- Email: [email protected]
Hippocampal synaptic plasticity in mice devoid of cellular prion protein
Molecular Brain Research 131 (2004) 58 – 64 www.elsevier.com/locate/molbrainres
Research report
Hippocampal synaptic plasticity in mice devoid of cellular prion protein Laura E. Maglioa, Mariela F. Pereza, Vilma R. Martinsb, Ricardo R. Brentanib, Oscar A. Ramireza,* a
Departamento de Farmacologı´a, Facultad de Ciencias Quı´micas, Universidad Nacional de Co´rdoba, Haya de la Torre y Medina Allende, 5000 Co´rdoba, Argentina b Ludwig Institute for Cancer Research, Sa˜o Paulo Branch, Rua Prof. Antoˆnio Prudente 109/4A, Sa˜o Paulo, 01509-010 SP, Brazil Accepted 23 August 2004 Available online 15 September 2004
Abstract The cellular prion protein plays a role in the etiology of transmissible and inherited spongiform encephalopathies. However, the physiological role of the cellular prion protein is still under debate. Results regarding the synaptic transmission using the same strain of animals where the cellular prion protein gene was ablated are controversial, and need further investigation. In this work, we have studied the hippocampal synaptic transmission in mice devoid of normal cellular prion protein, and have shown that these animals present an increased excitability in this area by the lower threshold (20 Hz) to generate long-term potentiation (LTP) in hippocampal dentate gyrus when compared to wild-type animals. The mice devoid of normal cellular prion protein are also more sensitive to the blocking effects of dizocilpine and 2amino-5-phosphonopentanoic acid on the hippocampal long-term potentiation generation. In situ hydridization experiments demonstrated overexpression of the mRNAs for the N-methyl-d-aspartate (NMDA) receptor NR2A and NR2B subunits in mice devoid of normal cellular prion protein. Therefore, our results indicate that these animals have an increased hippocampal synaptic plasticity which can be explained by a facilitated glutamatergic transmission. The higher expression of specific N-methyl-d-aspartate receptor subunits may account for these effects. D 2004 Elsevier B.V. All rights reserved. Theme: Disorders of the nervous system Topic: Degenerative disease: other Keywords: PrPc; NMDA receptor subunits; Hippocampus; Dentate gyrus; Long-term potentiation; Encephalopathies
1. Introduction The genetic code of the prion protein (PrPc) was identified only after the isolation of an abnormal isoform (PrPsc) from mice brains that were infected with the disease scrapie [33]. Scrapie and bovine spongiform encephalopathy in animals as well as Creutzfeldt–Jakob disease in humans are neurodegenerative disorders caused by prions [33–35]. During the disease process, the cellular isoform of prion protein PrPc is posttranslationally modified to an
* Corresponding author. Tel.: +54 351 4334437; fax: +54 351 4334420. E-mail address: [email protected] (O.A. Ramirez). 0169-328X/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.molbrainres.2004.08.004
abnormal or scrapie isoform designated as PrPsc [4,31]. The physiological functions of the normal host PrPc are still under investigation, with some of them starting to be clarified [27]. As PrPc is a glycoprotein expressed on the surface of many cell types [29,15], a neuron-only function for PrPc is not valid. However, the fact that the protein is expressed in neurons at higher levels than for any other cell type suggests that PrPc has a special importance for these cells. Besides, PrPc is concentrated in synapses [37] and is highly expressed in the hippocampus [14]. Additionally, both presynapticaly and postsynapticaly PrPc expression has been observed [1,16,37]. PrPc is a glycoprotein located on the outward surface of the cells, anchored by glycosylphosphatidylinositol, which is involved with protection against
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
oxidative stress [6] and programmed cell death through cAMP/PKA pathway [10,41]. Moreover, PrPc is a specific high affinity saturable receptor for the carboxy-terminal decapeptide (RNIAEIIKDI) of the laminin g-1 chain [18]. The interaction between the two molecules mediates neuritogenesis and neurite maintenance both in a cell line and for primary cultures from hippocampal neurons [18,19]. Long-term potentiation (LTP) in the hippocampus is one form of synaptic plasticity, and is thought to be a cellular mechanism underlying learning and memory [3,23]. LTP is induced by high-frequency stimulation, and requires activation of N-methyl-d-aspartate (NMDA)-type glutamate receptors and consequent calcium entry into the postsynaptic spine, at least in the Schaffer collateral–CA1 pyramidal cell synapses and granule cell of the hippocampus dentate gyrus [12]. Synaptic plasticity was recently considered to be related to the structural modification of postsynaptic regions [7,17] and may be regulated by the interaction between cells and the extracellular matrix (ECM). For instance, it has been recently reported that LTP can be regulated by laminin degradation by plasmin [30]. At present, there is some controversy related to the PrPc protein and synaptic transmission in the hippocampus. Collinge et al. [11] reported that prion protein is necessary for normal hippocampal synaptic functioning. On the other hand, Lledo et al. [22] have reported a normal neuronal excitability and synaptic transmission in the hippocampus of mice deficient in prion protein. More recently, Curtis et al. [13] have reported a reduction in the level of posttetanic potentiation and LTP in the CA1 region of aged PrP-null mice. Considering that PrPc is abundantly expressed in the hippocampus, we decided to further investigate the physiological function of PrPc protein in the CNS. To this end, we studied hippocampal synaptic plasticity in mice lacking the cellular prion protein (Prnp0/0, Zrch-1) [8].
2. Materials and methods 2.1. Animals Thirty-tree adult male Prnp0/0 mice (3 to 4 months old) descendents of the animals generated by Bqller et al. [8], were homozygous disrupted for the PrPc gene. Another 35 male wild-type mice also were used in the experiments. The genetic background of both Prnp0/0 and wild-type animals was derived from both 129/Sv and C57BL/6J. Animals were housed five to a plastic box with food and water available ad libitum, and were maintained in a 12-h light/dark cycle (lights on at 7:00 a.m.). 2.2. Electrophysiological procedures Animals were sedated with a 50:50 mixture of CO2–O2 and sacrificed by cervical dislocation, with the brains being removed for electrophysiological assays. Hippocampal
59
slices were obtained from 22 Prnp0/0 and wild-type animals. Electrophysiological experiments were carried out using the in vitro hippocampal slice preparation described elsewhere by Pe´ rez et al. [32]. Briefly, mice were sacrificed between 1100 and 1200 a.m. to prevent variations caused by circadian rhythms or nonspecific stressors [38]. The hippocampal formation was dissected, and transverse slices, approximately 400 Am thick, were placed in a (BSC-BU Harvard Apparatus) recording chamber, perfused with standard Krebs solution (NaCl 124.3 mM, KCl 4.9 mM, MgSO4.7 H2O 1.3 mM, H2KPO4 1.25 mM, HNaCO3 25.6 mM, glucose 10.4 mM, CaCl2.2 H2O 2.3 mM; Sigma) saturated with 95% O2 and 5% CO2. The rate of perfusion was 1.6 ml/min, while the bathing solution temperature was kept at 28 8C by the use of a Temperature Controller (TC-202A Harvard Apparatus). A stimulating electrode made of two insulated twisted wires except for the cut ends (diameters 50 Am) was placed in the perforant path (PP), and a recording microelectrode made with a micropipette (tip 10–20 Am) was inserted in the dentate granule cell body layer. Only slices showing a stable response were included in this electrophysiological study. Ten field potentials that responded to the stimuli were sampled at 0.2 Hz, then averaged on line using a PC computer, and the data thus obtained were stored on diskettes for further analysis. Once no further changes were observed in the amplitude of the response, which included population spike (PS) for 20 min, the intensity of the electrical stimulus to the PP was set at a value that would elicit spikes at approximately 30% of the maximum response and then the long-term