Histone Deacetylase Inhibitor MS-275 Alleviates Postoperative Cognitive Dysfunction in Rats by Inhibiting Hippocampal Neuroinflammation

NEUROSCIENCE RESEARCH ARTICLE Y. Wu et al. / Neuroscience 417 (2019) 70–80

Histone Deacetylase Inhibitor MS-275 Alleviates Postoperative Cognitive Dysfunction in Rats by Inhibiting Hippocampal Neuroinflammation Yang Wu, a Juan Dou, b Xing Wan, c Yan Leng, a Xuke Liu, a Lili Chen, a Qianni Shen, a Bo Zhao, a Qingtao Meng a and Jiabao Hou a,* a

Department of Anesthesiology, Renmin Hospital, Wuhan University, P.O. Box 430060, No. 238 Jiefang Road, Wuhan, China

b

Sterilization and Supply Center, Renmin Hospital, Wuhan University, P.O. Box 430060, No. 238 Jiefang Road, Wuhan, China

c

Operating Room, Renmin Hospital, Wuhan University, P.O. Box 430060, No. 238 Jiefang Road, Wuhan, China

Abstract—Neuroinflammation in the hippocampus plays essential roles in postoperative cognitive dysfunction (POCD). Histone deacetylases (HDACs) have recently been identified as key regulators of neuroinflammation. MS-275, an inhibitor of HDAC, has been reported to have neuroprotective effects. Therefore, the present study aimed to test the hypothesis that pretreatment with MS-275 prevents POCD by inhibiting neuroinflammation in rats. In this study, anesthesia/surgery impaired cognition, demonstrated by an increase escape latency and reduction in the number of platform crossings in Morris water maze (MWM) trials, through activating microglia neuroinflammation and decreasing PSD-95 expression. However, pretreatment with MS-275 attenuated postoperative cognitive impairment severity. Furthermore, pretreatment with MS-275 decreased activated microglia levels and increased PSD95 protein expression in the hippocampus. Pretreatment with MS-275 reduced NF-jB-p65 protein expression and nuclear accumulation as well as the neuroinflammatory response (production of proinflammatory cytokines including TNF-a and IL-1b) in the hippocampus. Additionally, MS-275 reduced HDAC2 expression and HDAC activity in the hippocampus, which were enhanced in vehicle-treated rats. These results suggest that MS-275 alleviates postoperative cognitive dysfunction by reducing neuroinflammation in the hippocampus of rats via HDAC inhibition. Ó 2019 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: postoperative cognitive dysfunction, neuroinflammation, histone deacetylase, MS-275, NF-jB-p65.

(Hovens et al., 2014; Wang et al., 2017). Despite recent advances in interventional strategies targeting inflammation in POCD, simple anti-inflammatory treatment failed to obtain satisfactory clinical effects. Thus, finding better therapeutic targets to prevent cerebral neuroinflammation has been a great challenge in neurobiology. The development of new promising strategies that support the activation of endogenous inhibitory pathways that suppress inflammation, such as the nuclear factor (NF)-jB and tumor necrosis factor-a (TNF-a) pathways, and restore inflamed tissue to the previous physiological state will be critical for the treatment of POCD. NF-jB, an inducible transcription factor, plays a critical role in the expression of a variety of genes involved in inflammatory responses. The transcription of NF-jB is highly regulated by several posttranslational nuclear modifications, especially acetylation (Leus et al., 2016). Previous studies have indicated that NF-jB participates in the inflammation-induced cognitive impairment process, which may be related to POCD (Li et al., 2017), but the mechanism regulating its acetylation remains unclear.

INTRODUCTION Postoperative cognitive dysfunction (POCD) is a clinical syndrome associated with cognitive decline in patients following surgery and adversely affects quality of life, social dependence, and mortality (Zhang et al., 2017). A study showed that surgery and inhaled sevoflurane could promote the progression of cognitive dysfunction in patients, but the pathogenesis remains largely unknown (Liu et al., 2013). A recent study found that surgery under volatile anesthetics could cause neuroinflammation in the hippocampus and may contribute to cognitive dysfunction *Corresponding author at: Department of Anesthesiology, Renmin Hospital, Wuhan University, P.O. Box 430060, No. 238 Jiefang Road, Wuhan, China Tel.: +86 0278 8041 9118 1024. E-mail address: [email protected] (J. Hou). Abbreviations: POCD, postoperative cognitive dysfunction; SD, Sprague–Dawley; HDAC, histone deacetylases; TNF-a, tumor necrosis factor-a; PCR, polymerase chain reaction; MWM, Morris water maze; NF-jB, nuclear factor kappa B; NeuN, detect neuronal nuclei; Iba-1, ionized calcium binding adaptor molecule; IP, immunoperoxidase; IF, immunofluorescence; PSD95, postsynaptic density 95; RelA, NF-jB -P65; ELISA, enzyme-linked immunosorbent assay; CTL, control; SAHA, suberoylanilide hydroxamic acid. https://doi.org/10.1016/j.neuroscience.2019.08.020 0306-4522/Ó 2019 IBRO. Published by Elsevier Ltd. All rights reserved. 70

Y. Wu et al. / Neuroscience 417 (2019) 70–80

The histone deacetylases (HDAC) family is composed of three distinct groups, nonsirtuin HDACs (class I, II) and longevity protein sirtuin deacetylases (class III). Recent studies have reported that members of class I HDACs regulate inflammation in the neurological system, and HDAC activity accounts for amplified inflammation and resistance to anti-inflammatory effects (Ganai et al., 2016; Lin et al., 2017). Downregulation of endogenous anti-inflammatory functions may contribute to the chronic inflammatory disorders of POCD (Riedel et al., 2014). On the other hand, class I HDACs may contribute to the inflammatory disorders of POCD. HDAC1 and HDAC2 have been shown in some studies to repress TNF-ainduced NF-jB-dependent gene expression, while HDAC3 has been reported to be an important player in inflammation by deacetylating NF-jB-p65 (Ashburner et al., 2001), which may be implicated in the pathology of POCD. Therefore, we hypothesized that small molecule HDAC inhibitors targeting class I HDAC members can regulate NF-jB-p65 neuroinflammation to induce POCD. In this study, we further investigated the effect of MS-275 (a selective inhibitor for HDAC1, 2 and 3) on inflammation induced by POCD in rats. In addition, we hypothesized that MS-275 might impart a neuroprotective effect on POCD rats by regulating inflammatory processes in the brain. Our investigation extends support for the neuroprotective effects of HDAC inhibition.

