 3. Effects of SGK1 overexpression on spatial learning and memory performance in APP/PS1 mice. A: From day 2 to day 5 of the learning phase, the APP/PS1 mice showed significantly longer escape latencies than the C57 animals, and this could be hardly improved by hippocampal-specific SGK1 overexpression except at day 4; two-way mixed measures ANOVA and Tukey test. B-C: Memory test. The memory impairment seen in the APP/PS1 mice could be reversed by SGK1 overexpression; one-way ANOVA and Tukey test. D: Representative tracking of mice spent in the maze during the memory trail. Both C57 and oSGK1 spent longer time in target quadrant compared to the remaining three quadrants, one-way ANOVA and Tukey test. E-F: The swimming speed and total distance traveled did not change in each group. Data were shown as mean ± SEM. T: target quadrant; R: right of target quadrant; O: opposite of target quadrant; L: left of target quadrant. *:P < 0.05;**: p < 0.01#:P < 0.05;##:P < 0.01. 5
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Fig. 4. Effects of SGK1 overexpression on Aβ formation and deposition in APP/PS1 mice. A-B: Hippocampal-specific SGK1 overexpression decreased the Aβ production compared to APP/PS1. C: The effect of SGK1 overexpression on senile plaques deposition in mice was examined by Congo Red staining. D-E: Hippocampalspecific SGK1 overexpression significantly reduced the number of senile plaques (amount) and the area percentage (%) of senile plaques compared to APP/PS1. **: p < 0.01; One-way ANOVA and Tukey test. Bar = 500 μm.
3.4. Hippocampal oSGK1 promoted non-amyloidogenic cleavage of APP and Aβ degradation
3.5. The effects of hippocampal oSGK1 on CA1 spine density and actin remodeling proteins
To elucidate the mechanisms underlying oSGK1 inhibition on Aβ generation and plaque formation, we examined several proteins that related Aβ production and degradation in the hippocampus of the C57, APP/PS1 and oSGK1 mice. As shown in Fig. 5A, One-way ANOVA and Tukey test revealed that hippocampal ADAM10 in APP/PS1 mice was significantly lower than C57 mice (p < 0.01) and this was unregulated after oSKG1 treatment (p < 0.01 vs APP/PS1) to a level comparable to C57 mice (p > 0.05 vs oSGK1). For hippocampal BACE1 (Fig. 5B), APP/PS1 mice had significantly higher levels than C57 (p < 0.01), but it did not show any differences compared to that detected in oSGK1 mice (p > 0.05). Since Aβ could be degraded by IDE, we then examined it changes after oSGK1 treatment. As shown in Fig. 5C, APP/ PS1 mice showed significantly lower levels of hippocampal IDE than C57 mice (p < 0.01), and this could be significantly increased after oSKG1 treatment to a level comparable to C57.
The alteration of spine density is the basis of synaptic plasticity but whether it was regulated by oSGK1 remains unclear. As shown in Fig. 6A, one-way ANOVA revealed that there were general differences among C57, APP/PS1 and oSGK1 mice (F(3,32) = 16.384, p < 0.01). Tukey test showed that the spine density was significantly decreased in the hippocampus of APP/PS1 mice when compared to that in the C57 mice (p < 0.01), and this decrease could be reversed by oSGK1 treatment (p < 0.01 vs APP/PS1). For hippocampal Rictor and Profilin-1, One-way ANOVA revealed that there were general differences among C57, APP/PS1 and oSGK1 regarding Rictor and Profilin-1 (F (2, 15) = 47.803, p < 0.01 for Rictor and F(2,15) = 52.525, p < 0.01 for Profilin-1). Tukey test revealed that their levels were decreased in APP/PS1 mice compared to the C57 groups (p < 0.01) but it was significantly reversed by oSGK1 (p < 0.01). Regarding the changes in hippocampal Confilin, One-way ANOVA revealed no significant differences among three groups (F (2,15) = 0.773, p > 0.05). These results were shown in Fig. 6B and D. 6
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Fig. 5. Effects of SGK1 overexpression on APP metabolism and Aβ degradation. A: Hippocampal-specific SGK1 overexpression increased ADAM10. B: Hippocampalspecific SGK1 overexpression did not affect BACE1. C: Hippocampal-specific SGK1 overexpression increased IDE. Data were shown as the mean ± SEM. **: p < 0.01; One-way ANOVA and Tukey test.
Fig. 6. Effects of SGK1 overexpression on CA1 spine density and actin remodeling proteins in the hippocampus of APP/PS1 mice. A: Hippocampal-specific SGK1 overexpression increased CA1 dendritic spine density. B-C: Hippocampal-specific SGK1 overexpression increased levels of Rictor and Profilin-1. D: Hippocampalspecific SGK1 overexpression increased did not affect Confilin. E-F: Hippocampal-specific SGK1 overexpression increased Rac1 and Cdc42. Data were shown as mean ± SEM. **: p < 0.01;*＜0.05; One-way ANOVA and Tukey test.
p < 0.01 for Cdc42). These results were shown in Fig. 6E and F.
The Rho-family GTPases have also been shown to play essential roles in orchestrating the development and remodeling of spine plasticity, in which the protein Rac1 and Cdc42 are the most important members [35–37]. One-way ANOVA showed that there were significant differences regarding the expression of hippocampal Rac1 and Cdc42 among the treatments (F(2,15) = 6.731, p < 0.01 for Rac1; F (2,15) = 26.072, p < 0.01 for Cdc42). Tukey test showed that the expression of Rac1 and Cdc42 was significantly downregulated in APP/ PS1 mice (p < 0.05 for Rac1 and p < 0.01 for Cdc42, compared to C57) and it was reversed by oSGK1 treatment (p < 0.05 for Rac1 and
4. Discussion SGK1 has been shown to be involved in the regulation of spatial memory, but its effects on the behaviors of APP/PS1 mice and related mechanisms are not clear. Since significant decrease of SGK1 in the hippocampus of these mice was detected at 10 months old, we constructed SGK1 overexpressing AAVs and injected them to the hippocampus then examined the behavior alterations and molecular and 7
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
functions primarily to promote actin polymerization but a minor role in actin depolymerization. So far it seems only one study showed that that SGK1 promoted the expression of Cdc42 in macrophages [49], thus our findings provided novel insight into understanding the role of SGK1 in the regulation of actin polymerization/depolymerization, especially in the hippocampus of AD mice. The increasing prevalence of AD has become the most serious challenge we must face. Currently the exact triggering factor of AD is unknown and the treatments for AD are quite limited, great efforts have been made targeting Aβ/senile plague but the results seem to suffer a great failure [50,51]. In an attempt to search potential candidate against AD, we overexpressed SGK1 in the hippocampus of middle-aged APP/PS1 mice and the results showed that the AD-like spatial memory impairment was significantly reversed by SGK1 overexpression. Meanwhile, the production and deposit of Aβ, the expression of actinremodeling proteins as well as the density of CA1 dendritic spines were also altered after SGK1 overexpression. Although several previous studies have reported the involvement of SGK1 in memory formation and consolidation [16–18], the current study presented the first direct evidence of SGK1 against AD behavior and pathology. Overall, our results together with other findings [16–18] strongly suggested that SGK1 may be a potent target for the treatment of AD.
