Histone deacetylase (HDAC) inhibitors reduce the glial inflammatory response in vitro and in vivo

Neurobiology of Disease 36 (2009) 269–279

Contents lists available at ScienceDirect

Neurobiology of Disease j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y n b d i

Histone deacetylase (HDAC) inhibitors reduce the glial inflammatory response in vitro and in vivo Giuseppe Faraco a, Maria Pittelli a, Leonardo Cavone a, Silvia Fossati a, Marco Porcu a, Paolo Mascagni b, Gianluca Fossati b, Flavio Moroni a, Alberto Chiarugi a,⁎ a b

Department of Preclinical and Clinical Pharmacology, University of Florence, Florence, Italy Italfarmaco, Milan, Italy

a r t i c l e

i n f o

Article history: Received 13 May 2009 Revised 8 July 2009 Accepted 17 July 2009 Available online 25 July 2009 Keywords: Transcription NFκB c-FOS Microglia SOCS microRNA-146

a b s t r a c t Histone deacetylase inhibitors (HDACi) are emerging tools for epigenetic modulation of gene expression and suppress the inflammatory response in models of systemic immune activation. Yet, their effects within the brain are still controversial. Also, whether HDACs are expressed in astrocytes or microglia is unclear. Here, we report the identification of transcripts for HDAC 1–11 in cultured mouse glial cells. Two HDACi such as SAHA and ITF2357 induce dramatic increase of histone acetylation without causing cytotoxicity of cultured cells. Of note, the two compounds inhibit expression of pro-inflammatory mediators by LPS-challenged glial cultures, and potentiate immunosuppression triggered by dexamethasone in vitro. The anti-inflammatory effect is not due to HDACi-induced transcription of immunosuppressant proteins, (including SOCS-1/3) or microRNA-146. Rather, it is accompanied by direct alteration of transcription factor DNA binding and ensuing transcriptional activation. Indeed, both HDACi impair NFκB-dependent IκBα resynthesis in glial cells exposed to LPS, and, among various AP1 subunits and NFκB p65, affect the DNA binding activity of c-FOS, c-JUN and FRA2. Importantly, ITF2357 reduces the expression of pro-inflammatory mediators in the striatum of mice iontophoretically injected with LPS. Data demonstrate that mouse glial cells have ongoing HDAC activity, and its inhibition suppresses the neuroinflammatory response because of a direct impairment of the transcriptional machinery. © 2009 Elsevier Inc. All rights reserved.

Introduction Dynamics of chromatin remodeling are crucial for transcriptional activation and gene expression. Among the various mechanisms underpinning chromatin unravelling, histone acetylation is one of the better characterized at the molecular level (Jenuwein and Allis, 2001). A complex network of signaling pathways converges on histone acetyl transferases leading to transfer of acetyl groups originating from acetyl-CoA to lysine residues of histone tails, thereby prompting electrostatic repulsion from nucleosome histones and DNA, resulting in chromatin decondensation. This allows the binding of transcription-regulating factors and RNA pol-II activation. Different repressors of gene transcription, in turn, recruit histone deacetylases (HDACs) to promoters, prompting chromatin compaction and gene silencing. Of note, HATs and HDACs also target transcription-regulating proteins different from histones such as the specific transcription factors NFκB, p53, Sp1 and others (Dokmanovic and Marks, 2005; Glozak et al., 2005c). ⁎ Corresponding author. Department of Pharmacology, University of Florence, Viale Pieraccini 6, 50139 Firenze, Italy. Fax: +39 055 4271280. E-mail address: alberto.chiarugi@unifi.it (A. Chiarugi). Available online on ScienceDirect (www.sciencedirect.com). 0969-9961/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.nbd.2009.07.019

Epigenetic pharmacology witnessed a real explosion of interest in the development of inhibitors of HDAC (HDACi) (Yoo and Jones, 2006). These are potent compounds able to unbalance cellular acetylation toward a hyperacetylation status, thereby affecting overall gene expression profiles (Xu et al., 2007). Interestingly, HDACi are currently evaluated in several clinical trials for neoplastic disorders (Minucci and Pelicci, 2006). In this light, the potent HDACi suberoylanilide hydroxamic acid (SAHA) has significant anticancer activity against both hematologic and solid tumors at doses well tolerated by patients, and has been recently approved for the treatment of cutaneous T-cell lymphoma (Marks, 2007). Preclinical and clinical evidence indicates that HDACi are also of potential therapeutic relevance to disorders of the central nervous system (Kazantsev and Thompson, 2008). Indeed, perturbation in acetylation homeostasis is emerging as a central event in the processes leading to neuronal death [see (Langley et al., 2005; Saha and Pahan, 2006; Abel and Zukin, 2008; Hahnen et al., 2008) for comprehensive reviews]. In keeping with this, recent studies demonstrate that HDACi of various chemical classes afford protection in models of Huntington's disease (Gardian et al., 2005; Ferrante et al., 2003; Hockly et al., 2003), spinal muscular atrophy (Chang et al., 2001), amyotrophic lateral sclerosis (Corcoran et al., 2004; Ryu et al., 2005; Petri et al., 2006), experimental autoimmune encephalomyelitis (Camelo et al., 2005)

270

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279

and stroke (Ren et al., 2004; Faraco et al., 2006; Kim et al., 2007). Experimental evidence indicates that inhibition of HDAC significantly affects immune cell activation (Blanchard and Chipoy, 2005), an effect that might underlie the neuroprotective effects of HDACi. However, the mechanisms responsible for HDACi-dependent immunosuppression have not been understood, and both potentiating and suppressing effects by HDACi on neuroimmune activation have been reported (Suuronen et al., 2005, 2006, 2003; Zhang et al., 2008; Chen et al., 2007; Kim et al., 2007). Hence, in the present study we sought to determine the pharmacodynamic effects of the potent HDACi suberoylanilide hydroxamic acid (SAHA) and its structural analog ITF2357 on acetylation levels and immune activation of glial cells in vitro and in vivo. We also investigated the mechanisms through which HDACi modulate the inflammatory glial response. Materials and methods Mouse primary glial cultures Primary mixed cultures of astrocytes and microglia (referred as “glial cells”) were prepared from post natal day 1 mice as previously described (Chiarugi and Moskowitz, 2003) and grown in DMEM + 10% fetal bovine serum. Briefly, cortices were isolated in cold phosphate-buffered saline (PBS) and then incubated 10 min at 37 °C in phosphate-buffered saline containing 0.25% trypsin and 0.05% DNase. After blocking enzymatic digestion with the addition of 10% heat-inactivated fetal bovine serum, cortices were mechanically disrupted, washed and the cells resuspended in DMEM + 10% FBS (GIBCO, Life Technologies, Rockville, MD) and two disrupted cortices were plated in a 75 cm2 flask. Glial cells were identified evaluating their morphology and immunoreactivity to glial fibrillary acidic protein (GFAP, astrocytes) and OX-42 (microglia). Labeling with an anti Neu-N antibody (Chemicon, Tamecula, CA) revealed the absence of neurons. Cells were subcultured in 48-well plates for 48 h before stimulation with 0.3 μg/ml bacterial lipopolysaccharides (LPS). HDAC inhibitors dissolved in 25% dimethylsulfoxide in phosphate-buffered saline were added to the culture medium together with LPS (from Escherichia coli 055:B5). Conditioned media were collected for TNFα measurement, whereas cells were lysed for Western blotting. For immunocytochemistry, glial cells were subcultured on glass slides. Cultures were kept in an incubator at 37 °C, 100% humidity, and 95% air/5% CO2 atmosphere and used for experiments at days 10–14 in vitro. Animals Male C57 Black mice (20–25 g, Harlan, Italy) were housed five per cage and kept at constant temperature (21 ± 1 °C) and relative humidity (60%) with regular light/dark schedule (7am–7pm). Food and water were available ad libitum. Procedures involving animals and their care were conducted in compliance with the Italian Guidelines for Animal Care (DL 116/92) in application of the European Communities Council Directive (86/609/EEC) and were formally approved by the Animal Care Committee of the Department of Pharmacology of the University of Florence.