EXPERIMENTAL PROCEDURES Animals and grouping Sixty male Sprague–Dawley (SD) rats (250–280 g) were obtained from HFK bioscience (Beijing, China). Rats were housed in a controlled environment at a room temperature of 22 °C and relative humidity of 50 ± 15% in a 12 h light/12 h dark cycle. All rats had free access to standard chow and water ad libitum. Animals were housed for 1 week to adapt to the environment. All study protocols and procedures were approved by the experimental animal ethics committee at Wuhan University. A total of 60 rats were randomly assigned to three groups (20 rats in each group) and treated with or without HDAC inhibitor before surgery: (1) in the control group (CTL), rats received neither anesthesia nor surgery; (2) in the surgery group (SS), rats underwent laparotomy under sevoflurane anesthesia; and (3) in the surgery plus MS-275 group (MS-275), rats were injected intraperitoneally (i.p.) with 10 mg/kg MS-275 at 0.5 h before laparotomy under sevoflurane anesthesia. The rats in the SS group and CTL group were given the same volume of saline or DMSO at the same time point. MS-275 (a specific inhibitor of HDAC1, 2 and 3) was purchased from Sigma (St. Louis, MO, USA). After full recovery from the anesthesia, the rats were housed in single cages. Surgery A simple laparotomy was performed under 3% sevoflurane in oxygen for 2 h. Specifically, anesthesia

71

was induced and maintained with 3% sevoflurane; 5 min after the induction, each of the rats was removed from the chamber, and sevoflurane anesthesia was maintained via a cone mask. Abdominal surgery was performed on rats as described previously (Cao et al., 2018). In short, the rats underwent routine skin disinfection procedures and laparotomy under sevoflurane anesthesia (3% sevoflurane in O2 at 2 L/min). The intestines were exteriorized for 1 min and pushed back into the abdominal cavity every three min for 2 h. This surgery mimicked major abdominal surgery in humans. The incision was then infiltrated with 0.25% bupivacaine for postoperative analgesia and closed using a sterile suture. The control group received no anesthesia or surgical treatments. Pharmacological treatment MS-275 was dissolved in DMSO and diluted in saline solution to achieve a final concentration of 2.0 mg/mL. MS-275 (10.0 mg/kg) or vehicle [DMSO diluted in saline solution (1:4)] was injected (i.p.) before the surgery. The dosage and route of MS-275 administration were based on previous studies, which demonstrated that this method could increase histone acetylation in hippocampal neurons and attenuate memory deficits (Simonini et al., 2006; Whittle et al., 2013; VargasLopez et al., 2016). Morris water maze test Morris water maze (MWM) testing was performed to assess the cognition function of rats in each group; the DMS-2 Morris water maze testing system (RWD life science, Guangdong, Shenzhen, China) was utilized (Hovens et al., 2014). The MWM was 0.5 m in height and 1.2 m in diameter. During the tests, the water temperature was maintained between 22 °C and 25 °C. The procedures for the place navigation test were as follows: the water area was divided into 4 quadrants, and rats were placed in the MWM at one of the water quadrants and allowed to search and find the platform. During each trial, rats were allowed 60 s to find the target platform that was hidden 2 cm beneath the water surface in the center of one quadrant. The duration of swimming was recorded as the escape latency. Animals underwent surgery on the sixth day, and the escape latency and velocity were measured on postoperative days 1, 3, and 7. The procedures for space exploration experiments were as follows: on postoperative days 3 and 7, the platform was removed from the MWM, and the rats were released into the water in one quadrant while facing the wall. The number of crossings where the platform had previously been located was measured (Hou et al., 2019). Tissue collection Rats in each group were divided into two subgroups, with each subgroup containing 10 rats. At 24 h after the operation, 5 rats were sacrificed for hippocampal tissue isolation and biochemical measurements, and the other

72

Y. Wu et al. / Neuroscience 417 (2019) 70–80

5 rats were fixed for tissue sections. The brains were rapidly removed, and hippocampal tissues were rapidly separated and stored in liquid nitrogen prior to use. The brains used for Nissl staining were fixed in 4% formaldehyde immediately after isolation. In the other subgroup, the 10 rats underwent MWM tests. Immediately after behavioral tests, the rats were anesthetized and sacrificed by decapitation. Real-time polymerase chain reaction The mRNA expression levels of HDAC1, 2, and 3 and key proinflammatory cytokines, i.e., TNF-a and interleukin (IL)-1b, were evaluated by real-time polymerase chain reaction (PCR). Total RNA was extracted from the hippocampus using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA measurement was conducted by measuring ultraviolet absorbance at 260 nm and 280 nm with a spectrophotometer (NanoDrop 2000; Thermo Scientific, Wilmington, DE). Equal amounts of RNA (2 lg) were taken from all the samples, and quantitative analysis of gene expression was carried out in triplicate in a 25 lL reaction volume using the One Step SYBR PrimeScript RT-PCR Kit II (Takara, Shiga, Japan) as previously described (Hsing et al., 2015; Zhu et al., 2016). The amplification was carried out initially with denaturation at 94 °C for 3 min, followed by the following thermocycler settings: 40 cycles at 94 °C for 30 s, 55 °C for 30 s, and a final extension at 72 °C for 5 min. Specific primers were designed using Primer5 and listed as follows (Table 1). For normalization of the total RNA in each sample, GAPDH was adopted as the endogenous reference to normalize the transcript levels. The relative gene expression levels were analyzed using the DDCt method.