potentiation (LTP) eliciting frequency threshold was determined. Tetanus consisting of a train of pulses (0.5 ms) of 2-s duration and with increasing frequency was delivered to the slice, by a A310 Accupulser Pulse Generator (World Precision Instruments), at intervals that ranged from 20 min up to 45 min, starting with a 5 Hz tetanus, whose intensity increased with each train to 10, 25, 50, 75, 100, 150 up to 200 Hz. Fifteen to 20 min after a tetanus, a new averaged response was recorded; when LTP was not observed, another tetanus at the next higher frequency was applied. LTP was considered to have occurred when the amplitude or slope of excitatory postsynaptic potential (EPSP), or the amplitude of the population spike recorded after the tetanus, had risen by at least 30% and persisted for more than 60 min. Once LTP was achieved, no further tetanus were given. In the experiments in which the effect of blockage by 2amino-5-phosphonopentanoic acid (APV, Sigma) on LTP generation was evaluated, slices were perfused continuously for 20 min with Krebs solution containing APV 20 and 50 AM. These concentrations of APV were chosen from previous work in our laboratory, in which 10 and 20 AM APV were found to block LTP induction [36]. The blocking effect of MK-801 (Sigma) on LTP generation was tested in
60
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
slices perfused continuously for 60 min with Krebs solution containing 5 and 10 AM of the drug. During perfusion with MK-801, slices were stimulated at low frequency (0.2 Hz) and every 10 min, a 10-Hz tetanus of 2-s duration was applied to produce the use-dependent blockade that has been described for MK-801 [5,40]. These conditions meet the standards for care of laboratory animals as outlined in the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications N8 80-23) revised 1996. 2.3. In situ hybridization 2.3.1. Brain tissue fixation Prnp0/0 and wild-type mice (3 for each group) were anesthetized with ethylic ether, and then perfused transcardially with physiological saline followed by 4% paraformaldehyde (Sigma) in 0.1 M PB, pH 7.4. Thereafter, brains were removed and maintained in paraformaldehyde fixation solution for 30 min and then transferred and maintained in 30% sucrose in 0.1 M PB during 72 h. Finally, the brains were sectioned into 30-Am coronal slices by means of a freezing microtome. 2.3.2. Labeling of oligonucleotide probes Deoxynucleotide probes (45-mer) synthesized by BIOSCHILE (Santiago, Chile) were used for the HIS experiments as previously described by Andre´s et al. [2], with minor modifications. The following antisense oligonucleotides targeted at subtype-specific regions between TMI and TMII were used as probes: 5V TTCCTCCTCCTCCTCACTGTTCACCTTGAATCGGCCAAAGGGACT 3V (oligo NR1 complementary to sequences encoding amino acid residues 566 to 580 of the mature NR1 polypeptide); 5V AGAAGGCCCGTGGGAGCTTTCCCTTTGGCTAAGTTTC 3V (oligo NR2A, complementary to codons 567 to 579 of NR2A); GGGCCTCCTGGCTCTCTGCCATCGGCTAGGCACCTGTTGTAACCC (oligo NR2B, complementary to codons 557 to 572 of NR2B) previously reported by Monyer et al [28]. One hundred picomoles of each probe was 3V end-labeled by incubation with 55U of terminal transferase (Roche) in 20 Al of tailing buffer, 9 nmol of dATP (Sigma), and 1nmol of digoxigenin-labeled deoxyuridine-triphosphate (DIG-dUTP, Roche). 2.3.3. In situ hybridization and immunological detection Brain coronal slices were rinsed with phosphate-buffered saline (PBS) and then incubated at 37 8C in a prehybridization solution containing Denhardt’s 1 (Denhardt’s 100: 2% Ficoll, 2% polyvinil pyrrolidone, 2% BSA; Sigma) and SSC 4 (SSC 20: 3 M sodium citrate, 3 M NaCl, pH 7.4; Sigma). The tissue slices were then hybridized overnight at 37 8C with 0.01 pmol/Al of NR1, NR2A or NR2B oligonucleotide antisense probes in a buffer containing formamide (Sigma), 50%; Dextran sulphate (Sigma), 1 mg/ ml; and dithiotreitol (Sigma), 10mM, in Tris buffer
(Backer), pH 7.5. Following hybridization, the tissues slices were rinsed with 2SSC, 1SSC and 0.5SSC, 10 min each time at 42 8C. For control experiments, tissue slices were incubated with the DIG-dUTP-labeled scrambled probe (45-mer) under the conditions previously described. The presence of DIG-oligonucleotides in brain tissues slices was detected with anti-DIG antibodies conjugated with alkaline phosphatase and NBT/ BCIP (GIBCO, Life technologies) used as enzyme substrates to develop the reaction. Briefly, the tissue slices were initially rinsed with Tris buffer, pH 7.5, and later incubated for 90 min with the antibody at room temperature. The slices were then rinsed several times and incubated with NBT/ BCIP in Tris buffer, pH 9.5, for 8 h. Finally, the slices were mounted onto glass slides with gelatine (0.1 %) and observed under light microscopy. 2.3.4. Data analysis Hippocampal dentate gyrus cells with the product of the alkaline phosphatase reaction originated from DIG-labeled probes were photographed using a light microscope (Zeiss Axioplan) with Metamorph computer software at a magnification of 200. Cells were counted in each field using the SCION program from NIH. Three glass slides, two fields per slide, per rat, were considered for the statistical analysis. 2.4. Statistics A one-way ANOVA was used to evaluate the differences in threshold in order to induce LTP for Prnp0/0 and wild-type mice. In addition, the same test was used to evaluate the differences in the expression of mRNA for the NMDA receptor NR1, NR2A and NR2B subunits between groups. The probability level at which the Null Hypothesis was rejected was 99.95%.
3. Results 3.1. Long-term potentiation A characteristic evoked field response in the granule cell body layer of the dentate gyrus, after single-pulse stimulation in the perforant path is shown in Fig. 1 (A and B), for Prnp0/0 and wild-type mice. It consists of a gradual positive-going field excitatory postsynaptic potential (EPSP), with a sharp negative-going PS superimposed on the rising phase of the EPSP. The EPSP reflects synaptic currents at perforant path-dentate granule cell synapses in striatum moleculare, whereas the PS reflects the synchronized action potential discharge of granule cell bodies in the striatum granulosum. There was no apparent difference between control and Prnp0/0 mice brain slices in terms of wave form.
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
61
Fig. 2. Threshold to induce LTP in hippocampal dentate gyrus, Prnp0/0 and wild-type mice (Prnp+/+). Each bar represents the mean and vertical barsFS.E.M. The number of animals used in each group is indicated between parentheses. *Pb0.0002 compared to the wild-type group. An average of three slices per animal was used.
3.2. In situ hybridization
Fig. 1. Sample field potential responses collected from slice of Prnp 0/0 (A) and Prnp+/+ (B), during baseline recordings and after inducing LTP, from the granule cell layer of the dentate gyrus following stimulation of the PP. (C) Plots of evoked potentials recorded in granule cells layer of the dentate gyrus by stimulation of the PP in hippocampal slices in Prnp0/0 and Prnp+/+ animals. Values before time point 20 min show the levels of baseline of each group. Recordings were then continued for 60 min in all groups. Potentiation are comparable and there was not statistically different between mice [Prnp 0/0 (146.05F11.73) vs. Prnp+/+ (141.11F3.85); F(1,15)=0.201; Pb0.66], 60 min after tetanus. Each point correspond to an average of EPSP obtained from three slices per animal (n=9 animals per group).
We observed that the threshold needed to induce LTP in hippocampal dentate gyrus slices from Prnp0/0 mice (27F4) is three times lower than that necessary to produce the same effect in wild-type mice (78F8) [ F(1,19)=32.7; Pb0.0001, Fig. 2]. The dose–response curve of MK-801 inhibitory activity on LTP induction in hippocampal dentate gyrus demonstrated that slices from Prnp0/0 mice need higher concentrations (10 AM) than those from wild-type animals (5 AM) to block LTP generation (Fig. 3). The same figure shows that APV perfusion (20 AM) blocks LTP generation in granule cells of hippocampus dentate gyrus on control slices, in 100% of the cases, whereas it is inactive on those from Prnp0/0 mice.
