- Email: [email protected]
Histone deacetylase inhibitors mediate post-transcriptional regulation of p21WAF1 through novel cis-acting elements in the 3′ untranslated region
Biochemical and Biophysical Research Communications 402 (2010) 687–692
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Histone deacetylase inhibitors mediate post-transcriptional regulation of p21WAF1 through novel cis-acting elements in the 30 untranslated region Calley L. Hirsch a,⇑, Danielle J.P. Ellis a, Keith Bonham b a
Department of Biochemistry, University of Saskatchewan, Saskatoon, SK, Canada S7N 5E5 Cancer Research Unit, Health Research Division, Saskatchewan Cancer Agency, and Division of Oncology, College of Medicine, University of Saskatchewan, 20 Campus Drive, Saskatoon, SK, Canada S7N 4H4
b
a r t i c l e
i n f o
Article history: Received 18 October 2010 Available online 25 October 2010 Keywords: Histone deacetylase inhibitors p21WAF1 mRNA stability 30 untranslated region
a b s t r a c t Histone deacetylase inhibitors (HDACIs) are promising anti-tumor agents that selectively induce cell cycle arrest, differentiation and/or apoptosis of tumor cells. Fundamentally, HDACIs are proposed to function by activating the transcription of genes, including the potent cyclin dependent kinase inhibitor p21WAF1. However, HDACIs primarily increase p21WAF1 expression at the post-transcriptional level in HepG2 cells, implying that these anti-tumor agents regulate genes at multiple levels. Here, two novel cis-acting elements in the 30 untranslated region (UTR) of p21WAF1 are identified that control the ability of HDACIs to induce p21WAF1 mRNA stabilization. Collectively, these studies highlight the complexity of HDACIs in gene regulation. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Histone deacetylase inhibitors (HDACIs) are a promising class of chemo-therapeutic agents that specifically induce tumor cell cycle arrest, differentiation, senescence, apoptosis and host immune response while also hindering angiogenesis [1]. Given their anti-cancer potential, HDACIs have been extensively studied in clinical trials, and in 2006 led to the approval of Vorinostat for the treatment of cutaneous T-cell lymphoma [2]. Initially, HDACIs were largely proposed to carry out their therapeutic functions by stimulating gene transcription. However, numerous studies have now shown that HDACIs more exclusively alter the expression of between 2% and 10% of genes and that an equivalent proportion of genes are up-regulated and down-regulated by HDACIs, suggesting that additional mechanisms must be responsible for HDACI mediated effects [3–5]. p21WAF1 is a cyclin dependent kinase inhibitor, whose over expression promotes cell cycle arrest and is a well established target of HDACIs [6]. Up-regulation of p21WAF1 is a central characteristic of HDACI exposure and a fundamental requirement for G1 growth arrest in human colon cancer and monocytic leukemia cells treated with the HDACI butyrate [7,8]. HDACIs, including butyrate and trichostatin A (TSA), enhance histone H3 and H4 acetylation levels at the p21WAF1 gene to activate transcription in a p53-inde⇑ Corresponding author. Present address: University of Texas MD Anderson Cancer Center, 1515 Holcombe Blvd, Houston, TX 77030, USA. Fax: +1 713 834 6273. E-mail addresses: [email protected] (C.L. Hirsch), Keith.Bonham@ saskcancer.ca (K. Bonham). 0006-291X/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2010.10.085
pendent manner [9,10]. However, histone hyperacetylation may not solely explain the ability of HDACIs to up-regulate p21WAF1 expression. We previously reported that butyrate and TSA do not activate p21WAF1 gene transcription, but enhance p21WAF1 levels post-transcriptionally, via a mechanism that requires de novo protein synthesis in the hepatocellular carcinoma cells, HepG2 [11]. Post-transcriptional mechanisms are an important contributor to p21WAF1gene regulation, as multiple agents have been shown to increase the mRNA stability of this gene, including the retinoid CD437 [12], tumor necrosis factor alpha [13], phorbol 12-myristate 13-acetate [14], phenylephrine [15], UV light irradiation [16], epidermal growth factor [17], and Prostaglandin A2 [18]. The p21WAF1 30 untranslated region (UTR) contains cis-acting elements that mediate mRNA stability by interacting with various RNA binding proteins. Three destabilizing AU-rich elements (AREs) and a U-rich HuD element are located within the first 250 nucleotides of the p21WAF1 30 UTR that interact with AUF1, RNA-binding region-containing protein 1 (RNPC1) and members of the ELAV family, including HuD and HuR [19–21]. Furthermore, the steady state of p21WAF1 is also regulated by a-globin poly(C) binding proteins (a-CP1, a-CP2), and RNPC1 binding to less characterized elements in the p21WAF1 30 UTR [22,23]. Exposure to UV irradiation and Prostaglandin A2 triggers the interaction between cytoplasmic HuR and AREs in the p21WAF1 30 UTR, enhancing mRNA stability [16,18,20]. Whereas uncharacterized elements downstream of the first 250 nucleotides in the 30 UTR mediate the enhancement of p21WAF1 mRNA levels in the presence of EGF [17]. Here we investigate whether HDACIs similarly mediate post-transcriptional regulation of p21WAF1 via distinct elements in the 30 UTR.
688
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
2. Materials and methods 2.1. Cell culture HepG2 hepatocellular carcinoma cells were grown in Dulbecco’s modified Eagle’s medium and Ham’s F-12 (DMEM-F12) medium (Gibco), supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin at 5% CO2 and 37 °C. 2.2. Plasmid construction for the p21WAF1 30 UTR deletions Generation of the 210WAF CAT reporter vector has been described previously [24]. Fragments of the p21WAF1 30 UTR were PCR amplified from the pCEP-WAF1 cDNA expression vector with primers bearing XbaI restriction sites. The XbaI restriction digested p21WAF1 30 UTR fragments were cloned into the 210WAF CAT vector between the CAT gene and the SV40 late poly(A) region. The primers used to generate the 210WAF1 CAT + p21WAF1 30 UTR (591–2079) vector were: FWD p21WAF1 30 UTR 591 – 50 GGAAGTCTAGAGTCCTGGAAG 30 , and REV p21WAF1 30 UTR 2079 – 50 CGTTTCT AGAGC ACCTGCTG 30 . The following plasmids were generated in a similar manner: 210WAF1 CAT + p21WAF1 30 UTR (712–2079), (788–2079), (840–2079), (591–840), (932–2079), (1045–2079), (1173–2079), (1272–2079), (840–1470), (591–1979), (591–1885), (591–1777), (591–2064), (591–2031), (591–2000) and (1467–2079). All primer sequences are available upon request. 2.3. Plasmid construction for the p21WAF1 30 UTR mutants The p21WAF1 30 UTR mutants was created by performing two mutagenesis reactions. First, the XbaI restriction site between the CAT gene and the p21WAF1 30 UTR was removed from the 210WAF1 CAT p21WAF1 30 UTR (591–2079) vector using the primers: sXbaIdestroy – 50 GCGGGGCGTAATCTGCAGTCCTGGAAGCGCG 30 and aXbaIdestroy – 50 CGCGCTTCCAGGACTGCAGATTACGCCCC GC 30 . Second, an EcoRV restriction site was created at position 1991 of the p21WAF1 30 UTR with the respective primers: sEcoRVcreate – 50 CTCCACCTAGACTGATATCCTCTCGAGGGCAGG 30 and aEcoRVcreate – 50 CCTGCCCTCGAGAGGATATCAGTCTAGGTG GAG 30 . The resulting 210WAF1 CAT + p21WAF1 30 UTR (591–2079) –XbaI/+EcoRV plasmid was used as the parental vector for construction of the 210WAF1 CAT + p21WAF1 30 UTR mutant vectors. All 16 mutants were created by inserting complementary annealed mutant oligonucleotides from 1997–2077 of the p21WAF1 30 UTR. Each mutant oligonucleotide pair contained five consecutive base pair mutations, beginning at position 2000 of the p21WAF1 30 UTR, where pyrimidines were replaced with pyrimidines (C to T, or T to C) and purines for purines (A to G, G to A). Mutant 16 was the exception, where only two base pairs were mutated at 2076 and 2077 of the p21WAF1 30 UTR. The mutant oligonucleotide sequences are available upon request.