temperature. Next, the following primary antibodies were incubated with these membranes: rabbit monoclonal anti-HDAC1, anti-HDAC2, anti-HDAC3, anti-acetylhistone H3 (Ac-H3), anti-postsynaptic density 95 (PSD95), anti-NF-jB-p65 (RelA), anti-TNF-a, anti-IL-1b and anti-b-actin, and the appropriate secondary antibodies were used. Finally, the proteins were detected by enhanced chemiluminescence (ECL) Western blotting detection reagents (Thermo Scientific, Rockford, IL, USA), and the intensity of each band was quantified by densitometry. Measurements of HDAC activity Hippocampal HDAC activity was determined using an assay described previously. Briefly, 25 mg of hippocampal tissue was washed with PBS and centrifuged at 500 g for 5 min at 4 °C. Subsequently, the supernatant was removed, and nuclear fractions were prepared using the Nuclear and Cytoplasmic Extraction kit (Thermo Scientific, Rockford, IL, USA) according to the manufacturer’s protocol (Leus et al., 2017). Protein concentration was quantitated using the BCA protein assay kit (Thermo Scientific, Rockford, IL, USA). Then, nuclear extracts from the hippocampus were diluted in ddH2O. After the addition of HDAC assay buffer, a colorimetric substrate comprising an acetylated lysine side chain was added and incubated with the sample. The reaction was stopped by adding lysine developer and incubating for 30 min. The fluorescence signal was measured by an enzyme-linked immunosorbent assay (ELISA) plate reader (Perkin Elmer Co. USA) at 400 nm. The results were expressed as relative OD values (% of control ± standard error of the mean (SEM)). ELISA for NF-jB-p65 activity

Western blotting assays The harvested hippocampal tissues were sampled and homogenized with a mixture of RIPA lysis buffer, PMSF (Beyotime, China), and a protease inhibitor cocktail (Roche, USA), as described previously. Then, the samples were homogenized and centrifuged for 30 min at 4 °C. Supernatants were collected, and the total protein concentration was determined by using a BCA kit (Beyotime, China). Equivalent amounts of proteins (20–50 lg) were separated on a 10% SDS polyacrylamide gel and electrotransferred onto a PVDF membrane. The PVDF membrane was blocked with 5% bovine serum albumin (BSA, Sigma) for 1 h at room

NF-jB activity was determined by the level of p65 in the nuclear fraction using the NF-jB-p65 Active ELISA kit (Imgenex, San Diego, CA). Nuclear extracts were prepared and subjected to a sandwich ELISA according to the manufacturer’s protocol. The optical density of samples was determined using an ELISA microplate reader (Perkin Elmer Co. USA) at 450 nm. Distribution of acetylated NF-jB-p65 protein The distribution profile of acetylated NF-jB-p65 (Ac-p65) protein was also investigated. Both nuclear and cytoplasmic fractions were extracted using the universal

Table 1. Rat primers used for real-time PCR. Gene

Forward primer (50 -30 )

Reverse primer (50 -30 )

HDAC1 HDAC2 HDAC3 IL-1b TNF-a PSD95 GAPDH

AAGTTCTTGCGTTCT ATTCG CGTAGGAATG TCGCTGAT CCTCT GGCTTCTGCTATG CATGATCCGAGATGTGGAACTGGC CATGATCCGAGATGTGGAACTGGC GCC GTT TGA GTT CTC CTT T CTACCCACGGCAAGTTCAAC

CCGTC TGCTGCTTAT TGA GGTTG TTGAGTTGTT CTGAT GTAACTCTGGTCATCAATGC CTGGCTCAGCCACTCCAGC CTGGCTCAGCCACTCCAGC AGC ATT TCC TGT CCT CCC CCAGTAGACTCCACGACATAC

HDAC = histone deacetylase; TNF-a = tumor necrosis factor-a; IL-1b = interleukin-1b; PSD95 = Postsynaptic density 95; GAPDH = glyceraldehyde-3-phosphate dehydrogenase.

73

Y. Wu et al. / Neuroscience 417 (2019) 70–80

magnetic CO-IP kit from Active Motif (Carlsbad, CA, USA). Hippocampal tissue was lysed and immunoprecipitated with an antibody targeting acetylated NF-jB-p65 specific to lysine residue 310. The immunoprecipitants were immunoblotted with an antibody targeting acetylated NF-jB (Abcam) and fractionated by SDS–PAGE. Bands were quantified by densitometry.

as the mean ± SEM. We first checked the normal distribution of our data and then performed the ANOVA. Values at *P < .05 were considered statistically significant.

Measurement of neuronal density by Nissl staining

The MWM test was conducted to evaluate spatial learning and memory in rodents. In our tests, a repeatedmeasures ANOVA followed by Dunnett’s test on swim data revealed that the escape latency gradually decreased over 6 consecutive days before surgery, and no significant difference was observed among all groups (Fig. 1A, F2, 27 = 1.425, P = .528). After the surgery,

Nissl staining was used to identify the basic neuronal structure in the brain. The hippocampus of each rat was fixed in 4% paraformaldehyde overnight and then embedded in paraffin. Coronal sections (3 lm thick) were prepared and subjected to Nissl staining as described (Afshar et al., 2018; Gu et al., 2018). Ten paraffin coronal sections (3 lm) of the dorsal hippocampus (referring to Paxinos and Watson, 1997) -3 mm from the bregma of each rat (n = 5) were stained with 0.5% cresyl violet to assess the cell density in the CA1 region. Microphotographs were taken using a microscope digital camera system (Olympus, Tokyo, Japan) at 400  magnification. The number of Nissl-positive healthy neuronal cells was counted by an investigator blinded to the protocol using Image J (National Institutes of Health, USA) and expressed as cell number/mm2 (Hou et al., 2019).

RESULTS Pretreatment with MS-275 alleviated anesthesia/surgery-induced cognitive impairment

Immunofluorescence staining of the hippocampus Tissue sections were used to detect neuronal nuclei (NeuN) and ionized calcium binding adaptor molecule (Iba)-1 in the hippocampus (CA1 area) by immunoperoxidase (IP) and immunofluorescence (IF). Hippocampal tissue was sliced into 5 lm thick sections, gradient deparaffinized, rehydrated, and then incubated in H2O2 for 15 min. The sections were treated with 10 mM sodium citrate buffer (pH 6.0), heated in a microwave oven for 10 min at 100 °C, and then blocked in normal goat serum for 30 min at 37 °C. The sections were further incubated overnight at 4 °C with the rabbit anti-NeuN (1:500; Gene Tex, USA) or anti-Iba-1(1: 100, Abcam, USA) primary antibody. Subsequently, the sections were incubated with Alexa 488-conjugated goat anti-rabbit IgG (1:1500, Invitrogen) in PBS with 2% normal goat serum for 1 h. Images were acquired using a fluorescence microscope (Olympus, Tokyo, Japan). Statistical analysis All data are expressed as the mean ± SEM and analyzed using GraphPad Prism 6 statistic software (La Jolla, CA, USA). For the MWM probe trial, the latency to platform and the number of platform crossings were analyzed using a repeated-measures analysis of variance (ANOVA) followed by Dunnett’s test to determine differences in the memory levels of the groups (with group and time as factors) if the number of rats in different groups were equal. All of the collected data from Western blotting, real-time PCR, ELISA and staining experiments were analyzed by one-way ANOVA with Tukey’s test, and the data are presented

Fig. 1. Effects of MS-275 on the learning and memory abilities of rats in Morris water maze testing. A, Swimming latency to the platform. B, Platform crossing number. C, The swimming speed. Data are presented as the mean ± SEM (n = 10 per group). *P < .05 compared with the control group by Dunnett’s test. #P < .05 compared with the SS group by Dunnett’s test. CTL: control group; SS: surgery group; and MS-275: surgery plus MS-275 group.