micrograms of LPS dissolved in 1 μl of saline was injected using a 10 μl syringe (Hamilton, Reno, NV) over a period of 4 min, and the needle was held in place for additional 5 min. Control mice received 1 μl of saline. Mice (n = 6) were divided into two groups and injected intraperitoneally (i.p.) after LPS injection and after 8 h with ITF2357 (10 and 30 mg/kg) or β-cyclodextrin (100 μg/ml; vehicle group) and killed 24 h later. Measurement of HDAC class I/II activity Neuronal HDAC activities ware measured by means of the specific kits Fluor de Lys™ (HDAC I/II activity) Fluorogenic Deacetylase Substrates (Biomol, Plymouth Meeting, PA) according to the manufacturer's instruction. Briefly, the fluorescent-caged HDAC I/II substrate was added to the cell culture medium for 1 h. Later on, the medium was removed, cells were washed with PBS and lysed with 50 μl of lysis buffer plus an equal volume of developer. After 15 min fluorescence was read (ex. 350, em. 500 nm) with a microplate reader fluorimetric detector (Victor3, Perkin Elmer). Semiquantitative PCR Total RNA (1 g) extracted from the glial cells was reverse transcribed and the DNA mixture subjected to polymerase chain reaction (PCR) using the following oligonucleotide primers: HDAC1: forward TCCAACATGACCAACCAGAA, reverse TTGTCAGGGTCCTCCTCATC; HDAC2: forward TGGAGGAGGCTACACAATCC, reverse TTTGAACACCAGGTGCATGT; HDAC3: forward CTCCCCTTTCCCTCAAACTC, reverse TTGCATGGAAGGAGGAACTG; HDAC4: forward CAGACAGCAAGCCCTCCTAC, reverse AGACCTGTGGTGAACCTTGG; HDAC5: forward AGTGAGAGCACCCAGGAAGA, reverse GTACACCTGGAGGGGCTGTA; HDAC6: forward TGAGTCACTGCAACCTCTGG, reverse GTGGCAGGTAAGGAGCTCAG; HDAC7: forward TTTCTACCAGGACCCCAGTG, reverse AAGCAGCCAGGTACTCAGGA; HDAC8: forward AGGTGATGAGGACCATCCAG, reverse ACCCTCCAGACCAGTTGATG; HDAC9: forward CGCGTAGGCAGACATGTAGA, reverse ACCTGTCCAACAAGGCAAAC; HDAC10: forward CCAGACCCCTTACTGGACAA; reverse CCAGGAGGTAAGCACAGAGC; HDAC11: forward TGAAAACACGTTTGGGATGA, reverse GTGGGGCCACTGTACCTAGA; forward NOS CCCTTCCGAAGTTTCTGGCAGCAGC, reverse GGCTGTCAGAGCCTCGTGGCTTTGG; IL-1β forward CAGGACAGGTATAGATTCTTTCCTTT, reverse ATGGCAAC TGTTCCTGAACTCAACT; COX-2 forward ACACACTCTATCACTGGCACC, reverse TTCAGGGAGAAGCGTTTGC; SOCS1 forward AGCAGCTCGAAAAGGCAGTC, reverse ACACTCAGTTCCGCACCTTC; SOCS3 forward ACCAGCGCCACTTCTTCACG, reverse GTGGAGCATCATACTGATCC; and β-actin forward GACCTGACAGACTACCTC reverse AGACAGCACTGTGTTGGC. Numbers of cycles selected after determining the linear working range for the reaction were 30 for iNOS, IL-1β, COX-2, 35 for HDAC 1–11, SOCS1 and -3, and 20 for β-actin. PCR products were separated on 1.8% agarose gels. miR-146a and -b amplification was conducted with the mirVana miRNA Isolation Kit (Ambion, Foster City, CA, USA) according to the manufacturer's instruction. Primers for miR-146a and -b were purchased from the Ambion website. Western blotting

Microinjection of LPS into the striatum of C57BL/6 mice Male C57BL/6 mice (5–6 weeks of age) were anesthetized with isoflurane and mounted in a stereotaxic frame on a heating blanket. Body temperature was maintained at 37 ± 0.5 °C during the time of surgery. A midsagittal incision was made to expose the cranium, and a hole b0.5 mm in diameter was drilled with a dental drill over the cerebrum according to the following coordinates: 0.5 mm anterior, 2.5 mm lateral (L) from bregma and 3.0 mm ventral (V). Five

Fifty micrograms of glial cell proteins from LPS stimulated cultures was loaded per lane. Striatal sections collected in Eppendorf tubes were sonicated in a lysis buffer [50 mmol/l Tris, pH 7.4, 1 mmol/ l EDTA, 1 mmol/l phenylmethylsulfonyl fluoride, 4 g/ml aprotinin and leupeptin, and 1% sodium dodecyl sulfate (SDS)]. Proteins were isolated and measured according to standard techniques, and 20 to 40 g of protein/lane was loaded. After 4% to 20% SDS-polyacrylamide gel electrophoresis (PAGE) and blotting, membranes (Hybond-ECL,

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279

Amersham, UK) were blocked with phosphate-buffered saline (PBS) containing 0.1% Tween-20 and 5% skimmed milk (TPBS/5% milk) and then probed overnight with primary antibodies (1:1000 in TPBS/5% milk). The anti-inducible nitric oxide synthase (iNOS), anti-IκBα and anti-interleukin (IL-1β) were polyclonal antibodies from Santa Cruz Biotechnology (Santa Cruz, CA, USA), the anti-cyclooxygenase-2 (COX-2) polyclonal antibody was from Cayman Chemicals (Ann Arbor, MI, USA) and the anti-acetylated histone H3-lysine (K)-18 was polyclonal antibody from Cell Signaling (Cell Signaling Technology, Beverly, MA, USA). Membranes were then washed with TPBS and incubated 1 h in TPBS/5% milk containing the corresponding peroxidase-conjugated secondary antibody (1:2000). After washing in TPBS, enhanced chemiluminescence (Amersham, UK) was used to visualize the peroxidase-coated bands. Densitometric data were obtained using the Quantity One image analysis system (Hercules, CA, USA). Immunocytochemistry For immunocytochemistry, glial cells were washed with cold phosphate-buffered saline (PBS) and then fixed with 4% paraformaldehyde in PBS. Glial cells were incubated in PBS with 0.3% Triton X-100 (Sigma, St. Louis, MO, USA) and 20% of bovine albumin. One hour later, cultures were incubated for 2 h with the anti-acetylated histone H3-K18 from Cell Signaling (Cell Signaling Technology, Beverly, MA, USA). After three 10-min washes, glial cells were incubated with a Cy2 conjugated secondary antibody (donkey antirabbit 1:200 in PBST/5 mg/ml BSA; Jackson ImmunoResearch Laboratories, West Grove, PA, USA). Sections were double stained with anti-glial fibrillary acidic protein (GFAP) (Sigma, Saint Louis, MO, USA) or anti OX-42/CD11b (Serotoc, Düsseldorf, Germany). Binding was revealed with the corresponding Cy3-conjugated secondary antibodies by means of a Nikon TU-2000 inverted fluorescence microscope equipped with a CF-cool snap CCD camera set to an exposure time of 200 ms. Specificity of immune detection was established by omission of the primary antibody.

