NF-κB pathway

Biomedicine & Pharmacotherapy 97 (2018) 818–824

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

Histone deacetylase 6 inhibitor ACY-1215 protects against experimental acute liver failure by regulating the TLR4-MAPK/NF-κB pathway

MARK

Wen-bin Zhanga, Hai-yue Zhanga, Fang-zhou Jiaoa, Lu-wen Wanga, Hong Zhangb, ⁎ Zuo-jiong Gonga, a b

Department of Infectious Diseases, Renmin Hospital of Wuhan University, Wuhan, Hubei 430060, China Department of Pharmaceutical, Renmin Hospital of Wuhan University, Wuhan, Hubei 430060, China

A R T I C L E I N F O

A B S T R A C T

Keywords: ACY-1215 Histone deacetylase 6 Acute liver failure Inflammation

Histone deacetylase 6 (HDAC6) is considered a new target for anticancer, anti-inflammatory, and neurodegenerative treatment. ACY-1215 is a selective histone deacetylase 6 inhibitor, and it has been recognized as a potential anticancer and anti-inflammation drug. The aim of our study was to investigate whether ACY-1215 has protective effects on acute liver failure (ALF) in mice and explore its potential mechanism. Male C57/BL6 mice were divided into normal, model, and ACY-1215 groups. ACY-1215 (25 mg/kg) and same amounts of saline were given to mice. After 2 h, the ALF models were induced by lipopolysaccharide (LPS, 100 μg/kg) combined with Dgalactosamine (D-gal, 400 mg/kg). All animals were killed after 24 h. The expressions of HDAC6 were determined by western blotting and RT-PCR assay. The expression levels of inflammatory cytokines were detected by ELISA and RT-PCR. The protein expression of Toll-like receptor 4 (TLR4), mitogen-activated protein kinase (MAPK), and nuclear factor κB (NF-κB) species were determined by western blot. The mortality of mice with ALF induced by LPS and D-gal was significantly decreased by ACY-1215 pretreatment. Procedures to manage ALF caused adversely affected liver histology and function; this damage was repaired by pretreatment of ACY-1215. ACY-1215 treatment also attenuated the serum and messenger RNA levels of the proinflammatory cytokines. Pretreatment of ACY-1215 significantly decreased the protein expression of TLR4 and the activation of MAPK and NF-κB signalling pathways. ACY-1215 has potential therapeutic value in mice with ALF by directly inhibiting inflammatory response via regulation of the TLR4-MAPK/NF-kB pathway.

1. Introduction Acute liver failure (ALF) is a fatal clinical syndrome caused by the rapid loss of hepatocyte function in patients without preexisting liver disease, and ALF often leads to hepatic encephalopathy, multiple organ failure, and death [1,2]. Although many years have been spent determining comprehensive treatment methods, liver transplantation is still the most effective treatment for ALF, a severe disease with high mortality [3,4]. Therefore, it is urgent to find a new and effective strategy for ALF. Liver inflammation plays a key role in the pathogenesis and progression of ALF [5]. The severity of liver injury and clinical progression of disease in ALF is closely associated with the innate immune response induced by endotoxin [6]. Lipopolysaccharide (LPS) is the major component of endotoxin, and can be recognized by Toll-like receptor 4

(TLR4) [7]. The expression of TLR4 is increased in ALF and TLR4mediated mitogen-activated protein kinase (MAPK) and nuclear factor κB (NF-κB) signalling pathways play an important role in the process of ALF and inflammation [8,9]. In addition, Kupffer cells and macrophages could be stimulated by LPS and release tumour necrosis factoralpha (TNF-α), interleukin (IL)-1β, IL-6, and other cytokines, resulting in necrosis of hepatocyte Kupffer cells and progression of liver failure. Previously, we have shown that Trichostatin A, a broad-spectrum histone deacetylase (HDAC) inhibitor, could relieve liver damage during ALF and acute-on-chronic liver failure in rats by directly inhibiting inflammatory response [10,11]. However, the acetylation of intracellular network molecules is very extensive and the use of broadspectrum HDAC inhibitor may lead to potentially toxic and unexpected results [12]. Therefore, selective HDAC inhibitors may lower side effects more safely than broad-spectrum inhibitors. Compared with 10

Abbreviations: ALF, acute liver failure; D-Gal, D-galactosamine; ELISA, enzyme-linked immunosorbent assay; GOT, glutamic oxaloacetic transaminase; GPT, glutamate pyruvic transaminase; HDAC6, histone deacetylase 6; HE, hematoxylin & eosin; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; NF-κB, nuclear factor κB; RT-PCR, reverse transcription-polymerase chain reaction; SPF, specific pathogen-free; TLR4, toll like receptor 4; TNF-α, tumor necrosis factor α; IL-1, βinterleukin-1β ⁎ Corresponding author at: Department of Infectious Diseases, Renmin Hospital of Wuhan University, 238 Jiefang Road, Wuchang, Wuhan, Hubei, 430060, China. E-mail address: [email protected] (Z.-j. Gong). http://dx.doi.org/10.1016/j.biopha.2017.10.103 Received 29 July 2017; Received in revised form 20 October 2017; Accepted 21 October 2017 0753-3322/ © 2017 Elsevier Masson SAS. All rights reserved.