dendritic changes one month later. The results showed that while the learning abilities of the AD mice were not obviously improves (the statistical significant improvement was only detected at day 4; the escape latency was longer than vector-treated mice but without statistical significance), the impaired spatial memory of vector-treated AD mice were obviously ameliorated after SGK1 overexpression, indicating the importance of hippocampal SGK1. Generally, these results were in well accordance with previous studies shown that increased hippocampal SGK1 was positively correlated with better learning and memory abilities [14–16,18]. Abnormal processing of APP has been regarded as the important early event in AD [38] and Aβ production and its deposited senile plaque [3–5] are two of the most featured pathologies of AD. To explore the underlying mechanisms of SGK1 on impaired spatial memory seen in AD, we examined the effects of overexpression of SGK1 on Aβ production using IF staining. The results showed that the control C57 mice had little Aβ production, while it significantly increased in AD mice and this increase could be reversed with SGK1 overexpression. The above findings were further demonstrated with Congo Red staining targeting the deposit of Aβ, strongly indicating the pivotal role of SGK1 in the production of Aβ and formation of plaques as proposed by previous works [29,39]. Furthermore, we for the first time reported that the inhibition of Aβ production of hippocampal overexpression of SGK1 was due to increase the non-amyloidogenic processing of APP mediated by ADAM10 [23] but did not affect the amyloidogenic processing of APP mediated by BACE1 [21,22]. Most importantly, we found that the degradation of Aβ was significantly enhanced by overexpression of SGK1, because levels of hippocampal IDE, the enzyme functions to degrade Aβ [22], were significantly increased by SGK1 overexpression. Although both Neprilysin (another Aβ degradase) and IDE have been shown to play significant roles in extracellular and intracellular Aβ degradation, IDE is specific toward β-structure-forming substrates, making it the proteolytic culprit against the formation of toxic Aβ oligomers associated with AD [40]. In fact, IDE has been regarded is the major protease responsible for Aβ clearance in human hippocampal lysates [41]. Thus, SGK1 overexpression induced decrease Aβ production and deposit involved two ways: increase in non-amyloidogenic metabolism of APP and increase in Aβ degradation. However, how SGK1 regulates the expression of ADAM10 and IDE remains further investigation. Dendritic spine contributes to proper synaptic function and memory formation [42]. Its morphological changes are driven by actin cytoskeleton dynamics including polymerization and depolymerization [37,43]. Additionally, Rho family is one of the Ras superfamily members and the most extensively studied members of Rho family are Rac1 (Ras-related C3 botulinum toxin substrate 1), Cdc42 (cell division control protein 42) and RhoA (Ras homolog gene family, member A) [44]. Accumulated studies have shown that they are major modulators of the postsynaptic spine morphology and density [45] thus play a role in learning and memory [37,46]. When activated, Rac1 and Cdc42 functions to promote spine formation, growth and stabilization [37,47] but activated RhoA has opposite effects compared to Rac1 and Cdc42 [47]. Rictor has been shown to be a positive regulator of the Rac1 and Cdc42 [25] and Profilin-1 and Cofilin are the downstream effectors of Rho [26,27]. In this study, we first examined the changes of CA1 dendritic spine density and found it was significantly decreased in middle-aged APP/PS1 mice when compared to that of the control mice, and then we found this decrease was limitedly but statistic significantly increased by overexpression of SGK1. These results were in general in accordance with previous study showing a positive relationship of SGK1 and dendritic spine morphology [48]. To address the underlying mechanisms, we examined the changes of hippocampal Rictor, Rac1, Cdc42, Profilin-1 and Cofilin. The results showed that although the decreased Cofilin in APP/PS1 mice was not altered by SGK1 overexpression, the levels of other actin polymerization/related molecules were significantly regulated by SGK1, indicating hippocampal SGK1
CRediT authorship contribution statement Biyao Lian: Data curation, Formal analysis, Methodology, Visualization, Writing - original draft. Mengying Liu: Data curation, Formal analysis, Methodology, Visualization, Writing - original draft. Zhen Lan: Formal analysis, Methodology. Tao Sun: Methodology. Zhaoyou Meng: Funding acquisition. Qing Chang: Visualization, Writing - review & editing. Zhi Liu: Methodology. Jiqiang Zhang: Conceptualization, Funding acquisition, Visualization, Writing - review & editing. Chengjun Zhao: Conceptualization, Writing - review & editing. Declaration of Competing Interest The authors declare that they have no conflicts of interest. Acknowledgements This work was supported by the grant from the Development and Regeneration Key Laboratory of Sichuan Province (SYS18-02), China Postdoctoral Science Foundation Grant (2019M653976) and Chongqing Natural Science Foundation (cstc2019jcyj-msxmX0255). References [1] M. Cascella, Y. Al Khalili, Short Term Memory Impairment, StatPearls, StatPearls Publishing LLC., Treasure Island (FL), 2019. [2] P. Zeidman, E.A. Maguire, Anterior hippocampus: the anatomy of perception, imagination and episodic memory, Nat. Rev. Neurosci. 17 (3) (2016) 173–182. [3] H. Sun, M. Liu, T. Sun, Y. Chen, Z. Lan, B. Lian, C. Zhao, Z. Liu, J. Zhang, Y. Liu, Age-related changes in hippocampal AD pathology, actin remodeling proteins and spatial memory behavior of male APP/PS1 mice, Behav. Brain Res. 376 (2019) 112182. [4] C. Aluganti Narasimhulu, C. Mitra, D. Bhardwaj, K.Y. Burge, S. Parthasarathy, Alzheimer’s disease markers in aged ApoE-PON1 deficient mice, J. Alzheimers Dis. 67 (4) (2019) 1353–1365. [5] T. Ondrejcak, I. Klyubin, G.T. Corbett, G. Fraser, W. Hong, A.J. Mably, M. Gardener, J. Hammersley, M.S. Perkinton, A. Billinton, D.M. Walsh, M.J. Rowan, Cellular prion protein mediates the disruption of hippocampal synaptic plasticity by soluble tau in vivo, J. Neurosci. 38 (50) (2018) 10595–10606. [6] K.R. Mifsud, J.M. Reul, Acute stress enhances heterodimerization and binding of corticosteroid receptors at glucocorticoid target genes in the hippocampus, Proc. Natl. Acad. Sci. U. S. A. 113 (40) (2016) 11336–11341. [7] C.S. Woolley, B.S. McEwen, Estradiol mediates fluctuation in hippocampal synapse density during the estrous cycle in the adult rat, J. Neurosci. 12 (7) (1992) 2549–2554. [8] T. Sun, Z. Liu, M. Liu, Y. Guo, H. Sun, J. Zhao, Z. Lan, B. Lian, J. Zhang, Hippocampus-specific Rictor knockdown inhibited 17beta-estradiol induced
8
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27] [28]
[29]
[30] F.Z. Xing, Y.G. Zhao, Y.Y. Zhang, L. He, J.K. Zhao, M.Y. Liu, Y. Liu, J.Q. Zhang, Nuclear and membrane estrogen receptor antagonists induce similar mTORC2 activation-reversible changes in synaptic protein expression and actin polymerization in the mouse hippocampus, CNS Neurosci. Ther. 24 (6) (2018) 495–507. [31] C. Bian, Y. Huang, H. Zhu, Y. Zhao, J. Zhao, J. Zhang, Steroid receptor Coactivator1 knockdown decreases synaptic plasticity and impairs spatial memory in the Hippocampus of mice, Neuroscience 377 (2018) 114–125. [32] J. Zhao, C. Bian, M. Liu, Y. Zhao, T. Sun, F. Xing, J. Zhang, Orchiectomy and letrozole differentially regulate synaptic plasticity and spatial memory in a manner that is mediated by SRC-1 in the hippocampus of male mice, J. Steroid Biochem. Mol. Biol. 178 (2018) 354–368. [33] Y. Zhao, L. He, Y. Zhang, J. Zhao, Z. Liu, F. Xing, M. Liu, Z. Feng, W. Li, J. Zhang, Estrogen receptor alpha and beta regulate actin polymerization and spatial memory through an SRC-1/mTORC2-dependent pathway in the hippocampus of female mice, J. Steroid Biochem. Mol. Biol. 174 (2017) 96–113. [34] Y.Y. Zhang, M.Y. Liu, Z. Liu, J.K. Zhao, Y.G. Zhao, L. He, W. Li, J.Q. Zhang, GPR30mediated estrogenic regulation of actin polymerization and spatial memory involves SRC-1 and PI3K-mTORC2 in the hippocampus of female mice, CNS Neurosci. Ther. 25 (6) (2019) 714–733. [35] L. Van Aelst, H.T. Cline, Rho GTPases and activity-dependent dendrite development, Curr. Opin. Neurobiol. 14 (3) (2004) 297–304. [36] Y. Liu, S. Du, L. Lv, B. Lei, W. Shi, Y. Tang, L. Wang, Y. Zhong, Hippocampal activation of Rac1 regulates the forgetting of object recognition memory, Curr. Biol. 26 (17) (2016) 2351–2357. [37] Z. Mi, T. Si, K. Kapadia, Q. Li, N.A. Muma, Receptor-stimulated transamidation induces activation of Rac1 and Cdc42 and the regulation of dendritic spines, Neuropharmacology 117 (2017) 93–105. [38] Y. Lu, L. Tan, X. Wang, Circular HDAC9/microRNA-138/Sirtuin-1 pathway mediates synaptic and amyloid precursor protein processing deficits in Alzheimer’s disease, Neurosci. Bull. 35 (5) (2019) 877–888. [39] W.N. Chow, J.C. Ngo, W. Li, Y.W. Chen, K.M. Tam, H.Y. Chan, C.C. Miller, K.F. Lau, Phosphorylation of FE65 Ser610 by serum- and glucocorticoid-induced kinase 1 modulates Alzheimer’s disease amyloid precursor protein processing, Biochem. J. 470 (3) (2015) 303–317. [40] I.V. Kurochkin, E. Guarnera, I.N. Berezovsky, Insulin-degrading enzyme in the fight against Alzheimer’s disease, Trends Pharmacol. Sci. 39 (1) (2018) 49–58. [41] A. Stargardt, J. Gillis, W. Kamphuis, A. Wiemhoefer, L. Kooijman, M. Raspe, W. Benckhuijsen, J.W. Drijfhout, E.M. Hol, E. Reits, Reduced amyloid-beta degradation in early Alzheimer’s disease but not in the APPswePS1dE9 and 3xTg-AD mouse models, Aging Cell 12 (3) (2013) 499–507. [42] Q. Liu, R. Feng, Y. Chen, G. Luo, H. Yan, L. Chen, R. Lin, Y. Ding, T. Wen, Dcf1 triggers dendritic spine formation and facilitates memory acquisition, Mol. Neurobiol. 55 (1) (2018) 763–775. [43] Y. Zhao, Y. Yu, Y. Zhang, L. He, L. Qiu, J. Zhao, M. Liu, J. Zhang, Letrozole regulates actin cytoskeleton polymerization dynamics in a SRC-1 dependent manner in the hippocampus of mice, J. Steroid Biochem. Mol. Biol. 167 (2017) 86–97. [44] T.R. Stankiewicz, D.A. Linseman, Rho family GTPases: key players in neuronal development, neuronal survival, and neurodegeneration, Front. Cell. Neurosci. 8 (2014) 314. [45] I.M. Anton, C. Gomez-Oro, S. Rivas, F. Wandosell, Crosstalk between WIP and Rho family GTPases, Small GTPases (2018) 1–7. [46] S. Martin-Vilchez, L. Whitmore, H. Asmussen, J. Zareno, R. Horwitz, K. NewellLitwa, RhoGTPase regulators orchestrate distinct stages of synaptic development, PLoS One 12 (1) (2017) e0170464. [47] T. Sarowar, A.M. Grabrucker, Actin-dependent alterations of dendritic spine morphology in Shankopathies, Neural Plast. 2016 (2016) 8051861. [48] P. Licznerski, V. Duric, M. Banasr, K.N. Alavian, K.T. Ota, H.J. Kang, E.A. Jonas, R. Ursano, J.H. Krystal, R.S. Duman, G. Traumatic stress brain study, decreased SGK1 expression and function contributes to behavioral deficits induced by traumatic stress, PLoS Biol. 13 (10) (2015) e1002282. [49] L. Ding, L. Zhang, M. Kim, T. Byzova, E. Podrez, Akt3 kinase suppresses pinocytosis of low-density lipoprotein by macrophages via a novel WNK/SGK1/Cdc42 protein pathway, J. Biol. Chem. 292 (22) (2017) 9283–9293. [50] A.B. Reiss, H.A. Arain, M.M. Stecker, N.M. Siegart, L.J. Kasselman, Amyloid toxicity in Alzheimer’s disease, Rev. Neurosci. 29 (6) (2018) 613–627. [51] A. Salminen, K. Kaarniranta, A. Kauppinen, The potential importance of myeloidderived suppressor cells (MDSCs) in the pathogenesis of Alzheimer’s disease, Cell. Mol. Life Sci. 75 (17) (2018) 3099–3120.