271

Results Effects of different HDACi on HDAC activity, viability and histone H3 acetylation levels in glial cells The brain distribution of the eleven HDACs has been recently reported in the rat (Broide et al., 2007). Surprisingly, HDAC isoforms are expressed primarily in neurons, with a subset also found in oligodendrocytes. No expression is detected in astrocytes or microglia (Broide et al., 2007). To confirm these findings, we analyzed transcripts for the different HDAC isoforms in primary mixed glial cell cultures. As shown in Fig. 1A, mRNAs for all the known HDACs belonging to Classes I (1–3, 8), II (4–7, 9, 10) and IV (11) were found in glial cultures. Accordingly, by means of a fluorimetric kit we found HDAC activity in mouse glial cell culture extracts. Of note, the deacetylating activity was inhibited by three HDACi such as SAHA, ITF2357 and sodium butyrate. Specifically, upon 6 h exposure to the drugs, ITF2357 was the most potent inhibitor with an IC50 of 28 ± 4 nM, whereas SAHA and sodium butyrate showed IC50s of 340 ± 58 nM and 420 ± 75 μM, respectively (Fig. 1B). Importantly, none of the three inhibitors affected glial cell viability up to 24 (Fig. 1C) and 72 h (not shown) exposure. Given the low inhibitory potency of sodium butyrate, only ITF2357 and SAHA were used in the following experiments. Histone H3 acetylation of lysine (K)-18 was highly increased in glial cultures exposed 6 h to the two HDACi (Figs. 2A and B), with effects consistent with their IC50s on HDAC activity. Immunohistochemistry revealed that staining related to acetylation of H3-K18 was confined into the nucleus in both resting and SAHA/ ITF2357-challenged glial cells. In keeping with Western blotting, nuclear staining was higher in cultures exposed to the HDACi (Fig. 2C). To clarify whether the two drugs prompted histone hyperacetylation in both astrocytes and microglia, we double stained glial cultures exposed to the anti-acetylated H3-K18 antibody to antibodies raised against GFAP or OX42, specific markers of astrocytes or microglia, respectively. Fig. 2D shows that a robust increase of acetylated-H3-K18 immunostaining selectively occurred in the nucleus of both GFAP+ astrocytes and OX42+ microglial cells.

Transcription factor activation Effects of HDAC inhibitors on inflammatory activation of glia The DNA binding activity of NFκB was investigated by means of electrophoresis mobility gel shift assay (EMSA) experiments in cells scraped, pelleted and then resuspended in buffer “A” containing 10 mM Hepes pH 7.8, 10 mM KCl, 1 mM EDTA, 0.1 mM EGTA, 1 mM PMSF and 4 μg/ml aprotinin and leupeptin. Cells were kept on ice for 15 min, vortexed every 3 min and then centrifuged (5000 g/5 min/ 4 °C). The nuclear pellet was resuspended in 50 μl of buffer “B”, analogous to “A” plus 400 mM NaCl and incubated for 10 min on ice. The mixture was centrifuged (14,000 g/10 min/4 °C) and the supernatant aliquoted and stored at −80 °C. The DNA binding activity was tested by incubating 10 μg of proteins of the nuclear extract in 20 μl of a buffer containing 10 mM Tris pH 7.4, 4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 1 mM dithiothreitol, 50 mM NaCl, 0.05 mg/ml poly(dIdC), and 10,000 cpm of specific 32P-labeled oligonucleotide for 20 min at room temperature. The mixture was electrophoresed in 6% non-denaturing polyacrylamide gels that, after drying, were exposed to x-ray films (Amersham, Little Chalfont Buckinghamshire, UK). The double-stranded oligonucleotide 5′-AGTTGAGGGGACTTTCCCAGGC-3′ was used. Transcription factor activation of AP1 and NFκB-p65 subunits was also evaluated by means of a TransAM™ ELISA kits from Active Motif (Rixensart, Belgium). Statistical analysis Statistical significance of differences between results was evaluated by performing ANOVA followed by Tukey's w test for multiple comparisons. The P value was calculated using a two-tailed test.

To understand the role of HDACs in the immune activation of glial cells in vitro, as well as the impact of hyperacetylation triggered by HDACi on the same cultures, we added the two HDACi to glial cultures exposed to bacterial lipopolysaccharides (LPS, 0.3 μg/ml). As shown in Fig. 3A, SAHA and ITF2357 reduced the transcript levels of iNOS, COX2 and IL1β present in glial cell cultures after a 2 h exposure to LPS. Among these immune mediators, iNOS transcripts were those most sensitive to SAHA or ITF2357. In good agreement with the data on transcriptional activation, expression levels of the three proteins induced by a 6 h challenge to LPS were reduced by a concomitant exposure to SAHA or ITF2357 in a concentration-dependent manner. Again, iNOS protein induction was the most sensitive to the repressive effects of the two HDACi. Suppression of the immune mediators inversely correlated to the H3-K18 acetylation status (Figs. 3B and C). The increased expression of pro-inflammatory mediators induced by LPS was not accompanied by changes in histone acetylation (Fig. 3B), probably because LPS prompt selective remodeling at specific gene promoters that is not able to affect overall nuclear acetylation levels. Also, as shown in Fig. 3D, both SAHA and ITF2357 concentration-dependently reduced LPS-dependent release of TNFα in the culture medium. Of note, the extent of immune suppression prompted by SAHA and ITF2357 at 6 h was unaltered at 24 and 48 h (not shown), indicating that the anti-inflammatory effects of HDACi are long-lasting. Given the central role of glucocorticoids in the therapeutic armamentarium currently available to counteract the neuroinflammatory response within the CNS, we next investigated

272

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279

Fig. 1. Effects of SAHA, ITF2357 and butyrate on HDAC activity and viability of cultured glial cells. (A) Semi quantitative PCR analysis of the transcripts for HDAC 1–11. ST, molecular weight standards. -DNA, PRC run in the absence of cDNA. (B) Primary cultures of mouse glial cells were exposed to different concentrations of SAHA, ITF2357 and butyrate (dissolved in the culture media) for 6 h. HDAC activity was measured as described in the Materials and methods section. (B) Twenty four hours after exposure of cultured glial cells to different concentrations of SAHA, ITF2357 and butyrate, the cultures' ability to reduce MTT was taken as an index of cell viability. Bars represent the mean ± SEM of 3 experiments conducted in duplicate. ⁎p b 0.05, ⁎⁎p b 0.01, ⁎⁎⁎p b 0.001 vs control (C). ANOVA and Tukey's post hoc test.