Biomedicine & Pharmacotherapy 97 (2018) 818–824

W.-b. Zhang et al.

Table 1 The primers utilized for amplification of respective genes. Gene

Species

Forward primer(5， → 3，)

Reverse primer(5， → 3,)

GAPDH TLR4 HDAC6 TNF-α IL-1β IL-6

Mouse Mouse Mouse Mouse Mouse Mouse

ATGGGTGTGAACCACGAGA GCCCTACCAAGTCTCAGCTA AGGAAATGACCACACCGAA CGTCAGCCGATTTGCTATCT CGGACTCCGCAAAGTCTAAG TACCACTCCCAACAGACCTG

CAGGGATGATGTTCTGGGCA CTGCAGCTCTTCTAGACCCA CTCCCAAAGCCTCCACAGA CGGACTCCGCAAAGTCTAAG AGCTCATATGGGTCCGACAG GGTACTCCAGAAGACCAGAGG

TLR4, Toll like receptor 4; HDAC6, histone deacetylase 6; TNF-α, tumor necrosis factor-α; IL-1β, interleukin-1β; IL-6, interleukin-6.

were sacrificed. All blood samples were centrifuged at 4,200 × g for 10 min at room temperature, and the supernatants were subsequently collected and stored at-20° C. According to the manufacturer's instructions, enzyme-linked immunosorbent assay (ELISA) kits (eBioscience, Inc., San Diego, CA, USA) were used to measure the levels of tumour necrosis factor α (TNF-α), interleukin-1β (IL-1β) and IL-6 in blood samples.

other zinc-dependent histone deacetylases (HDACs) in humans, HDAC6 is structurally and functionally unique [13]. HDAC6 has multiple biological functions, including regulation of cell growth, metastasis, and apoptosis [14]. Many studies have found that inhibiting HDAC6 activity could reduce the expression of cytokines and decrease the degree of inflammatory reaction in nervous system injury and sepsis [15,16]. However, as a new agent, there have been few studies on ACY-1215, and the effect and related mechanisms of HDAC6 inhibitor in ALF remain unclear. In the current study, we used LPS and D-galactosamine (D-gal) to induce an ALF model in C57BL/6 mice, and observed whether ACY1215 could provide protection against ALF. The association of the hepatic protection with the activation of TLR4-MAPK-NF-κB signalling pathway was also explored.

2.5. GOT/GPT measurement In order to collect the supernatant, all liver tissue was homogenized with homogenizer, then all samples were centrifuged at 2,500 × g for 10 min at 4 °C. According to the manufacturer's protocols，we used an enzymatic analysis kit (C009-2 and C010-2，Nanjing Jiancheng Bioengineering Institute, Jiangsu, China) to test the activities of glutamic-oxaloacetic transaminase (GOT) and glutamic-pyruvic transaminase (GPT).

2. Materials and methods 2.1. Animals and animal models

2.6. Quantitative real-time reverse transcription-polymerase chain reaction

All animal experiments were performed in accordance with the institutional guidelines of the Animal Care and Use Committee of Renmin Hospital of Wuhan University and the Guide for the Care of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). Adult specific pathogen-free (SPF) male C57BL/6 mice (8–10 weeks old, 18–22 g) were purchased from the Laboratory Animal Science, CAMS & PUMC (Beijing, China). All animals were allowed to acclimatize to the laboratory environment for 7 days. Fifty mice were randomly divided into a normal group (10 mice), model group (20 mice), and ACY-1215 group (20 mice). The ALF models were induced by intraperitoneal injection of LPS (100 μg/kg, L2880; Sigma) and D-gal (400 mg/kg, G0050; Sigma) as described previously [10]. A high dose of ACY-1215 (25 mg/kg, S8001, Selleck) was given to the ACY-1215 group 2 h before ALF. Meanwhile, the mice in the normal and model groups received the same volume of normal saline. All animals were killed after 24 h.