74

Y. Wu et al. / Neuroscience 417 (2019) 70–80

the spatial probe test was conducted. The swimming data showed impairments in escape latency in the SS group on postoperative days 1 (F2, 27 = 39.72, P < .001), 3 (F2, 27 = 66.98, P < .001) and 7 (F2, 27 = 31.78, P < .001). The platform crossing number in the target zone by rats in the SS group revealed a significant impairment compared to that by rats in the CTL group; this analysis was performed on postoperative day 1 (F2, 27 = 7.69, P = .002), 3 (F2, 27 = 8.15, P = .002) and 7 (F2, P < .001) (Fig. 1B, Dunnett’s multiple 27 = 9.57, comparison test). However, MS-275-treated rats took less time to find the platform and had a significantly greater platform crossing number than rats without MS275 pretreatment (P < .05). Overall, these results indicated that anesthesia/surgery contributed to cognitive impairment in POCD and that MS-275 treatment could eliminate the effects caused by anesthesia/surgery-induced trauma. The swimming speed in the MWM test revealed no significant differences in the spatial probe trials among groups throughout the procedures, which indicated that the group differences in escape latency time and platform crossing times did not result from differences in swimming ability (P > .05) (Fig. 1C, Dunnett’s multiple comparison test).

Pretreatment with MS-275 reduced HDAC2 mRNA expression Some HDACs, including HDAC1, HDAC2 and HDAC3, play specific roles in cognitive function. Therefore, the effects of anesthesia/surgery-induced trauma on HDAC were examined on postoperative day 1 by detecting the levels of HDAC mRNA in the hippocampus collected from control rats and rats that underwent anesthesia/surgery with or without MS-275 treatment (Fig. 2). Tukey’s test showed that compared with the hippocampal tissues from the control group, those from the SS group expressed HDAC2 mRNA at significantly higher levels (F2, 12 = 73.98, P < .001). However, the

mRNA expression levels of HDAC1 (F2, 12 = 1.81, P = .21) and HDAC3 (F2, 12 = 2.16, P = .16) were unaltered. In contrast, treatment with MS-275 was associated with a significant decrease in HDAC2 mRNA levels in the hippocampus (P < .05). Pretreatment of MS-275 on the levels of hippocampal HDAC, histone acetylation, and HDAC activity Furthermore, we investigated histone acetylation by Western blotting. The acetylation of histone H3 was significantly reduced in the hippocampal tissue of the SS group compared to that of the CTL group (F2, 12 = 5.58, P = .019) (Fig. 3A, Tukey’s test). Interestingly, an increase in H3 acetylation was observed upon MS-275 treatment (P < .05). Altogether, these results show for the first time that histone H3 acetylation is decreased in the rat hippocampus following exposure to surgery and is enhanced by MS275. Subsequently, HDAC protein expression was measured by Western blotting (Fig. 3B). Consistent with the mRNA expression levels, HDAC2 protein expression levels were dramatically elevated in the hippocampal tissues from the SS group (F2, 12 = 5.87, P = .017) and significantly attenuated following HDAC inhibition (P < .05). HDAC 1 (F2, 12 = 0.11, P = .898) and HDAC3 (F2, 12 = 0.574, P = .578) were not affected by HDAC inhibition, indicating that HDAC2 may be more sensitive to anesthesia/surgery-induced POCD and HDAC inhibition (Fig. 3C and D, Tukey’s test). To determine the involvement of HDAC activity, we further investigated the effect of MS-275 on HDAC activity. As shown in Fig. 3C, hippocampal HDAC activity was 2.1-fold higher in the SS group than in the control group (F2, 12 = 20.11, P = .001). However, a significant reduction in HDAC activity was observed in MS-275-treated rats compared with vehicle-treated rats (P < .01). These results suggest that the decrease in HDAC activity may have resulted from decreased HDAC2 expression and may increase histone acetylation. Pretreatment of MS-275 inhibited anesthesia/surgeryinduced neuroinflammation

Fig. 2. HDAC messenger RNA (mRNA) expression in the three groups. Data are presented as the mean ± SEM (n = 5 per group). * P < .05 compared with the control group by post hoc Tukey’s test. # P < .05 compared with the SS group by post hoc Tukey’s test. CTL: control group; SS: surgery group; and MS-275: surgery plus MS-275 group.

The mRNA and protein expression levels of a number of key proinflammatory cytokines, i.e., TNF-a and IL-1b, were determined in the hippocampi of rats following surgery, with or without MS-275 treatment. The mRNA expression of TNF-a and IL-1b in the SS group was significantly higher than that in the CTL group (F2, 12 = 111.8, P < .001, Fig. 4A, Tukey’s test). Moreover, a similar trend of an increase in IL-1b mRNA expression was also observed in the SS group (F2, 12 = 76.61, P < .001). However, following MS-275 administration, the mRNA expression levels of the proinflammatory cytokines in the MS-275 group were lower than those in the SS group but not lower than those in the CTL group (P < .001). Western blot analyses were also performed to assess the protein expression levels of IL-1b, and TNF-a (Fig. 4B, Tukey’s test). Anesthesia/surgery-induced trauma

Y. Wu et al. / Neuroscience 417 (2019) 70–80

75

Fig. 4. Effects of MS-275 pretreatment on anesthesia/surgeryinduced NF-jB-P65, IL-1b, TNF-a and PSD95 expression in the hippocampus after surgery. A, Real-time PCR analysis was used to determine the mRNA levels of IL-1b, TNF-a and PSD95 in each group. B, The protein expression levels of NF-jB-P65, IL-1b, TNF-a and PSD95 in the hippocampus were analyzed by Western blotting. Data are presented as the mean ± SEM (n = 5 per group). #P < .05 compared with the SS group, by post hoc Tukey’s test. CTL: control group; SS: surgery group; and MS-275: surgery plus MS-275 group.