the effect of HDACi on the glucocorticoid-dependent suppression of glial immune activation. As shown in Figs. 3E and F, ITF2357 potentiated the dexamethasone (DXE)-dependent suppression of iNOS and COX2 induction in LPS-challenged glial cells. Conversely, ITF2357 reduced the DXE-dependent suppression of IL1β in the same cultures (Figs. 3E and F). Mechanisms underlying the anti-inflammatory effects of HDAC inhibitors in glial cells Histone hyperacetylation and ensuing chromatin unravelling promote gene expression. Hence, suppression of pro-inflammatory mediator expression by HDACi appears counterintuitive. To solve this conundrum, it has been hypothesized that HDACi promote expression of immunosuppressant mediators which, in turn, silence inflammatory genes. Suppressor of cytokine signaling (SOCS)-1 and -3 (Dimitriou et al., 2008), which play a key role in suppressing excessive immune

activation within the CNS (Yang et al., 2007), might be the endogenous immunosuppressants whose transcription is hypothetically induced upon HDAC inhibition. Under our experimental settings, however, neither SOCS1 nor SOCS3 transcripts increased upon exposure of LPSchallenged glial cells to SAHA or ITF2357 (Fig. 4A). To further clarify whether the anti-inflammatory effects of HDACi were indeed dependent upon expression of immunosuppressant proteins, we checked for the ability of SAHA and ITF2357 to reduce transcripts for iNOS, COX2 and IL-1β in the presence of cycloheximide (CXE), a prototypical and potent inhibitor of translation. We reasoned that if the anti-inflammatory effect of HDACi would occur through expression of immunosuppressant proteins, then reduction of transcripts of inflammatory mediators would not occur in condition of translational block. However, CXE, used at concentrations which were able to fully prevent LPS-dependent iNOS, COX2 and TNFα expression/release (Figs. 4B and C), did not relieve the suppressive effect of the two HDACi on transcriptional activation of iNOS and COX2 genes (Fig. 4D). Together

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279

273

Fig. 2. Effects of SAHA and ITF2357 on histone H3 acetylation in glial cell cultures. (A) Glial cell cultures were exposed to different concentrations of SAHA or ITF2357. Six hours later proteins were extracted for Western blotting with an antibody raised against acetylated lysine (K)-18 of histone H3. β-actin is used as a loading control. (B) Densitometric analysis of the effect of different concentrations of SAHA and ITF2357 on histone H3 acetylation in glial cell cultures. (C) Immunocytochemistry for acetylated lysine (K)-18 of histone H3 in mouse glial cell cultures under control conditions or exposed for 6 h to SAHA or ITF2357 both at 1 μM. Note the exclusive nuclear localization of fluorescence and its increase in nuclei of SAHA- or ITF2357-exposed cells. (D) Glial cultures immunostained with an anti-acetylated lysine (K)-18 of histone H3 antibody were double stained with an anti-glial fibrillary acidic protein (GFAP, a marker of astrocytes, upper row) or anti-OX42 (a marker of microglia, lower row). Note that fluorescence related to acetylated histone H3 is increased in both astrocytes and microglia compared to control. In (A), (C) and (D) representative Western blot/images of at least three independent experiments are shown. Bar = 20 nm (C), 10 μm (D). ⁎p b 0.05, ⁎⁎p b 0.01, ⁎⁎⁎p b 0.001 vs control (C). ANOVA and Tukey's post hoc test.

these findings indicate that suppression of transcriptional activation in immune activated glial cells by HDACi is not due to histone hyperacetylation-dependent facilitated expression of immunosuppressant mediators. Rather, data obtained with CXE on the one hand clearly demonstrate that the HDACi-dependent anti-inflammatory effect does not depend on expression of newborn immunosuppressant

proteins, on the other suggest that the drugs prompt a direct impairment of transcriptional activation processes. Epigenetic mechanisms regulate transcription factor activation not only by modulating chromatin architecture but also by direct targeting of their DNA binding activity (Dokmanovic and Marks, 2005; Glozak et al., 2005a). Hence, we next investigated whether

274

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279

SAHA or ITF2357 might affect DNA binding activity of NFκB and AP1, two transcription factors of key relevance to immune activation. We first checked whether the two HDACi affected the kinetics of

degradation and resynthesis of the constitutive NFκB inhibitor protein IκBα, a key event in LPS-dependent NFκB activation. One hour after LPS exposure, IκBα expression levels decreased similarly in the

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279

275

Fig. 4. Suppression of pro-inflammatory mediators by HDAC is not due to translation of newborn proteins. (A) Glial cell cultures were exposed or not to LPS in the presence or absence of SAHA or ITF2357 (both at 1 μM) for 2 h and then mRNA was extracted to evaluate the transcript levels for SOC1 and -3. (B) Effect of CXE on expression of iNOS or COX2 by glial cell cultures exposed to 0.3 μg/ml LPS/6 h. (C) Effect of CXE on TNFα release in the culture medium of glial cells exposed to 0.3 μg/ml LPS for 3 or 6 h. (D) Effect of CXE (30 μM) on the SAHAand ITF2357-dependent reduction of the transcript levels for iNOS and COX2 in LPS-challenged glial cells. In (A), (B) and (D) a representative image of three independent experiments is shown. In (C) bars represent the mean ± SEM or two experiments conducted in duplicate. ⁎⁎⁎p b 0.001 vs control (C), ANOVA and Tukey's post hoc test.

presence or absence of the two HDACi (Figs. 5Aa and B). In keeping with the notion that, once activated, NFκB prompts rapid transactivation of the IκBα gene, IκBα levels increased at 2 and 3 h after LPS exposure. Interestingly, this increase was hampered by the presence of SAHA or ITF2357 (Figs. 5Aa and B). When tested on resting glial cells, both SAHA and ITF2357 prompted a slight increase of IκBα expression levels (Fig. 5Ab), in keeping with their ability to promote gene expression via chromatin hyperacetylation. Fig. 5C shows that the shifted band corresponding to LPS-induced NFκB subunit p65 binding to the radioactive oligoprobe was not affected by the concomitant presence of SAHA or ITF2357. Evaluating the DNA binding activity of p65 by means of an ELISA kit, confirmed that the protein's binding activity was indeed increased in glial cells exposed to LPS. Yet, ITF2357 was unable to affect p65 binding to its DNA recognition sequence (Fig. 5D). On the contrary, ITF2357 almost abrogated the LPS-induced DNA binding activity of the AP1 subunit cFOS. AP-1 proteins include the JUN, FOS, ATF (activating transcription factor) and MAF (musculoaponeurotic fibrosarcoma) protein families, which can form homodimers and heterodimers through their leucinezipper domains. The different dimer combinations recognize different sequence elements in the promoters and enhancers of target genes. We therefore checked whether ITF2357 was able to affect the binding activity of various AP1 subunits in glial cells exposed to LPS. Interestingly, the DNA binding activity of all the various subunits analyzed was two orders of magnitude lower than that of c-FOS, and,

with the exception of JUN-D, significantly increased upon exposure to LPS. ITF2357 did not affect the LPS-induced binding activity of JUN-B, FRA-1 and JUN-D, whereas increased that of c-JUN and FRA-2 (Fig. 5E). MicroRNAs (miRNAs) are short, non-coding RNAs responsible for post-transcriptional regulation of gene expression. Typically, they bind to the 3′-UTR (untranslated region) of their target mRNAs and repress protein expression by mRNA destabilization (Flynt and Lai, 2008). By so doing, miRNAs are emerging as key regulators of the immune response (Schickel et al., 2008). Remarkably, evidence is accumulating that HDACi regulate gene expression not only by affecting promoter-driven gene transcription, but also by increasing microRNA transcription, which, in turn, regulates mRNAs posttranscriptionally (Scott et al., 2006; Saito et al., 2006). miRNAs regulate LPS-driven innate immune responses and miR-146 has a key role in this regulation (Baltimore et al., 2008). In particular, miR-146 transcription is induced by LPS and negatively regulates immune activation, thereby constituting a negative feedback regulation loop (Taganov et al., 2006; Pedersen and David, 2008). We reasoned therefore that the anti-inflammatory effects of HDACi on glial cells might be due, at least in part, to a facilitated miR-146 transcription. However, we found that both miR-146a and miR-146b were not induced in glial cells exposed to LPS or LPS plus ITF2357 (Fig. 5F). This finding strengthens the hypothesis that direct impairment of transcriptional activation underlies HDACi-dependent immunosuppression in glial cells.