neuronal plasticity and spatial memory improvement in ovariectomized mice, Behav. Brain Res. 364 (2019) 50–61. M. Liu, F. Xing, C. Bian, Y. Zhao, J. Zhao, Y. Liu, J. Zhang, Letrozole induces worse hippocampal synaptic and dendritic changes and spatial memory impairment than ovariectomy in adult female mice, Neurosci. Lett. 706 (2019) 61–67. D. Zhang, Q. Guo, C. Bian, J. Zhang, W. Cai, B. Su, Expression of steroid receptor coactivator-1 was regulated by postnatal development but not ovariectomy in the hippocampus of rats, Dev. Neurosci. 33 (1) (2011) 57–63. E. Gould, C.S. Woolley, M. Frankfurt, B.S. McEwen, Gonadal steroids regulate dendritic spine density in hippocampal pyramidal cells in adulthood, J. Neurosci. 10 (4) (1990) 1286–1291. S. Warntges, B. Friedrich, G. Henke, C. Duranton, P.A. Lang, S. Waldegger, R. Meyermann, D. Kuhl, E.J. Speckmann, N. Obermuller, R. Witzgall, A.F. Mack, H.J. Wagner, A. Wagner, S. Broer, F. Lang, Cerebral localization and regulation of the cell volume-sensitive serum- and glucocorticoid-dependent kinase SGK1, Pflugers Arch. 443 (4) (2002) 617–624. H. Mukai, T. Kimoto, Y. Hojo, S. Kawato, G. Murakami, S. Higo, Y. Hatanaka, M. Ogiue-Ikeda, Modulation of synaptic plasticity by brain estrogen in the hippocampus, Biochim. Biophys. Acta 1800 (10) (2010) 1030–1044. N. Strutz-Seebohm, G. Seebohm, E. Shumilina, A.F. Mack, H.J. Wagner, A. Lampert, F. Grahammer, G. Henke, L. Just, T. Skutella, M. Hollmann, F. Lang, Glucocorticoid adrenal steroids and glucocorticoid-inducible kinase isoforms in the regulation of GluR6 expression, J. Physiol. 565 (Pt 2) (2005) 391–401. Y.C. Yang, Y.L. Ma, W.T. Liu, E.H. Lee, Laminin-beta1 impairs spatial learning through inhibition of ERK/MAPK and SGK1 signaling, Neuropsychopharmacology 36 (12) (2011) 2571–2586. C.C. Chao, Y.L. Ma, E.H. Lee, Protein kinase CK2 impairs spatial memory formation through differential cross talk with PI-3 kinase signaling: activation of Akt and inactivation of SGK1, J. Neurosci. 27 (23) (2007) 6243–6248. F. Lang, N. Strutz-Seebohm, G. Seebohm, U.E. Lang, Significance of SGK1 in the regulation of neuronal function, J. Physiol. 588 (Pt 18) (2010) 3349–3354. S.W. Tyan, M.C. Tsai, C.L. Lin, Y.L. Ma, E.H. Lee, Serum- and glucocorticoid-inducible kinase 1 enhances zif268 expression through the mediation of SRF and CREB1 associated with spatial memory formation, J. Neurochem. 105 (3) (2008) 820–832. Y.C. Yang, C.H. Lin, E.H. Lee, Serum- and glucocorticoid-inducible kinase 1 (SGK1) increases neurite formation through microtubule depolymerization by SGK1 and by SGK1 phosphorylation of tau, Mol. Cell. Biol. 26 (22) (2006) 8357–8370. A. Yang, C. Wang, B. Song, W. Zhang, Y. Guo, R. Yang, G. Nie, Y. Yang, C. Wang, Attenuation of beta-amyloid toxicity in vitro and in vivo by accelerated aggregation, Neurosci. Bull. 33 (4) (2017) 405–412. Z. Cai, C. Wang, W. He, Y. Chen, Berberine alleviates amyloid-beta pathology in the brain of APP/PS1 transgenic mice via inhibiting beta/gamma-Secretases activity and enhancing alpha-secretases, Curr. Alzheimer Res. 15 (11) (2018) 1045–1052. M. Chin-Chan, M.G. Maldonado-Velazquez, R. Mex-Alvarez, P.M. Garma-Quen, L. Cobos-Puc, Amyloid-degrading enzymes in Alzheimer s disease: from molecules to genetic therapy, Rev. Med. Inst. Mex. Seguro Soc. 56 (4) (2018) 387–394. A. Sogorb-Esteve, M.S. Garcia-Ayllon, J. Gobom, J. Alom, H. Zetterberg, K. Blennow, J. Saez-Valero, Levels of ADAM10 are reduced in Alzheimer’s disease CSF, J. Neuroinflammation 15 (1) (2018) 213. S.F. Lichtenthaler, Alpha-secretase cleavage of the amyloid precursor protein: proteolysis regulated by signaling pathways and protein trafficking, Curr. Alzheimer Res. 9 (2) (2012) 165–177. N.K. Agarwal, C.H. Chen, H. Cho, D.R. Boulbes, E. Spooner, D.D. Sarbassov, Rictor regulates cell migration by suppressing RhoGDI2, Oncogene 32 (20) (2013) 2521–2526. A. Pyronneau, Q. He, J.Y. Hwang, M. Porch, A. Contractor, R.S. Zukin, Aberrant Rac1-cofilin signaling mediates defects in dendritic spines, synaptic function, and sensory perception in fragile X syndrome, Sci. Signal. 10 (504) (2017). M.R. Bennett, J. Lagopoulos, Stress and trauma: BDNF control of dendritic-spine formation and regression, Prog. Neurobiol. 112 (2014) 80–99. W. Huang, P.J. Zhu, S. Zhang, H. Zhou, L. Stoica, M. Galiano, K. Krnjevic, G. Roman, M. Costa-Mattioli, mTORC2 controls actin polymerization required for consolidation of long-term memory, Nat. Neurosci. 16 (4) (2013) 441–448. H. Izumi, Y. Shinoda, T. Saito, T.C. Saido, K. Sato, Y. Yabuki, Y. Matsumoto, Y. Kanemitsu, Y. Tomioka, N. Abolhassani, Y. Nakabeppu, K. Fukunaga, The disease-modifying drug candidate, SAK3 improves cognitive impairment and inhibits amyloid beta deposition in app knock-in mice, Neuroscience 377 (2018) 87–97.
9
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Research report
Hippocampal overexpression of SGK1 ameliorates spatial memory, rescues Aβ pathology and actin cytoskeleton polymerization in middle-aged APP/ PS1 mice
T
Biyao Liana,1, Mengying Liub,c,1, Zhen Lanb, Tao Sunb, Zhaoyou Mengb, Qing Changa, Zhi Liud, Jiqiang Zhangb,*, Chengjun Zhaoa,* a
Department of Histology and Embryology, Ningxia Medical University, Yinchuan, 750004, China Department of Neurobiology, Third Military Medical University, Chongqing, 400038, China The 305 Hospital of PLA, 100017, Beijing, China d Department of Histology and Embryology, Third Military Medical University, Chongqing 400038, China b c
A R T I C LE I N FO
A B S T R A C T
Keywords: SGK1 APP/PS1 mice Hippocampus Spatial memory Dendritic spine Rictor
The increasing occurrence and ineffective treatment of Alzheimer’s disease (AD) has become one of the major challenges of the world. Limited studies have shown that serum- and glucocorticoid-inducible kinase 1 (SGK1) is involved in spatial memory formation and consolidation, but its role in AD-like spatial memory impairment and the related mechanisms are not clear. In this study, we first examined the age-related changes of SGK1 in the hippocampus of female APP/PS1 (AD) mice. Based on the finding and our previous finding that significant spatial memory impairment was detected in 8-month old AD mice, SGK1-overexpressing AAV (oSGK1) was constructed and injected into the hippocampus of 9-month old AD mice. One month later, the behavior alterations, Aβ production and deposit as well as changes of CA1 spine density and selected actin polymerization remodeling proteins were examined. The results showed that significant decrease of SGK1 was detected in 10month old AD mice. The spatial memory impairment, the production and deposit of Aβ were reversed by oSGK1. Levels of hippocampal ADAM10 (α-secretase) and IDE (Aβ degradase), actin remodeling related proteins Rictor, Rac1, Cdc42 and Profilin-1 were significantly increased after oSGK1 treatment while hippocampal BACE1 (γsecretase) and Cofilin remained unchanged. Taken together, our findings demonstrated a pivotal role of SGK1 in the treatment of AD-related memory impairment through upregulation of non- amyloidogenic processing of APP and degradation of Aβ, increase in spine plasticity related proteins, indicating increase in hippocampal SGK1 may be a potent therapeutic target against AD.