Digoxigenin antisense oligonucleotide probes complementary to the mRNA for the NMDA receptor NR1, NR2A and NR2B subunits, were able to generate intense and specific hybridization signals in numerous cells of dentate gyrus of the hippocampus from Prnp0/0 (Fig. 4A, C and E) and wild-type (Fig. 4B, D, and F) mice. Incubation with the DIG-dUTP-labeled scramble probe (45-mer) blocked the appearance of hybridization signals in brain coronal slices under the present experimental conditions. Fig. 5 shows that Prnp0/0 mice had a significant increase of hybridization signals of mRNA (number of positive cells/ mm2) for the NMDA receptor NR2A subunit (1.01F0.21) compared to wild type (0.35F0.03) [ F(1,13)=12.78; Pb0.003] and also for NR2B subunit (0.86F0.08) compared
Fig. 3. Inhibitory effect of APV and MK-801 on LTP induction. Each bar represents the percentage slices where the LTP induction was blocked. A total of 10 slices was used (2 slices from 5 different animals).
62
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
Fig. 4. In situ localization of NMDA receptor subunits mRNA in hippocampal dentate gyrus. Each figure represents a hippocampal dentate gyrus section of coronal brain slices from Prnp0/0 (A, C, E) and Prnp+/+ (B, D, F) animals reacted with DIG-dUTP-labeled probes for NR1 (A, B), NR2A (C, D), and NR2B (E, F). The contrast and brightness of this image have been adjusted with Adobe Photoshop 7.0 program.
with wild type (0.53F0.05) [ F(1,23)=11.24; Pb0.003] in the hippocampal dentate gyrus.
4. Discussion
Fig. 5. Quantification of cells with positive mRNA expression for NMDA receptor subunits NR1, NR2A and NR2B in hippocampal dentate gyrus of wild-type (Prnp+/+), and Prnp0/0 mice. Cells with DIG-labeled oligonucleotides were counted in sample fields as described under Materials and methods. Bars represent meanFS.E.M. of sample fields from three independent experiments with three animals per group. *Pb0.0002 compared with wild-type group.
The major finding of the present study was the lower threshold needed to generate LTP in the hippocampal dentate gyrus of Prnp0/0 mice compared to wild-type animals. Furthermore, these animals showed less sensitivity to the blockage effects of both APV (an NMDA glutamate receptor antagonist) and MK-801 (a blocker of the ionic channel NMDA associated receptor). Controversial results have previously been reported for the neuronal excitability and synaptic transmission in the hippocampus of mice deficient for PrPc protein. Using the same Prnp0/0 mice strain that we used here, Collinge et al. [11] reported that prion protein is necessary for normal synaptic functioning, while Lledo et al. [22] found that these mice exhibited normal neuronal excitability and synaptic transmission in the hippocampus. There are many reasons to explain the
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
differences between the results reported in the present study and those reported by the other authors. First of all, under our experimental conditions we delivered increasing frequencies up to 40 Hz to stimulate the PP that reach the granule cell of the dentate gyrus in order to generate a LTP, whereas other authors have used supra maximal stimulation (100 Hz). Secondly, most authors record from CA1 pyramidal cell, but in the present study we have recorded from granule cells of the hippocampal dentate gyrus. Moreover, our experimental subjects were 3 months old while Lledo et al. [22] worked with 8-month-old animals. In fact, we have recently found that hippocampal slices from 8month-old Prnp0/0 mice have similar thresholds for LTP induction as compared with those from 3-month-old wildtype animals (unpublished observation). The NMDAR1 subunit is essential for the functioning of the NMDA receptor, and multiple NMDAR2 subunits potentate and differentiate NMDA receptor function by forming different heteromeric configurations with NMDAR1 [20]. One interesting feature of the NMDAR2 subunits, is that as in the case of NMDAR1, all possess many possible phosphorylation sites for Ca2+/calmodulin-dependent protein kinase type II and protein kinase C [21]. These protein kinases have been reported to play a crucial role in the induction and maintenance of LTP [24]. Furthermore, the heteromeric receptor NMDAR1/R2A showed strong sensitivity to the channel blocker MK-801 [21]. In order to look closer at the participation of hippocampal glutamatergic transmission in the increased excitability exhibited by the granule cells of the dentate gyrus, we have examined mRNA levels for the different subunits of the NMDA receptor. The expression of mRNA for subunits NR2A and NR2B showed much greater increase in the hippocampal dentate gyrus of Prnp0/0 mice compared to the wild-type animals. Considering all these findings, we can speculate that increased hippocampal synaptic plasticity, reported here in Prnp0/0 mice, is a consequence of the facilitated glutamatergic transmission. In addition, the lower threshold needed to induce LTP in the hippocampal dentate gyrus could also be explained by a decreased GABAergic hippocampal transmission, because it has been reported that PrPc-deficient mice show a lower GABAA receptor-mediated inhibition [11,26]. It has been demonstrated that PrPc is a receptor for laminin [18], and that laminin degradation facilitates LTP generation [30]. The results presented here show an increased excitability in the hippocampal synaptic transmission in mice devoid of PrPc. In agreement with this, more recently, Mallucci et al. [25] have reported that PrPc postnatal knockout mice showed a significant reduction of afterhyperpolarization potential in hippocampal CA1 cells, suggesting a direct role of PrPc in the modulation of neuronal excitability. In fact, previous work have demonstrated that these animals are more susceptible to seizure induced by kainic acid [39], a convulsant agent known to induce tissue plasminogen activator which degradates laminin in the brain
63
[9]. Therefore, we can postulate that laminin binding to PrPc could contribute to decreased neuronal excitability in different areas of the CNS and this modulating effect could be one of the physiological functions of this protein.
Acknowledgements This work was partially supported by FAPESP (99/07124-8).
References [1] A. Aguzzi, C. Welssman, Prion research: the next frontiers, Nature 387 (1999) 795 – 798. [2] M.E. Andre´s, K. Gysling, S. Araneda, A. Venegas, G. Bustos, NMDA-NR1 receptor subunit mRNA expression in rat brain after 6OH-dopamine induced lessions: a non-isotopic in situ hybridization study, J. Neurosci. Res. 46 (1996) 375 – 384. [3] T.V.P. Bliss, T. Lomo, Long lasting potentiation of synaptic transmission in the dentate area of the anaesthetized rabbit following stimulation of the perforant path, J. Physiol. (Lond.) 232 (1973) 331 – 356. [4] D.R. Borchelt, M. Scott, A. Taraboulos, N. Stahl, S.B. Prusiner, Scrapie and cellular prion proteins differ in their kinetics of synthesis and topology in cultured cells, J. Cell. Biol. 110 (1990) 743 – 752. [5] C.M. Borghese, R.A. Gomez, O.A. Ramı´rez, Phosphatidylserine increase hippocampal synaptic efficacy, Brain Res. Bull. 31 (1993) 697 – 700. [6] D.R. Brown, Prion and prejudice: normal protein and synapse, Trends Neurosci. 24 (2) (2001) 85 – 90. [7] P.A. Buchs, D. Mqller, Induction of long-term potentiation is associated with major ultrastructural changes of activated synapses, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 8040 – 8045. [8] H. Bqller, M. Fischer, Y. Lang, H. Bluetmann, H.P. Lipp, S.J. DeArmond, S.B. Prusiner, M. Aguet, C. Weismann, Normal development and behavior of mice lacking the neuronal cell-surfaces PrP protein, Nature 356 (1992) 577 – 582. [9] Z.L. Chen, S. Strickland, Neuronal death in the hippocampus is promoted by plasmin-catalyzed degradation of laminin, Cell 91 (7) (1997) 917 – 925. [10] L.B. Chiarini, A.R. Freitas, S.M. Zanata, R.R. Brentani, V.R. Martins, R. Linden, Cellular prion protein transduces neuroprotective signals, EMBO J. 21 (13) (2002) 3317 – 3326. [11] J. Collinge, M.A. Whittington, K.C.L. Sidle, C.J. Smith, M.S. Palmer, A.R. Clarke, C.R. Jefferys, Prion protein is necessary for normal synaptic function, Nature 370 (1994) 295 – 297. [12] G.L. Collingridge, S.J. Kehl, H. Mc Lennan, Excitatory aminoacid in synaptic transmission in the Schaffer collateral commissural pathway of the rat hippocampus, J. Physiol. (Lond.) 334 (1983) 33 – 46. [13] J. Curtis, M. Errington, T. Bliss, K. Voss, N. MacLeod, Agedependent loss of PTP and LTP in the hippocampus of PrP-null mice, Neurobiol. Dis. 13 (2003) 55 – 62. [14] S.J. DeArmond, W.C. Mobley, D.L. DeMott, R.A. Barry, J.H. Beckstead, S.B. Prusiner, Changes in the localization of brain prion proteins during scrapie infection, Neurology 37 (1987) 1271 – 1280. [15] L. Diomede, S. Sozzani, W. Luini, M. Algeri, L. De Gioia, R. Chiesa, M. Lievens, O. Bugiani, G. Forloni, F. Tagliavini, M. Salmona, Activation effect of a prion protein fragment [PrP-(106–126)] on human leucocytes, Biochem. J. 320 (1996) 563 – 570. [16] J.G. Fournier, F. Escaig-Haye, V. Grigoriev, Ultrastructural localization of prion proteins: physiological and pathological implications, Microsc. Res. Tech. 50 (2000) 76 – 88.