mRNA stability. Our previous studies indicate that HDACIs do not transcriptionally activate the minimal p21WAF1 (210WAF1) promoter, but that new protein synthesis is required for HDACIs to increase the steady state mRNA levels of p21WAF1 in HepG2 cells [11]. This suggests that cis-acting elements in the p21WAF1 30 UTR may contribute to stabilizing the mRNA. To examine the role of the p21WAF1 30 UTR in HDACI mediated post-transcriptional regulation, the full length p21WAF1 30 UTR (591–2079) was cloned into the 210WAF1 CAT plasmid (Fig. 1A). Transient transfections were performed in HepG2 cells with the 210WAF1 CAT or 210WAF1 CAT + p21WAF1 30 UTR plasmids in the absence and presence of the HDACIs, NaB and TSA. As predicted, the inclusion of the p21WAF1 30 UTR had a marked destabilizing effect. In addition, the CAT activity of cells transfected with the 210WAF1 CAT + p21WAF1 30 UTR plasmid was up-regulated 6.9-fold by TSA and 11.7-fold by NaB, while only a minimal increase in CAT activity was detectable after HDACI exposure in cells transfected with the 210WAF1 CAT vector lacking the p21WAF1 30 UTR (Fig. 1A). To ensure that the context of the 210WAF1 promoter did not indirectly affect these results, the p21WAF1 30 UTR was also tested in the SV40 driven pCAT3 promoter vector (Supplementary Fig. 1). Similar to our initial observations, neither TSA nor NaB could activate the pCAT3 promoter vector. However, the presence of the p21WAF1 30 UTR increased HDACI responsiveness in HepG2 cells. Taken together, these observations indicate that the p21WAF1 30 UTR functions in HDACI mediated stabilization of p21WAF1 mRNA levels. 3.2. The proximal p21WAF1 30 UTR Well established destabilizing elements reside in the proximal 250 nucleotides of the p21WAF1 30 UTR. A series of deletions were made within the 591–840 region of the 30 UTR to determine if the HuD element or AREs contribute to HDACI mediated mRNA stabilization of p21WAF1 (Fig. 1B). The p21WAF1 30 UTR deletions were cloned into the 210WAF1 CAT plasmid and transient transfections were performed in HepG2 cells. Interestingly, the basal CAT activity of the p21WAF1 30 UTR deletions lacking the HuD site and/or the AREs were massively destabilized compared to the 210WAF1 CAT + p21WAF1 (591–840) (Fig. 1C). In addition, the ability of TSA and NaB to mediate p21WAF1 mRNA stability was examined (Fig. 1D). Deletion of neither the HuD element or AREs prevented HDACIs from stabilizing the mRNA, however, HDACIs failed to stabilize the 210WAF1 CAT + p21WAF1 30 UTR (591– 840) vector. This suggests that nucleotides 841–2079 of the p21WAF1 30 UTR contain a powerful destabilizing element, as well as a cis-acting element that is required to mediate HDACI stabilization of p21WAF1 mRNA levels. 3.3. The internal p21WAF1 30 UTR
2.4. Transient transfections and CAT assays HepG2 cells were seeded at 2.5 105 cells on 35 mm tissue culture plates. After 24 h the cells were transfected with a mixture containing: 1.0 lg of CAT reporter plasmid, 1.0 lg of CMV b-Gal, 2.0 lg pBlue, 85 lL of serum free DMEM media and 10 lL of the SuperFect Transfection Reagent (Qiagen). The procedures for transient transfections and CAT assays have been described previously [5]. 3. Results 3.1. The role of the p21WAF1 30 UTR in HDACI mediated mRNA stabilization Key cis-acting elements in the p21WAF1 30 UTR and their interaction with RNA binding proteins have been shown to regulate
To elucidate the element required for increasing the steady state of p21WAF1 in the presence HDACIs, another set of four p21WAF1 30 UTR deletion plasmids were created lacking nucleotides between 591 and 1272 of the 30 UTR (Supplementary Fig. 2). After HepG2 transfections, a clear increase in 210WAF1 CAT + p21WAF1 30 UTR (1272–2079) basal CAT levels was observed compared to 210WAF1 CAT + p21WAF1 30 UTR (932–2079) CAT activity (Fig. 2A). Furthermore, HDACIs were progressively impaired in their ability to stabilize p21WAF1 mRNA, as the nucleotides between 932 and 1272 were deleted from the p21WAF1 30 UTR (Fig. 2B). These data suggest that an instability element and HDACI responsive element resides between 932 and 1272 of the p21WAF1 30 UTR. However, when a 210WAF1 CAT vector bearing only nucleotides 840–1470 of the p21WAF1 30 UTR was transfected into HepG2 cells, basal CAT levels remained elevated and HDACI mediated mRNA
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
689
Fig. 1. The p21WAF1 30 UTR functions in HDACI mediated mRNA stabilization. (A) An illustration of the 210WAF1 CAT + p21WAF1 30 UTR (591–2079) vector is shown. The empty 210WAF1 CAT and 210WAF1 CAT + p21WAF1 30 UTR (591–2079) vectors were transfected into HepG2 cells and treated with TSA (1.0 lM) or NaB (5 mM). The CAT levels relative to the untreated 210WAF1 CAT vector are displayed. (B) The proximal 210WAF1 CAT + p21WAF1 30 UTR deletion plasmids. (C) HepG2 cells were transiently transfected and the basal CAT levels of the proximal deletion plasmids relative to the 210WAF1 CAT are graphed. (D) The CAT levels after TSA and NaB treatment are represented as fold induction relative to untreated transfected cells. The results represent two independent experiments performed in duplicate. The standard deviations are included as error bars.
stabilization was not restored upon treatment with either TSA or NaB. This implies that another instability element resides between nucleotides 1272 and 2079 of the p21WAF1 30 UTR and that the HDACI responsive element within the region 932–1272 may cooperate with other cis-acting elements to effectively stabilize p21WAF1 mRNA levels. 3.4. The terminal p21WAF1 30 UTR To search for additional cis-acting instability determinants and HDACI responsive elements within the p21WAF1 30 UTR, a group of vectors were produced with deletions made to the terminal portion of the 30 UTR. The first three plasmids created were: 210WAF1 CAT + p21WAF1 30 UTR (591–1979), 210WAF1 CAT + p21WAF1 30 UTR (591–1885) and 210WAF1 CAT + p21WAF1 30 UTR (591–1777) (Supplementary Fig. 3A). Upon transfection into HepG2 cells, each of these plasmids had basal CAT levels well above the full length 210WAF1 CAT + p21WAF1 30 UTR (591– 2079) vector (Supplementary Fig. 3B). Moreover, TSA did not stabilize the mRNA products of these terminal deletion vectors (Supplementary Fig. 3C). Together, these results suggest that a remaining instability and HDACI responsive element resides in the terminal 100 nucleotides of the p21WAF1 30 UTR. Therefore, new p21WAF1 30 UTR vectors were generated with further deletions made to the extreme 100 nucleotides of the 30 UTR, including: 210WAF1
CAT + p21WAF1 30 UTR (591–2063), 210WAF1 CAT + p21WAF1 30 UTR (591–2031) and 210WAF1 CAT + p21WAF1 30 UTR (591–2000) (Supplementary Fig. 4). Transient transfections in HepG2 cells demonstrated that nucleotides 2000–2079 of the p21WAF1 30 UTR likely contain an instability element, as basal CAT levels of cells transfected with the 210WAF1 CAT + p21WAF1 30 UTR (591–2000) vector were 12-fold higher compared to the full length 210WAF1 CAT + p21WAF1 30 UTR (591–2079) plasmid (Fig. 2C). In addition, neither the HDACIs TSA nor NaB had the same ability to enhance CAT levels of the extreme 30 UTR deletions as the full length p21WAF1 30 UTR plasmid (Fig. 2D), suggesting that a second element is present in the terminal portion of the p21WAF1 30 UTR. In agreement with our previous results this terminal element alone was not sufficient to allow HDACI mediated mRNA stabilization, as CAT levels were not elevated in cells transfected with the 210WAF1 CAT + p21WAF1 30 UTR (1467–2079) vector. Therefore, at least two cis-acting sequence determinants, between nucleotides 932–1272 and 2000–2079 contribute to basal p21WAF1 mRNA instability and increased p21WAF1 steady state levels in the presence of HDACIs. To begin further characterization of the terminal HDACI response element in the 30 UTR, 79 nucleotides immediately upstream of the human p21WAF1 poly(A) signal were aligned to the rat and mouse p21WAF1 30 UTR sequences (Fig. 3A). Among these species, a high degree of sequence conservation was observed,
690
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
Fig. 2. The p21WAF 30 UTR contains two cis-acting elements that regulate mRNA stabilization in the absence and presence of HDACIs. (A) HepG2 transfections were performed with 210WAF1 CAT, 210WAF1 CAT + p21WAF1 30 UTR (591–2079) and the internal p21WAF1 30 UTR deletions. The basal CAT levels are displayed relative to the 210WAF1 CAT plasmid. (B) Following HDACI treatment with TSA and NaB the CAT levels of the internal 30 UTR deletions were determined relative to their untreated counterparts. (C) HepG2 cells were transfected with the terminal 30 UTR deletions plasmids and the basal CAT levels were determined in relation to the 210WAF1 CAT vector. (D) The relative fold change in CAT levels of the terminal 30 UTR deletions after TSA and NaB exposure is plotted relative to the untreated transfection. A minimum of two independent experiments were performed in duplicate and the averages are represented with standard deviations.