1. Introduction The hippocampus is one of the most studied brain structures and crucial in forming new memories quickly and automatically but does not keep them for long [1] thus plays important roles for learning, memory formation and consolidation and cognition [2]. Accumulated evidences have shown that the structure and function of hippocampus could be regulated by many factors. For example, it is seriously affected by Alzheimer’s disease (AD) [3–5]. Hippocampal neurogenesis has been shown to be regulated by stress and treatment with glucocorticoid hormones [6], fluctuation of estrogens such as estrus cycle [7], ovariectomy [8–11] and/or estrogen synthase (aromatase) inhibition [9]. Serum- and glucocorticoid-inducible kinase 1 (SGK1) is a member of
the Ser/Thr protein kinase family. An early study by Warntges et al. localized SGK1 mRNA in the rat hippocampus and many other brain nuclei using Northern blot; further they used in situ hybridization and immunohistochemistry and found that in the hippocampus, an increased expression of SGK1 in neurons of the hippocampal area CA3 after dehydration [12]. Since hippocampus is the center for learning and memory and is one of the most important targets of AD [13], several pilot studies explored the role of SGK1 in hippocampus-dependent memory. The fast-learning rats showed significant higher expression of SGK1 when compared with slow-learning rats [14]. Inhibition of laminin-β1, one isoform of laminin, enhanced spatial learning but it was blocked by co-transfection with SGK1 siRNA [15], and dominant negative mutant SGK1 markedly impaired spatial
⁎
Corresponding authors. E-mail addresses: [email protected], [email protected] (J. Zhang), [email protected] (C. Zhao). 1 These authors contributed equally to this study. https://doi.org/10.1016/j.bbr.2020.112503 Received 6 November 2019; Received in revised form 30 December 2019; Accepted 21 January 2020 Available online 22 January 2020 0166-4328/ © 2020 Elsevier B.V. All rights reserved.
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
staining to show dendritic spine (n = 3).
memory formation [16]. Thus, SGK1 contributed to memory consolidation [17] and spatial memory formation [18]. Additionally, SGK1 markedly increased the activity of the neuronal K + channel Kv1.3 that has been related to neuronal excitability [12]. It increased dendritic growth of primary hippocampal neurons through microtubule depolymerization, SGK1 transfection significantly increased the number of primary neurites and shortened the length of the total process in cultured hippocampal neurons [19]. But the role of SGK1 in AD related spatial memory impairment is not elucidated. Accumulation and aggregation of β-amyloid (Aβ) induce neuronal death and cognitive dysfunction seen in AD [20]. Aβ is resulted from a sequential cleavage by β-secretase (beta-site amyloid precursor protein cleaving enzyme 1, BACE1) and γ–secretase through proteolytic processing of amyloid precursor protein (APP) [21,22]. While ADAM10, the disintegrin metalloproteinase 10, is the main α-secretase responsible for the non-amyloidogenic processing of APP [23] thus preventing Aβ generation [24]. Additionally, insulin-degrading enzyme (IDE) has been shown to degrade Aβ [22]. Rictor (rapamycin-insensitive companion of mTOR) functions to control the actin cytoskeleton polymerization that involves Rho small GTPases family members and its downstream effector profilin-1 (induces actin polymerization) and cofilin (induces actin depolymerization) [25–27]; and Rictor conditional knockout selectively impaired long-term memory and the late long-term potentiation, indicating the importance of Rictor in the regulation of spatial memory [28]. Although SGK1 has been shown to play a role in memory formation and consolidation [16–18] as well as Aβ production [29], its effects on AD-related behavior and pathologies as well the related mechanisms are far from clear. Therefore, in this study, we overexpressed SGK1 in the hippocampus of middle-aged APP/PS1 AD model mice, examined the changes of learning and memory behavior, Aβ production and senile plaque deposit; meanwhile, changes of CA1 dendritic spine density and hippocampal actin cytoskeleton polymerization related proteins were also investigated.
2.2. SGK1 overexpressing AAV vector construction, stereotaxic injection and verification The sgk1 overexpression (oSGK1) adeno-associated virus (AAV) vector (pAAV [Exp]-CMV > mSgk1 [NM_001161845.2] (ns):T2A:EGFP) and the empty control virus vector (pAAV[Exp]CMV > EGFP) were provided by Cyagen Biology (Guangzhou, China). The stereotaxic injection was performed essentially in accordance with our previously reports [8,31]. In brief, the animals were anaesthetized with Isoflurane and then mounted onto a stereotaxic apparatus (Stoelting Instruments, Wood Dale, IL, USA), the oSGK1 or empty vector was infused into the bilateral CA1 of the hippocampus (0.5 μl each; AP: -2.00 mm, ML: +/-1.40 mm, DV:-1.00 mm, relative to Bregma). The speed of injection was performed at a rate of 0.1 μl/min using an injection pump (Harvard Apparatus, Holliston, MA, USA) equipped with a 1-μl Hamilton syringe. The syringe was stayed for five minutes after injection. For the overexpressing efficacy analysis, immunofluorescence and qPCR were employed (n = 3 each). For the behavior test, Morris water maze was used (n = 10 in each group). 2.3. Morris water maze test The classic Morris water maze test was used to evaluate the effects of hippocampus specific overexpression of SGK1 on spatial learning and memory according to our previous report [8]. During the 5 d place learning, the mice were placed on the submerged platform in white opaque pool, the test started randomly in one of the four quadrants (L: the left quadrant; R: the right quadrant; T: the target quadrant; O: the opposite quadrant). On day 6, the memory test, the platform was removed and the test was started usually at the opposite quadrant and lasted for 60 s; the time to find the target quadrant and the times to cross the platform were recorded by a tracking system connected to the image analyzer (HVSImage, Hampton, UK). The swim speed and traveled distance were also automatically recorded with the same system.
2. Material and method 2.1. Animal and treatment
2.4. Immunohistochemistry (IHC) and immunofluorescence (IF) The female APP/PS1 mice and the sex- and age-matched wild type C57BL/6 mice (C57) were obtained from the Model Animal Research Centre of Nanjing. All animal-related experiments were conducted in accordance with Approved Institutional Animals Care and Use protocols of Third Military Medical University. The mice were randomly grouphoused, raised in an environment where they could eat water and food freely and maintained on a 12-h light, 12-h dark cycle. Before sacrifice, the vaginal smears of the mice were prepared and the cycling of all the animals was examined by Tar purple staining. In order to make the circulating levels of estrogens comparable among the animals, only the diestrus mice were used for further experiments. To examine the age-related (4-, 6-, 8-, 10-month old) changes of hippocampal SGK1 expression, the tissue preparation for immunohistochemistry (n = 3 in each group) was conducted as reported by a previous report [30]. For the Quantitative real-time PCR (qPCR) analysis of hippocampal SGK1 expression in these mice, the protocols were described below (n = 3 in each group). These mice were sacrificed at the pre-defined time-point. For virus injection experiments, 10month old female C57 mice were used as the control (C57; n = 10), 10 female APP/PS1 mice of 9-month old were used for empty virus vector injection (APP/PS1; n = 10) and another 10 female APP/PS1 mice of the same age were used for SGK1 overexpressing virus injection (oSGK1; n = 10). One month after virus injection, the learning and memory behavior of these virus-treated mice and the corresponding control C57 mice were examined with the 6 d Morris water maze, then they were sacrificed for Western blot analysis (n = 3), immunohistochemistry and immunofluorescence staining to show Aβ and Congo Red staining to show senile plaque (n = 4), and Golgi-cox
For all the staining-related experiments, mice were deeply anesthetized with an injection of sodium pentobarbital (i.p) and transcardially perfused with saline and 4 % paraformaldehyde in PBS. The brains were dissected and the dehydration was conducted with 30 % sucrose solution, the brain was cut into 25-μm-thick sections with a cryostat (CM1900, Leica Microsystems, Heidelberger, Germany). The sections were collected with 24-well plate containing 4 % paraformaldehyde until use. IHC and IF were performed to examine the changes of hippocampal SGK1 and β-Amyloid (Aβ). The procedure used was similar to our previous report [32]. For IHC, the sections were washed with PBS and quenched for 15 min with 3 % H2O2 and blocked with sheep serum (ZLI-9022, Zhongshan Biotech, Beijing, China) for 20 min; then the sections were incubated overnight at 4 °C with the primary antibodies against SGK1 or Aβ (see Table 1) prepared with the antibody diluent (ZLI-9028, Zhongshan). After washing with PBS, the sections were incubated with a corresponding biotinylated secondary antibody (1:200, goat-anti-rabbit, ZB-2010; 1:200, goat-anti-mouse, ZB-2094; Zhongshan) at room temperature for 1 h. Then, Sections were washed with PBS again and incubated with the HRP-labeled streptavidin (1:200, ZB2404, Zhongshan) for 1 h and then visualized using a DAB-nickel chromogen kit (SK-4100, Vector Laboratories Inc., Burlingame, USA) for 5 min at room temperature. The slides were air-dried, cleared with xylene, and mounted. Finally, the slides were imaged with an Olympus microscope (BX60, Olympus, Tokyo, Japan), the optical density was analyzed using Image-Pro Plus software 6.0 (Media Cybernetics, Rockville, USA). 2
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Table 1 The primary antibodies used for WB and/or IHC/IF in this study. Name
Mol. Weight
Specificity
Dilution IHC/IF
ADAM10 BACE1 Cdc42 Confilin IDE Profilin-1 Rac1 Rictor SGK1 β-actin β-Amyloid
100kDa 70kDa 21kDa 19kDa 55kDa 21kDA 21kDa 200kDa 70kDa 42kDa
rabbit monoclonal rabbit monoclonal rabbit polyclonal rabbit polyclonal mouse monoclonal rabbit polyclonal mouse monoclonal rabbit polyclonal rabbit polyclonal mouse monoclonal mouse monoclonal
Source
ab124695 ab108394 2462 3318 sc-393887 3237 ab33186 2140 210735 AA128 A5213
Abcam Abcam Cell Signaling Cell Signaling Santa Cruz Cell Signaling Abcam Cell Signaling Sigma Beyotime Sigma
WB 1:500 1:1000 1:800 1:800 1:500 1:800 1:800 1:800 1:500 1:1000
1:200
Cat No.