significantly alleviated the effects of anesthesia/surgeryinduced trauma (P < .05, respectively). Fig. 3. Pretreatment of MS-275 alleviated the anesthesia/surgeryinduced upregulation of histone acetylation and HDAC2 and HDAC activity in the hippocampus of rats. A, Western blot analysis of histone H3 acetylation (Ac-H3) in the hippocampal tissues from the three experimental groups. B, The protein expression levels of HDAC1, HDAC2 and HDAC3 were determined by Western blot analysis. C, HDAC activity was measured in the hippocampus from different groups. Data are presented as the mean ± SEM (n = 5 per group). *P < .05 compared with the CTL group, by post hoc Tukey’s test. #P < .05 compared with the SS group, by post hoc Tukey’s test. CTL: control group; SS: surgery group; and MS-275: surgery plus MS-275 group.

significantly upregulated the expression of TNF-a (F2, 12 = 24.97, P < .001) and IL-1b (F2, 12 = 43.96, P < .001) in the hippocampus, while MS-275 treatment

Pretreatment with MS-275 increased the levels of PSD95 in the hippocampus PSD95 is a marker of synapses in the hippocampus and is closely related to learning and memory (Wang et al., 2017); therefore, we determined the effects of surgery on the mRNA and protein expression levels of PSD95 in the hippocampus of rats. As we expected, anesthesia/surgery decreased the mRNA (F2, 12 = 53.07, P < .001) and protein (F2, 12 = 41.47, P < .001) expression of PSD95 in the hippocampus in the control group (Fig. 4A and B, Tukey’s test). Importantly, the inhibited expression levels of PSD95 in the control group were attenuated by the HDAC inhibitor (P < .05).

76

Y. Wu et al. / Neuroscience 417 (2019) 70–80

MS-275 inhibited anesthesia/surgery-induced NF-jBp65 protein expression and nuclear accumulation Western blot analysis revealed distinctly higher levels of NF-jB-p65 protein expression in the hippocampal tissue of the SS group than in that of the CTL group; lower levels were observed in MS-275-treated rats than in rats in the SS group (F2, 12 = 31.15, P < .001) (Fig. 4B, Tukey’s test). A transcription factor binding assay ELISA kit was used to measure the NF-jB-p65 DNA-binding activity. A significant reduction in NF-jB-p65 DNA-binding activity was observed in the MS-275 group when compared to that in the SS group (F2, 12 = 27.34, P < .001) (Fig. 5A, Tukey’s test). To confirm the inhibitory effect of MS-275 on NF-jBp65 nuclear accumulation, the distribution profile of

acetylated NF-jB within the nucleus and cytoplasm was assessed with Co-IP. There was little acetylated NF-jB in either the nucleus or cytoplasm of the CTL group. Anesthesia/surgery increased acetylated NF-jB localization in the nucleus. There was less acetylated NF-jB-p65 in the nuclear fraction than in the cytoplasmic fraction when the rats were treated with MS-275 (F2, 12 = 16.7, P = .0003), which is in line with the results obtained from the NF-jB ELISA study showing that MS-275 treatment significantly reduced NF-jB-p65 nuclear accumulation. The effects of HDAC inhibitors on acetylated NF-jB-p65 localization in the hippocampus are shown in Fig. 5B. Taken together, these results indicate that MS-275 attenuates NF-jB-p65 expression, acetylation and transcriptional activity. MS-275 decreased the expression of Iba-1 in the hippocampus following anesthesia/surgery Microglial activation is a key factor in hippocampal neuroinflammation associated with POCD (Lu et al., 2019). Morphological changes of microglia were studied by immunofluorescence staining for the activated microglia/macrophage marker Iba-1. The hippocampal expression of Iba-1 in SS group rats was higher than that in control group rats at 24 h after surgery (F2, 24 = 15.21, P < .001, Fig. 6E and F, Tukey’s test). Additionally, rats pretreated with MS-275 before surgery/anesthesia exhibited lower Iba-1 expression than SS group rats at 24 h after surgery. Collectively, these findings demonstrate that administration of MS-275 suppresses hippocampal inflammation in mice with POCD. Pretreatment with MS-275 alleviated neuronal damage in rats exposed to anesthesia/surgeryinduced trauma As shown in Fig. 6, Nissl staining was used to assess neuron loss in the hippocampus. The reduction in the number of neurons was notable in the rats from the SS group after anesthesia/surgery-induced trauma (F2, 72 = 150.8, P < .001, Fig. 6A and B, Tukey’s test). In contrast, pretreatment with MS-275 rescued the neuronal damage in the CA1, as shown by more blue-stained Nissl bodies (P < .001). NeuN immunohistochemistry was performed to confirm the results of Nissl staining. Similarly, a significantly lower number of NeuN-positive cells was observed in the CA1 of the hippocampus from the SS group (F2, 42 = 8.035, P = .0011), but this reduction in NeuN-positive cells was reversed by pretreatment with MS-275 (Fig. 6C and D, P < .001, Tukey’s test).

Fig. 5. MS-275 inhibited NF-jB-p65 activity and NF-jB-p65 acetylation status in the hippocampus. A, NF-jB-p65 activity was measured in the hippocampus from different groups. B, The distribution profile of acetylated NF-jB-p65 (Ac-p65) between nuclei and cytoplasm was visualized by Western blotting. Data are presented as the mean ± SEM (n = 5 per group). *P < .05 compared with the CTL group, by post hoc Tukey’s test. #P < .05 compared with the SS group, by post hoc Tukey’s test. CTL: control group; SS: surgery group; and MS-275: surgery plus MS-275 group.

