- Email: [email protected]
Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants
MPB-07764; No of Pages 8 Marine Pollution Bulletin xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Marine Pollution Bulletin journal homepage: www.elsevier.com/locate/marpolbul
Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants Altuğ Yavaşoğlu a, Dilara Özkan b, Adem Güner b, Selma Katalay c, Fatih Oltulu a, N.Ülkü Karabay Yavaşoğlu b,d,⁎ a
Ege University, Faculty of Medicine, Department of Histology and Embriology 35100 Bornova-, Izmir, Turkey Ege University, Faculty of Science, Department of Biology 35100 Bornova-, Izmir, Turkey Celal Bayar University, Faculty of Science and Art, Department of Biology Muradiye-, Manisa, Turkey d Ege University, Center for Drug Research & Development and Pharmacokinetic Applications 35100 Bornova-, Izmir, Turkey b c
a r t i c l e
i n f o
Article history: Received 15 March 2016 Received in revised form 30 May 2016 Accepted 31 May 2016 Available online xxxx Keywords: Mytilus galloprovincialis L. apoptosis histopathology TUNEL assay caspase RT-PCR
a b s t r a c t Marine bivalve mussels, especially Mytilus species are an earlywarning system used for determining of damage caused by the various aquatic pollutions. In the present study, Mytilus galloprovincialis L. (black mussel) have been utilised as a biomonitoring organism to reveal environmental pollution in the Aliaga, Foca and Urla where located along the Izmir Coast of Turkey. Mussels were collected at these areas and gill and hepatopancreas (digestive gland) tissues were excised. mRNA expressions of initiator (caspase-2 and −8) and executioner (caspase −3/7–1, −3/7–2, −3/7–3 and −3/7–4) caspases of mussels tissues in areas exposed to pollution agent have been observed. TUNEL immunoreactivity in paralel to histopathological changes in both Aliaga and Foca areas were compared with Urla. This study is the first report to reveal the pollution with apoptotic expression on mussels in the coast of Turkey. © 2016 Elsevier Ltd. All rights reserved.
1. Introduction Environmental pollution has emerged as an ever-growing problem with the development of technology and industrialization. However, ecotoxicology has gained popularity to protect endangered species against threats caused by pollution in more recent times (Shugart et al., 1992; Santos et al., 2010). Pollution-exposed organisms in the ecosystem such as land, air and sea may react in various ways. Although potential risks of various pollutants in seas and oceans were determined by chemical parameters, these values were not much idea about their effects on viability (Depledge, 1994; Tsangaris et al., 2004; Wu et al., 2005). The majority of immobile organisms living on the bottom have used as bioindicators of pollution in aquatic ecosystems. At this method, response generated against chemicals accumulating in body fluids, cells or tissues of organisms is based measuring the biochemical and cellular bases (Hellawell, 1986; Rainbow, 1996). Because of the mussels such as Mytilus galloprovincialis L. (black mussel) is a sessile, selective filterfeeding sedentary organism and widely distributed as well as have a big capacity to accumulate pollutants (pesticides, hydrocarbons, metals, etc.), they are one of the most convenient indicator organisms using for monitoring the toxicity and risk in the coastal environments in recent years (Viarengo and Canesi, 1991; Cajaraville et al., 2000). ⁎ Corresponding author at: Ege University, Faculty of Science, Department of Biology, 35100 Bornova, Izmir, Turkey. E-mail address: [email protected] (N.Ü.K. Yavaşoğlu).
Apoptosis is a tightly regulated stepwise progression that leads to disruption of cell content via exrinsic or intrinsic pathway by various environmental or natural stressors in both vertebrates and invertebrates (Tittel and Steller, 2000). Cells undergo apoptosis are characterized by a series of morphological and biochemical changes such as protein cleavage, cell shrinkage with smaller cells in size, the dense of cytoplasm, degradation of DNA which is often used to identify an apoptotic cell (Kerr et al., 1972; Schwartzman and Cidlowski, 1993). Caspase proteins are synthesized in the early stages of apoptosis and these proteins are involved in the hydrolysis of many cellular components. Caspases depending on their function in the apoptotic process are classified as the initiator (casp-2 or − 8) and effector (casp-3 or −7). Caspases in the heart of apoptosis has two basic tasks as transmitting the cell death signal and fragmentation of many cellular proteins that cause changes in apoptosis (Salvesen and Dixit, 1997). With this in mind, apoptosis is one of the important vehicles used for monitoring the pollution in many aquatic organisms. Changes in apoptosis-related proteins have been studied intensively in many aquatic species, especially in M. galloprovincialis L. (Micic et al., 2001; Perry and Lynn, 2009). DNA damage which indicator of cumulative cells damage of hepatopancreas (digestive gland) or gill in mussels can be detected with various types of caspase activity and the TUNEL (tdt-mediated dUTP nick-end labeling) assays. Aliaga where located along the Aegean Coast and northwest of Izmir municipality has become the industrial city losing its agricultural character with the announcement as heavy industrial area in 1997. There
http://dx.doi.org/10.1016/j.marpolbul.2016.05.084 0025-326X/© 2016 Elsevier Ltd. All rights reserved.