Fig. 3. Effects of SAHA or ITF2357 on INOS, COX2 and IL1β induction in activated glial cells. Mouse glial cell cultures were exposed to 0.3 μg/ml of LPS in the presence or absence of various concentrations of SAHA or ITF2357. (A) Glial cell cultures were exposed or not to SAHA or ITF2357 (both at 1 μM) for 2 h and then mRNA was extracted to evaluate the transcript levels of the 3 inflammatory mediators. (B) Cultures were exposed to different concentrations of SAHA or ITF2357 and protein extracted 6 h later for Western blotting. (C) Densitometric analysis of the effects of SAHA or ITF2357 on iNOS, COX2 or IL1β induction as well as histone H3 acetylation levels (AcH3K18). (D) Effect of SAHA or ITF2357 on TNFα release in the culture medium of glial cells exposed to 0.3 μg/ml LPS/3 h. (E) Effect of ITF2357 (0.1 μM), dexamethasone (DXE) alone or in combination on iNOS, COX2 and IL1β induction in glial cells exposed 6 h to 0.3 μg/ml LPS. (F) Densitometric analysis of the effect of ITF2357, dexamethasone (DXE) alone or in combination on iNOS, COX2 and IL1β induction in glial cells exposed 6 h to 0.3 μg/ml LPS. In (A), (B) and (E) representative images of 3 independent experiments are shown. In (C) and (F) columns represent the mean ± SEM of 3 experiments. In (D), columns represent the mean ± SEM or three experiments conducted in duplicate. ⁎p b 0.05, ⁎⁎p b 0.01, ⁎⁎⁎p b 0.001 vs LPS, ANOVA and Tukey's post hoc test.

276

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279

Fig. 5. Effect of ITF2357 and SAHA on NFκB and AP1 subunit DNA binding activity and miR-146 expression in glial cells exposed to LPS. (Aa) Expression levels of IκBα were evaluated by Western blotting in cultured glial cells exposed to 0.3 μg/ml LPS for different times in the presence or absence of SAHA (SA) or ITF2357 (IT), both at 1 μM. (Ab) Effects of SAHA or ITF2357 on IκBα expression levels. (B) Densitometric analysis of the effects of SAHA (SA) or ITF2357 (IT) on kinetics of IκBα degradation and resynthesis prompted by LPS. ⁎p b 0.05, ⁎⁎p b 0.01 vs control (C), ANOVA and Tukey's post hoc test. (C) Electromobility shift assay (EMSA) of extracts from glial cultures was exposed to 0.3 μg/ml LPS for 1 h in the presence or absence of ITF2357 or SAHA (both at 1 μM). A retarded band corresponding to of p65 NFκB subunit (see text) is present in extracts from cultures exposed to LPS but not affected by the concomitant presence of the HDACi. (D) The effect of ITF2357 on DNA binding activity of p65 NFκB subunit was also evaluated in LPS-challenged glial cells by means of a specific ELISA kit. (E) A similar kit was used to evaluate the effect of ITF2357 on the DNA binding activity of various AP1 subunits in LPS-challenged glial cell cultures. (F) PCR amplification of miR-146a/b and U6 (as loading control) in glial cell cultures under control conditions or exposed for 2 h to 0.3 μg/ml LPS in the presence or absence of ITF2357 or SAHA (both at 1 μM). A gel representative of 3 (A) and 2 (C) is shown. In (D) and (E) bars represent the mean of 3 experiments conducted in duplicate, in (F) a PCR representative of 4 independent experiments is shown (D) and (E) ⁎p b 0.05 vs control (C), §p b 0.05 vs LPS, ANOVA and Tukey's post hoc test.

Effect of HDAC inhibition on the neuroinflammatory response in vivo It is well accepted that the gene expression profile and transcriptional activation of cultured glial cells are different with respect to resting glia in vivo. Assuming that the pharmacodynamic effects of a transcription-regulating drug in cultured glia also occur in the brain

may be misleading. Hence, to ascertain the pharmacodynamic effects of HDAC inhibition on the neuroinflammatory response in the mouse brain, we microiontophoretically injected LPS into the mouse striatum, and checked for the neuroimmune response in animals receiving or not i.p. injection of ITF2357 at 10 or 30 mg/kg (Fig. 6A). As shown in Figs. 6B and C, striatal expression of iNOS, COX2 and IL-1

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279

277

Fig. 6. Effect of SAHA or ITF2357 on the neuroinflammatory response in vivo. (A) Schematic diagram of the treatment time schedule. (B) Striatal iNOS, COX2 and IL-1β expression was evaluated in mice microiontophoretically injected with 1 μl of LPS (1 μg/ml) into the striatum 24 h before sacrifice. Ten (ITF2357 10) or 30 (ITF2357 30) mg/kg of ITF2357 was injected i.p. at 0 and 6 h post the LPS challenge. Six animals per group were used and 2 mice per group are shown. (C) Densitometric analysis of the experiments represented in (A). Each column represents the mean ± SEM of six mice. ⁎p b 0.05 vs LPS, ANOVA and Tukey's post hoc test.

induced 24 h after LPS injection was reduced by ITF2357 given i.p. at 0 and 8 h post injection. Of note, in agreement with the in vitro results, among the immune mediators analyzed iNOS induction was the most sensitive to the suppressive effect of ITF2357. IL-1 induction was not reduced by ITF2357 in a dose-dependent fashion (Figs. 6A and B), in keeping with prior work in vitro (Leoni et al., 2002). Discussion It is now well appreciated that glia activation and ensuing production of inflammatory mediators can be detrimental for neural cell functioning and survival. Hence, a great deal of effort has been directed at the development of pharmacological strategies targeting the inflammatory response within the brain (Allan and Rothwell, 2001). Still, with the exception of corticosteroid, efficacious drugs that are able to counteract acute as well as chronic neuroinflammation are still an unmet need. In this scenario, our data are of molecular as well as clinical significance. Indeed, we provide both in vitro as well as in vivo evidence that production of inflammatory mediators by LPSactivated glial cells is reduced by drugs that are able to inhibit HDAC. Of note, these drugs are currently well tolerated in patients enrolled in clinical trials for cancer treatment (Minucci and Pelicci, 2006). In contrast with a recent report claiming that, among glial cells of the rat brain, only oligodendrocytes express HDACs (Broide et al., 2007), we show here that HDAC transcripts and activity are present in mouse glial cell cultures. These findings, plus evidence that enzymatic activity is inhibited by prototypical HDAC inhibitors displaying IC50s

consistent with their potency on pure HDACs (Jung, 2001; Hahnen et al., 2008; Khan et al., 2008), and that histone acetylation levels increase in cultured astrocytes and microglia, indicate that cultured mouse glia express HDACs. Also, evidence that ITF2357 reduces the neuroinflammatory response within the mouse brain corroborates the assumption that HDACs are expressed by glial cells and regulate their immune activation. Although this is in apparent contrast with the immuno-histological study by Broide et al. (2007), evidence that HDACs are expressed in glia is in agreement with the widespread distribution of the enzyme family and its key role in cell homeostasis. Also, our findings are in keeping with the expression of specific HDAC enzymes within the brain (Liu et al., 2008; MacDonald and Roskams, 2008; Shen et al., 2008). The impact of HDACi on the neuroimmune response still waits to be clarified (Suuronen et al., 2005, 2006, 2003; Zhang et al., 2008; Chen et al., 2007; Kim et al., 2007). By means of different and potent HDAC inhibitors, we now show that HDAC activity is essential for expression of pro-inflammatory mediators by mouse glia in vitro and in vivo. Data therefore strengthen the hypothesis that pharmacological suppression of HDAC is of therapeutic relevance to treatment of the neuroinflammatory disorders (Kazantsev and Thompson, 2008). The fact that results have been obtained in primary glial cultures and in the mouse brain renders our findings more relevant to immunotherapy than those obtained with glial or microglial cell lines. Furthermore, the present study is in keeping with those focusing on the effect of HDACi in models of experimental allergic encephalomyelitis (Gray and Dangond, 2006), stroke (Kim et al., 2007), septic