DISCUSSION In this study, we evaluated the effect of MS-275, an HDAC inhibitor, on POCD in rats. This study showed that anesthesia/surgery induced hippocampusdependent cognitive dysfunction, as evidenced by postoperative spatial learning and memory impairments,

Y. Wu et al. / Neuroscience 417 (2019) 70–80

77

that was related to a decrease in the number of neurons and activated microglia/macrophages in the hippocampal CA1 area. We demonstrated that MS-275 reduced the cognitive deficits caused by surgery. Furthermore, we showed that HDACs played pivotal roles in the neuroinflammation of POCD. Specifically, HDAC2 expression was positively correlated with neuroinflammation after surgery, and MS-275 pretreatment inhibited HDAC2 upregulation and neuroinflammation. Previous studies have shown that HDAC2 inhibition enhances cognition in animal models (Guan et al., 2009; Mungenast and Tsai, 2012). Therefore, these findings are the first to demonstrate that HDAC2 inhibition reduces cognitive dysfunction through downregulating neuroinflammation in rats following surgery. Currently, POCD is one of the most common complications after surgery, and there are few therapeutic options available to prevent it. Emerging data have demonstrated that the hippocampus plays a specific and fundamental role in learning, memory and cognition. Damage to the hippocampus can result in cognitive and behavioral impairment. Exposure to surgical stress can have long-term effects on the structure and function of the hippocampus. Neuroinflammation has been considered the main mechanism involved in the pathogenesis of POCD (Qian et al., 2015; Tian et al., 2015; Feng et al., 2017). Studies have shown that anesthesia/surgery-induced trauma promotes the activation of the inflammatory NFjB signaling pathway, IL-1b and TNF-a in the hippocampus (Kong et al., 2017), and these changes have been considered the main mechanism involved in the development of POCD (Feng et al., 2017). Currently, several HDAC inhibitors are amidst various clinical trials for the treatment of neurological diseases, including Alzheimer’s disease, dementia, and stroke (Ganai et al., 2016; Park and Sohrabji, 2016). The enhancement of acetylation levels by inhibiting HDACs serves to improve long-term memory (Duan et al., 2016). Recent data have demonstrated that HDAC inhibitors have promising anti-inflammatory properties. Thus, HDAC inhibitors may have neuroprotective potential in rats following surgery through their anti-inflammatory effects, acting as a key regulator in POCD. Based on previous results, we hypothesized that MS275 may provide a pharmacological strategy to prevent

3 Fig. 6. Effects of MS-275 pretreatment on hippocampal CA1 neurons. A, Representative Nissl staining in the hippocampal CA1 subfield. Scale bar = 100 lm. B, The population of intact cells in the hippocampal CA1 subfield was counted as shown. C, Photographs of brain sections showing the distribution of NeuN immunostaining in the hippocampus. Scale bar = 100 lm. D, Quantification of NeuNimmunopositive neurons in the hippocampal CA1 region. E, Representative immunohistochemistry images of microglia in areas CA1 of the hippocampus based on staining with an anti-Iba1 antibody. Scale bar = 25 lm. F, Quantification of Iba1-positive cells in the CA1 area of the hippocampus. Data are presented as the mean ± SEM. (n = 5 per group). #P < .05 compared with the SS group, by post hoc Tukey’s test. Scale bar = 100 lm. CTL: control group; SS: surgery group; and MS-275: surgery plus MS-275 group.

78

Y. Wu et al. / Neuroscience 417 (2019) 70–80

POCD. To determine the effect of MS-275 on cognitive dysfunction after laparotomy, we used the MWM, one of the most widely used behavioral tests for studying spatial learning and memory in rodents, to evaluate cognitive function. Similar to previous investigations, surgery in rats leads to significant deficits in spatial memory, which is dependent on the hippocampus. However, those deficits could be clearly reversed by MS-275 pretreatment. The effect of HDAC inhibition on the attenuation of cognition dysfunction remains unclear. According to previous research, the activation of neuroinflammation induced by surgery could decrease brain activity and cause symptoms of cognitive impairment (Chen et al., 2018). To investigate the potential mechanisms of how MS-275 improves learning and memory, we focused our biochemical analyses on neuroinflammation in the hippocampus. NF-jB appears to play a critical role in cytokine-mediated inflammation, and overexpression of inflammatory cytokines in the brain is associated with cognitive dysfunction (Zheng et al., 2017). Therefore, a reasonable conclusion is that the operation performed in this study increased the expression of NF-jB-p65, IL-1b and TNF-a. In the present study, the levels of inflammatory factors were significantly decreased by using MS-275, suggesting that the expression of these inflammatory cytokines was indeed correlated with HDAC activity. In addition, recent research has confirmed that HDAC inhibitors enhance NF-jB-p65 acetylation and regulate the NF-jB signaling pathway, thereby likely contributing to the anti-inflammatory capacities (Liang et al., 2017; Jiao et al., 2018; Tan et al., 2018). NF-jB-p65 acetylation plays a crucial role in the regulation of NF-jB-mediated genes. Some studies have shown that suberoylanilide hydroxamic acid (SAHA), a systemic HDAC inhibitor, subsequently activates the NF-jB pro-survival pathway, particularly through p65 acetylation (K310). This neuroprotective effect was reproduced in mice treated with MS-275 and resveratrol, indicating that HDAC inhibitors increase NF-jB-p65 acetylation and exhibit protective effects on animal models by activating NF-jB target gene pathways (Lanzillotta et al., 2013; Layman et al., 2015). Other studies have implied that the HDAC2 inhibitor CAY10683 promotes anti-inflammatory effects through attenuating the Toll-like receptor 4 (TLR4)/NF-jB pathway and that the HDAC3 special inhibitor RGFP966 significantly reduces the transcriptional activity of NF-jBp65, whereas NF-jB-p65 acetylation and localization remain unaltered (Leus et al., 2016; Kumar et al., 2017). Our study indicates that anesthesia/surgery increases the expression of NF-jB signaling pathway genes associated with nuclear accumulation of acetylated NF-jB-p65 at the Lysine 310. However, the increase in p65 acetylation, at other lysine residues, by MS-275 can induce the nuclear export of NF-jB-p65 into the cytoplasm, and decrease IL-1b and TNF-a expression.. Another study supports our findings showing that MS-275 and SAHA effectively inhibit HDACs and enhance the acetylation of NF-jB-p65, which can then be exported to the cytoplasm and become inactivated (Choo et al., 2010).