1:200
IHC: immunohistochemistry. IF: immunofluorescence. WB: Western blot.
2.7. Western blot
For IF, the sections were washed with PBS and blocked with sheep serum (ZLI-9022, Zhongshan Biotech) for 20 min then incubated overnight at 4 °C with the primary antibodies (see Table1) prepared with the antibody diluent (ZLI-9028, Zhongshan). After washed with PBS and incubated with a corresponding fluorescent secondary antibodies (1:200, A10040, Alexa Fluor 546, donkey-anti-rabbit IgG, Thermo Fisher Scientific; A10037 Alexa Fluor 568 donkey-anti-mouse IgG, Thermo Fisher) diluted 1:200 with PBS for 1.5 h at room temperature and the sections were washed with PBS again and counterstained with DAPI (C1005, Beyotime). Finally, the slides were washed for 5 min with PBS and mounted with fluorescence quenching agent (P0176-3, Beyotime). The pictures were obtained with the same Olympus microscope as mentioned above; the optical density was measured and analyzed with Image-J software.
Western blot analysis was conducted according to our previous reports [8,33]. Briefly, the hippocampi of each group were dissected, pooled and lysed with RIPA buffer (P0013B, Beyotime Biotech, Beijing, China) containing 1 % PMSF (ST506, Beyotime). The protein concentration was measured with a BCA Assay Kit (P0010, Beyotime) then the protein was diluted with loading buffer and ddH2O. After SDSPAGE, the separated proteins were transferred to PVDF membrane and blocked with 5 % nonfat dry milk dissolved in TBST for 2 h at room temperature, then PVDF membrane was cut into small strips according to the molecular weight of individual target protein, and the strips were incubated with specific antibodies (see Table 1) overnight at 4 °C. After washing with TBST, the stripes were incubated with goat-anti-mouse secondary antibody (1:2000, ZB-2305, Zhongshan), and goat-antirabbit secondary antibody (1:2000; ZB-2301, Zhongshan), respectively. Finally, the blots were developed with a chemiluminescent HRP kit (WBKLS0100, Merk Millipore, Massachusetts, USA) and visualized with Western Lighting-ECL (Bio-Rad, Hercules, USA). The Quantity One software (Bio-Rad) was used to measure the optical density of each band and β-actin was used as an internal control. All of these experiments were repeated at least three times.
2.5. Congo red staining Congo Red staining was used to examine the changes of Aβ senile plaques in the hippocampus. The tissue sections were washed with PBS three times for 5 min, then the sections were transferred to pre-heated (70℃) EP tube containing FD Congo Red solution (PS108, FD Neurotechnologies Inc., Columbia, MD, USA) for 20 min. The sections were then dipped into 80 % ethanol containing 0.2 % NaOH three times. Finally, the positive materials were photographed with the same Olympus microscope as mentioned above and the number of plaques and the area percentage of plaques (area %) were measured and analyzed with Image-J software.
2.8. Golgi-Cox staining Golgi-Cox staining was performed with a FD Rapid Golgi Stain Kit (PK401, FD NeuroTechnologies, Columbia, USA) according to the manufacturer’s instructions and our previous report [34]. The brains of each group were dissected quickly, washed with dd-H2O and then impregnated in the Golgi-Cox solution (Solution A: B = 1:1) with one change on the next day. These brains were stored at room temperature in dark for 2 weeks, and then each sample was transferred into Solution C in darkness for 7 days at room temperature. The brains were then cut into 200-μm-thick slices with a vibratome (Microslicer DTK- 600, Dosaka EM, Tokyo, Japan) and mounted on gelatin-coated slides and airdried in a dark place for 2 weeks. The slices were the incubated with a mixture of Solution D, Solution E, and distilled water (1:1:2) for 10 min; and then dehydrated with 50 %, 75 %, 95 %, and 100 % alcohol. Finally, the sections were cleaned, mounted, and photographed with an Olympus microscope (100× oil immersion lens). The number of dendritic spines along the secondary branching of the dendrites of CA1 pyramidal neurons was measured double-blindly with Image-Pro Plus software (Media Cybernetics), and the number of dendritic spines per 20 μm was counted and used for further analysis.
2.6. Quantitative real-time PCR (qPCR) To quantify the levels of SGK1 mRNA, the hippocampal of selected mice in each group were collected, and the total RNA of each group was extracted with Trizol method (15596018, Invitrogen, Shanghai, China); the A260/A280 was 1.8–2.0, and the mass fraction was > 90 %. Reverse transcription into complementary deoxyribonucleic acid (cDNA) was conducted using the ReverTra Ace qPCR RT Kit (FSQ-101, Toyobo Life Science, Osaka, Japan). The used primers were: SGK1 forward: GCCAAACCCTCCGACTTTCAC; reverse: CTTGTGCCTAGCCA GAAGAACC. The reaction system and conditions were carried out according to the instructions provided by the SYBR Green Real-Time PCR Master Mix Kit (QPK-212, Toyobo Life Science). The relative level of GAPDH gene was used as internal control (forward: CGTGTTCCTACC CCCAATGT; reverse: TGTCATCATACTTGGCAGGTTTCT), and the relative expression levels of the target gene were calculated using the 2−ΔΔCt model.
2.9. Statistical analysis The results were presented as the mean ± S.E. and the data were 3
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Fig. 1. Age-related changes of SGK1 in the hippocampus of APP/PS1 mice. A: IF showed significantly lower levels of SGK1 protein were detected at 10-month age (10 M) in APP/PS1 mice. B: qPCR showed significantly lower levels of SGK1 mRNA were detected at 10 M in APP/PS1 mice. Data were shown as mean ± SEM. **: p < 0.01; one-way ANOVA and Tukey test. Bar = 500 μm.
C57 (p > 0.05 for Day 1; p ＜ 0.01 for Day 2; p < 0.01 for Day 3; p < 0.05 for Day 4; p < 0.01 for Day 5) as well as oSGK1 and C57 (p > 0.05 for Day 1; p＜0.01 for Day 2; p < 0.05 for Day 3; p ＞0.05 for Day 4; p < 0.05 for Day 5). In detail, there were no significant differences among the treatments on day 1. From day 2, APP/PS1 and oSGK1 mice showed significantly longer escape latency than C57 mice, indicating impaired learning in APP/PS1 mice. However, this difference was substantially reversed by oSGK1 at day 4 compared to C57 (p > 0.05). On day 5, the analysis revealed that the escape latencies did not show statistical differences between the APP/PS1 and oSGK1, but oSGK1 mice still showed shorter latencies compared to C57 mice. For the memory test on day 6, there were general differences among C57, APP/PS1 and oSGK1 (F (2, 27) = 7.719, p < 0.01, Fig. 3B and D). For the time the animals spent in the target quadrant within the 60 s test, it was 41.83 % (24.77 ± 4.10 s) for the C57 mice, 30.5 % (18.30 ± 3.18 s) for the APP/PS1 mice, 39.77 % (23.86 ± 4.56 s) for the oSGK1 mice. In detail, the APP/PS1 mice spent significantly shorter time in the target quadrant when compared to the C57 (p < 0.01), and this was reversed by SGK1 overexpression treatment (p < 0.01). Additionally, the APP/PS1 mice showed a significant decrease in the number of times crossing the platform location than C57 mice, and this was reversed by SGK1 overexpression treatment (F (2, 27) = 27.458, p < 0.01, Fig. 3C), but there were no statistical differences between C57 and oSGK1 (p > 0.05). Moreover, the swimming speed and total distance traveled showed no statistical differences among the three groups (F(2, 27) = 0.476, p > 0.05 for swimming speed; F(2, 27) = 0.559, p > 0.05 for distance traveled; Fig. 3E-F).