64
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
[17] Y. Geinisman, Perforated axospinous synapses with multiple, completely partitioned transmission zones: probable structural intermediates in synaptic plasticity, Hippocampus 3 (1993) 417 – 434. [18] E. Graner, A.F. Mercadante, S.M. Zanata, O.V. Forlenza, A.L.B. Cabral, S.S. Veiga, M.A. Juliano, R. Roesler, R. Walz, A. Minetti, I. Izquierdo, V.R. Martins, R.R. Brentani, Cellular prion protein binds laminin and mediates neuritogenesis, Brain Res. Mol. Brain Res. 76 (2000) 85 – 92. [19] E. Graner, A.F. Mercadante, S.M. Zanata, V.R. Martins, D.G. Jay, R.R. Brentani, Laminin-induced PC-12 cell differentiation is inhibited following laser inactivation of cellular prion protein, FEBS Lett. 482 (3) (2000) 257 – 260. [20] T. Ishii, K. Moriyoshi, H. Sugihara, K. Sakurada, H. Kadotani, M. Yokoi, C. Akazawa, R. Shigemoto, N. Mizuno, M. Masu, S. Nakanishi, Molecular caracterization of the family of the Nmethyl-d-Aspartate receptor subunits, J. Biol. Chem. 268 (1993) 2836 – 2843. [21] B.E. Kemp, R.B. Pearson, Protein kinase recognition sequence motifs, Trends Biochem. Sci. 15 (1990) 342 – 346. [22] P.M. Lledo, P. Tremblay, S.J. DeArmond, S.B. Prusiner, R.A. Nicoll, Mice efficient for prion protein exhibit normal neuronal excitability and synaptic transmission in the hippocampus, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 2403 – 2407. [23] R.C. Malenka, R.A. Nicoll, Long term-potentiation: a decade of progress? Science 285 (1999) 1870 – 1874. [24] R. Malinow, D.V. Madison, R.W. Tsien, Persistent protein kinase activity underlying long-term potentiation, Nature 335 (1988) 820 – 824. [25] G.R. Mallucci, S. Ratte´, E.A. Asante, J. Linehan, I. Gowland, J.G.R. Jefferys, J. Collinge, Post-natal knockout of prion protein alters hippocampal CA1 properties, but does not result in neurodegeneration, Eur. Mol. Biol. Org. J. 21 (3) (2002) 202 – 210. [26] J.C. Manson, J. Hope, A.R. Clarke, A. Johnston, C. Black, N. MacLeod, PrP gene dosage and long term potentiation, Neurodegeneration 4 (1995) 113 – 114. [27] V.R. Martins, R. Linden, A.M. Prado, R. Waltz, A.C. Sakamoto, I. Izquierdo, R.R. Brentani, Cellular prion protein: on the road for functions, FEBS Lett. 512 (2002) 25 – 28. [28] H. Monyer, R. Spregel, R. Schoepfer, A. Herb, M. Higuchi, H. Lomeli, N. Burnasher, B. Sakmann, P.H. Seeburg, Heteromeric NMDA receptors: molecular and functional distinction of subtipes, Science 256 (1992) 1217 – 1221.
[29] M. Moser, R.J. Colello, U. Pott, B. Oesch, Developmental expression of the prion protein gene in glial cells, Neuron 14 (1995) 509 – 517. [30] Y. Nakagami, K. Abe, N. Nishiyama, N. Matsuki, Laminin degradation by plasmina regulates log-term potentiation, J. Neurosci. 20 (5) (2000) 2003 – 2010. [31] K.M. Pan, M. Baldwin, J. Nguyen, M. Gasset, A. Servan, D. Groth, I. Mehlborn, Z. Huang, R.J. Fletterick, F.E. Cohen, S.B. Prusiner, Conversion of alpha-helices into beta-sheets features in the formation of the scrapie prion proteins, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 10962 – 10966. [32] M.F. Pe´rez, L.E. Maglio, G.R. Marchesini, J.C. Molina, O.A. Ramı´rez, Environmental changes modify the expression of diazepam withdrawal, Behav. Brain Res. 136 (2002) 75 – 81. [33] S.B. Prusiner, Novel Proteinaceus infectous particles cause scrapie, Science 216 (1982) 136 – 144. [34] S.B. Prusiner, Molecular biology of prion diseases, Science 252 (1991) 1515 – 1522. [35] S.B. Prusiner, S.J. De Armond, Prion diseases and neurodegeneration, Annu. Rev. Neurosci. 17 (1994) 311 – 339. [36] O.A. Ramı´rez, R.A. Go´mez, F.H. Carrer, Differences in hippocampal synaptic plasticity in rats with inborn high or low learning ability may be related to different sensitivity of aspartate receptors, Brain Res. Bull. 27 (1991) 291 – 293. [37] N. Sales, K. Rodolfo, R. Hassig, B. Faucheux, L. Di Giamberardino, K.L. Moya, Cellular prion protein localization in rodent and primates brain, Eur. J Neurosci. 10 (1998) 2464 – 2471. [38] J. Tayler, P. Di Scenna, Long-term potentiation, Annu. Rev. Neurosci. 10 (1987) 131 – 161. [39] R. Walz, O.B. Amaral, I.C. Rockenbach, R. Roesler, I. Izquierdo, E.A. Cavalheiro, V.R. Martins, R.R. Brentani, Increased sensitivity to seizure in mice lacking cellular prion protein, Epilepsia 40 (12) (1999) 1679 – 1682. [40] G.N. Woodruff, A.C. Foster, R. Gill, J.A. Kemp, E.H.F. Wong, L.L. Iversen, The interaction between MK-801 and receptors N-methyl-daspartate: functional consequences, Neuropharmacology 26 (1987) 903 – 909. [41] S.M. Zanata, M.H. Lopez, A.F. Mercadante, G.N. Hajj, L.B. Chiarini, R. Nomizo, A.R. Freitas, A.L. Cabral, K.S. Lee, M.A. Juliano, E. De Oliveira, S.G. Jachieri, A. Burlingame, L. Huang, R. Linden, R.R. Brentani, V.R. Martins, Stress-inducible protein 1 is a cell surface ligand for cellular prion that triggers neuroprotection, EMBO J. 21 (13) (2002) 3307 – 3316.