To investigate the relative mRNA expression of HDAC6, TLR4, TNFα, IL-1β and IL-6, the total mRNA obtained from frozen liver tissues and reverse transcription were performed using a PrimeScript RT reagent kit (Takara Bio, Inc., Otsu, Japan). According to the manufacturer’s protocol, the PCR amplifications were quantified using the SYBR® Green Master Mix kit (Takara Bio, Inc.) and a 7500 Real-Time PCR system (Applied Biosystems Thermo Fisher Scientific, Inc.). All results were normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression. The primer sequences used for amplification of respective genes are shown in Table 1. 2.7. Western blotting In order to determine the protein expression level of HDAC6 and activation state of TLR4-MAPK-NF-κB signalling pathway, all protein samples were extracted from liver tissues in this study. All samples have been measured by using the BCA-Kit (Thermo Fisher Scientific, 23227). A total of 50 μg of protein was loaded per lane, subjected to 10% SDSPAGE and then transferred onto a polyvinylidene difluoride membrane (Millipore, IPFL00010). After blocking with 5% non-fat milk for 1 h, the membranes were incubated overnight at 4 °C with the following primary antibodies: α-tubulin (#2125), acetyl-α-tubulin (#5335), histone H3 (#9715), acetyl-histone H3 (#9649), histone H4 (#2935), acetylhistone H4 (#2591), TLR4 (#14358), total-ERK1/2 (#4695), phosphoERK1/2 (#4370), total-P38 (#8690), phospho-p38 (#4511), total JNK (#9592), phosphor-JNK (#4668), phospho-P65(#3033), P65 (#8242), and IκBα (#4814) (Cell Signaling Technology, Inc, Danvers, MA, USA). The antibody for HDAC6 (ab1440) was purchased from Abcam Co., UK, and GAPDH (AB-P-R 001) was purchased from Hangzhou Goodhere Biotechnology Co., Ltd. After incubation with secondary antibodies, the specific bands were visualized by an ECL detection system. Specific protein expression levels were normalized to GAPDH protein for total tissue lysates.

2.2. Observation of the mortality rate The time of administration of LPS and D-gal was accepted as baseline (time point 0). The mice were observed for survival every 6 h for 24 h after induction of ALF. Then the mortality rate of the three groups was calculated. 2.3. Histological examination The livers were excised, washed with PBS and fixed overnight with 10% formalin. Then the liver tissues were embedded in paraffin and cut into 4- to 5-μm-thick slide sections. Haematoxylin and eosin staining was used for histological analysis and the pathological changes were evaluated under a light microscope. 2.4. Analysis of blood samples Blood was collected from the endocanthion in all mice before they 819

Biomedicine & Pharmacotherapy 97 (2018) 818–824

W.-b. Zhang et al.

Fig. 1. The effect of ACY-1215 on liver structure, function, and inflammation in mice with ALF. (A) The results of the haematoxylin and eosin staining (original magnification × 100) showed that ACY-1215 could alleviate necrotic changes and preserve the architecture of the liver. (B) The activities of glutamic-oxaloacetic transaminase (GOT) and glutamic-pyruvic transaminase (GPT) were used to evaluate liver function. The activities of GOT and GPT were enhanced in the model group and decreased by ACY-1215. (C) Blood was harvested, and the serum levels of TNF-α, IL-β, and IL-6 were examined by using ELISA kits. (D) The mRNA expression of proinflammatory cytokine was analysed by reverse transcription-polymerase chain reaction analysis. *P < 0.05 as compared with the corresponding normal group. #P < 0.05 versus model group.

(Fig. 1C). The mRNA expression level of inflammatory cytokines including TNF-α, IL-1β and IL-6 were significantly increased in the model group, and were suppressed in the ACY-1215 treated group (Fig. 1D).

2.8. Statistical analysis Data are expressed as means ± SD. Differences among groups were determined by two-way ANOVA followed by a post hoc Tukey test. Comparisons between two groups were performed by using an unpaired Student t-test. All data were analysed by SPSS 17.0 and a value of P < 0.05 was considered to be statistically significant.

3.2. ACY-1215 suppressed the expression levels of HDAC6 As shown in Fig. 2A, compared with the normal group, the protein expression levels of HDAC6 in liver of mice with ALF were significantly increased and were decreased by pretreatment of ACY-1215 (Fig. 2A). There was a similar trend in the level of HDAC6 mRNA expression (Fig. 2B). The acetylation levels of α-tubulin, histone H3, and histone H4 were markedly increased in the model group, as compared with the normal group. Furthermore, the acetylation levels of α-tubulin, histone H3, and histone H4 were further enhanced in the ACY-1215 group (Fig. 2C and D).