analyzed using SPSS software (version 22.0; IBM; Chicago, IL). Behavioral data were analyzed with repeated two-way mixed ANOVA (day × treatment). Other measurements were analyzed using one-way ANOVA. The Tukey test or t-test were employed for analysis and the statistical significance was defined as p < 0.05. 3. Results 3.1. Age-related changes of hippocampal SGK1 in the APP/PS1 mice We first examined the level of hippocampal SGK1 in the APP/PS1 mice using IHC and qPCR. As illustrated in Fig. 1A-B, one-way ANOVA revealed that there were significant differences among different ages (4−10 M old) of mice (F(3,20) = 23.387, p < 0.01 for IHC; F (3,8) = 20.251, p＜0.01 for qPCR), indicating the levels of SGK1 were changed with aging from 4 to 10 M old. Further analysis revealed that there were no significant differences among 4, 6 and 8 M (p > 0.05), but the levels of hippocampal SGK1 were significantly decreased at 10 M when compared with other checkpoint (p＜0.01). 3.2. Hippocampal oSGK1 ameliorated the behavioral impairment of APP/ PS1 mice According to the above results, we constructed SGK1 overexpressing AAV vector (Fig. 2A and B) and verified the efficacy of oSGK1 AAV using q-PCR and IF. As shown in Fig. 2C and D, qPCR and t-test revealed that the levels of sgk1 mRNA in oSGK1 mice were significantly increased when compare to APP/PS1 mice (p < 0.01) and similar results were also detected with IF (p < 0.01), indicating that SGK1 was successfully overexpressed in the hippocampus of mice. Based on the successful overexpression of SGK1 in middle-aged APP/PS1 mice, we then tested the effects of hippocampal oSGK1 on the learning and memory of these mice. As shown in Fig. 3A, repeated two-way mixed ANOVA revealed that the escape latencies were significantly affected by both day (F (4,108) = 75.478, p < 0.01) and treatment (F (2,27) = 25.457, p < 0.01); but there was no detectable day × treatment interaction (F (8,108) = 1.702, p > 0.05). One-way ANOVA showed that there were general statistical differences among C57, APP/ PS1 and oSGK1 except day 1 (F(2,27) = 1.610, p > 0.05 for Day 1; F (2,27) = 7.132, p＜ 0.01 for Day 2; F(2,27) = 5.951, p < 0.01 for Day 3; F(2,27) = 3.876, p < 0.05 for Day 4; F(2,27) = 13.364, p < 0.01 for Day 5). Similar differences were detected between APP/PS1 and
3.3. Hippocampal oSGK1 inhibited Aβ generation and senile plaques formation IF and IHC were used to examine the effects of oSGK1 on the production of hippocampal Aβ. As shown in Fig. 4A-B, one-way ANOVA revealed that there were general differences among C57, APP/PS1 and oSGK1 (F(2,15) = 101.265, p＜0.01 for IF; F(2,15) = 41.927, p < 0.01 for IHC). The Tukey test of the two experimental methods showed significant more plaques formed in APP/PS1 mice but this was reversed by oSGK1 (p < 0.01) to the control levels (p < 0.01, oSGK1 vs C57). Congo Red staining was used to examine the formation of senile plaques in the hippocampus. As shown in Fig. 4C–E, One-way ANOVA showed that there were significantly differences among C57, APP/PS1 4
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Fig. 2. The construction and verification of SGK1 overexpressing adeno-associated virus. A: SGK1 overexpression virus vector construction strategy. B: The empty virus vector used as control. C: qPCR revealed the levels of SGK1 mRNA in the oSGK1 hippocampus were significantly increased compared to APP/PS1 mice. D: IF revealed that the levels of hippocampal SGK1 in the oSGK1 group were significantly increased compared to APP/PS1 mice. Data were shown as mean ± SEM. **: p < 0.01; t-test. Bar = 500 μm.
C57 mice, in which no senile plaques were detected.
and oSGK1 (F(2,15) = 62.936, p < 0.01 for the number of senile plaques; F(2.15) = 79.138, p < 0.01 for the area (%) of senile plaques). The Tukey test indicated that the number and area (%) of senile plaques of oSGK1 group was significantly lower than APP/PS1 group (p < 0.01), although they were still higher than that detected in the
Fig. 3. Effects of SGK1 overexpression on spatial learning and memory performance in APP/PS1 mice. A: From day 2 to day 5 of the learning phase, the APP/PS1 mice showed significantly longer escape latencies than the C57 animals, and this could be hardly improved by hippocampal-specific SGK1 overexpression except at day 4; two-way mixed measures ANOVA and Tukey test. B-C: Memory test. The memory impairment seen in the APP/PS1 mice could be reversed by SGK1 overexpression; one-way ANOVA and Tukey test. D: Representative tracking of mice spent in the maze during the memory trail. Both C57 and oSGK1 spent longer time in target quadrant compared to the remaining three quadrants, one-way ANOVA and Tukey test. E-F: The swimming speed and total distance traveled did not change in each group. Data were shown as mean ± SEM. T: target quadrant; R: right of target quadrant; O: opposite of target quadrant; L: left of target quadrant. *:P < 0.05;**: p < 0.01#:P < 0.05;##:P < 0.01. 5
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Fig. 4. Effects of SGK1 overexpression on Aβ formation and deposition in APP/PS1 mice. A-B: Hippocampal-specific SGK1 overexpression decreased the Aβ production compared to APP/PS1. C: The effect of SGK1 overexpression on senile plaques deposition in mice was examined by Congo Red staining. D-E: Hippocampalspecific SGK1 overexpression significantly reduced the number of senile plaques (amount) and the area percentage (%) of senile plaques compared to APP/PS1. **: p < 0.01; One-way ANOVA and Tukey test. Bar = 500 μm.
3.4. Hippocampal oSGK1 promoted non-amyloidogenic cleavage of APP and Aβ degradation
3.5. The effects of hippocampal oSGK1 on CA1 spine density and actin remodeling proteins
To elucidate the mechanisms underlying oSGK1 inhibition on Aβ generation and plaque formation, we examined several proteins that related Aβ production and degradation in the hippocampus of the C57, APP/PS1 and oSGK1 mice. As shown in Fig. 5A, One-way ANOVA and Tukey test revealed that hippocampal ADAM10 in APP/PS1 mice was significantly lower than C57 mice (p < 0.01) and this was unregulated after oSKG1 treatment (p < 0.01 vs APP/PS1) to a level comparable to C57 mice (p > 0.05 vs oSGK1). For hippocampal BACE1 (Fig. 5B), APP/PS1 mice had significantly higher levels than C57 (p < 0.01), but it did not show any differences compared to that detected in oSGK1 mice (p > 0.05). Since Aβ could be degraded by IDE, we then examined it changes after oSGK1 treatment. As shown in Fig. 5C, APP/ PS1 mice showed significantly lower levels of hippocampal IDE than C57 mice (p < 0.01), and this could be significantly increased after oSKG1 treatment to a level comparable to C57.
The alteration of spine density is the basis of synaptic plasticity but whether it was regulated by oSGK1 remains unclear. As shown in Fig. 6A, one-way ANOVA revealed that there were general differences among C57, APP/PS1 and oSGK1 mice (F(3,32) = 16.384, p < 0.01). Tukey test showed that the spine density was significantly decreased in the hippocampus of APP/PS1 mice when compared to that in the C57 mice (p < 0.01), and this decrease could be reversed by oSGK1 treatment (p < 0.01 vs APP/PS1). For hippocampal Rictor and Profilin-1, One-way ANOVA revealed that there were general differences among C57, APP/PS1 and oSGK1 regarding Rictor and Profilin-1 (F (2, 15) = 47.803, p < 0.01 for Rictor and F(2,15) = 52.525, p < 0.01 for Profilin-1). Tukey test revealed that their levels were decreased in APP/PS1 mice compared to the C57 groups (p < 0.01) but it was significantly reversed by oSGK1 (p < 0.01). Regarding the changes in hippocampal Confilin, One-way ANOVA revealed no significant differences among three groups (F (2,15) = 0.773, p > 0.05). These results were shown in Fig. 6B and D. 6
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
Fig. 5. Effects of SGK1 overexpression on APP metabolism and Aβ degradation. A: Hippocampal-specific SGK1 overexpression increased ADAM10. B: Hippocampalspecific SGK1 overexpression did not affect BACE1. C: Hippocampal-specific SGK1 overexpression increased IDE. Data were shown as the mean ± SEM. **: p < 0.01; One-way ANOVA and Tukey test.
Fig. 6. Effects of SGK1 overexpression on CA1 spine density and actin remodeling proteins in the hippocampus of APP/PS1 mice. A: Hippocampal-specific SGK1 overexpression increased CA1 dendritic spine density. B-C: Hippocampal-specific SGK1 overexpression increased levels of Rictor and Profilin-1. D: Hippocampalspecific SGK1 overexpression increased did not affect Confilin. E-F: Hippocampal-specific SGK1 overexpression increased Rac1 and Cdc42. Data were shown as mean ± SEM. **: p < 0.01;*＜0.05; One-way ANOVA and Tukey test.
p < 0.01 for Cdc42). These results were shown in Fig. 6E and F.
The Rho-family GTPases have also been shown to play essential roles in orchestrating the development and remodeling of spine plasticity, in which the protein Rac1 and Cdc42 are the most important members [35–37]. One-way ANOVA showed that there were significant differences regarding the expression of hippocampal Rac1 and Cdc42 among the treatments (F(2,15) = 6.731, p < 0.01 for Rac1; F (2,15) = 26.072, p < 0.01 for Cdc42). Tukey test showed that the expression of Rac1 and Cdc42 was significantly downregulated in APP/ PS1 mice (p < 0.05 for Rac1 and p < 0.01 for Cdc42, compared to C57) and it was reversed by oSGK1 treatment (p < 0.05 for Rac1 and
4. Discussion SGK1 has been shown to be involved in the regulation of spatial memory, but its effects on the behaviors of APP/PS1 mice and related mechanisms are not clear. Since significant decrease of SGK1 in the hippocampus of these mice was detected at 10 months old, we constructed SGK1 overexpressing AAVs and injected them to the hippocampus then examined the behavior alterations and molecular and 7
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
functions primarily to promote actin polymerization but a minor role in actin depolymerization. So far it seems only one study showed that that SGK1 promoted the expression of Cdc42 in macrophages [49], thus our findings provided novel insight into understanding the role of SGK1 in the regulation of actin polymerization/depolymerization, especially in the hippocampus of AD mice. The increasing prevalence of AD has become the most serious challenge we must face. Currently the exact triggering factor of AD is unknown and the treatments for AD are quite limited, great efforts have been made targeting Aβ/senile plague but the results seem to suffer a great failure [50,51]. In an attempt to search potential candidate against AD, we overexpressed SGK1 in the hippocampus of middle-aged APP/PS1 mice and the results showed that the AD-like spatial memory impairment was significantly reversed by SGK1 overexpression. Meanwhile, the production and deposit of Aβ, the expression of actinremodeling proteins as well as the density of CA1 dendritic spines were also altered after SGK1 overexpression. Although several previous studies have reported the involvement of SGK1 in memory formation and consolidation [16–18], the current study presented the first direct evidence of SGK1 against AD behavior and pathology. Overall, our results together with other findings [16–18] strongly suggested that SGK1 may be a potent target for the treatment of AD.