supporting the idea that the nucleotides between 2000 and 2079 of the p21WAF1 30 UTR may mediate mRNA stabilization. To identify the precise HDACI sequence determinant, 16 full length p21WAF1 30 UTR mutants were generated. Five consecutive nucleotides were systematically replaced for each mutant, starting with the 210WAF1 CAT + p21WAF1 30 UTR mutant 1 vector where nucleotides 2001–2005 were mutated (Fig. 3B). HepG2 transient transfections indicated that the 210WAF1 CAT + p21WAF1 30 UTR mutant vectors 1–14 (mut 1–14), had similar basal CAT levels and responses to HDACIs as the wild type (wt) 210WAF1 CAT + p21WAF1 30 UTR (591–2079) vector (Fig. 3C–F). However, the 210WAF1 CAT + p21WAF1 30 UTR mutant 15 and mutant 16 vectors had a 3and 2-fold basal increase in CAT levels, and both TSA and NaB failed to stabilize these mutant mRNA species to the same degree as the wt counterpart (Fig. 3F). Similar results were also observed when the endogenous p21WAF1 poly(A) signal was included in the wt and mutant plasmids (Supplementary Fig. 5). Cumulatively, these data indicate that the p21WAF1 30 UTR contains a terminal instability determinant, between nucleotides 2071 and 2077, that is responsive to HDACIs in HepG2 cells. 4. Discussion Up-regulation of p21WAF1 has been identified as a necessary event for HDACIs to induce cell cycle arrest in human tumor cells [7,8]. HDACIs have been well documented to stimulate p21WAF1 mRNA levels at the transcriptional level [9,10]. However,
we identified that HDACIs also have the ability to increase p21WAF1 expression at the post-transcriptional level [11]. Interestingly, the ability of HDACIs to influence mRNA stability has not been limited to p21WAF1, as DNA methyltransferase-3B (DNMT3B) [29], DNA methyltransferase-1 (DNMT-1) [30], tyrosine kinase receptor ERBB2 [31], claudin-1 [32] and nonsteroidal anti-inflammatory drug-activated gene (NAG-1) [33] display alterations in mRNA stability upon HDACI exposure, suggesting that common mechanisms may control HDACI mediated post-transcriptional regulation. Numerous reports have implicated the p21WAF1 30 UTR in mRNA steady state regulation [12–18]. Here, the importance of the p21WAF1 30 UTR in HDACI mediated mRNA stabilization was studied by linking the p21WAF1 30 UTR to a CAT reporter gene. We identified that inclusion of the p21WAF1 30 UTR has massive destabilizing potential and that the 30 UTR is required for HDACIs to enhance p21WAF1 mRNA stability. Yet, neither the HuD element nor the AREs in the p21WAF1 30 UTR functions in HDACI mediated stabilization of p21WAF1 mRNA levels, but two novel cis-acting elements were identified between nucleotides 932–1272 and 2071– 2079 of the p21WAF1 30 UTR that are required to mediate basal mRNA decay and increase p21WAF1 steady state levels in the presence of HDACIs. [11]. Two observations suggest that the interaction of RNA binding proteins with the p21WAF1 30 UTR may facilitate mRNA stability upon HDACI exposure. First, de novo protein synthesis is required for HDACIs to post-transcriptionally regulate p21WAF1 [11]. Second,
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
691
Fig. 3. Characterization of the p21WAF1 30 UTR terminal cis-acting element. (A) The sequence alignment of the rat (U24174), mouse (U24173) and human (U03106) p21WAF1 30 UTRs upstream of their poly(A) signals. The poly(A) signals are shown in bold. (B) An example of the p21WAF1 30 UTR mutant design, illustrating the 210WAF1 CAT + p21WAF1 30 UTR mutant 1 (mut 1) vector. (C and E) Transient transfections were performed in HepG2 cells with 210WAF1 CAT, 210WAF1 CAT + p21WAF1 30 UTR (591–2079), (581– 2000), or mutants (mut 1–16). The relative fold induction of basal CAT levels was determined. (D and F) The fold induction of CAT levels relative to untreated self following TSA or NaB treatment of the mutant transfected cells. The data are an average of at least two independent experiments performed in duplicate and include standard deviations.
the two cis-acting elements identified in this study regulate both basal p21WAF1 mRNA stability and HDACI responsive stabilization. Interestingly, CP1a and CP2a have been shown to interact with nucleotides 879–1006 of the p21WAF1 30 UTR and RNCP1 associates with nucleotides 879–1512 [22,23]. However, our RNA binding assays were unsuccessful at identifying changes in protein binding after HDACI exposure, to either the 932–1272 or the 2071–2079
cis-acting elements alone. Therefore, both stability determinants within the 30 UTR may cooperate to regulate protein binding in addition to p21WAF1 mRNA stability. miRNAs are important post-transcriptional regulators that bind the 30 UTR of mRNAs, and may also control the mRNA decay rate of p21WAF1 in the absence and presence of HDACIs. HDACIs are known to up-regulate and down-regulate the expression of select miRNAs
692
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
[25,26]. Furthermore, the p21WAF1 30 UTR is the target of several miRNAs, including members of the miRNA-106b family, which interacts with nucleotides 1022–1047 and 1702–1726 of the p21WAF1 30 UTR [27,28]. Of interest, the expression of three members of the miRNA-106b family (miRNA-17, miRNA-20 and miRNA-106a) are reduced by HDACIs [25,26]. Therefore, HDACIs could indirectly up-regulate the steady state of p21WAF1 mRNA levels by decreasing the expression of the miRNA-106b family members. Clearly, the mechanisms surrounding HDACI mediated stabilization of p21WAF1 require further investigation. 5. Conclusions This study highlights the ability of HDACIs to regulate gene expression at the post-transcriptional level and provides evidence that HDACIs enhance p21WAF1 mRNA stability through two novel cis-acting elements in the p21WAF1 30 UTR. Acknowledgments K. Bonham is supported by operating grants from the Canadian Institute of Health Research (CIHR) and the Saskatchewan Cancer Agency. C.L. Hirsch is supported by a CIHR Canada graduate scholarship doctoral award and D.J.P. Ellis is supported by a Natural Sciences and Engineering Research Council of Canada PGSD3 award. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2010.10.085. References [1] A.J. Frew, R.W. Johnstone, J.E. Bolden, Enhancing the apoptotic and therapeutic effects of HDAC inhibitors, Cancer Lett. 280 (2009) 125–133. [2] K. Garber, HDAC inhibitors Overcome first hurdle, Nat. Biotechnol. 25 (2007) 17–19. [3] C. Van Lint, S. Emiliani, E. Verdin, The expression of a small fraction of cellular genes is changed in response to histone hyperacetylation, Gene Expr. 5 (1996) 245–253. [4] J.M. Mariadason, G.A. Corner, L.H. Augenlicht, Genetic reprogramming in pathways of colonic cell maturation induced by short chain fatty acids: comparison with trichostatin A, sulindac, and curcumin and implications for chemoprevention of colon cancer, Cancer Res. 60 (2000) 4561–4572. [5] C.L. Kostyniuk, S.M. Dehm, D. Batten, K. Bonham, The ubiquitous and tissue specific promoters of the human SRC gene are repressed by inhibitors of histone deacetylases, Oncogene 21 (2002) 6340–6347. [6] Y.S. Jung, Y. Qian, X. Chen, Examination of the expanding pathways for the regulation of p21 expression and activity, Cell Signal. 22 (2010) 1003– 1012. [7] S.Y. Archer, S. Meng, A. Shei, R.A. Hodin, p21(WAF1) is required for butyratemediated growth inhibition of human colon cancer cells, Proc. Natl. Acad. Sci. USA 95 (1998) 6791–6796. [8] R.R. Rosato, Z. Wang, R.V. Gopalkrishnan, P.B. Fisher, S. Grant, Evidence of a functional role for the cyclin-dependent kinase-inhibitor p21WAF1/CIP1/ MDA6 in promoting differentiation and preventing mitochondrial dysfunction and apoptosis induced by sodium butyrate in human myelomonocytic leukemia cells (U937), Int. J. Oncol. 19 (2001) 181–191. [9] K. Nakano, T. Mizuno, Y. Sowa, T. Orita, T. Yoshino, Y. Okuyama, T. Fujita, N. Ohtani-Fujita, Y. Matsukawa, T. Tokino, H. Yamagishi, T. Oka, H. Nomura, T. Sakai, Butyrate activates the WAF1/Cip1 gene promoter through Sp1 sites in a p53-negative human colon cancer cell line, J. Biol. Chem. 272 (1997) 22199– 22206. [10] Y. Sowa, T. Orita, S. Minamikawa, K. Nakano, T. Mizuno, H. Nomura, T. Sakai, Histone deacetylase inhibitor activates the WAF1/Cip1 gene promoter through the Sp1 sites, Biochem. Biophys. Res. Commun. 241 (1997) 142–150. [11] C.L. Hirsch, K. Bonham, Histone deacetylase inhibitors regulate p21WAF1 gene expression at the post-transcriptional level in HepG2 cells, FEBS Lett. 570 (2004) 37–40.