3. Results 3.1. ACY-1215 improved the impaired liver function and alleviated inflammation infiltration and the expression of inflammatory cytokines In the normal group, the hepatic lobule structure was complete and the hepatocytes arrayed radially around the central vein without cellular necrosis. In the mice with ALF, the normal structure of the liver was ruined and massive necrosis could be observed. However, pretreatment with ACY-1215 could cause remission of the cellular necrosis and the hepatic cells redistributed in a radial pattern, which was confirmed by HE staining (Fig. 1A). The levels of GPT and GOT were used to assess liver function. From Fig. 1B, we can see distinctly that the levels of GPT and GOT were normalized in mice treated with ACY-1215 compared with the mice with ALF (Fig. 1B). The levels of inflammatory cytokines in serum were also normalized in the ACY-1215 group

3.3. ACY-1215 downregulated expression of TLR4 protein and mRNA After stimulation for 24 h with LPS and D-gal, the level of TLR4 protein expression was significantly higher compared with the normal group. With the treatment of ACY-1215, TLR4 protein expression was obviously normalized (Fig. 3A). This trend was also detected in the level of TLR4 mRNA expression (Fig. 3B). 820

Biomedicine & Pharmacotherapy 97 (2018) 818–824

W.-b. Zhang et al.

Fig. 2. The changes of HDAC6 expression in different groups. (A) The HDAC6 protein expression change was detected by western blotting. (B) Effect of ACY-1215 on the mRNA expression of HDAC6. (C) The representative expression of acetylated α-tubulin and acetylated histones H3 and H4 on indicated groups. (D) The quantitative blots of acetylated α-tubulin and acetylated histones H3 and H4 in the indicated groups. *P < 0.05 as compared with the corresponding normal group. #P < 0.05 versus the model group.

60%. The mortality rate in rats with ALF to 24 h was significantly reduced by the ACY-1215 pretreatment. By log-rank test, there was a significant difference among the curves (χ2 = 13.87, P < 0.01).

3.4. ACY-1215 suppressed the activation of MAPK and NF-κB signalling pathways We examined the activation state of TLR4′s downstream signalling pathways to investigate whether the anti-inflammatory effect of ACY1215 occurred via regulation of the MAPK pathway and NF-κB pathway. After the activation of TLR4, the protein expression levels of p-ERK, p-P38, and p-JNK were increased, and ACY-1215 could restrain the activation of MAPKs (Fig. 4A and B). Similarly, ACY-1215 could also regulate the NF-κB signalling pathway and normalized the expression levels of p-P65 and IκBα (Fig. 4C and D).

4. Discussion ALF is a serious life-threatening disease characterized by massive necrosis and inflammation. However, as a disease with a high mortality rate, there is still no effective treatment for ALF without liver transplantation [17]. It is widely accepted that the activation of TLR4 stimulated by LPS and the release of proinflammatory factors such as TNFα, IL-1β, and IL-6 are well correlated with the occurrence and development of ALF [18,19]. ALF induced by LPS and D-gal is a well-established model covering the process of inflammation and hepatic necrosis [20]. In this study, we investigated whether the ACY-1215 had a beneficial effect in mice with ALF induced by LPS and D-gal. The results

3.5. ACY-1215 pretreatment decreased the mortality of mice with ALF Kaplan–Meier survival curves (Fig. 5) showed that the model group mice without ACY-1215 pretreatment had a mortality rate of up to

Fig. 3. The effects of ACY-1215 on TLR4 expression. (A) Western blotting was used to analyse TLR4 expression in liver tissues. (B) The gene expression of TLR4 was detected by reverse transcription-polymerase chain reaction analysis. *P < 0.05 as compared with the corresponding normal group. #P < 0.05 versus the model group.

821

Biomedicine & Pharmacotherapy 97 (2018) 818–824

W.-b. Zhang et al.

Fig. 4. The effects of ACY-1215 on MAPK and NF-κB activation. (A) The representative expression of phosphorylated and total ERK, P38, JNK were analysed by western blotting. (B) The quantitative blots of MAPKs in liver tissues of mice in the indicated groups. (C) The representative expression of p-P65, IκBα on indicated groups. (D) The quantitative blots of p-P65, IκBα in the indicated groups. *P < 0.05 as compared with the corresponding normal group. #P < 0.05 versus the model group.