A study showed that histone acetylation and memory formation ability were reduced in HDAC2overexpressing mice (Guan et al., 2009). We found that HDAC2 mRNA expression was increased in the anesthesia/surgery group. MS-275 reduced HDAC2 expression in the surgery group and facilitated the recovery from anesthesia/surgery-induced cognitive dysfunction in rats. These findings clearly indicate that increased expression and activity of HDAC2 may account for the POCDdependent neuroinflammation and subsequent changes in hippocampus-dependent cognitive ability. Next, we found that anesthesia/surgery decreased the levels of the synaptic marker PSD-95 and increased the activated microglia in the hippocampus of rats. Recent findings have indicated that anesthesia/surgery may affect cognitive function and synaptic marker levels in the rat hippocampus (Jia et al., 2015; Zhang et al., 2017), which is in line with our findings. Taken together, the findings that MS-275 prevented anesthesia/surgery-induced cognitive impairment and reduced hippocampal levels of synaptic markers in rats could be explained by HDAC2 activity inducing neuroinflammation in POCD and the levels of hippocampal synaptic markers following surgery. The present study has several limitations. We did not use a specific HDAC2 inhibitor, which could be responsible for the differences observed in rats following the surgery. Hence, we will use the established system to perform further studies in the future. In conclusion, we found that abdominal surgery under sevoflurane anesthesia induced hippocampusdependent cognitive impairment through activating neuroinflammation and reducing hippocampal levels of synaptic markers in rats. Moreover, enhanced expression and activation of HDAC2 in the hippocampus may contribute to the development of POCD. Such findings should guide our development of better surgical treatment options for POCD patients, ultimately leading to the development of treatment and prevention strategies for POCD.

ACKNOWLEDGMENTS We thank the central laboratory and laboratory animal center, Renmin Hospital of Wuhan University, for their support.

FUNDING This study was supported by grants from the National Natural Science Foundation of China (81471844), the Fundamental Research Funds for the Central Universities (2042019kf0061) and a fund administered by Renmin Hospital of Wuhan University (RMYD2018M03).

DECLARATION OF COMPETING INTEREST The authors declare no conflicts of interest.

Y. Wu et al. / Neuroscience 417 (2019) 70–80

REFERENCES Afshar S, Shahidi S, Rohani AH, Komaki A, Asl SS (2018) The effect of NAD-299 and TCB-2 on learning and memory, hippocampal BDNF levels and amyloid plaques in Streptozotocin-induced memory deficits in male rats. Psychopharmacology (Berl) 235:2809–2822. Ashburner BP, Westerheide SD, Baldwin AJ (2001) The p65 (RelA) subunit of NF-kappaB interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression. Mol Cell Biol 21:7065–7077. Cao M, Fang J, Wang X, Wang Y, Duan K, Ye F, Ouyang W, Tong J (2018) Activation of AMP-activated protein kinase (AMPK) aggravated postoperative cognitive dysfunction and pathogenesis in aged rats. Brain Res 1684:21–29. Chen S, Ye J, Chen X, Shi J, Wu W, Lin W, Lin W, Li Y, et al. (2018) Valproic acid attenuates traumatic spinal cord injury-induced inflammation via STAT1 and NF-kappaB pathway dependent of HDAC3. J Neuroinflammation 15:150. Choo QY, Ho PC, Tanaka Y, Lin HS (2010) Histone deacetylase inhibitors MS-275 and SAHA induced growth arrest and suppressed lipopolysaccharide-stimulated NF-kappaB p65 nuclear accumulation in human rheumatoid arthritis synovial fibroblastic E11 cells. Rheumatology (Oxford) 49:1447–1460. Duan R, Liu X, Wang T, Wu L, Gao X, Zhang Z (2016) Histone acetylation regulation in sleep deprivation-induced spatial memory impairment. Neurochem Res 41:2223–2232. Feng P, Deng P, Liu L, Ai Q, Yin J, Liu Z, Wang G (2017) Electroacupuncture alleviates postoperative cognitive dysfunction in aged rats by inhibiting hippocampal Neuroinflammation activated via microglia/TLRs pathway. EVID-BASED COMPL ALT 2017:1–10. Ganai SA, Ramadoss M, Mahadevan V (2016) Histone deacetylase (HDAC) inhibitors - emerging roles in neuronal memory, learning, synaptic plasticity and neural regeneration. Curr Neuropharmacol 14:55–71. Gu JX, Cheng XJ, Luo X, Yang X, Pang YP, Zhang XF, Zhang YY, Liu Y (2018) Luteolin ameliorates cognitive impairments by suppressing the expression of inflammatory cytokines and enhancing synapse-associated proteins GAP-43 and SYN levels in Streptozotocin-induced diabetic rats. Neurochem Res 43:1905–1913. Guan JS, Haggarty SJ, Giacometti E, Dannenberg JH, Joseph N, Gao J, Nieland TJ, Zhou Y, et al. (2009) HDAC2 negatively regulates memory formation and synaptic plasticity. NATURE 459:55–60. Hou J, Shen Q, Wan X, Zhao B, Wu Y, Xia Z (2019) REM sleep deprivation-induced circadian clock gene abnormalities participate in hippocampal-dependent memory impairment by enhancing inflammation in rats undergoing sevoflurane inhalation. Behav Brain Res 364:167–176. Hovens IB, Schoemaker RG, van der Zee EA, Absalom AR, Heineman E, van Leeuwen BL (2014) Postoperative cognitive dysfunction: involvement of neuroinflammation and neuronal functioning. Brain Behav Immun 38:202–210. Hsing CH, Hung SK, Chen YC, Wei TS, Sun DP, Wang JJ, Yeh CH (2015) Histone deacetylase inhibitor Trichostatin a ameliorated endotoxin-induced Neuroinflammation and cognitive dysfunction. Mediators Inflamm 2015:163140. Jia M, Liu WX, Sun HL, Chang YQ, Yang JJ, Ji MH, Yang JJ, Feng CZ (2015) Suberoylanilide hydroxamic acid, a histone deacetylase inhibitor, attenuates postoperative cognitive dysfunction in aging mice. FRONT MOL NEUROSCI 8:52. Jiao FZ, Wang Y, Zhang HY, Zhang WB, Wang LW, Gong ZJ (2018) Histone deacetylase 2 inhibitor CAY10683 alleviates lipopolysaccharide induced Neuroinflammation through attenuating TLR4/NF-kappaB signaling pathway. Neurochem Res 43:1161–1170. Kong Z, Chen X, Hua H, Liang L, Liu L (2017) The Oral pretreatment of glycyrrhizin prevents surgery-induced cognitive impairment in aged mice by reducing Neuroinflammation and Alzheimer’s-