[12] X.S. Li, A.K. Rishi, Z.M. Shao, M.I. Dawson, L. Jong, B. Shroot, U. Reichert, J. Ordonez, J.A. Fontana, Posttranscriptional regulation of p21WAF1/CIP1 expression in human breast carcinoma cells, Cancer Res. 56 (1996) 5055– 5062. [13] M. Shiohara, M. Akashi, A.F. Gombart, R. Yang, H.P. Koeffler, Tumor necrosis factor alpha: posttranscriptional stabilization of WAF1 mRNA in p53-deficient human leukemic cells, J. Cell. Physiol. 166 (1996) 568–576. [14] M. Akashi, Y. Osawa, H.P. Koeffler, M. Hachiya, p21WAF1 expression by an activator of protein kinase C is regulated mainly at the post-transcriptional level in cells lacking p53: important role of RNA stabilization, Biochem. J. 337 (Pt 3) (1999) 607–616. [15] J. Liu, X. Shen, V.A. Nguyen, G. Kunos, B. Gao, Alpha(1) adrenergic agonist induction of p21(waf1/cip1) mRNA stability in transfected HepG2 cells correlates with the increased binding of an AU-rich element binding factor, J. Biol. Chem. 275 (2000) 11846–11851. [16] W. Wang, H. Furneaux, H. Cheng, M.C. Caldwell, D. Hutter, Y. Liu, N. Holbrook, M. Gorospe, HuR regulates p21 mRNA stabilization by UV light, Mol. Cell. Biol. 20 (2000) 760–769. [17] K.M. Giles, J.M. Daly, D.J. Beveridge, A.M. Thomson, D.C. Voon, H.M. Furneaux, J.A. Jazayeri, P.J. Leedman, The 30 -untranslated region of p21WAF1 mRNA is a composite cis-acting sequence bound by RNA-binding proteins from breast cancer cells, including HuR and poly(C)-binding protein, J. Biol. Chem. 278 (2003) 2937–2946. [18] X. Yang, W. Wang, J. Fan, A. Lal, D. Yang, H. Cheng, M. Gorospe, Prostaglandin A2-mediated stabilization of p21 mRNA through an ERK-dependent pathway requiring the RNA-binding protein HuR, J. Biol. Chem. 279 (2004) 49298– 49306. [19] B. Joseph, M. Orlian, H. Furneaux, p21(waf1) mRNA contains a conserved element in its 30 -untranslated region that is bound by the Elav-like mRNAstabilizing proteins, J. Biol. Chem. 273 (1998) 20511–20516. [20] A. Lal, K. Mazan-Mamczarz, T. Kawai, X. Yang, J.L. Martindale, M. Gorospe, Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs, EMBO J. 23 (2004) 3092–3102. [21] S.J. Cho, J. Zhang, X. Chen, RNPC1 modulates the RNA-binding activity of, and cooperates with, HuR to regulate p21 mRNA stability, Nucleic Acids Res. 38 (2010) 2256–2267. [22] S.A. Waggoner, G.J. Johannes, S.A. Liebhaber, Depletion of the poly(C)-binding proteins alphaCP1 and alphaCP2 from K562 cells leads to p53-independent induction of cyclin-dependent kinase inhibitor (CDKN1A) and G1 arrest, J. Biol. Chem. 284 (2009) 9039–9049. [23] L. Shu, W. Yan, X. Chen, RNPC1, an RNA-binding protein and a target of the p53 family, is required for maintaining the stability of the basal and stress-induced p21 transcript, Genes Dev. 20 (2006) 2961–2972. [24] S.M. Dehm, T.L. Hilton, E.H. Wang, K. Bonham, SRC proximal and core promoter elements dictate TAF1 dependence and transcriptional repression by histone deacetylase inhibitors, Mol. Cell. Biol. 24 (2004) 2296–2307. [25] G.K. Scott, M.D. Mattie, C.E. Berger, S.C. Benz, C.C. Benz, Rapid alteration of microRNA levels by histone deacetylase inhibition, Cancer Res. 66 (2006) 1277–1281. [26] E.M. Lee, S. Shin, H.J. Cha, Y. Yoon, S. Bae, J.H. Jung, S.M. Lee, S.J. Lee, I.C. Park, Y.W. Jin, S. An, Suberoylanilide hydroxamic acid (SAHA) changes microRNA expression profiles in A549 human non-small cell lung cancer cells, Int. J. Mol. Med. 24 (2009) 45–50. [27] I. Ivanovska, A.S. Ball, R.L. Diaz, J.F. Magnus, M. Kibukawa, J.M. Schelter, S.V. Kobayashi, L. Lim, J. Burchard, A.L. Jackson, P.S. Linsley, M.A. Cleary, MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression, Mol. Cell. Biol. 28 (2008) 2167–2174. [28] S. Wu, S. Huang, J. Ding, Y. Zhao, L. Liang, T. Liu, R. Zhan, X. He, Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 30 untranslated region, Oncogene 29 (2010) 2302–2308. [29] Y. Xiong, S.C. Dowdy, K.C. Podratz, F. Jin, J.R. Attewell, N.L. Eberhardt, S.W. Jiang, Histone deacetylase inhibitors decrease DNA methyltransferase-3B messenger RNA stability and down-regulate de novo DNA methyltransferase activity in human endometrial cells, Cancer Res. 65 (2005) 2684–2689. [30] R. Januchowski, M. Dabrowski, H. Ofori, P.P. Jagodzinski, Trichostatin A downregulate DNA methyltransferase 1 in Jurkat T cells, Cancer Lett. 246 (2007) 313–317. [31] G.K. Scott, C. Marx, C.E. Berger, L.R. Saunders, E. Verdin, S. Schafer, M. Jung, C.C. Benz, Destabilization of ERBB2 transcripts by targeting 30 untranslated region messenger RNA associated HuR and histone deacetylase-6, Mol. Cancer Res. 6 (2008) 1250–1258. [32] M. Krishnan, A.B. Singh, J.J. Smith, A. Sharma, X. Chen, S. Eschrich, T.J. Yeatman, R.D. Beauchamp, P. Dhawan, HDAC inhibitors regulate claudin-1 expression in colon cancer cells through modulation of mRNA stability, Oncogene 29 (2010) 305–312. [33] H. Yoshioka, H. Kamitani, T. Watanabe, T.E. Eling, Nonsteroidal antiinflammatory drug-activated gene (NAG-1/GDF15) expression is increased by the histone deacetylase inhibitor trichostatin A, J. Biol. Chem. 283 (2008) 33129–33137.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Histone deacetylase inhibitors mediate post-transcriptional regulation of p21WAF1 through novel cis-acting elements in the 30 untranslated region Calley L. Hirsch a,⇑, Danielle J.P. Ellis a, Keith Bonham b a
Department of Biochemistry, University of Saskatchewan, Saskatoon, SK, Canada S7N 5E5 Cancer Research Unit, Health Research Division, Saskatchewan Cancer Agency, and Division of Oncology, College of Medicine, University of Saskatchewan, 20 Campus Drive, Saskatoon, SK, Canada S7N 4H4
b
a r t i c l e
i n f o
Article history: Received 18 October 2010 Available online 25 October 2010 Keywords: Histone deacetylase inhibitors p21WAF1 mRNA stability 30 untranslated region