in macrophages, and suppression of HDAC6 also leads to elevated αtubulin acetylation [25,26]. Our previous studies found that acetylated histones H3 and H4 were increased in rats with ALF and acute-onchronic liver failure [10,11], and Choi SY et al. [27] reported that inhibition of HDAC6 could greatly increase the acetylation level of histones. The results of our study demonstrated that the protein and mRNA expression levels of HDAC6 were increased in the mice with ALF, and were decreased following ACY-1215 treatment. Our study further found that LPS stimulation induces the acetylation of α-tubulin and acetylated histones H3 and H4. The acetylation of α-tubulin and histones were further enhanced by the suppression of HDAC6 by intraperitoneal injection of high-dose (25 mg/kg) ACY-1215. The abnormal expression levels of HDAC6 may influence the progression of many pathological conditions including inflammation [28–30]. It is recognized that the inflammatory response could be further aggravated by large amounts of inflammatory cytokines released by the activated Kupffer cells and macrophages stimulated by LPS. Park et al. [31] found that the overexpression of HDAC6 in macrophages could induce the release of proinflammatory mediators and aggravate proinflammatory responses. Similarly, inhibition of HDAC6 activity significantly restrains activation of macrophages and LPS-induced production of inflammatory cytokines [32]. The aforementioned studies suggest that HDAC6 is an important regulator of the production and release of proinflammatory mediators. Therefore, in this study, the ACY-1215, which is tenfold more selective for HDAC6 than other HDACs, was used to observe the effect on inflammation. Our study found that compared with the mice in the normal group, the protein and mRNA expression levels of HDAC6 in ALF mice were significantly increased, and were suppressed by treatment with high dose of ACY1215. This trend was also detected in the levels of inflammatory cytokines such as TNF-α, IL-1β, and IL-6. All results suggest inhibition of

Fig. 5. Effect of ACY-1215 on mortality rate in mice with ALF. Normal:normal group, model:model group, ACY-1215: ACY-1215 pretreated group. The mice with ALF had a mortality rate up to 60% without ACY-1215 pretreatment, and ACY-1215 significantly reduced the mortality rate. By log-rank test, there was a significant difference among the curves (χ2 = 13.87, P < 0.01).

showed that compared with the model group, the ACY-1215 group had normalized liver structure and function, and pretreatment had a positive effect on reducing mortality in mice. All data suggest that ACY1215 has a protective effect on mice with ALF. As a member of the class IIb HDACs, HDAC6 is mainly located in cytoplasm and exerts its activity by deacetylation of a variety of target molecules [21]. Currently, the best characterized interaction with a substrate is with the α-tubulin subunit of microtubules, and the level of acetylated α-tubulin could reflect HDAC6 enzymatic activity [22,23]. ACY-1215 can induce potent acetylation of α-tubulin at very low doses, and triggers acetylation of histone H3 and histone H4 at high doses, confirming its specific inhibitory effect on HDAC6 activity [24]. Previous studies have reported that LPS could induce α-tubulin acetylation 822

Biomedicine & Pharmacotherapy 97 (2018) 818–824

W.-b. Zhang et al.

HDAC6 activity by using ACY-1215 could suppress the inflammatory disorders in mice with ALF, and HDAC6 may be a potential target for the management of immune disorders. TLR4 is recognized as the major receptor and signal transduction molecule for LPS, and plays a crucial role as amplifier of the inflammatory response and proinflammatory cytokine production [33,34]. The increased protein expression level of TLR4 was correlated with mortality and LPS/D-gal induced liver damage [35]. Moreover, the release of important inflammatory mediators in liver injury such as TNF-α, IL-1β, and IL-6 were also increased by the activation of TLR4. Previous studies have found that the impaired liver function and overall survival rate in LPS and D-gal induced ALF models with TLR4 knockout or antagonist were improved, accompanied by attenuation of MAPK and NF-κB signalling pathway [36–38]. Similarly, mice with deleted MAPKs could resist the liver damage caused by LPS and D-gal, along with the reduction of inflammatory mediators of liver injury [39]. Chattopadhyay et al. [40] reported that compared with the wild-type mice, the HDAC6−/− mice were more resistant to LPS-induced pathogenesis and had a decreased mortality rate. Another study also reported that HDAC6 were partially involved in suppression of TLR4-mediated MAPK signalling pathway [41]. Those studies suggest that HDAC6 may play a significant role in regulating the activation of TLR4 and TLR4mediated pathways. Our results reveal that the mice with ALF had an increased activation of TLR4 and MAPKs. We also observed that with pretreatment of HDAC6 selective inhibitor ACY-1215, the mRNA and protein expression levels of TLR4 were normalized and the protein expression activation of p-ERK, p-P38, and p-JNK were suppressed, and all data suggest that HDAC6 may protect the liver by regulating the activation of TLR4 and MAPKs. The synthesis and release of inflammatory cytokines are closely related to the NF-κB signalling pathway. In animal experiments, inhibition of NF-κB pathway not only improved the survival rate of mice with liver failure, but also decreased the level of inflammatory cytokines including TNF-α, IL-1β, and IL-6 [42]. Under an inactive condition, p50, p65, and I-κBα can form inactive complexes and the degradation of IκB leads to nuclear translocation of NF-κB [43]. The activity of NF-κB p65 DNA-binding could be affected by HDAC inhibitors inhibiting the degradation of IκB, and overexpression of HDAC6 significantly increased the activation of the NF-κB signalling pathway [30]. In this study, we found that compared with the normal group, the protein expression level of p-P65 and IκBα was abnormal in mice with ALF. Treatment with a high dose of ACY-1215 could normalize the protein expression levels of the NF-κB pathway. All the results suggest that the selective HDAC6 inhibitor ACY-1215 might retard the progression of ALF by blunting the activation of TLR4-MAPK-NF-κB signalling pathway. In conclusion, a high dose of ACY-1215 could ameliorate injury to the liver and reduce the mortality rate in mice with ALF. ACY-1215 has a significant inhibitory effect on inflammatory cytokines and the mechanism may be related to the inhibition of TLR4-MAPK-NF-κB signalling pathway. HDAC6 may be a potential target for the treatment of ALF and ACY-1215 may provide a potentially effective and safe therapy for mice with ALF.