Research report
Hippocampal synaptic plasticity in mice devoid of cellular prion protein Laura E. Maglioa, Mariela F. Pereza, Vilma R. Martinsb, Ricardo R. Brentanib, Oscar A. Ramireza,* a
Departamento de Farmacologı´a, Facultad de Ciencias Quı´micas, Universidad Nacional de Co´rdoba, Haya de la Torre y Medina Allende, 5000 Co´rdoba, Argentina b Ludwig Institute for Cancer Research, Sa˜o Paulo Branch, Rua Prof. Antoˆnio Prudente 109/4A, Sa˜o Paulo, 01509-010 SP, Brazil Accepted 23 August 2004 Available online 15 September 2004
Abstract The cellular prion protein plays a role in the etiology of transmissible and inherited spongiform encephalopathies. However, the physiological role of the cellular prion protein is still under debate. Results regarding the synaptic transmission using the same strain of animals where the cellular prion protein gene was ablated are controversial, and need further investigation. In this work, we have studied the hippocampal synaptic transmission in mice devoid of normal cellular prion protein, and have shown that these animals present an increased excitability in this area by the lower threshold (20 Hz) to generate long-term potentiation (LTP) in hippocampal dentate gyrus when compared to wild-type animals. The mice devoid of normal cellular prion protein are also more sensitive to the blocking effects of dizocilpine and 2amino-5-phosphonopentanoic acid on the hippocampal long-term potentiation generation. In situ hydridization experiments demonstrated overexpression of the mRNAs for the N-methyl-d-aspartate (NMDA) receptor NR2A and NR2B subunits in mice devoid of normal cellular prion protein. Therefore, our results indicate that these animals have an increased hippocampal synaptic plasticity which can be explained by a facilitated glutamatergic transmission. The higher expression of specific N-methyl-d-aspartate receptor subunits may account for these effects. D 2004 Elsevier B.V. All rights reserved. Theme: Disorders of the nervous system Topic: Degenerative disease: other Keywords: PrPc; NMDA receptor subunits; Hippocampus; Dentate gyrus; Long-term potentiation; Encephalopathies
1. Introduction The genetic code of the prion protein (PrPc) was identified only after the isolation of an abnormal isoform (PrPsc) from mice brains that were infected with the disease scrapie [33]. Scrapie and bovine spongiform encephalopathy in animals as well as Creutzfeldt–Jakob disease in humans are neurodegenerative disorders caused by prions [33–35]. During the disease process, the cellular isoform of prion protein PrPc is posttranslationally modified to an
* Corresponding author. Tel.: +54 351 4334437; fax: +54 351 4334420. E-mail address: [email protected] (O.A. Ramirez). 0169-328X/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.molbrainres.2004.08.004
abnormal or scrapie isoform designated as PrPsc [4,31]. The physiological functions of the normal host PrPc are still under investigation, with some of them starting to be clarified [27]. As PrPc is a glycoprotein expressed on the surface of many cell types [29,15], a neuron-only function for PrPc is not valid. However, the fact that the protein is expressed in neurons at higher levels than for any other cell type suggests that PrPc has a special importance for these cells. Besides, PrPc is concentrated in synapses [37] and is highly expressed in the hippocampus [14]. Additionally, both presynapticaly and postsynapticaly PrPc expression has been observed [1,16,37]. PrPc is a glycoprotein located on the outward surface of the cells, anchored by glycosylphosphatidylinositol, which is involved with protection against
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
oxidative stress [6] and programmed cell death through cAMP/PKA pathway [10,41]. Moreover, PrPc is a specific high affinity saturable receptor for the carboxy-terminal decapeptide (RNIAEIIKDI) of the laminin g-1 chain [18]. The interaction between the two molecules mediates neuritogenesis and neurite maintenance both in a cell line and for primary cultures from hippocampal neurons [18,19]. Long-term potentiation (LTP) in the hippocampus is one form of synaptic plasticity, and is thought to be a cellular mechanism underlying learning and memory [3,23]. LTP is induced by high-frequency stimulation, and requires activation of N-methyl-d-aspartate (NMDA)-type glutamate receptors and consequent calcium entry into the postsynaptic spine, at least in the Schaffer collateral–CA1 pyramidal cell synapses and granule cell of the hippocampus dentate gyrus [12]. Synaptic plasticity was recently considered to be related to the structural modification of postsynaptic regions [7,17] and may be regulated by the interaction between cells and the extracellular matrix (ECM). For instance, it has been recently reported that LTP can be regulated by laminin degradation by plasmin [30]. At present, there is some controversy related to the PrPc protein and synaptic transmission in the hippocampus. Collinge et al. [11] reported that prion protein is necessary for normal hippocampal synaptic functioning. On the other hand, Lledo et al. [22] have reported a normal neuronal excitability and synaptic transmission in the hippocampus of mice deficient in prion protein. More recently, Curtis et al. [13] have reported a reduction in the level of posttetanic potentiation and LTP in the CA1 region of aged PrP-null mice. Considering that PrPc is abundantly expressed in the hippocampus, we decided to further investigate the physiological function of PrPc protein in the CNS. To this end, we studied hippocampal synaptic plasticity in mice lacking the cellular prion protein (Prnp0/0, Zrch-1) [8].
2. Materials and methods 2.1. Animals Thirty-tree adult male Prnp0/0 mice (3 to 4 months old) descendents of the animals generated by Bqller et al. [8], were homozygous disrupted for the PrPc gene. Another 35 male wild-type mice also were used in the experiments. The genetic background of both Prnp0/0 and wild-type animals was derived from both 129/Sv and C57BL/6J. Animals were housed five to a plastic box with food and water available ad libitum, and were maintained in a 12-h light/dark cycle (lights on at 7:00 a.m.). 2.2. Electrophysiological procedures Animals were sedated with a 50:50 mixture of CO2–O2 and sacrificed by cervical dislocation, with the brains being removed for electrophysiological assays. Hippocampal
59
slices were obtained from 22 Prnp0/0 and wild-type animals. Electrophysiological experiments were carried out using the in vitro hippocampal slice preparation described elsewhere by Pe´ rez et al. [32]. Briefly, mice were sacrificed between 1100 and 1200 a.m. to prevent variations caused by circadian rhythms or nonspecific stressors [38]. The hippocampal formation was dissected, and transverse slices, approximately 400 Am thick, were placed in a (BSC-BU Harvard Apparatus) recording chamber, perfused with standard Krebs solution (NaCl 124.3 mM, KCl 4.9 mM, MgSO4.7 H2O 1.3 mM, H2KPO4 1.25 mM, HNaCO3 25.6 mM, glucose 10.4 mM, CaCl2.2 H2O 2.3 mM; Sigma) saturated with 95% O2 and 5% CO2. The rate of perfusion was 1.6 ml/min, while the bathing solution temperature was kept at 28 8C by the use of a Temperature Controller (TC-202A Harvard Apparatus). A stimulating electrode made of two insulated twisted wires except for the cut ends (diameters 50 Am) was placed in the perforant path (PP), and a recording microelectrode made with a micropipette (tip 10–20 Am) was inserted in the dentate granule cell body layer. Only slices showing a stable response were included in this electrophysiological study. Ten field potentials that responded to the stimuli were sampled at 0.2 Hz, then averaged on line using a PC computer, and the data thus obtained were stored on diskettes for further analysis. Once no further changes were observed in the amplitude of the response, which included population spike (PS) for 20 min, the intensity of the electrical stimulus to the PP was set at a value that would elicit spikes at approximately 30% of the maximum response and then the long-term potentiation (LTP) eliciting frequency threshold was determined. Tetanus consisting of a train of pulses (0.5 ms) of 2-s duration and with increasing frequency was delivered to the slice, by a A310 Accupulser Pulse Generator (World Precision Instruments), at intervals that ranged from 20 min up to 45 min, starting with a 5 Hz tetanus, whose intensity increased with each train to 10, 25, 50, 75, 100, 150 up to 200 Hz. Fifteen to 20 min after a tetanus, a new averaged response was recorded; when LTP was not observed, another tetanus at the next higher frequency was applied. LTP was considered to have occurred when the amplitude or slope of excitatory postsynaptic potential (EPSP), or the amplitude of the population spike recorded after the tetanus, had risen by at least 30% and persisted for more than 60 min. Once LTP was achieved, no further tetanus were given. In the experiments in which the effect of blockage by 2amino-5-phosphonopentanoic acid (APV, Sigma) on LTP generation was evaluated, slices were perfused continuously for 20 min with Krebs solution containing APV 20 and 50 AM. These concentrations of APV were chosen from previous work in our laboratory, in which 10 and 20 AM APV were found to block LTP induction [36]. The blocking effect of MK-801 (Sigma) on LTP generation was tested in