dendritic changes one month later. The results showed that while the learning abilities of the AD mice were not obviously improves (the statistical significant improvement was only detected at day 4; the escape latency was longer than vector-treated mice but without statistical significance), the impaired spatial memory of vector-treated AD mice were obviously ameliorated after SGK1 overexpression, indicating the importance of hippocampal SGK1. Generally, these results were in well accordance with previous studies shown that increased hippocampal SGK1 was positively correlated with better learning and memory abilities [14–16,18]. Abnormal processing of APP has been regarded as the important early event in AD [38] and Aβ production and its deposited senile plaque [3–5] are two of the most featured pathologies of AD. To explore the underlying mechanisms of SGK1 on impaired spatial memory seen in AD, we examined the effects of overexpression of SGK1 on Aβ production using IF staining. The results showed that the control C57 mice had little Aβ production, while it significantly increased in AD mice and this increase could be reversed with SGK1 overexpression. The above findings were further demonstrated with Congo Red staining targeting the deposit of Aβ, strongly indicating the pivotal role of SGK1 in the production of Aβ and formation of plaques as proposed by previous works [29,39]. Furthermore, we for the first time reported that the inhibition of Aβ production of hippocampal overexpression of SGK1 was due to increase the non-amyloidogenic processing of APP mediated by ADAM10 [23] but did not affect the amyloidogenic processing of APP mediated by BACE1 [21,22]. Most importantly, we found that the degradation of Aβ was significantly enhanced by overexpression of SGK1, because levels of hippocampal IDE, the enzyme functions to degrade Aβ [22], were significantly increased by SGK1 overexpression. Although both Neprilysin (another Aβ degradase) and IDE have been shown to play significant roles in extracellular and intracellular Aβ degradation, IDE is specific toward β-structure-forming substrates, making it the proteolytic culprit against the formation of toxic Aβ oligomers associated with AD [40]. In fact, IDE has been regarded is the major protease responsible for Aβ clearance in human hippocampal lysates [41]. Thus, SGK1 overexpression induced decrease Aβ production and deposit involved two ways: increase in non-amyloidogenic metabolism of APP and increase in Aβ degradation. However, how SGK1 regulates the expression of ADAM10 and IDE remains further investigation. Dendritic spine contributes to proper synaptic function and memory formation [42]. Its morphological changes are driven by actin cytoskeleton dynamics including polymerization and depolymerization [37,43]. Additionally, Rho family is one of the Ras superfamily members and the most extensively studied members of Rho family are Rac1 (Ras-related C3 botulinum toxin substrate 1), Cdc42 (cell division control protein 42) and RhoA (Ras homolog gene family, member A) [44]. Accumulated studies have shown that they are major modulators of the postsynaptic spine morphology and density [45] thus play a role in learning and memory [37,46]. When activated, Rac1 and Cdc42 functions to promote spine formation, growth and stabilization [37,47] but activated RhoA has opposite effects compared to Rac1 and Cdc42 [47]. Rictor has been shown to be a positive regulator of the Rac1 and Cdc42 [25] and Profilin-1 and Cofilin are the downstream effectors of Rho [26,27]. In this study, we first examined the changes of CA1 dendritic spine density and found it was significantly decreased in middle-aged APP/PS1 mice when compared to that of the control mice, and then we found this decrease was limitedly but statistic significantly increased by overexpression of SGK1. These results were in general in accordance with previous study showing a positive relationship of SGK1 and dendritic spine morphology [48]. To address the underlying mechanisms, we examined the changes of hippocampal Rictor, Rac1, Cdc42, Profilin-1 and Cofilin. The results showed that although the decreased Cofilin in APP/PS1 mice was not altered by SGK1 overexpression, the levels of other actin polymerization/related molecules were significantly regulated by SGK1, indicating hippocampal SGK1
CRediT authorship contribution statement Biyao Lian: Data curation, Formal analysis, Methodology, Visualization, Writing - original draft. Mengying Liu: Data curation, Formal analysis, Methodology, Visualization, Writing - original draft. Zhen Lan: Formal analysis, Methodology. Tao Sun: Methodology. Zhaoyou Meng: Funding acquisition. Qing Chang: Visualization, Writing - review & editing. Zhi Liu: Methodology. Jiqiang Zhang: Conceptualization, Funding acquisition, Visualization, Writing - review & editing. Chengjun Zhao: Conceptualization, Writing - review & editing. Declaration of Competing Interest The authors declare that they have no conflicts of interest. Acknowledgements This work was supported by the grant from the Development and Regeneration Key Laboratory of Sichuan Province (SYS18-02), China Postdoctoral Science Foundation Grant (2019M653976) and Chongqing Natural Science Foundation (cstc2019jcyj-msxmX0255). References [1] M. Cascella, Y. Al Khalili, Short Term Memory Impairment, StatPearls, StatPearls Publishing LLC., Treasure Island (FL), 2019. [2] P. Zeidman, E.A. Maguire, Anterior hippocampus: the anatomy of perception, imagination and episodic memory, Nat. Rev. Neurosci. 17 (3) (2016) 173–182. [3] H. Sun, M. Liu, T. Sun, Y. Chen, Z. Lan, B. Lian, C. Zhao, Z. Liu, J. Zhang, Y. Liu, Age-related changes in hippocampal AD pathology, actin remodeling proteins and spatial memory behavior of male APP/PS1 mice, Behav. Brain Res. 376 (2019) 112182. [4] C. Aluganti Narasimhulu, C. Mitra, D. Bhardwaj, K.Y. Burge, S. Parthasarathy, Alzheimer’s disease markers in aged ApoE-PON1 deficient mice, J. Alzheimers Dis. 67 (4) (2019) 1353–1365. [5] T. Ondrejcak, I. Klyubin, G.T. Corbett, G. Fraser, W. Hong, A.J. Mably, M. Gardener, J. Hammersley, M.S. Perkinton, A. Billinton, D.M. Walsh, M.J. Rowan, Cellular prion protein mediates the disruption of hippocampal synaptic plasticity by soluble tau in vivo, J. Neurosci. 38 (50) (2018) 10595–10606. [6] K.R. Mifsud, J.M. Reul, Acute stress enhances heterodimerization and binding of corticosteroid receptors at glucocorticoid target genes in the hippocampus, Proc. Natl. Acad. Sci. U. S. A. 113 (40) (2016) 11336–11341. [7] C.S. Woolley, B.S. McEwen, Estradiol mediates fluctuation in hippocampal synapse density during the estrous cycle in the adult rat, J. Neurosci. 12 (7) (1992) 2549–2554. [8] T. Sun, Z. Liu, M. Liu, Y. Guo, H. Sun, J. Zhao, Z. Lan, B. Lian, J. Zhang, Hippocampus-specific Rictor knockdown inhibited 17beta-estradiol induced
8
Behavioural Brain Research 383 (2020) 112503
B. Lian, et al.
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27] [28]
[29]
[30] F.Z. Xing, Y.G. Zhao, Y.Y. Zhang, L. He, J.K. Zhao, M.Y. Liu, Y. Liu, J.Q. Zhang, Nuclear and membrane estrogen receptor antagonists induce similar mTORC2 activation-reversible changes in synaptic protein expression and actin polymerization in the mouse hippocampus, CNS Neurosci. Ther. 24 (6) (2018) 495–507. [31] C. Bian, Y. Huang, H. Zhu, Y. Zhao, J. Zhao, J. Zhang, Steroid receptor Coactivator1 knockdown decreases synaptic plasticity and impairs spatial memory in the Hippocampus of mice, Neuroscience 377 (2018) 114–125. [32] J. Zhao, C. Bian, M. Liu, Y. Zhao, T. Sun, F. Xing, J. Zhang, Orchiectomy and letrozole differentially regulate synaptic plasticity and spatial memory in a manner that is mediated by SRC-1 in the hippocampus of male mice, J. Steroid Biochem. Mol. Biol. 178 (2018) 354–368. [33] Y. Zhao, L. He, Y. Zhang, J. Zhao, Z. Liu, F. Xing, M. Liu, Z. Feng, W. Li, J. Zhang, Estrogen receptor alpha and beta regulate actin polymerization and spatial memory through an SRC-1/mTORC2-dependent pathway in the hippocampus of female mice, J. Steroid Biochem. Mol. Biol. 174 (2017) 96–113. [34] Y.Y. Zhang, M.Y. Liu, Z. Liu, J.K. Zhao, Y.G. Zhao, L. He, W. Li, J.Q. Zhang, GPR30mediated estrogenic regulation of actin polymerization and spatial memory involves SRC-1 and PI3K-mTORC2 in the hippocampus of female mice, CNS Neurosci. Ther. 25 (6) (2019) 714–733. [35] L. Van Aelst, H.T. Cline, Rho GTPases and activity-dependent dendrite development, Curr. Opin. Neurobiol. 