79

related pathology via HMGB1 inhibition. J Mol Neurosci 63:385–395. Kumar P, Gogulamudi VR, Periasamy R, Raghavaraju G, Subramanian U, Pandey KN (2017) Inhibition of HDAC enhances STAT acetylation, blocks NF-kappaB, and suppresses the renal inflammation and fibrosis in Npr1 haplotype male mice. Am J Physiol Renal Physiol 313: F781–F795. Lanzillotta A, Pignataro G, Branca C, Cuomo O, Sarnico I, Benarese M, Annunziato L, Spano P, et al. (2013) Targeted acetylation of NF-kappaB/RelA and histones by epigenetic drugs reduces postischemic brain injury in mice with an extended therapeutic window. Neurobiol Dis 49:177–189. Layman WS, Williams DM, Dearman JA, Sauceda MA, Zuo J (2015) Histone deacetylase inhibition protects hearing against acute ototoxicity by activating the Nf-kappaB pathway. Cell Death Discov 1. Leus NG, van den Bosch T, van der Wouden PE, Krist K, Ourailidou ME, Eleftheriadis N, Kistemaker LE, Bos S, et al.(2017) HDAC1-3 inhibitor MS-275 enhances IL10 expression in RAW264.7 macrophages and reduces cigarette smoke-induced airway inflammation in mice. Sci rep 7:45047. Leus NG, van der Wouden PE, van den Bosch T, Hooghiemstra W, Ourailidou ME, Kistemaker LE, Bischoff R, Gosens R, et al. (2016) HDAC 3-selective inhibitor RGFP966 demonstrates antiinflammatory properties in RAW 264.7 macrophages and mouse precision-cut lung slices by attenuating NF-kappaB p65 transcriptional activity. Biochem Pharmacol 108:58–74. Li Z, Ni C, Xia C, Jaw J, Wang Y, Cao Y, Xu M, Guo X (2017) Calcineurin/nuclear factor-kappaB signaling mediates isofluraneinduced hippocampal neuroinflammation and subsequent cognitive impairment in aged rats. Mol Med Rep 15:201–209. Liang L, Ma Z, Dong M, Ma J, Jiang A, Sun X (2017) Protective effects of salidroside against isoflurane-induced cognitive impairment in rats. Hum Exp Toxicol 36:1295–1302. Lin YH, Dong J, Tang Y, Ni HY, Zhang Y, Su P, Liang HY, Yao MC, et al. (2017) Opening a new time window for treatment of stroke by targeting HDAC2. J Neurosci 37:6712–6728. Liu Y, Pan N, Ma Y, Zhang S, Guo W, Li H, Zhou J, Liu G, et al. (2013) Inhaled sevoflurane may promote progression of amnestic mild cognitive impairment: a prospective, randomized parallelgroup study. Am J Med Sci 345:355–360. Lu Y, Xu X, Dong R, Sun L, Chen L, Zhang Z, Peng M (2019) MicroRNA-181b-5p attenuates early postoperative cognitive dysfunction by suppressing hippocampal neuroinflammation in mice. CYTOKINE 120:41–53. Mungenast AE, Tsai LH (2012) Cognitive function in health and disease: the role of epigenetic mechanisms. Neurodegener Dis 10:191–194. Park MJ, Sohrabji F (2016) The histone deacetylase inhibitor, sodium butyrate, exhibits neuroprotective effects for ischemic stroke in middle-aged female rats. J Neuroinflammation 13:300. Qian X, Zhang W, Liu M, Zhou Y, Zhang J, Han L, Peng Y, Jiang J, et al. (2015) Dexmedetomidine improves early postoperative cognitive dysfunction in aged mice. Eur J Pharmacol 746:206–212. Riedel B, Browne K, Silbert B (2014) Cerebral protection: inflammation, endothelial dysfunction, and postoperative cognitive dysfunction. Curr Opin Anaesthesiol 27:89–97. Simonini MV, Camargo LM, Dong E, Maloku E, Veldic M, Costa E, Guidotti A (2006) The benzamide MS-275 is a potent, long-lasting brain region-selective inhibitor of histone deacetylases. Proc Natl Acad Sci U S A 103:1587–1592. Tan Y, Delvaux E, Nolz J, Coleman PD, Chen S, Mastroeni D (2018) Upregulation of histone deacetylase 2 in laser capture nigral microglia in Parkinson’s disease. Neurobiol Aging 68:134–141. Tian A, Ma H, Zhang R, Tan W, Wang X, Wu B, Wang J, Wan C (2015) Interleukin17A promotes postoperative cognitive dysfunction by triggering b-amyloid accumulation via the transforming growth factor-b (TGFb)/Smad signaling pathway. PLOS ONE 10 e141596.

80

Y. Wu et al. / Neuroscience 417 (2019) 70–80

Vargas-Lopez V, Lamprea MR, Munera A.(2016) Histone deacetylase inhibition abolishes stress-induced spatial memory impairment. NEUROBIOL LEARN MEM 134 Pt B:328-338. Wang W, Zhang X, Feng Z, Wang D, Zhang H, Sui B, Zhang Y, Zhao W, et al. (2017) Overexpression of phosphodiesterase-4 subtypes involved in surgery-induced neuroinflammation and cognitive dysfunction in mice. Brain Res Bull 130:274–282. Whittle N, Schmuckermair C, Gunduz CO, Hauschild M, Ferraguti F, Holmes A, Singewald N (2013) Deep brain stimulation, histone deacetylase inhibitors and glutamatergic drugs rescue resistance to fear extinction in a genetic mouse model. NEUROPHARMACOLOGY 64:414–423.

Zhang C, Zhang Y, Shen Y, Zhao G, Xie Z, Dong Y (2017) Anesthesia/surgery induces cognitive impairment in female Alzheimer’s disease transgenic mice. J Alzheimers Dis 57:505–518. Zheng JW, Meng B, Li XY, Lu B, Wu GR, Chen JP (2017) NFkappaB/P65 signaling pathway: a potential therapeutic target in postoperative cognitive dysfunction after sevoflurane anesthesia. Eur Rev Med Pharmacol Sci 21:394–407. Zhu J, Wu Y, Guo Y, Tang Q, Lu T, Cai W, Huang H (2016) Choline alleviates parenteral nutrition-associated duodenal motility disorder in infant rats. JPEN J Parenter Enteral Nutr 40:995–1005.

(Received 28 November 2018, Accepted 10 August 2019) (Available online 17 August 2019)