60
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
slices perfused continuously for 60 min with Krebs solution containing 5 and 10 AM of the drug. During perfusion with MK-801, slices were stimulated at low frequency (0.2 Hz) and every 10 min, a 10-Hz tetanus of 2-s duration was applied to produce the use-dependent blockade that has been described for MK-801 [5,40]. These conditions meet the standards for care of laboratory animals as outlined in the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications N8 80-23) revised 1996. 2.3. In situ hybridization 2.3.1. Brain tissue fixation Prnp0/0 and wild-type mice (3 for each group) were anesthetized with ethylic ether, and then perfused transcardially with physiological saline followed by 4% paraformaldehyde (Sigma) in 0.1 M PB, pH 7.4. Thereafter, brains were removed and maintained in paraformaldehyde fixation solution for 30 min and then transferred and maintained in 30% sucrose in 0.1 M PB during 72 h. Finally, the brains were sectioned into 30-Am coronal slices by means of a freezing microtome. 2.3.2. Labeling of oligonucleotide probes Deoxynucleotide probes (45-mer) synthesized by BIOSCHILE (Santiago, Chile) were used for the HIS experiments as previously described by Andre´s et al. [2], with minor modifications. The following antisense oligonucleotides targeted at subtype-specific regions between TMI and TMII were used as probes: 5V TTCCTCCTCCTCCTCACTGTTCACCTTGAATCGGCCAAAGGGACT 3V (oligo NR1 complementary to sequences encoding amino acid residues 566 to 580 of the mature NR1 polypeptide); 5V AGAAGGCCCGTGGGAGCTTTCCCTTTGGCTAAGTTTC 3V (oligo NR2A, complementary to codons 567 to 579 of NR2A); GGGCCTCCTGGCTCTCTGCCATCGGCTAGGCACCTGTTGTAACCC (oligo NR2B, complementary to codons 557 to 572 of NR2B) previously reported by Monyer et al [28]. One hundred picomoles of each probe was 3V end-labeled by incubation with 55U of terminal transferase (Roche) in 20 Al of tailing buffer, 9 nmol of dATP (Sigma), and 1nmol of digoxigenin-labeled deoxyuridine-triphosphate (DIG-dUTP, Roche). 2.3.3. In situ hybridization and immunological detection Brain coronal slices were rinsed with phosphate-buffered saline (PBS) and then incubated at 37 8C in a prehybridization solution containing Denhardt’s 1 (Denhardt’s 100: 2% Ficoll, 2% polyvinil pyrrolidone, 2% BSA; Sigma) and SSC 4 (SSC 20: 3 M sodium citrate, 3 M NaCl, pH 7.4; Sigma). The tissue slices were then hybridized overnight at 37 8C with 0.01 pmol/Al of NR1, NR2A or NR2B oligonucleotide antisense probes in a buffer containing formamide (Sigma), 50%; Dextran sulphate (Sigma), 1 mg/ ml; and dithiotreitol (Sigma), 10mM, in Tris buffer
(Backer), pH 7.5. Following hybridization, the tissues slices were rinsed with 2SSC, 1SSC and 0.5SSC, 10 min each time at 42 8C. For control experiments, tissue slices were incubated with the DIG-dUTP-labeled scrambled probe (45-mer) under the conditions previously described. The presence of DIG-oligonucleotides in brain tissues slices was detected with anti-DIG antibodies conjugated with alkaline phosphatase and NBT/ BCIP (GIBCO, Life technologies) used as enzyme substrates to develop the reaction. Briefly, the tissue slices were initially rinsed with Tris buffer, pH 7.5, and later incubated for 90 min with the antibody at room temperature. The slices were then rinsed several times and incubated with NBT/ BCIP in Tris buffer, pH 9.5, for 8 h. Finally, the slices were mounted onto glass slides with gelatine (0.1 %) and observed under light microscopy. 2.3.4. Data analysis Hippocampal dentate gyrus cells with the product of the alkaline phosphatase reaction originated from DIG-labeled probes were photographed using a light microscope (Zeiss Axioplan) with Metamorph computer software at a magnification of 200. Cells were counted in each field using the SCION program from NIH. Three glass slides, two fields per slide, per rat, were considered for the statistical analysis. 2.4. Statistics A one-way ANOVA was used to evaluate the differences in threshold in order to induce LTP for Prnp0/0 and wild-type mice. In addition, the same test was used to evaluate the differences in the expression of mRNA for the NMDA receptor NR1, NR2A and NR2B subunits between groups. The probability level at which the Null Hypothesis was rejected was 99.95%.
3. Results 3.1. Long-term potentiation A characteristic evoked field response in the granule cell body layer of the dentate gyrus, after single-pulse stimulation in the perforant path is shown in Fig. 1 (A and B), for Prnp0/0 and wild-type mice. It consists of a gradual positive-going field excitatory postsynaptic potential (EPSP), with a sharp negative-going PS superimposed on the rising phase of the EPSP. The EPSP reflects synaptic currents at perforant path-dentate granule cell synapses in striatum moleculare, whereas the PS reflects the synchronized action potential discharge of granule cell bodies in the striatum granulosum. There was no apparent difference between control and Prnp0/0 mice brain slices in terms of wave form.
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
61
Fig. 2. Threshold to induce LTP in hippocampal dentate gyrus, Prnp0/0 and wild-type mice (Prnp+/+). Each bar represents the mean and vertical barsFS.E.M. The number of animals used in each group is indicated between parentheses. *Pb0.0002 compared to the wild-type group. An average of three slices per animal was used.
3.2. In situ hybridization
Fig. 1. Sample field potential responses collected from slice of Prnp 0/0 (A) and Prnp+/+ (B), during baseline recordings and after inducing LTP, from the granule cell layer of the dentate gyrus following stimulation of the PP. (C) Plots of evoked potentials recorded in granule cells layer of the dentate gyrus by stimulation of the PP in hippocampal slices in Prnp0/0 and Prnp+/+ animals. Values before time point 20 min show the levels of baseline of each group. Recordings were then continued for 60 min in all groups. Potentiation are comparable and there was not statistically different between mice [Prnp 0/0 (146.05F11.73) vs. Prnp+/+ (141.11F3.85); F(1,15)=0.201; Pb0.66], 60 min after tetanus. Each point correspond to an average of EPSP obtained from three slices per animal (n=9 animals per group).
We observed that the threshold needed to induce LTP in hippocampal dentate gyrus slices from Prnp0/0 mice (27F4) is three times lower than that necessary to produce the same effect in wild-type mice (78F8) [ F(1,19)=32.7; Pb0.0001, Fig. 2]. The dose–response curve of MK-801 inhibitory activity on LTP induction in hippocampal dentate gyrus demonstrated that slices from Prnp0/0 mice need higher concentrations (10 AM) than those from wild-type animals (5 AM) to block LTP generation (Fig. 3). The same figure shows that APV perfusion (20 AM) blocks LTP generation in granule cells of hippocampus dentate gyrus on control slices, in 100% of the cases, whereas it is inactive on those from Prnp0/0 mice.