a b s t r a c t Histone deacetylase inhibitors (HDACIs) are promising anti-tumor agents that selectively induce cell cycle arrest, differentiation and/or apoptosis of tumor cells. Fundamentally, HDACIs are proposed to function by activating the transcription of genes, including the potent cyclin dependent kinase inhibitor p21WAF1. However, HDACIs primarily increase p21WAF1 expression at the post-transcriptional level in HepG2 cells, implying that these anti-tumor agents regulate genes at multiple levels. Here, two novel cis-acting elements in the 30 untranslated region (UTR) of p21WAF1 are identified that control the ability of HDACIs to induce p21WAF1 mRNA stabilization. Collectively, these studies highlight the complexity of HDACIs in gene regulation. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Histone deacetylase inhibitors (HDACIs) are a promising class of chemo-therapeutic agents that specifically induce tumor cell cycle arrest, differentiation, senescence, apoptosis and host immune response while also hindering angiogenesis [1]. Given their anti-cancer potential, HDACIs have been extensively studied in clinical trials, and in 2006 led to the approval of Vorinostat for the treatment of cutaneous T-cell lymphoma [2]. Initially, HDACIs were largely proposed to carry out their therapeutic functions by stimulating gene transcription. However, numerous studies have now shown that HDACIs more exclusively alter the expression of between 2% and 10% of genes and that an equivalent proportion of genes are up-regulated and down-regulated by HDACIs, suggesting that additional mechanisms must be responsible for HDACI mediated effects [3–5]. p21WAF1 is a cyclin dependent kinase inhibitor, whose over expression promotes cell cycle arrest and is a well established target of HDACIs [6]. Up-regulation of p21WAF1 is a central characteristic of HDACI exposure and a fundamental requirement for G1 growth arrest in human colon cancer and monocytic leukemia cells treated with the HDACI butyrate [7,8]. HDACIs, including butyrate and trichostatin A (TSA), enhance histone H3 and H4 acetylation levels at the p21WAF1 gene to activate transcription in a p53-inde⇑ Corresponding author. Present address: University of Texas MD Anderson Cancer Center, 1515 Holcombe Blvd, Houston, TX 77030, USA. Fax: +1 713 834 6273. E-mail addresses: [email protected] (C.L. Hirsch), Keith.Bonham@ saskcancer.ca (K. Bonham). 0006-291X/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2010.10.085
pendent manner [9,10]. However, histone hyperacetylation may not solely explain the ability of HDACIs to up-regulate p21WAF1 expression. We previously reported that butyrate and TSA do not activate p21WAF1 gene transcription, but enhance p21WAF1 levels post-transcriptionally, via a mechanism that requires de novo protein synthesis in the hepatocellular carcinoma cells, HepG2 [11]. Post-transcriptional mechanisms are an important contributor to p21WAF1gene regulation, as multiple agents have been shown to increase the mRNA stability of this gene, including the retinoid CD437 [12], tumor necrosis factor alpha [13], phorbol 12-myristate 13-acetate [14], phenylephrine [15], UV light irradiation [16], epidermal growth factor [17], and Prostaglandin A2 [18]. The p21WAF1 30 untranslated region (UTR) contains cis-acting elements that mediate mRNA stability by interacting with various RNA binding proteins. Three destabilizing AU-rich elements (AREs) and a U-rich HuD element are located within the first 250 nucleotides of the p21WAF1 30 UTR that interact with AUF1, RNA-binding region-containing protein 1 (RNPC1) and members of the ELAV family, including HuD and HuR [19–21]. Furthermore, the steady state of p21WAF1 is also regulated by a-globin poly(C) binding proteins (a-CP1, a-CP2), and RNPC1 binding to less characterized elements in the p21WAF1 30 UTR [22,23]. Exposure to UV irradiation and Prostaglandin A2 triggers the interaction between cytoplasmic HuR and AREs in the p21WAF1 30 UTR, enhancing mRNA stability [16,18,20]. Whereas uncharacterized elements downstream of the first 250 nucleotides in the 30 UTR mediate the enhancement of p21WAF1 mRNA levels in the presence of EGF [17]. Here we investigate whether HDACIs similarly mediate post-transcriptional regulation of p21WAF1 via distinct elements in the 30 UTR.
688
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
2. Materials and methods 2.1. Cell culture HepG2 hepatocellular carcinoma cells were grown in Dulbecco’s modified Eagle’s medium and Ham’s F-12 (DMEM-F12) medium (Gibco), supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin at 5% CO2 and 37 °C. 2.2. Plasmid construction for the p21WAF1 30 UTR deletions Generation of the 210WAF CAT reporter vector has been described previously [24]. Fragments of the p21WAF1 30 UTR were PCR amplified from the pCEP-WAF1 cDNA expression vector with primers bearing XbaI restriction sites. The XbaI restriction digested p21WAF1 30 UTR fragments were cloned into the 210WAF CAT vector between the CAT gene and the SV40 late poly(A) region. The primers used to generate the 210WAF1 CAT + p21WAF1 30 UTR (591–2079) vector were: FWD p21WAF1 30 UTR 591 – 50 GGAAGTCTAGAGTCCTGGAAG 30 , and REV p21WAF1 30 UTR 2079 – 50 CGTTTCT AGAGC ACCTGCTG 30 . The following plasmids were generated in a similar manner: 210WAF1 CAT + p21WAF1 30 UTR (712–2079), (788–2079), (840–2079), (591–840), (932–2079), (1045–2079), (1173–2079), (1272–2079), (840–1470), (591–1979), (591–1885), (591–1777), (591–2064), (591–2031), (591–2000) and (1467–2079). All primer sequences are available upon request. 2.3. Plasmid construction for the p21WAF1 30 UTR mutants The p21WAF1 30 UTR mutants was created by performing two mutagenesis reactions. First, the XbaI restriction site between the CAT gene and the p21WAF1 30 UTR was removed from the 210WAF1 CAT p21WAF1 30 UTR (591–2079) vector using the primers: sXbaIdestroy – 50 GCGGGGCGTAATCTGCAGTCCTGGAAGCGCG 30 and aXbaIdestroy – 50 CGCGCTTCCAGGACTGCAGATTACGCCCC GC 30 . Second, an EcoRV restriction site was created at position 1991 of the p21WAF1 30 UTR with the respective primers: sEcoRVcreate – 50 CTCCACCTAGACTGATATCCTCTCGAGGGCAGG 30 and aEcoRVcreate – 50 CCTGCCCTCGAGAGGATATCAGTCTAGGTG GAG 30 . The resulting 210WAF1 CAT + p21WAF1 30 UTR (591–2079) –XbaI/+EcoRV plasmid was used as the parental vector for construction of the 210WAF1 CAT + p21WAF1 30 UTR mutant vectors. All 16 mutants were created by inserting complementary annealed mutant oligonucleotides from 1997–2077 of the p21WAF1 30 UTR. Each mutant oligonucleotide pair contained five consecutive base pair mutations, beginning at position 2000 of the p21WAF1 30 UTR, where pyrimidines were replaced with pyrimidines (C to T, or T to C) and purines for purines (A to G, G to A). Mutant 16 was the exception, where only two base pairs were mutated at 2076 and 2077 of the p21WAF1 30 UTR. The mutant oligonucleotide sequences are available upon request.