14 (3) (2004) 297–304. [36] Y. Liu, S. Du, L. Lv, B. Lei, W. Shi, Y. Tang, L. Wang, Y. Zhong, Hippocampal activation of Rac1 regulates the forgetting of object recognition memory, Curr. Biol. 26 (17) (2016) 2351–2357. [37] Z. Mi, T. Si, K. Kapadia, Q. Li, N.A. Muma, Receptor-stimulated transamidation induces activation of Rac1 and Cdc42 and the regulation of dendritic spines, Neuropharmacology 117 (2017) 93–105. [38] Y. Lu, L. Tan, X. Wang, Circular HDAC9/microRNA-138/Sirtuin-1 pathway mediates synaptic and amyloid precursor protein processing deficits in Alzheimer’s disease, Neurosci. Bull. 35 (5) (2019) 877–888. [39] W.N. Chow, J.C. Ngo, W. Li, Y.W. Chen, K.M. Tam, H.Y. Chan, C.C. Miller, K.F. Lau, Phosphorylation of FE65 Ser610 by serum- and glucocorticoid-induced kinase 1 modulates Alzheimer’s disease amyloid precursor protein processing, Biochem. J. 470 (3) (2015) 303–317. [40] I.V. Kurochkin, E. Guarnera, I.N. Berezovsky, Insulin-degrading enzyme in the fight against Alzheimer’s disease, Trends Pharmacol. Sci. 39 (1) (2018) 49–58. [41] A. Stargardt, J. Gillis, W. Kamphuis, A. Wiemhoefer, L. Kooijman, M. Raspe, W. Benckhuijsen, J.W. Drijfhout, E.M. Hol, E. Reits, Reduced amyloid-beta degradation in early Alzheimer’s disease but not in the APPswePS1dE9 and 3xTg-AD mouse models, Aging Cell 12 (3) (2013) 499–507. [42] Q. Liu, R. Feng, Y. Chen, G. Luo, H. Yan, L. Chen, R. Lin, Y. Ding, T. Wen, Dcf1 triggers dendritic spine formation and facilitates memory acquisition, Mol. Neurobiol. 55 (1) (2018) 763–775. [43] Y. Zhao, Y. Yu, Y. Zhang, L. He, L. Qiu, J. Zhao, M. Liu, J. Zhang, Letrozole regulates actin cytoskeleton polymerization dynamics in a SRC-1 dependent manner in the hippocampus of mice, J. Steroid Biochem. Mol. Biol. 167 (2017) 86–97. [44] T.R. Stankiewicz, D.A. Linseman, Rho family GTPases: key players in neuronal development, neuronal survival, and neurodegeneration, Front. Cell. Neurosci. 8 (2014) 314. [45] I.M. Anton, C. Gomez-Oro, S. Rivas, F. Wandosell, Crosstalk between WIP and Rho family GTPases, Small GTPases (2018) 1–7. [46] S. Martin-Vilchez, L. Whitmore, H. Asmussen, J. Zareno, R. Horwitz, K. NewellLitwa, RhoGTPase regulators orchestrate distinct stages of synaptic development, PLoS One 12 (1) (2017) e0170464. [47] T. Sarowar, A.M. Grabrucker, Actin-dependent alterations of dendritic spine morphology in Shankopathies, Neural Plast. 2016 (2016) 8051861. [48] P. Licznerski, V. Duric, M. Banasr, K.N. Alavian, K.T. Ota, H.J. Kang, E.A. Jonas, R. Ursano, J.H. Krystal, R.S. Duman, G. Traumatic stress brain study, decreased SGK1 expression and function contributes to behavioral deficits induced by traumatic stress, PLoS Biol. 13 (10) (2015) e1002282. [49] L. Ding, L. Zhang, M. Kim, T. Byzova, E. Podrez, Akt3 kinase suppresses pinocytosis of low-density lipoprotein by macrophages via a novel WNK/SGK1/Cdc42 protein pathway, J. Biol. Chem. 292 (22) (2017) 9283–9293. [50] A.B. Reiss, H.A. Arain, M.M. Stecker, N.M. Siegart, L.J. Kasselman, Amyloid toxicity in Alzheimer’s disease, Rev. Neurosci. 29 (6) (2018) 613–627. [51] A. Salminen, K. Kaarniranta, A. Kauppinen, The potential importance of myeloidderived suppressor cells (MDSCs) in the pathogenesis of Alzheimer’s disease, Cell. Mol. Life Sci. 75 (17) (2018) 3099–3120.
neuronal plasticity and spatial memory improvement in ovariectomized mice, Behav. Brain Res. 364 (2019) 50–61. M. Liu, F. Xing, C. Bian, Y. Zhao, J. Zhao, Y. Liu, J. Zhang, Letrozole induces worse hippocampal synaptic and dendritic changes and spatial memory impairment than ovariectomy in adult female mice, Neurosci. Lett. 706 (2019) 61–67. D. Zhang, Q. Guo, C. Bian, J. Zhang, W. Cai, B. Su, Expression of steroid receptor coactivator-1 was regulated by postnatal development but not ovariectomy in the hippocampus of rats, Dev. Neurosci. 33 (1) (2011) 57–63. E. Gould, C.S. Woolley, M. Frankfurt, B.S. McEwen, Gonadal steroids regulate dendritic spine density in hippocampal pyramidal cells in adulthood, J. Neurosci. 10 (4) (1990) 1286–1291. S. Warntges, B. Friedrich, G. Henke, C. Duranton, P.A. Lang, S. Waldegger, R. Meyermann, D. Kuhl, E.J. Speckmann, N. Obermuller, R. Witzgall, A.F. Mack, H.J. Wagner, A. Wagner, S. Broer, F. Lang, Cerebral localization and regulation of the cell volume-sensitive serum- and glucocorticoid-dependent kinase SGK1, Pflugers Arch. 443 (4) (2002) 617–624. H. Mukai, T. Kimoto, Y. Hojo, S. Kawato, G. Murakami, S. Higo, Y. Hatanaka, M. Ogiue-Ikeda, Modulation of synaptic plasticity by brain estrogen in the hippocampus, Biochim. Biophys. Acta 1800 (10) (2010) 1030–1044. N. Strutz-Seebohm, G. Seebohm, E. Shumilina, A.F. Mack, H.J. Wagner, A. Lampert, F. Grahammer, G. Henke, L. Just, T. Skutella, M. Hollmann, F. Lang, Glucocorticoid adrenal steroids and glucocorticoid-inducible kinase isoforms in the regulation of GluR6 expression, J. Physiol. 565 (Pt 2) (2005) 391–401. Y.C. Yang, Y.L. Ma, W.T. Liu, E.H. Lee, Laminin-beta1 impairs spatial learning through inhibition of ERK/MAPK and SGK1 signaling, Neuropsychopharmacology 36 (12) (2011) 2571–2586. C.C. Chao, Y.L. Ma, E.H. Lee, Protein kinase CK2 impairs spatial memory formation through differential cross talk with PI-3 kinase signaling: activation of Akt and inactivation of SGK1, J. Neurosci. 27 (23) (2007) 6243–6248. F. Lang, N. Strutz-Seebohm, G. Seebohm, U.E. Lang, Significance of SGK1 in the regulation of neuronal function, J. Physiol. 588 (Pt 18) (2010) 3349–3354. S.W. Tyan, M.C. Tsai, C.L. Lin, Y.L. Ma, E.H. Lee, Serum- and glucocorticoid-inducible kinase 1 enhances zif268 expression through the mediation of SRF and CREB1 associated with spatial memory formation, J. Neurochem. 105 (3) (2008) 820–832. Y.C. Yang, C.H. Lin, E.H. Lee, Serum- and glucocorticoid-inducible kinase 1 (SGK1) increases neurite formation through microtubule depolymerization by SGK1 and by SGK1 phosphorylation of tau, Mol. Cell. Biol. 26 (22) (2006) 8357–8370. A. Yang, C. Wang, B. Song, W. Zhang, Y. Guo, R. Yang, G. Nie, Y. Yang, C. Wang, Attenuation of beta-amyloid toxicity in vitro and in vivo by accelerated aggregation, Neurosci. Bull. 33 (4) (2017) 405–412. Z. Cai, C. Wang, W. He, Y. Chen, Berberine alleviates amyloid-beta pathology in the brain of APP/PS1 transgenic mice via inhibiting beta/gamma-Secretases activity and enhancing alpha-secretases, Curr. Alzheimer Res. 15 (11) (2018) 1045–1052. M. Chin-Chan, M.G. Maldonado-Velazquez, R. Mex-Alvarez, P.M. Garma-Quen, L. Cobos-Puc, Amyloid-degrading enzymes in Alzheimer s disease: from molecules to genetic therapy, Rev. Med. Inst. Mex. Seguro Soc. 56 (4) (2018) 387–394. A. Sogorb-Esteve, M.S. Garcia-Ayllon, J. Gobom, J. Alom, H. Zetterberg, K. Blennow, J. Saez-Valero, Levels of ADAM10 are reduced in Alzheimer’s disease CSF, J. Neuroinflammation 15 (1) (2018) 213. S.F. Lichtenthaler, Alpha-secretase cleavage of the amyloid precursor protein: proteolysis regulated by signaling pathways and protein trafficking, Curr. Alzheimer Res. 9 (2) (2012) 165–177. N.K. Agarwal, C.H. Chen, H. Cho, D.R. Boulbes, E. Spooner, D.D. Sarbassov, Rictor regulates cell migration by suppressing RhoGDI2, Oncogene 32 (20) (2013) 2521–2526. A. Pyronneau, Q. He, J.Y. Hwang, M. Porch, A. Contractor, R.S. Zukin, Aberrant Rac1-cofilin signaling mediates defects in dendritic spines, synaptic function, and sensory perception in fragile X syndrome, Sci. Signal. 10 (504) (2017). M.R. Bennett, J. Lagopoulos, Stress and trauma: BDNF control of dendritic-spine formation and regression, Prog. Neurobiol. 112 (2014) 80–99. W. Huang, P.J. Zhu, S. Zhang, H. Zhou, L. Stoica, M. Galiano, K. Krnjevic, G. Roman, M. Costa-Mattioli, mTORC2 controls actin polymerization required for consolidation of long-term memory, Nat. Neurosci. 16 (4) (2013) 441–448. H. Izumi, Y. Shinoda, T. Saito, T.C. Saido, K. Sato, Y. Yabuki, Y. Matsumoto, Y. Kanemitsu, Y. Tomioka, N. Abolhassani, Y. Nakabeppu, K. Fukunaga, The disease-modifying drug candidate, SAK3 improves cognitive impairment and inhibits amyloid beta deposition in app knock-in mice, Neuroscience 377 (2018) 87–97.
9