Digoxigenin antisense oligonucleotide probes complementary to the mRNA for the NMDA receptor NR1, NR2A and NR2B subunits, were able to generate intense and specific hybridization signals in numerous cells of dentate gyrus of the hippocampus from Prnp0/0 (Fig. 4A, C and E) and wild-type (Fig. 4B, D, and F) mice. Incubation with the DIG-dUTP-labeled scramble probe (45-mer) blocked the appearance of hybridization signals in brain coronal slices under the present experimental conditions. Fig. 5 shows that Prnp0/0 mice had a significant increase of hybridization signals of mRNA (number of positive cells/ mm2) for the NMDA receptor NR2A subunit (1.01F0.21) compared to wild type (0.35F0.03) [ F(1,13)=12.78; Pb0.003] and also for NR2B subunit (0.86F0.08) compared
Fig. 3. Inhibitory effect of APV and MK-801 on LTP induction. Each bar represents the percentage slices where the LTP induction was blocked. A total of 10 slices was used (2 slices from 5 different animals).
62
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
Fig. 4. In situ localization of NMDA receptor subunits mRNA in hippocampal dentate gyrus. Each figure represents a hippocampal dentate gyrus section of coronal brain slices from Prnp0/0 (A, C, E) and Prnp+/+ (B, D, F) animals reacted with DIG-dUTP-labeled probes for NR1 (A, B), NR2A (C, D), and NR2B (E, F). The contrast and brightness of this image have been adjusted with Adobe Photoshop 7.0 program.
with wild type (0.53F0.05) [ F(1,23)=11.24; Pb0.003] in the hippocampal dentate gyrus.
4. Discussion
Fig. 5. Quantification of cells with positive mRNA expression for NMDA receptor subunits NR1, NR2A and NR2B in hippocampal dentate gyrus of wild-type (Prnp+/+), and Prnp0/0 mice. Cells with DIG-labeled oligonucleotides were counted in sample fields as described under Materials and methods. Bars represent meanFS.E.M. of sample fields from three independent experiments with three animals per group. *Pb0.0002 compared with wild-type group.
The major finding of the present study was the lower threshold needed to generate LTP in the hippocampal dentate gyrus of Prnp0/0 mice compared to wild-type animals. Furthermore, these animals showed less sensitivity to the blockage effects of both APV (an NMDA glutamate receptor antagonist) and MK-801 (a blocker of the ionic channel NMDA associated receptor). Controversial results have previously been reported for the neuronal excitability and synaptic transmission in the hippocampus of mice deficient for PrPc protein. Using the same Prnp0/0 mice strain that we used here, Collinge et al. [11] reported that prion protein is necessary for normal synaptic functioning, while Lledo et al. [22] found that these mice exhibited normal neuronal excitability and synaptic transmission in the hippocampus. There are many reasons to explain the
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
differences between the results reported in the present study and those reported by the other authors. First of all, under our experimental conditions we delivered increasing frequencies up to 40 Hz to stimulate the PP that reach the granule cell of the dentate gyrus in order to generate a LTP, whereas other authors have used supra maximal stimulation (100 Hz). Secondly, most authors record from CA1 pyramidal cell, but in the present study we have recorded from granule cells of the hippocampal dentate gyrus. Moreover, our experimental subjects were 3 months old while Lledo et al. [22] worked with 8-month-old animals. In fact, we have recently found that hippocampal slices from 8month-old Prnp0/0 mice have similar thresholds for LTP induction as compared with those from 3-month-old wildtype animals (unpublished observation). The NMDAR1 subunit is essential for the functioning of the NMDA receptor, and multiple NMDAR2 subunits potentate and differentiate NMDA receptor function by forming different heteromeric configurations with NMDAR1 [20]. One interesting feature of the NMDAR2 subunits, is that as in the case of NMDAR1, all possess many possible phosphorylation sites for Ca2+/calmodulin-dependent protein kinase type II and protein kinase C [21]. These protein kinases have been reported to play a crucial role in the induction and maintenance of LTP [24]. Furthermore, the heteromeric receptor NMDAR1/R2A showed strong sensitivity to the channel blocker MK-801 [21]. In order to look closer at the participation of hippocampal glutamatergic transmission in the increased excitability exhibited by the granule cells of the dentate gyrus, we have examined mRNA levels for the different subunits of the NMDA receptor. The expression of mRNA for subunits NR2A and NR2B showed much greater increase in the hippocampal dentate gyrus of Prnp0/0 mice compared to the wild-type animals. Considering all these findings, we can speculate that increased hippocampal synaptic plasticity, reported here in Prnp0/0 mice, is a consequence of the facilitated glutamatergic transmission. In addition, the lower threshold needed to induce LTP in the hippocampal dentate gyrus could also be explained by a decreased GABAergic hippocampal transmission, because it has been reported that PrPc-deficient mice show a lower GABAA receptor-mediated inhibition [11,26]. It has been demonstrated that PrPc is a receptor for laminin [18], and that laminin degradation facilitates LTP generation [30]. The results presented here show an increased excitability in the hippocampal synaptic transmission in mice devoid of PrPc. In agreement with this, more recently, Mallucci et al. [25] have reported that PrPc postnatal knockout mice showed a significant reduction of afterhyperpolarization potential in hippocampal CA1 cells, suggesting a direct role of PrPc in the modulation of neuronal excitability. In fact, previous work have demonstrated that these animals are more susceptible to seizure induced by kainic acid [39], a convulsant agent known to induce tissue plasminogen activator which degradates laminin in the brain
63
[9]. Therefore, we can postulate that laminin binding to PrPc could contribute to decreased neuronal excitability in different areas of the CNS and this modulating effect could be one of the physiological functions of this protein.
Acknowledgements This work was partially supported by FAPESP (99/07124-8).
References [1] A. Aguzzi, C. Welssman, Prion research: the next frontiers, Nature 387 (1999) 795 – 798. [2] M.E. Andre´s, K. Gysling, S. Araneda, A. Venegas, G. Bustos, NMDA-NR1 receptor subunit mRNA expression in rat brain after 6OH-dopamine induced lessions: a non-isotopic in situ hybridization study, J. Neurosci. Res. 46 (1996) 375 – 384. [3] T.V.P. Bliss, T. Lomo, Long lasting potentiation of synaptic transmission in the dentate area of the anaesthetized rabbit following stimulation of the perforant path, J. Physiol. (Lond.) 232 (1973) 331 – 356. [4] D.R. Borchelt, M. Scott, A. Taraboulos, N. Stahl, S.B. Prusiner, Scrapie and cellular prion proteins differ in their kinetics of synthesis and topology in cultured cells, J. Cell. Biol. 110 (1990) 743 – 752. [5] C.M. Borghese, R.A. Gomez, O.A. Ramı´rez, Phosphatidylserine increase hippocampal synaptic efficacy, Brain Res. Bull. 31 (1993) 697 – 700. [6] D.R. Brown, Prion and prejudice: normal protein and synapse, Trends Neurosci. 24 (2) (2001) 85 – 90. [7] P.A. Buchs, D. Mqller, Induction of long-term potentiation is associated with major ultrastructural changes of activated synapses, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 8040 – 8045. [8] H. Bqller, M. Fischer, Y. Lang, H. Bluetmann, H.P. Lipp, S.J. DeArmond, S.B. Prusiner, M. Aguet, C. Weismann, Normal development and behavior of mice lacking the neuronal cell-surfaces PrP protein, Nature 356 (1992) 577 – 582. [9] Z.L. Chen, S. Strickland, Neuronal death in the hippocampus is promoted by plasmin-catalyzed degradation of laminin, Cell 91 (7) (1997) 917 – 925. [10] L.B. Chiarini, A.R. Freitas, S.M. Zanata, R.R. Brentani, V.R. Martins, R. Linden, Cellular prion protein transduces neuroprotective signals, EMBO J. 21 (13) (2002) 3317 – 3326. [11] J. Collinge, M.A. Whittington, K.C.L. Sidle, C.J. Smith, M.S. Palmer, A.R. Clarke, C.R. Jefferys, Prion protein is necessary for normal synaptic function, Nature 370 (1994) 295 – 297. [12] G.L. Collingridge, S.J. Kehl, H. Mc Lennan, Excitatory aminoacid in synaptic transmission in the Schaffer collateral commissural pathway of the rat hippocampus, J. Physiol. (Lond.) 334 (1983) 33 – 46. [13] J. Curtis, M. Errington, T. Bliss, K. Voss, N. MacLeod, Agedependent loss of PTP and LTP in the hippocampus of PrP-null mice, Neurobiol. Dis. 13 (2003) 55 – 62. [14] S.J. DeArmond, W.C. Mobley, D.L. DeMott, R.A. Barry, J.H. Beckstead, S.B. Prusiner, Changes in the localization of brain prion proteins during scrapie infection, Neurology 37 (1987) 1271 – 1280. [15] L. Diomede, S. Sozzani, W. Luini, M. Algeri, L. De Gioia, R. Chiesa, M. Lievens, O. Bugiani, G. Forloni, F. Tagliavini, M. Salmona, Activation effect of a prion protein fragment [PrP-(106–126)] on human leucocytes, Biochem. J. 320 (1996) 563 – 570. [16] J.G. Fournier, F. Escaig-Haye, V. Grigoriev, Ultrastructural localization of prion proteins: physiological and pathological implications, Microsc. Res. Tech. 50 (2000) 76 – 88.