[2] [3]

[4] [5]

[6]

[7] [8]

[9]

[10] [11]

[12] [13] [14]

[15]

[16]

[17]

[18] [19]

[20]

[21] [22]

[23] [24]

[25]

Conflict of interests

[26]

The authors have declared that no competing interests exist. [27]

Acknowledgements [28]

The present study was supported by the National Natural Science Foundation of China (grant No. 81371789).

[29]

References [30] [1] L. Rabinowich, J. Wendon, W. Bernal, O. Shibolet, Clinical management of acute

823

liver failure: results of an international multi-center survey, World J. Gastroenterol. 22 (33) (2016) 7595–7603. W. Bernal, W.M. Lee, J. Wendon, F.S. Larsen, R. Williams, Acute liver failure: a curable disease by 2024? J. Hepatol. (62 (1 Suppl.)) (2015) S112–S120. U. Lodes, D. Jacob, F. Meyer, Acute liver failure, acute-on-chronic liver failure, hepatorenal syndrome, hepatopulmonary syndrome and portopulmonary hypertension, artificial liver support on the ICU, Zentralbl. Chir. 142 (3) (2017) 275–286. N. Halliday, R.H. Westbrook, Liver transplantation: need, indications, patient selection and pre-transplant care, Br. J. Hosp. Med. (Lond.) 78 (5) (2017) 252–259. E. Triantafyllou, O.T. Pop, L.A. Possamai, A. Wilhelm, E. Liaskou, A. Singanayagam, et al., MerTK expressing hepatic macrophages promote the resolution of inflammation in acute liver failure, Gut (2017) 2016–313615 (pii: gutjnl). K.C. Lee, L.A. Baker, G. Stanzani, H. Alibhai, Y.M. Chang, C. Jimenez Palacios, et al., Extracorporeal liver assist device to exchange albumin and remove endotoxin in acute liver failure: results of a pivotal pre-clinical study, J. Hepatol. 63 (3) (2015) 634–642. C. Qian, X. Cao, Regulation of Toll-like receptor signaling pathways in innate immune responses, Ann. N. Y. Acad Sci. 1283 (2013) 67–74. X. Zhang, W. Jiang, A.L. Zhou, M. Zhao, D.R. Jiang, Inhibitory effect of oxymatrine on hepatocyte apoptosis via TLR4/PI3 K/Akt/GSK-3β signaling pathway, World J. Gastroenterol. 23 (21) (2017) 3839–3849. H. Liu, W. Zhang, S. Dong, L. Song, S. Zhao, C. Wu, et al., Protective effects of sea buckthorn polysaccharide extracts against LPS/d-GalN-induced acute liver failure in mice via suppressing TLR4-NF-kappaB signaling, J. Ethnopharmacol. 176 (2015) 69–78. Q. Zhang, F. Yang, X. Li, et al., Trichostatin A protects against intestinal injury in rats with acute liver failure, J. Surg. Res. 205 (1) (2016) 1–10. Q. Zhang, F. Yang, X. Li, H.Y. Zhang, X.G. Chu, H. Zhang, et al., Trichostatin a protects against experimental acute-on-chronic liver failure in rats through regulating the acetylation of nuclear factor-kappaB, Inflammation 38 (3) (2015) 1364–1373. H.M. Prince, M.J. Bishton, S.J. Harrison, Clinical studies of histone deacetylase inhibitors, Clin. Cancer Res. 15 (12) (2009) 3958–3969. Y. Li, E. Setos, HDACs and HDAC inhibitors in cancer development and therapy, Cold Spring Harb. Perspect. Med. 6 (10) (2016) a026831. J.H. Lee, A. Mahendran, Y. Yao, L. Ngo, G. Venta-Perez, M.L. Choy, et al., Development of a histone deacetylase 6 inhibitor and its biological effects, Proc. Natl. Acad. Sci. U. S. A. 110 (39) (2013) 15704–15709. M.A. Rivieccio, C. Brochier, D.E. Willis, B.A. Walker, M.A. D'Annibale, K. McLaughlin, et