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
2
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
Fig. 1. The study area and sampling stations.
are various industrial facilities for different purposes, including machine-chemical industry, Tüpraş, Petkim (a petro chemistry plant), liquefied gas storage and filling plants, fuel storage and distribution facilities, iron–steel factories, fertilizer factory, electric power plant, ship recycling facilities, paper mills and fertilizer plants. Industrial plants established in Aliaga and Nemrut Bay where the neighboring of Aliaga town and many regions of the province of Izmir meets the water needs from the Güzelhisar Dam. In Foca unlike Aliaga, Gediz river-fed agriculture constitutes a significant portion of the economy and it is one marine protected areas established in Turkey (Sponza and Karaoğlu, 2002; Esen et al., 2010). Various heavy metals and xenobiotics caused by industrial plants located in around and Aliaga Bay can be dangerous to aquatic life. Begin to be included in the food chain of aquatic organisms affected by the pollution poses a risk in terms of all organisms and ultimately agents-not metabolized can reach higher concentrations to other higher organisms. The aim of this study was to assess histopatological effects and the level of apoptosis in M. galloprovincialis L. heptopancreas and gill tissues which are a key ring of this chain collected from different stations. 2. Material and Methods 2.1. Specimen Collection Fifty individuals which about same in size of mussels were collected in October and November 2012 at Aliaga Fishing Ports and Old Foca stations along the coast of the Aegean Sea. For comparative purposes, Urla also situated at a distance of 35 km from Izmir was selected as control
area (Fig. 1). The mussels were kept at +4 ° C in seawater during transfer back to the laboratory, and then the hepatopancreas and gill tissues were excised and immediately frozen in liquid nitrogen and the tissue was stored at −80 °C by using the TriPure Isolation Reagent (Roche Applied Science, Penzberg, Germany). Research have been carried out with the permission of Turkish Republic, General Directorate of Fisheries and Aquaculture of Ministry of Food, Agriculture and Livestock (Number: 83,364,995–67,852,565/140.03.03–3040) and General Directorate of Nature Protection and National Parks of Livestock and Ministry of Forestry and Water Affairs (Number: 80,202,595–488.04/358). 2.2. RNA preparation and RT-PCR Total RNAs collected separately from mussels gill and hepatopancreas were isolated using the TriPure Isolation reagent (Roche, Switzerland, cat. no. 11,667,157,001). The RNA isolation quality was controled by NanoDrop (NanoDrop ND-2000c, Thermo Scientific, USA). From each sample, 1 μg RNA was used for cDNA synthesis. First-strand complementary DNAs (cDNAs) were synthesized with Transcriptor First Strand cDNA Synthesis kit (Roche, cat. no. 04,379,012,001) using total RNA. Primer and probe sets were chosen from the Universal Probe Library (Roche Applied Science). Real-time polymerase chain reaction (RTPCR) analysis of Casp-2, Casp-3/7–1, Casp-3/7–2, Casp-3/7–3, Casp-3/ 7–4 and Casp-8 was performed on the LightCycler v.1.5 instrument (Roche Applied Science). Relative ratios were calculated by normalizing gene expression levels of each sample with the house-keeping gene Beta actin. The primers used are shown in Table 1. Results were expressed as ΔCt (Livak and Schmittgen, 2001).