278

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279

shock (Leoni et al., 2002) or experimental colitis (Glauben et al., 2008). Further strengthening the therapeutic potential of HDACi for the treatment of neuroinflammatory disorders, we provide here the first evidence that inhibition of HDAC by ITF2357 is able to boost the anti-inflammatory effects of DXE on LPS-challenged glial cells. Oddly, however, ITF2357 reduced DXE-induced suppression of IL1β (Figs. 3E and F). In this regard, it is worth noting that the suppressive effects of SAHA and ITF2357 were less evident on IL1β than on iNOS or COX2 (see Figs. 3 and 6). These findings taken together, along the evidence that above 0.1 μM SAHA increases IL1β secretion by cultured peripheral blood mononuclear cells (Leoni et al., 2002), suggest that acetylationdependent transcriptional regulation at the IL1β promoter differs from that occurring at promoters for iNOS or COX2. Evidence that, among the four inflammatory mediators analyzed, iNOS induction is the most sensitive to the inhibitory effects of SAHA and ITFF2357 in vitro and in vivo, corroborates the assumption that sensitivity of the basal transcriptional machinery to HDACi is gene specific. Remarkably, the anti-inflammatory effects were already evident at concentrations of 0.1 μM, with ITF2357 displaying higher inhibitory potency than SAHA on both HDAC activity and immune suppression. This concentration is at least one order of magnitude lower than that required to inhibit cancer cell proliferation by SAHA and ITF2357 (Leoni et al., 2002). Accordingly, we originally report that none of the two drugs had any effect on glial cell viability despite huge increases in histone acetylation (compare Figs. 1B and 2A). This finding corroborates prior work indicating that cytotoxicity triggered by HDACi in cancer cells occurs because of the activation of apoptotic programs which are not prompted in primary cell cultures or in vivo (Dokmanovic et al., 2007). In this regard, we have recently reported that Bcl-2, an anti-apoptotic protein typically downregulated in neoplastic cells exposed to HDACi, is induced in the brain of mice injected with SAHA (Faraco et al., 2006). The safety profile of HDACi on the one hand underscores the therapeutic applicability of HDAC to immune disorders of the CNS, while on the other suggests that different molecular mechanisms at the level of the transcriptional machinery underlie the anti-inflammatory and anti-neoplastic effects of HDACi. Obviously, identification of the molecular mechanisms responsible for HDAC-dependent immune suppression is of considerable pharmacological and clinical relevance. We provide here the first evidence that inhibition of the pro-inflammatory response of glial cells is not dependent on translation of newborn proteins including SOCS-1/3. This is in apparent contrast with the assumption that histone hyperacetylation is associated with chromatin unravelling and increased gene expression. This assumption is obviously trivial and, indeed, upon exposure to HDACi gene expression profile undergoes changes due to increased as well as decreased transcription. Indeed, HDAC recently emerged as transcriptional activators of inducible genes (Nusinzon and Horvath, 2005). Our data are also consistent with the very rapid suppression of transcripts of proinflammatory mediators, which is difficult to bring together with the kinetics necessary to obtain newborn protein-dependent transcriptional repression. The findings obtained with CXE also rule out the hypothesis of HDACi-dependent stabilization of mRNAs for immunosuppressor proteins. This study, however, does not rule out the possibility that in a more integrated immune response (i.e. involving DC–T cell interaction) HDACi-assisted expression of newborn immunosuppressant proteins such as indoleamine dioxygenase (IDO) (Reddy et al., 2008) or IL-10 (Villagra et al., 2009) by antigen presenting cells can impair the inflammatory response within the CNS. Acetylation is emerging as a key post-translational modification regulating transactivation of various transcription factors including NFκB (Dokmanovic and Marks, 2005; Glozak et al., 2005b). Additionally, prior work demonstrates that HDACi affect the NFκB signaling pathway (Calao et al., 2008). Although this can well underlie the capability of HDACi of suppressing the inflammatory response, we show here that the DNA binding activity of the transactivating NFκB

subunits p65 is not affected in glial cells undergoing ITF2357dependent hyperacetylation. Importantly, however, HDAC inhibition delays recovery of IκBα expression levels upon LPS exposure (Figs. 5A and B). Given that IκBα re-expression is typically driven by NFκB, we conclude that the transcriptional machinery prompted by NFκB (and not its binding to recognition DNA elements) is impaired in glial cells exposed to SAHA or ITF2357. The fact that the DNA binding of c-FOS is significantly reduced in cells exposed to ITF2357, prompted us to better investigate the effects of hyperacetylation on activity of various AP1 subunits. Interestingly, we report that none of the additional AP1 subunits investigated is negatively regulated by HDAC inhibition, with some of them being unaffected and others activated (see Fig. 5E). Based on these findings, although we cannot be certain that the modulation of transcription factor binding indeed occurred at promoters of iNOS, COX or IL1β, we speculate that direct impairment of inducible transcription factor DNA binding, as well as functioning of basal transcriptional machinery underlies HDACi-dependent suppression of transcriptional activation within LPS-exposed glial cells. Because of the intriguing relationship among microRNA, suppression of gene expression and HDAC inhibition, we also investigated whether ITF2357 or SAHA might increase transcription of miR-146a and -b. The latter are two microRNAs induced by LPS and working in a feedback negative signaling loop in immune cells. Yet, the two variants of miR146 are not induced in mouse glial cells exposed to LPS alone or in the presence of the SAHA or ITF2357, thereby excluding that the two HDACi suppressed immune glia activation by promoting transcription of this microRNA. Of course, the possibility that other microRNAs contribute to the anti-inflammatory effects of drugs inhibiting HDACs deserves further investigation. Selectivity of HDAC inhibitors toward the different HDAC subclasses has been determined (Jung, 2001; Hahnen et al., 2008; Khan et al., 2008). Yet, given that both SAHA and ITF2357 are pan-HDAC inhibitors (Jung, 2001), we speculate that suppression of the inflammatory response in the brain is due to a shift toward protein hyperacetylation triggered by broad-spectrum HDAC inhibition. Future studies with isoform-selective HDAC inhibitors (Witt et al., 2008) will show whether suppression of neuroinflammation can be achieved by targeting specific enzyme of this family, and will allow to understand the relative contribution of HDACs to immune glial activation. These studies will certainly help delineate the real therapeutic potential of HDACi to treatment of neuroinflammatory disorders. Acknowledgments This study was supported by the University of Florence, the Italian Ministry of University and Scientific and Technological Research PRIN 2007, Associazione Italiana Sclerosi Multipla, Ente Cassa di Risparmio di Firenze and Italfarmaco SpA. References Abel, T., Zukin, R.S., 2008. Epigenetic targets of HDAC inhibition in neurodegenerative and psychiatric disorders. Curr. Opin. Pharmacol. 8, 57–64. Allan, S.M., Rothwell, N.J., 2001. Cytokines and acute neurodegeneration. Nat. Rev., Neurosci. 2, 734–744. Baltimore, D., Boldin, M.P., O'Connell, R.M., Rao, D.S., Taganov, K.D., 2008. MicroRNAs: new regulators of immune cell development and function. Nat. Immunol. 9, 839–845. Blanchard, F., Chipoy, C., 2005. Histone deacetylase inhibitors: new drugs for the treatment of inflammatory diseases? Drug Discov. Today 10, 197–204. Broide, R.S., Redwine, J.M., Aftahi, N., Young, W., Bloom, F.E., Winrow, C.J., 2007. Distribution of histone deacetylases 1–11 in the rat brain. J. Mol. Neurosci. 31, 47–58. Calao, M., Burny, A., Quivy, V., Dekoninck, A., Van Lint, C., 2008. A pervasive role of histone acetyltransferases and deacetylases in an NF-kappaB-signaling code. Trends Biochem. Sci. 33, 339–349. Camelo, S., Iglesias, A.H., Hwang, D., Due, B., Ryu, H., Smith, K., Gray, S.G., Imitola, J., Duran, G., Assaf, B., Langley, B., Khoury, S.J., Stephanopoulos, G., De Girolami, U., Ratan, R.R., Ferrante, R.J., Dangond, F., 2005. Transcriptional therapy with the histone deacetylase inhibitor trichostatin A ameliorates experimental autoimmune encephalomyelitis. J. Neuroimmunol. 164, 10–21.