mRNA stability. Our previous studies indicate that HDACIs do not transcriptionally activate the minimal p21WAF1 (210WAF1) promoter, but that new protein synthesis is required for HDACIs to increase the steady state mRNA levels of p21WAF1 in HepG2 cells [11]. This suggests that cis-acting elements in the p21WAF1 30 UTR may contribute to stabilizing the mRNA. To examine the role of the p21WAF1 30 UTR in HDACI mediated post-transcriptional regulation, the full length p21WAF1 30 UTR (591–2079) was cloned into the 210WAF1 CAT plasmid (Fig. 1A). Transient transfections were performed in HepG2 cells with the 210WAF1 CAT or 210WAF1 CAT + p21WAF1 30 UTR plasmids in the absence and presence of the HDACIs, NaB and TSA. As predicted, the inclusion of the p21WAF1 30 UTR had a marked destabilizing effect. In addition, the CAT activity of cells transfected with the 210WAF1 CAT + p21WAF1 30 UTR plasmid was up-regulated 6.9-fold by TSA and 11.7-fold by NaB, while only a minimal increase in CAT activity was detectable after HDACI exposure in cells transfected with the 210WAF1 CAT vector lacking the p21WAF1 30 UTR (Fig. 1A). To ensure that the context of the 210WAF1 promoter did not indirectly affect these results, the p21WAF1 30 UTR was also tested in the SV40 driven pCAT3 promoter vector (Supplementary Fig. 1). Similar to our initial observations, neither TSA nor NaB could activate the pCAT3 promoter vector. However, the presence of the p21WAF1 30 UTR increased HDACI responsiveness in HepG2 cells. Taken together, these observations indicate that the p21WAF1 30 UTR functions in HDACI mediated stabilization of p21WAF1 mRNA levels. 3.2. The proximal p21WAF1 30 UTR Well established destabilizing elements reside in the proximal 250 nucleotides of the p21WAF1 30 UTR. A series of deletions were made within the 591–840 region of the 30 UTR to determine if the HuD element or AREs contribute to HDACI mediated mRNA stabilization of p21WAF1 (Fig. 1B). The p21WAF1 30 UTR deletions were cloned into the 210WAF1 CAT plasmid and transient transfections were performed in HepG2 cells. Interestingly, the basal CAT activity of the p21WAF1 30 UTR deletions lacking the HuD site and/or the AREs were massively destabilized compared to the 210WAF1 CAT + p21WAF1 (591–840) (Fig. 1C). In addition, the ability of TSA and NaB to mediate p21WAF1 mRNA stability was examined (Fig. 1D). Deletion of neither the HuD element or AREs prevented HDACIs from stabilizing the mRNA, however, HDACIs failed to stabilize the 210WAF1 CAT + p21WAF1 30 UTR (591– 840) vector. This suggests that nucleotides 841–2079 of the p21WAF1 30 UTR contain a powerful destabilizing element, as well as a cis-acting element that is required to mediate HDACI stabilization of p21WAF1 mRNA levels. 3.3. The internal p21WAF1 30 UTR
2.4. Transient transfections and CAT assays HepG2 cells were seeded at 2.5 105 cells on 35 mm tissue culture plates. After 24 h the cells were transfected with a mixture containing: 1.0 lg of CAT reporter plasmid, 1.0 lg of CMV b-Gal, 2.0 lg pBlue, 85 lL of serum free DMEM media and 10 lL of the SuperFect Transfection Reagent (Qiagen). The procedures for transient transfections and CAT assays have been described previously [5]. 3. Results 3.1. The role of the p21WAF1 30 UTR in HDACI mediated mRNA stabilization Key cis-acting elements in the p21WAF1 30 UTR and their interaction with RNA binding proteins have been shown to regulate
To elucidate the element required for increasing the steady state of p21WAF1 in the presence HDACIs, another set of four p21WAF1 30 UTR deletion plasmids were created lacking nucleotides between 591 and 1272 of the 30 UTR (Supplementary Fig. 2). After HepG2 transfections, a clear increase in 210WAF1 CAT + p21WAF1 30 UTR (1272–2079) basal CAT levels was observed compared to 210WAF1 CAT + p21WAF1 30 UTR (932–2079) CAT activity (Fig. 2A). Furthermore, HDACIs were progressively impaired in their ability to stabilize p21WAF1 mRNA, as the nucleotides between 932 and 1272 were deleted from the p21WAF1 30 UTR (Fig. 2B). These data suggest that an instability element and HDACI responsive element resides between 932 and 1272 of the p21WAF1 30 UTR. However, when a 210WAF1 CAT vector bearing only nucleotides 840–1470 of the p21WAF1 30 UTR was transfected into HepG2 cells, basal CAT levels remained elevated and HDACI mediated mRNA
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
689
Fig. 1. The p21WAF1 30 UTR functions in HDACI mediated mRNA stabilization. (A) An illustration of the 210WAF1 CAT + p21WAF1 30 UTR (591–2079) vector is shown. The empty 210WAF1 CAT and 210WAF1 CAT + p21WAF1 30 UTR (591–2079) vectors were transfected into HepG2 cells and treated with TSA (1.0 lM) or NaB (5 mM). The CAT levels relative to the untreated 210WAF1 CAT vector are displayed. (B) The proximal 210WAF1 CAT + p21WAF1 30 UTR deletion plasmids. (C) HepG2 cells were transiently transfected and the basal CAT levels of the proximal deletion plasmids relative to the 210WAF1 CAT are graphed. (D) The CAT levels after TSA and NaB treatment are represented as fold induction relative to untreated transfected cells. The results represent two independent experiments performed in duplicate. The standard deviations are included as error bars.
stabilization was not restored upon treatment with either TSA or NaB. This implies that another instability element resides between nucleotides 1272 and 2079 of the p21WAF1 30 UTR and that the HDACI responsive element within the region 932–1272 may cooperate with other cis-acting elements to effectively stabilize p21WAF1 mRNA levels. 3.4. The terminal p21WAF1 30 UTR To search for additional cis-acting instability determinants and HDACI responsive elements within the p21WAF1 30 UTR, a group of vectors were produced with deletions made to the terminal portion of the 30 UTR. The first three plasmids created were: 210WAF1 CAT + p21WAF1 30 UTR (591–1979), 210WAF1 CAT + p21WAF1 30 UTR (591–1885) and 210WAF1 CAT + p21WAF1 30 UTR (591–1777) (Supplementary Fig. 3A). Upon transfection into HepG2 cells, each of these plasmids had basal CAT levels well above the full length 210WAF1 CAT + p21WAF1 30 UTR (591– 2079) vector (Supplementary Fig. 3B). Moreover, TSA did not stabilize the mRNA products of these terminal deletion vectors (Supplementary Fig. 3C). Together, these results suggest that a remaining instability and HDACI responsive element resides in the terminal 100 nucleotides of the p21WAF1 30 UTR. Therefore, new p21WAF1 30 UTR vectors were generated with further deletions made to the extreme 100 nucleotides of the 30 UTR, including: 210WAF1
CAT + p21WAF1 30 UTR (591–2063), 210WAF1 CAT + p21WAF1 30 UTR (591–2031) and 210WAF1 CAT + p21WAF1 30 UTR (591–2000) (Supplementary Fig. 4). Transient transfections in HepG2 cells demonstrated that nucleotides 2000–2079 of the p21WAF1 30 UTR likely contain an instability element, as basal CAT levels of cells transfected with the 210WAF1 CAT + p21WAF1 30 UTR (591–2000) vector were 12-fold higher compared to the full length 210WAF1 CAT + p21WAF1 30 UTR (591–2079) plasmid (Fig. 2C). In addition, neither the HDACIs TSA nor NaB had the same ability to enhance CAT levels of the extreme 30 UTR deletions as the full length p21WAF1 30 UTR plasmid (Fig. 2D), suggesting that a second element is present in the terminal portion of the p21WAF1 30 UTR. In agreement with our previous results this terminal element alone was not sufficient to allow HDACI mediated mRNA stabilization, as CAT levels were not elevated in cells transfected with the 210WAF1 CAT + p21WAF1 30 UTR (1467–2079) vector. Therefore, at least two cis-acting sequence determinants, between nucleotides 932–1272 and 2000–2079 contribute to basal p21WAF1 mRNA instability and increased p21WAF1 steady state levels in the presence of HDACIs. To begin further characterization of the terminal HDACI response element in the 30 UTR, 79 nucleotides immediately upstream of the human p21WAF1 poly(A) signal were aligned to the rat and mouse p21WAF1 30 UTR sequences (Fig. 3A). Among these species, a high degree of sequence conservation was observed,
690
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
Fig. 2. The p21WAF 30 UTR contains two cis-acting elements that regulate mRNA stabilization in the absence and presence of HDACIs. (A) HepG2 transfections were performed with 210WAF1 CAT, 210WAF1 CAT + p21WAF1 30 UTR (591–2079) and the internal p21WAF1 30 UTR deletions. The basal CAT levels are displayed relative to the 210WAF1 CAT plasmid. (B) Following HDACI treatment with TSA and NaB the CAT levels of the internal 30 UTR deletions were determined relative to their untreated counterparts. (C) HepG2 cells were transfected with the terminal 30 UTR deletions plasmids and the basal CAT levels were determined in relation to the 210WAF1 CAT vector. (D) The relative fold change in CAT levels of the terminal 30 UTR deletions after TSA and NaB exposure is plotted relative to the untreated transfection. A minimum of two independent experiments were performed in duplicate and the averages are represented with standard deviations.