al., HDAC6 is a target for protection and regeneration following injury in the nervous system, Proc. Natl. Acad. Sci. U. S. A. 106 (46) (2009) 19599–19604. Y. Li, T. Zhao, B. Liu, I. Halaweish, R. Mazitschek, X. Duan, et al., Inhibition of histone deacetylase 6 improves long-term survival in a lethal septic model, J. Trauma Acute Care Surg. 78 (2) (2015) 378–385. X. Gong, Y. Yang, L. Huang, Q. Zhang, R.Z. Wan, P. Zhang, et al., Antioxidation, anti-inflammation and anti-apoptosis by paeonol in LPS/d-GalN-induced acute liver failure in mice, Int. Immunopharmacol. 46 (2017) 124–132. D.W. Han, Intestinal endotoxemia as a pathogenetic mechanism in liver failure, World J. Gastroenterol. 8 (6) (2002) 961–965. X. Xia, J. Fu, X. Song, Q. Shi, C. Su, E. Song, et al., Neohesperidin dihydrochalcone down-regulates MyD88-dependent and –independent signaling by inhibiting endotoxin-induced trafficking of TLR4 to lipid rafts, Free Radic. Biol. Med. 89 (2015) 522–532. A.A. Jambekar, E. Palma, L. Nicolosi, A. Rasola, V. Petronilli, F. Chiara, et al., A glutamine synthetase inhibitor increases survival and decreases cytokine response in a mouse model of acute liver failure, Liver Int. 31 (8) (2011) 1209–1221. Y. Li, D. Shin, S.H. Kwon, Histone deacetylase 6 plays a role as a distinct regulator of diverse cellular processes, FEBS J. 280 (3) (2013) 775–793. G. Li, H. Jiang, M. Chang, H. Xie, L. Hu, HDAC6 α-tubulin deacetylase: a potential therapeutic target in neurodegenerative diseases, J. Neurol. Sci. 304 (1-2) (2011) 1–8. J.H. Kalin, J.A. Bergman, Development and therapeutic implications of selective histone deacetylase 6 inhibitors, J. Med. Chem. 56 (16) (2013) 6297–6313. L. Santo, T. Hideshima, A.L. Kung, J.C. Tseng, D. Tamang, M. Yang, et al., Preclinical activity, pharmacodynamic, and pharmacokinetic properties of a selective HDAC6 inhibitor, ACY-1215, in combination with bortezomib in multiple myeloma, Blood 119 (11) (2012) 2579–2589. B. Wang, Y.H. Rao, M. Inoue, R. Hao, C.H. Lai, D. Chen, et al., Microtubule acetylation amplifies p38 kinase signalling and anti-inflammatory IL-10 production, Nat. Commun. 5 (2014) 3479. B. Yan, S. Xie, Z. Liu, J. Ran, Y. Li, J. Wang, et al., HDAC6 deacetylase activity is critical for lipopolysaccharide-induced activation of macrophages, PLoS One 9 (10) (2014) e110718. S.Y. Choi, Y. Ryu, H.J. Kee, S.N. Cho, G.R. Kim, J.Y. Cho, et al., Tubastatin A suppresses renal fibrosis via regulation of epigenetic histone modification and Smad3-dependent fibrotic genes, Vascul. Pharmacol. 72 (2015) 130–140. C.Y. Lu, Y.C. Chang, C.H. Hua, C. Chuang, S.H. Huang, S.H. Kung, et al., Tubacin, an HDAC6 selective inhibitor, reduces the replication of the Japanese encephalitis virus via the decrease of viral RNA synthesis, Int. J. Mol. Sci. 18 (5) (2017) E954. M.R. Shakespear, M.A. Halili, K.M. Irvine, D.P. Fairlie, M.J. Sweet, Histone deacetylases as regulators of inflammation and immunity, Trends Immunol. 32 (7) (2011) 335–343. H.J. Nam, J.K. Kang, S.K. Kim, K.J. Ahn, H. Seok, S.J. Park, et al., Clostridium difficile toxin A decreases acetylation of tubulin, leading to microtubule

Biomedicine & Pharmacotherapy 97 (2018) 818–824

W.-b. Zhang et al.