G. Faraco et al. / Neurobiology of Disease 36 (2009) 269–279 Chang, J.G., Hsieh-Li, H.M., Jong, Y.J., Wang, N.M., Tsai, C.H., Li, H., 2001. Treatment of spinal muscular atrophy by sodium butyrate. Proc. Natl. Acad. Sci. U. S. A. 98, 9808–9813. Chen, P.S., Wang, C.C., Bortner, C.D., Peng, G.S., Wu, X., Pang, H., Lu, R.B., Gean, P.W., Chuang, D.M., Hong, J.S., 2007. Valproic acid and other histone deacetylase inhibitors induce microglial apoptosis and attenuate lipopolysaccharide-induced dopaminergic neurotoxicity. Neuroscience 149, 203–212. Chiarugi, A., Moskowitz, M.A., 2003. Poly(ADP-ribose) polymerase-1 activity promotes NF-kappaB-driven transcription and microglial activation: implication for neurodegenerative disorders. J. Neurochem. 85, 306–317. Corcoran, L.J., Mitchison, T.J., Liu, Q., 2004. A novel action of histone deacetylase inhibitors in a protein aggresome disease model. Curr. Biol. 14, 488–492. Dimitriou, I.D., Clemenza, L., Scotter, A.J., Chen, G., Guerra, F.M., Rottapel, R., 2008. Putting out the fire: coordinated suppression of the innate and adaptive immune systems by SOCS1 and SOCS3 proteins. Immunol. Rev. 224, 265–283. Dokmanovic, M., Marks, P.A., 2005. Prospects: histone deacetylase inhibitors. J. Cell. Biochem. 96, 293–304. Dokmanovic, M., Clarke, C., Marks, P.A., 2007. Histone deacetylase inhibitors: overview and perspectives. Mol. Cancer Res. 5, 981–989. Faraco, G., Pancani, T., Formentini, L., Mascagni, P., Fossati, G., Leoni, F., Moroni, F., Chiarugi, A., 2006. Pharmacological inhibition of histone deacetylases by suberoylanilide hydroxamic acid specifically alters gene expression and reduces ischemic injury in the mouse brain. Mol. Pharmacol. 70, 1876–1884. Ferrante, R.J., Kubilus, J.K., Lee, J., Ryu, H., Beesen, A., Zucker, B., Smith, K., Kowall, N.W., Ratan, R.R., Luthi-Carter, R., Hersch, S.M., 2003. Histone deacetylase inhibition by sodium butyrate chemotherapy ameliorates the neurodegenerative phenotype in Huntington's disease mice. J. Neurosci. 23, 9418–9427. Flynt, A.S., Lai, E.C., 2008. Biological principles of microRNA-mediated regulation: shared themes amid diversity. Nat. Rev., Genet. 9, 831–842. Gardian, G., Browne, S.E., Choi, D.K., Klivenyi, P., Gregorio, J., Kubilus, J.K., Ryu, H., Langley, B., Ratan, R.R., Ferrante, R.J., Beal, M.F., 2005. Neuroprotective effects of phenylbutyrate in the N171-82Q transgenic mouse model of Huntington's disease. J. Biol. Chem. 280, 556–563. Glauben, R., Batra, A., Stroh, T., Erben, U., Fedke, I., Lehr, H.A., Leoni, F., Mascagni, P., Dinarello, C.A., Zeitz, M., Siegmund, B., 2008. Histone deacetylases: novel targets for prevention of colitis-associated cancer in mice. Gut 57, 613–622. Glozak, M.A., Sengupta, N., Zhang, X.H., Seto, E., 2005a. Acetylation and deacetylation of non-histone proteins. Gene 363, 15–23. Glozak, M.A., Sengupta, N., Zhang, X.H., Seto, E., 2005b. Acetylation and deacetylation of non-histone proteins. Gene 363, 15–23. Glozak, M.A., Sengupta, N., Zhang, X.H., Seto, E., 2005c. Acetylation and deacetylation of non-histone proteins. Gene 363, 15–23. Gray, S.G., Dangond, F., 2006. Rationale for the use of histone deacetylase inhibitors as a dual therapeutic modality in multiple sclerosis. Epigenetics 1, 67–75. Hahnen, E., Hauke, J., Trankle, C., Eyupoglu, I.Y., Wirth, B., Blumcke, I., 2008. Histone deacetylase inhibitors: possible implications for neurodegenerative disorders. Expert Opin. Investig. Drugs 17, 169–184. Hockly, E., Richon, V.M., Woodman, B., Smith, D.L., Zhou, X., Rosa, E., Sathasivam, K., Ghazi-Noori, S., Mahal, A., Lowden, P.A., Steffan, J.S., Marsh, J.L., Thompson, L.M., Lewis, C.M., Marks, P.A., Bates, G.P., 2003. Suberoylanilide hydroxamic acid, a histone deacetylase inhibitor, ameliorates motor deficits in a mouse model of Huntington's disease. Proc. Natl. Acad. Sci. U. S. A. 100, 2041–2046. Jenuwein, T., Allis, C.D., 2001. Translating the histone code. Science 293, 1074–1080. Jung, M., 2001. Inhibitors of histone deacetylase as new anticancer agents. Curr. Med. Chem. 8, 1505–1511. Kazantsev, A.G., Thompson, L.M., 2008. Therapeutic application of histone deacetylase inhibitors for central nervous system disorders. Nat. Rev., Drug Discov. 7, 854–868. Khan, N., Jeffers, M., Kumar, S., Hackett, C., Boldog, F., Khramtsov, N., Qian, X., Mills, E., Berghs, S.C., Carey, N., Finn, P.W., Collins, L.S., Tumber, A., Ritchie, J.W., Jensen, P.B., Lichenstein, H.S., Sehested, M., 2008. Determination of the class and isoform selectivity of small-molecule histone deacetylase inhibitors. Biochem. J. 409, 581–589. Kim, H.J., Rowe, M., Ren, M., Hong, J.S., Chen, P.S., Chuang, D.M., 2007. Histone deacetylase inhibitors exhibit anti-inflammatory and neuroprotective effects in a rat permanent ischemic model of stroke: multiple mechanisms of action. J. Pharmacol. Exp. Ther. 321, 892–901. Langley, B., Gensert, J.M., Beal, M.F., Ratan, R.R., 2005. Remodeling chromatin and stress resistance in the central nervous system: histone deacetylase inhibitors as novel and broadly effective neuroprotective agents. Curr. Drug Targets CNS Neurol. Disord. 4, 41–50. Leoni, F., Zaliani, A., Bertolini, G., Porro, G., Pagani, P., Pozzi, P., Dona, G., Fossati, G., Sozzani, S., Azam, T., Bufler, P., Fantuzzi, G., Goncharov, I., Kim, S.H., Pomerantz, B.J., Reznikov, L.L., Siegmund, B., Dinarello, C.A., Mascagni, P., 2002. The antitumor