supporting the idea that the nucleotides between 2000 and 2079 of the p21WAF1 30 UTR may mediate mRNA stabilization. To identify the precise HDACI sequence determinant, 16 full length p21WAF1 30 UTR mutants were generated. Five consecutive nucleotides were systematically replaced for each mutant, starting with the 210WAF1 CAT + p21WAF1 30 UTR mutant 1 vector where nucleotides 2001–2005 were mutated (Fig. 3B). HepG2 transient transfections indicated that the 210WAF1 CAT + p21WAF1 30 UTR mutant vectors 1–14 (mut 1–14), had similar basal CAT levels and responses to HDACIs as the wild type (wt) 210WAF1 CAT + p21WAF1 30 UTR (591–2079) vector (Fig. 3C–F). However, the 210WAF1 CAT + p21WAF1 30 UTR mutant 15 and mutant 16 vectors had a 3and 2-fold basal increase in CAT levels, and both TSA and NaB failed to stabilize these mutant mRNA species to the same degree as the wt counterpart (Fig. 3F). Similar results were also observed when the endogenous p21WAF1 poly(A) signal was included in the wt and mutant plasmids (Supplementary Fig. 5). Cumulatively, these data indicate that the p21WAF1 30 UTR contains a terminal instability determinant, between nucleotides 2071 and 2077, that is responsive to HDACIs in HepG2 cells. 4. Discussion Up-regulation of p21WAF1 has been identified as a necessary event for HDACIs to induce cell cycle arrest in human tumor cells [7,8]. HDACIs have been well documented to stimulate p21WAF1 mRNA levels at the transcriptional level [9,10]. However,
we identified that HDACIs also have the ability to increase p21WAF1 expression at the post-transcriptional level [11]. Interestingly, the ability of HDACIs to influence mRNA stability has not been limited to p21WAF1, as DNA methyltransferase-3B (DNMT3B) [29], DNA methyltransferase-1 (DNMT-1) [30], tyrosine kinase receptor ERBB2 [31], claudin-1 [32] and nonsteroidal anti-inflammatory drug-activated gene (NAG-1) [33] display alterations in mRNA stability upon HDACI exposure, suggesting that common mechanisms may control HDACI mediated post-transcriptional regulation. Numerous reports have implicated the p21WAF1 30 UTR in mRNA steady state regulation [12–18]. Here, the importance of the p21WAF1 30 UTR in HDACI mediated mRNA stabilization was studied by linking the p21WAF1 30 UTR to a CAT reporter gene. We identified that inclusion of the p21WAF1 30 UTR has massive destabilizing potential and that the 30 UTR is required for HDACIs to enhance p21WAF1 mRNA stability. Yet, neither the HuD element nor the AREs in the p21WAF1 30 UTR functions in HDACI mediated stabilization of p21WAF1 mRNA levels, but two novel cis-acting elements were identified between nucleotides 932–1272 and 2071– 2079 of the p21WAF1 30 UTR that are required to mediate basal mRNA decay and increase p21WAF1 steady state levels in the presence of HDACIs. [11]. Two observations suggest that the interaction of RNA binding proteins with the p21WAF1 30 UTR may facilitate mRNA stability upon HDACI exposure. First, de novo protein synthesis is required for HDACIs to post-transcriptionally regulate p21WAF1 [11]. Second,
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
691
Fig. 3. Characterization of the p21WAF1 30 UTR terminal cis-acting element. (A) The sequence alignment of the rat (U24174), mouse (U24173) and human (U03106) p21WAF1 30 UTRs upstream of their poly(A) signals. The poly(A) signals are shown in bold. (B) An example of the p21WAF1 30 UTR mutant design, illustrating the 210WAF1 CAT + p21WAF1 30 UTR mutant 1 (mut 1) vector. (C and E) Transient transfections were performed in HepG2 cells with 210WAF1 CAT, 210WAF1 CAT + p21WAF1 30 UTR (591–2079), (581– 2000), or mutants (mut 1–16). The relative fold induction of basal CAT levels was determined. (D and F) The fold induction of CAT levels relative to untreated self following TSA or NaB treatment of the mutant transfected cells. The data are an average of at least two independent experiments performed in duplicate and include standard deviations.
the two cis-acting elements identified in this study regulate both basal p21WAF1 mRNA stability and HDACI responsive stabilization. Interestingly, CP1a and CP2a have been shown to interact with nucleotides 879–1006 of the p21WAF1 30 UTR and RNCP1 associates with nucleotides 879–1512 [22,23]. However, our RNA binding assays were unsuccessful at identifying changes in protein binding after HDACI exposure, to either the 932–1272 or the 2071–2079
cis-acting elements alone. Therefore, both stability determinants within the 30 UTR may cooperate to regulate protein binding in addition to p21WAF1 mRNA stability. miRNAs are important post-transcriptional regulators that bind the 30 UTR of mRNAs, and may also control the mRNA decay rate of p21WAF1 in the absence and presence of HDACIs. HDACIs are known to up-regulate and down-regulate the expression of select miRNAs
692
C.L. Hirsch et al. / Biochemical and Biophysical Research Communications 402 (2010) 687–692
[25,26]. Furthermore, the p21WAF1 30 UTR is the target of several miRNAs, including members of the miRNA-106b family, which interacts with nucleotides 1022–1047 and 1702–1726 of the p21WAF1 30 UTR [27,28]. Of interest, the expression of three members of the miRNA-106b family (miRNA-17, miRNA-20 and miRNA-106a) are reduced by HDACIs [25,26]. Therefore, HDACIs could indirectly up-regulate the steady state of p21WAF1 mRNA levels by decreasing the expression of the miRNA-106b family members. Clearly, the mechanisms surrounding HDACI mediated stabilization of p21WAF1 require further investigation. 5. Conclusions This study highlights the ability of HDACIs to regulate gene expression at the post-transcriptional level and provides evidence that HDACIs enhance p21WAF1 mRNA stability through two novel cis-acting elements in the p21WAF1 30 UTR. Acknowledgments K. Bonham is supported by operating grants from the Canadian Institute of Health Research (CIHR) and the Saskatchewan Cancer Agency. C.L. Hirsch is supported by a CIHR Canada graduate scholarship doctoral award and D.J.P. Ellis is supported by a Natural Sciences and Engineering Research Council of Canada PGSD3 award. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2010.10.085. References [1] A.J. Frew, R.W. Johnstone, J.E. Bolden, Enhancing the apoptotic and therapeutic effects of HDAC inhibitors, Cancer Lett. 280 (2009) 125–133. [2] K. Garber, HDAC inhibitors Overcome first hurdle, Nat. Biotechnol. 25 (2007) 17–19. [3] C. Van Lint, S. Emiliani, E. Verdin, The expression of a small fraction of cellular genes is changed in response to histone hyperacetylation, Gene Expr. 5 (1996) 245–253. [4] J.M. Mariadason, G.A. Corner, L.H. Augenlicht, Genetic reprogramming in pathways of colonic cell maturation induced by short chain fatty acids: comparison with trichostatin A, sulindac, and curcumin and implications for chemoprevention of colon cancer, Cancer Res. 60 (2000) 4561–4572. [5] C.L. Kostyniuk, S.M. Dehm, D. Batten, K. Bonham, The ubiquitous and tissue specific promoters of the human SRC gene are repressed by inhibitors of histone deacetylases, Oncogene 21 (2002) 6340–6347. [6] Y.S. Jung, Y. Qian, X. Chen, Examination of the expanding pathways for the regulation of p21 expression and activity, Cell Signal. 22 (2010) 1003– 1012. [7] S.Y. Archer, S. Meng, A. Shei, R.A. Hodin, p21(WAF1) is required for butyratemediated growth inhibition of human colon cancer cells, Proc. Natl. Acad. Sci. USA 95 (1998) 6791–6796. [8] R.R. Rosato, Z. Wang, R.V. Gopalkrishnan, P.B. Fisher, S. Grant, Evidence of a functional role for the cyclin-dependent kinase-inhibitor p21WAF1/CIP1/ MDA6 in promoting differentiation and preventing mitochondrial dysfunction and apoptosis induced by sodium butyrate in human myelomonocytic leukemia cells (U937), Int. J. Oncol. 19 (2001) 181–191. [9] K. Nakano, T. Mizuno, Y. Sowa, T. Orita, T. Yoshino, Y. Okuyama, T. Fujita, N. Ohtani-Fujita, Y. Matsukawa, T. Tokino, H. Yamagishi, T. Oka, H. Nomura, T. Sakai, Butyrate activates the WAF1/Cip1 gene promoter through Sp1 sites in a p53-negative human colon cancer cell line, J. Biol. Chem. 272 (1997) 22199– 22206. [10] Y. Sowa, T. Orita, S. Minamikawa, K. Nakano, T. Mizuno, H. Nomura, T. Sakai, Histone deacetylase inhibitor activates the WAF1/Cip1 gene promoter through the Sp1 sites, Biochem. Biophys. Res. Commun. 241 (1997) 142–150. [11] C.L. Hirsch, K. Bonham, Histone deacetylase inhibitors regulate p21WAF1 gene expression at the post-transcriptional level in HepG2 cells, FEBS Lett. 570 (2004) 37–40.