[31]

[32]

[33] [34]

[35]

[36]

[37]

acute liver failure in rats, J. Gastroenterol. Hepatol. 25 (5) (2010) 1009–1012. [38] L. Ma, X. Gong, G. Kuang, R. Jiang, R. Chen, J. Wan, Sesamin ameliorates lipopolysaccharide/d-galactosamine-induced fulminant hepatic failure by suppression of Toll-like receptor 4 signaling in mice, Biochem. Biophys. Res. Commun. 461 (2) (2015) 230–236. [39] B. González-Terán, J.R. Cortés, E. Manieri, N. Matesanz, Á. Verdugo, M.E. Rodríguez, et al., Eukaryotic elongation factor 2 controls TNF-α translation in LPS-induced hepatitis, J. Clin. Invest. 123 (1) (2013) 164–178. [40] S. Chattopadhyay, V. Fensterl, Y. Zhang, M. Veleeparambil, J.L. Wetzel, G.C. Sen, Inhibition of viral pathogenesis and promotion of the septic shock response to bacterial infection by IRF-3 are regulated by the acetylation and phosphorylation of its coactivators, MBio 4 (2) (2013) e00636–12. [41] T. Into, M. Inomata, S. Niida, Y. Murakami, K. Shibata, Regulation of MyD88 aggregation and the MyD88-dependent signaling pathway by sequestosome 1 and histone deacetylase 6, J. Biol. Chem. 285 (46) (2010) 35759–35769. [42] W. Zhong, K. Qian, J. Xiong, K. Ma, A. Wang, Y. Zou, Curcumin alleviates lipopolysaccharide induced sepsis and liver failure by suppression of oxidative stress-related inflammation via PI3 K/AKT and NF-kappaB related signaling, Biomed. Pharmacother. 83 (2016) 302–313. [43] M.D. Wheeler, S. Yamashina, M. Froh, I. Rusyn, R.G. Thurman, Adenoviral gene delivery can inactivate Kupffer cells: role of oxidants in NF-kappaB activation and cytokine production, J. Leukoc. Biol. 69 (4) (2001) 622–630.

depolymerization through activation of histone deacetylase 6, and this mediates acute inflammation, J. Biol. Chem. 285 (43) (2010) 32888–32896. G.S. Youn, K.W. Lee, S.Y. Choi, J. Park, Overexpression of HDAC6 induces proinflammatory responses by regulating ROS-MAPK-NF-kappaB/AP-1 signaling pathways in macrophages, Free Radic. Biol. Med. 97 (2016) 14–23. B. Yan, S. Xie, Z. Liu, J. Ran, Y. Li, J. Wang, et al., HDAC6 deacetylase activity is critical for lipopolysaccharide-induced activation of macrophages, PLoS One 9 (10) (2014) e110718. M. Molteni, S. Gemma, C. Rossetti, The role of toll-like receptor 4 in infectious and noninfectious inflammation, Mediators Inflamm. 2016 (2016) 6978936. H.H. Kang, I.K. Kim, H.I. Lee, H. Joo, J.U. Lim, J. Lee, et al., Chronic intermittent hypoxia induces liver fibrosis in mice with diet-induced obesity via TLR4/MyD88/ MAPK/NF-kB signaling pathways, Biochem. Biophys. Res. Commun. 490 (2) (2017) 349–355. J. Perego, C. Bourbon, L. Chasson, C. Laprie, L. Spinelli, V. Camosseto, et al., Guanabenz prevents d-galactosamine/lipopolysaccharide-induced liver damage and mortality, Front. Immunol. 8 (2017) 679. Z. Ben Ari, O. Avlas, O. Pappo, V. Zilbermints, Y. Cheporko, L. Bachmetov, et al., Reduced hepatic injury in Toll-like receptor 4-deficient mice following D-galactosamine/lipopolysaccharide-induced fulminant hepatic failure, Cell. Physiol. Biochem. 29 (1–2) (2012) 41–50. T. Kitazawa, T. Tsujimoto, H. Kawaratani, H. Fukui, Salvage effect of E5564, tolllike receptor 4 antagonist on d-galactosamine and lipopolysaccharide-induced

824