279

histone deacetylase inhibitor suberoylanilide hydroxamic acid exhibits antiinflammatory properties via suppression of cytokines. Proc. Natl. Acad. Sci. U. S. A. 99, 2995–3000. Liu, H., Hu, Q., Kaufman, A., D'Ercole, A.J., Ye, P., 2008. Developmental expression of histone deacetylase 11 in the murine brain. J. Neurosci. Res. 86, 537–543. MacDonald, J.L., Roskams, A.J., 2008. Histone deacetylases 1 and 2 are expressed at distinct stages of neuro-glial development. Dev. Dyn. 237, 2256–2267. Marks, P.A., 2007. Discovery and development of SAHA as an anticancer agent. Oncogene 26, 1351–1356. Minucci, S., Pelicci, P.G., 2006. Histone deacetylase inhibitors and the promise of epigenetic (and more) treatments for cancer. Nat. Rev., Cancer 6, 38–51. Nusinzon, I., Horvath, C.M., 2005. Histone deacetylases as transcriptional activators? Role reversal in inducible gene regulation. Sci. STKE 2005, re11. Pedersen, I., David, M., 2008. MicroRNAs in the immune response. Cytokine 43, 391–394. Petri, S., Kiaei, M., Kipiani, K., Chen, J., Calingasan, N.Y., Crow, J.P., Beal, M.F., 2006. Additive neuroprotective effects of a histone deacetylase inhibitor and a catalytic antioxidant in a transgenic mouse model of amyotrophic lateral sclerosis. Neurobiol. Dis. 22, 40–49. Reddy, P., Sun, Y., Toubai, T., Duran-Struuck, R., Clouthier, S.G., Weisiger, E., Maeda, Y., Tawara, I., Krijanovski, O., Gatza, E., Liu, C., Malter, C., Mascagni, P., Dinarello, C.A., Ferrara, J.L., 2008. Histone deacetylase inhibition modulates indoleamine 2,3dioxygenase-dependent DC functions and regulates experimental graft-versushost disease in mice. J. Clin. Invest. 118, 2562–2573. Ren, M., Leng, Y., Jeong, M., Leeds, P.R., Chuang, D.M., 2004. Valproic acid reduces brain damage induced by transient focal cerebral ischemia in rats: potential roles of histone deacetylase inhibition and heat shock protein induction. J. Neurochem. 89, 1358–1367. Ryu, H., Smith, K., Camelo, S.I., Carreras, I., Lee, J., Iglesias, A.H., Dangond, F., Cormier, K.A., Cudkowicz, M.E., Brown Jr., R.H., Ferrante, R.J., 2005. Sodium phenylbutyrate prolongs survival and regulates expression of anti-apoptotic genes in transgenic amyotrophic lateral sclerosis mice. J. Neurochem. 93, 1087–1098. Saha, R.N., Pahan, K., 2006. HATs and HDACs in neurodegeneration: a tale of disconcerted acetylation homeostasis. Cell Death Differ. 13, 539–550. Saito, Y., Liang, G., Egger, G., Friedman, J.M., Chuang, J.C., Coetzee, G.A., Jones, P.A., 2006. Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. Cancer Cell 9, 435–443. Schickel, R., Boyerinas, B., Park, S.M., Peter, M.E., 2008. MicroRNAs: key players in the immune system, differentiation, tumorigenesis and cell death. Oncogene 27, 5959–5974. Scott, G.K., Mattie, M.D., Berger, C.E., Benz, S.C., Benz, C.C., 2006. Rapid alteration of microRNA levels by histone deacetylase inhibition. Cancer Res. 66, 1277–1281. Shen, S., Sandoval, J., Swiss, V.A., Li, J., Dupree, J., Franklin, R.J., Casaccia-Bonnefil, P., 2008. Age-dependent epigenetic control of differentiation inhibitors is critical for remyelination efficiency. Nat. Neurosci. 11, 1024–1034. Suuronen, T., Huuskonen, J., Pihlaja, R., Kyrylenko, S., Salminen, A., 2003. Regulation of microglial inflammatory response by histone deacetylase inhibitors. J. Neurochem. 87, 407–416. Suuronen, T., Nuutinen, T., Huuskonen, J., Ojala, J., Thornell, A., Salminen, A., 2005. Antiinflammatory effect of selective estrogen receptor modulators (SERMs) in microglial cells. Inflamm. Res. 54, 194–203. Suuronen, T., Huuskonen, J., Nuutinen, T., Salminen, A., 2006. Characterization of the proinflammatory signaling induced by protein acetylation in microglia. Neurochem. Int. 49, 610–618. Taganov, K.D., Boldin, M.P., Chang, K.J., Baltimore, D., 2006. NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc. Natl. Acad. Sci. U. S. A. 103, 12481–12486. Villagra, A., Cheng, F., Wang, H.W., Suarez, I., Glozak, M., Maurin, M., Nguyen, D., Wright, K.L., Atadja, P.W., Bhalla, K., Pinilla-Ibarz, J., Seto, E., Sotomayor, E.M., 2009. The histone deacetylase HDAC11 regulates the expression of interleukin 10 and immune tolerance. Nat. Immunol. 10, 92–100. Witt, O., Deubzer, H.E., Milde, T., Oehme, I., 2008. HDAC family: what are the cancer relevant targets? Cancer Lett. 277, 8–21. Xu, W.S., Parmigiani, R.B., Marks, P.A., 2007. Histone deacetylase inhibitors: molecular mechanisms of action. Oncogene 26, 5541–5552. Yang, M.S., Min, K.J., Joe, E., 2007. Multiple mechanisms that prevent excessive brain inflammation. J. Neurosci. Res. 85, 2298–2305. Yoo, C.B., Jones, P.A., 2006. Epigenetic therapy of cancer: past, present and future. Nat. Rev., Drug Discov. 5, 37–50. Zhang, B., West, E.J., Van, K.C., Gurkoff, G.G., Zhou, J., Zhang, X.M., Kozikowski, A.P., Lyeth, B.G., 2008. HDAC inhibitor increases histone H3 acetylation and reduces microglia inflammatory response following traumatic brain injury in rats. Brain Res. 1226, 181–191.