[12] X.S. Li, A.K. Rishi, Z.M. Shao, M.I. Dawson, L. Jong, B. Shroot, U. Reichert, J. Ordonez, J.A. Fontana, Posttranscriptional regulation of p21WAF1/CIP1 expression in human breast carcinoma cells, Cancer Res. 56 (1996) 5055– 5062. [13] M. Shiohara, M. Akashi, A.F. Gombart, R. Yang, H.P. Koeffler, Tumor necrosis factor alpha: posttranscriptional stabilization of WAF1 mRNA in p53-deficient human leukemic cells, J. Cell. Physiol. 166 (1996) 568–576. [14] M. Akashi, Y. Osawa, H.P. Koeffler, M. Hachiya, p21WAF1 expression by an activator of protein kinase C is regulated mainly at the post-transcriptional level in cells lacking p53: important role of RNA stabilization, Biochem. J. 337 (Pt 3) (1999) 607–616. [15] J. Liu, X. Shen, V.A. Nguyen, G. Kunos, B. Gao, Alpha(1) adrenergic agonist induction of p21(waf1/cip1) mRNA stability in transfected HepG2 cells correlates with the increased binding of an AU-rich element binding factor, J. Biol. Chem. 275 (2000) 11846–11851. [16] W. Wang, H. Furneaux, H. Cheng, M.C. Caldwell, D. Hutter, Y. Liu, N. Holbrook, M. Gorospe, HuR regulates p21 mRNA stabilization by UV light, Mol. Cell. Biol. 20 (2000) 760–769. [17] K.M. Giles, J.M. Daly, D.J. Beveridge, A.M. Thomson, D.C. Voon, H.M. Furneaux, J.A. Jazayeri, P.J. Leedman, The 30 -untranslated region of p21WAF1 mRNA is a composite cis-acting sequence bound by RNA-binding proteins from breast cancer cells, including HuR and poly(C)-binding protein, J. Biol. Chem. 278 (2003) 2937–2946. [18] X. Yang, W. Wang, J. Fan, A. Lal, D. Yang, H. Cheng, M. Gorospe, Prostaglandin A2-mediated stabilization of p21 mRNA through an ERK-dependent pathway requiring the RNA-binding protein HuR, J. Biol. Chem. 279 (2004) 49298– 49306. [19] B. Joseph, M. Orlian, H. Furneaux, p21(waf1) mRNA contains a conserved element in its 30 -untranslated region that is bound by the Elav-like mRNAstabilizing proteins, J. Biol. Chem. 273 (1998) 20511–20516. [20] A. Lal, K. Mazan-Mamczarz, T. Kawai, X. Yang, J.L. Martindale, M. Gorospe, Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs, EMBO J. 23 (2004) 3092–3102. [21] S.J. Cho, J. Zhang, X. Chen, RNPC1 modulates the RNA-binding activity of, and cooperates with, HuR to regulate p21 mRNA stability, Nucleic Acids Res. 38 (2010) 2256–2267. [22] S.A. Waggoner, G.J. Johannes, S.A. Liebhaber, Depletion of the poly(C)-binding proteins alphaCP1 and alphaCP2 from K562 cells leads to p53-independent induction of cyclin-dependent kinase inhibitor (CDKN1A) and G1 arrest, J. Biol. Chem. 284 (2009) 9039–9049. [23] L. Shu, W. Yan, X. Chen, RNPC1, an RNA-binding protein and a target of the p53 family, is required for maintaining the stability of the basal and stress-induced p21 transcript, Genes Dev. 20 (2006) 2961–2972. [24] S.M. Dehm, T.L. Hilton, E.H. Wang, K. Bonham, SRC proximal and core promoter elements dictate TAF1 dependence and transcriptional repression by histone deacetylase inhibitors, Mol. Cell. Biol. 24 (2004) 2296–2307. [25] G.K. Scott, M.D. Mattie, C.E. Berger, S.C. Benz, C.C. Benz, Rapid alteration of microRNA levels by histone deacetylase inhibition, Cancer Res. 66 (2006) 1277–1281. [26] E.M. Lee, S. Shin, H.J. Cha, Y. Yoon, S. Bae, J.H. Jung, S.M. Lee, S.J. Lee, I.C. Park, Y.W. Jin, S. An, Suberoylanilide hydroxamic acid (SAHA) changes microRNA expression profiles in A549 human non-small cell lung cancer cells, Int. J. Mol. Med. 24 (2009) 45–50. [27] I. Ivanovska, A.S. Ball, R.L. Diaz, J.F. Magnus, M. Kibukawa, J.M. Schelter, S.V. Kobayashi, L. Lim, J. Burchard, A.L. Jackson, P.S. Linsley, M.A. Cleary, MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression, Mol. Cell. Biol. 28 (2008) 2167–2174. [28] S. Wu, S. Huang, J. Ding, Y. Zhao, L. Liang, T. Liu, R. Zhan, X. He, Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 30 untranslated region, Oncogene 29 (2010) 2302–2308. [29] Y. Xiong, S.C. Dowdy, K.C. Podratz, F. Jin, J.R. Attewell, N.L. Eberhardt, S.W. Jiang, Histone deacetylase inhibitors decrease DNA methyltransferase-3B messenger RNA stability and down-regulate de novo DNA methyltransferase activity in human endometrial cells, Cancer Res. 65 (2005) 2684–2689. [30] R. Januchowski, M. Dabrowski, H. Ofori, P.P. Jagodzinski, Trichostatin A downregulate DNA methyltransferase 1 in Jurkat T cells, Cancer Lett. 246 (2007) 313–317. [31] G.K. Scott, C. Marx, C.E. Berger, L.R. Saunders, E. Verdin, S. Schafer, M. Jung, C.C. Benz, Destabilization of ERBB2 transcripts by targeting 30 untranslated region messenger RNA associated HuR and histone deacetylase-6, Mol. Cancer Res. 6 (2008) 1250–1258. [32] M. Krishnan, A.B. Singh, J.J. Smith, A. Sharma, X. Chen, S. Eschrich, T.J. Yeatman, R.D. Beauchamp, P. Dhawan, HDAC inhibitors regulate claudin-1 expression in colon cancer cells through modulation of mRNA stability, Oncogene 29 (2010) 305–312. [33] H. Yoshioka, H. Kamitani, T. Watanabe, T.E. Eling, Nonsteroidal antiinflammatory drug-activated gene (NAG-1/GDF15) expression is increased by the histone deacetylase inhibitor trichostatin A, J. Biol. Chem. 283 (2008) 33129–33137.