64
L.E. Maglio et al. / Molecular Brain Research 131 (2004) 58–64
[17] Y. Geinisman, Perforated axospinous synapses with multiple, completely partitioned transmission zones: probable structural intermediates in synaptic plasticity, Hippocampus 3 (1993) 417 – 434. [18] E. Graner, A.F. Mercadante, S.M. Zanata, O.V. Forlenza, A.L.B. Cabral, S.S. Veiga, M.A. Juliano, R. Roesler, R. Walz, A. Minetti, I. Izquierdo, V.R. Martins, R.R. Brentani, Cellular prion protein binds laminin and mediates neuritogenesis, Brain Res. Mol. Brain Res. 76 (2000) 85 – 92. [19] E. Graner, A.F. Mercadante, S.M. Zanata, V.R. Martins, D.G. Jay, R.R. Brentani, Laminin-induced PC-12 cell differentiation is inhibited following laser inactivation of cellular prion protein, FEBS Lett. 482 (3) (2000) 257 – 260. [20] T. Ishii, K. Moriyoshi, H. Sugihara, K. Sakurada, H. Kadotani, M. Yokoi, C. Akazawa, R. Shigemoto, N. Mizuno, M. Masu, S. Nakanishi, Molecular caracterization of the family of the Nmethyl-d-Aspartate receptor subunits, J. Biol. Chem. 268 (1993) 2836 – 2843. [21] B.E. Kemp, R.B. Pearson, Protein kinase recognition sequence motifs, Trends Biochem. Sci. 15 (1990) 342 – 346. [22] P.M. Lledo, P. Tremblay, S.J. DeArmond, S.B. Prusiner, R.A. Nicoll, Mice efficient for prion protein exhibit normal neuronal excitability and synaptic transmission in the hippocampus, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 2403 – 2407. [23] R.C. Malenka, R.A. Nicoll, Long term-potentiation: a decade of progress? Science 285 (1999) 1870 – 1874. [24] R. Malinow, D.V. Madison, R.W. Tsien, Persistent protein kinase activity underlying long-term potentiation, Nature 335 (1988) 820 – 824. [25] G.R. Mallucci, S. Ratte´, E.A. Asante, J. Linehan, I. Gowland, J.G.R. Jefferys, J. Collinge, Post-natal knockout of prion protein alters hippocampal CA1 properties, but does not result in neurodegeneration, Eur. Mol. Biol. Org. J. 21 (3) (2002) 202 – 210. [26] J.C. Manson, J. Hope, A.R. Clarke, A. Johnston, C. Black, N. MacLeod, PrP gene dosage and long term potentiation, Neurodegeneration 4 (1995) 113 – 114. [27] V.R. Martins, R. Linden, A.M. Prado, R. Waltz, A.C. Sakamoto, I. Izquierdo, R.R. Brentani, Cellular prion protein: on the road for functions, FEBS Lett. 512 (2002) 25 – 28. [28] H. Monyer, R. Spregel, R. Schoepfer, A. Herb, M. Higuchi, H. Lomeli, N. Burnasher, B. Sakmann, P.H. Seeburg, Heteromeric NMDA receptors: molecular and functional distinction of subtipes, Science 256 (1992) 1217 – 1221.
[29] M. Moser, R.J. Colello, U. Pott, B. Oesch, Developmental expression of the prion protein gene in glial cells, Neuron 14 (1995) 509 – 517. [30] Y. Nakagami, K. Abe, N. Nishiyama, N. Matsuki, Laminin degradation by plasmina regulates log-term potentiation, J. Neurosci. 20 (5) (2000) 2003 – 2010. [31] K.M. Pan, M. Baldwin, J. Nguyen, M. Gasset, A. Servan, D. Groth, I. Mehlborn, Z. Huang, R.J. Fletterick, F.E. Cohen, S.B. Prusiner, Conversion of alpha-helices into beta-sheets features in the formation of the scrapie prion proteins, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 10962 – 10966. [32] M.F. Pe´rez, L.E. Maglio, G.R. Marchesini, J.C. Molina, O.A. Ramı´rez, Environmental changes modify the expression of diazepam withdrawal, Behav. Brain Res. 136 (2002) 75 – 81. [33] S.B. Prusiner, Novel Proteinaceus infectous particles cause scrapie, Science 216 (1982) 136 – 144. [34] S.B. Prusiner, Molecular biology of prion diseases, Science 252 (1991) 1515 – 1522. [35] S.B. Prusiner, S.J. De Armond, Prion diseases and neurodegeneration, Annu. Rev. Neurosci. 17 (1994) 311 – 339. [36] O.A. Ramı´rez, R.A. Go´mez, F.H. Carrer, Differences in hippocampal synaptic plasticity in rats with inborn high or low learning ability may be related to different sensitivity of aspartate receptors, Brain Res. Bull. 27 (1991) 291 – 293. [37] N. Sales, K. Rodolfo, R. Hassig, B. Faucheux, L. Di Giamberardino, K.L. Moya, Cellular prion protein localization in rodent and primates brain, Eur. J Neurosci. 10 (1998) 2464 – 2471. [38] J. Tayler, P. Di Scenna, Long-term potentiation, Annu. Rev. Neurosci. 10 (1987) 131 – 161. [39] R. Walz, O.B. Amaral, I.C. Rockenbach, R. Roesler, I. Izquierdo, E.A. Cavalheiro, V.R. Martins, R.R. Brentani, Increased sensitivity to seizure in mice lacking cellular prion protein, Epilepsia 40 (12) (1999) 1679 – 1682. [40] G.N. Woodruff, A.C. Foster, R. Gill, J.A. Kemp, E.H.F. Wong, L.L. Iversen, The interaction between MK-801 and receptors N-methyl-daspartate: functional consequences, Neuropharmacology 26 (1987) 903 – 909. [41] S.M. Zanata, M.H. Lopez, A.F. Mercadante, G.N. Hajj, L.B. Chiarini, R. Nomizo, A.R. Freitas, A.L. Cabral, K.S. Lee, M.A. Juliano, E. De Oliveira, S.G. Jachieri, A. Burlingame, L. Huang, R. Linden, R.R. Brentani, V.R. Martins, Stress-inducible protein 1 is a cell surface ligand for cellular prion that triggers neuroprotection, EMBO J. 21 (13) (2002) 3307 – 3316.