Table 1 The primers and genes used for measuring the expression level of apoptosis. Gene name
Forward pimer
Reverse primer
Beta Actin Casp-2 Casp-3/7–1 Casp-3/7–2 Casp-3/7–3 Casp-3/7–4 Casp-8
5’AACCGCCGCTTCTTCATCTTC 5’GATATATGACAAGGGTGGCAATG 5’GATCTTGGAAGTGGTGTAGAACG 5’CCTGTAGAGGAGGAGGATTAGGAC 5’CAATGTGTAAAAACGAGAGACATTG 5’GATTTCCTTGAAGTCTTTTCTACGTC 5’CCCAACCAGTAGTAACACCAGAC
5’TACCACCAGACAAGACGG 5’GACTTTACAGCATCCAGGACATC 5’CACTGCTAGGAAATCTGCTTCAT 5’GGAAGGATCCATAACCAGCAG 5’GTTAGTATATGCCCACTGTCCATTC 5’AATATCATCGTCTTCCTGGATGTTAT 5’GTATGAACCATGCCCCTATATCA
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx Table 2 Lengths, widths and weights averages of mussels, M.galloprovincialis L.
Urla Foca Aliaga
Length (cm)
Width (cm)
Weight (gr)
4.82 ± 0.36 4.78 ± 0.13 4.31 ± 0.09
2.64 ± 0.12 2.97 ± 0.10 2.73 ± 0.09
2.71 ± 0.08 2.85 ± 0.12 2.82 ± 0.24
Values are presented mean ± SEM.
2.3. Histological Examination For light microscopic examination, gills and hepatopancreas were fixed by 4% paraformaldehyde (Sigma Chemical, St.Louis, MO) for 24 h, at 48 °C and processed for embedding in paraffin wax using routine protocols. After routine processing, paraffin sections of each tissue were cut into 5 μm thickness and stained with haematoxylin and eosin (H&E). 2.4. Analysis of Apoptosis in Tissue Section Apoptosis in the hepatopancreas and gill cells was defined and quantitated as previously described by Promega DeadEnd™ Colorimetric
3
Apoptosis Detection System (TUNEL) (Promega Corp., Madison, U.S.A., Cat No: G7130). For TUNEL, cells were fixed in 4% paraformalde-hyde solution for 25 min at room temperature, rinsed in phosphate buffered saline (PBS) and permeabilized by immersing the slides in 20 μg/ml Proteinase K solution. Tissues were incubated with terminal deoxynucleotidyl transferase (rTdT) reaction mixture containing biotinylated nucleotides and rTdT at 37 °C for 60 min, rinsed with sodium chloride-sodium citrate buffer (SSC) and PBS. Streptavidin horseradish peroxidase (HRP) was added to each slide and incubates for 30 min at room temperature. Slides were then stained with diamino benzidyne system (DAB). For each group, a minimum of 2000 cells were assessed.
2.5. Statistical Analyses The weight, width and height averages of the mussels were presented as the mean ± standard error mean (SEM). Comparisons of tissue expression analyses results were made between control area and other areas using one-way analysis of variance (ANOVA) followed by a Tukey post hoc test. Values of p ≤ 0.05 were regarded as statistically significant (Snedecor and Cochran, 1968).
Fig. 2. Histopathological alterations in the hepatopancreas of mussels, M. galloprovincialis L. H&E stain; A (40X), B (100X) Mussels of Foca area: degeneration in the digestive tubules (dt) and cell loss due to necrosis (*), hemolytic widespread infiltration (hi) in the connective tissue (ct) as well as pyknotic nuclei (pn) in epithelial cells (ec). C (20X), D (100X) Mussels of Aliaga area: cell loss due to necrosis (*) and hemolytic widespread infiltration (hi) in the connective tissue (ct). E (40X), F (100X) Mussels of Urla area as control.
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
4
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
Fig. 3. Histopathological alterations in the gill tissue of mussels, M.galloprovincialis L. H&E stain; A (40X), B (100X) Mussels of Foca area: ciliar (s) degeneration and erosion in the lateral (LB) and frontal regions (FB) and cellular swelling (*) in the epithelial cells (ge). C (40X), D (100X) Mussels of Aliaga area: contractions and adhesions in the hemo-lymphatic vessels (v) with ciliar erosion (s). E (40X), F (100X) Mussels of Urla area as control.
3. Results 3.1. Weights, widths and heights of mussels The total tissue weights of the collected mussels were scaled with precision scales, the lengths and widths of them with a ruler were measured and the average was taken. The results are shown in Table 2. 3.2. Histopathological findings Histological changes were observed in the hepatopancreas and gills of mussels compared with control. While digesive tubules, tubular epithelial cells and stromal connective tissues in the hepatopancreas collected from Urla has a normal appearance [Fig. 2(E-F)], degeneration in the digestive tubules and cell loss due to necrosis in the hepatopancreas tissue from Foca was observed [Fig. 2(A-B)]. At the same time, eosinophilic cytoplasm and pyknotic nuclei in epithelial cells and hemolytic widespread infiltration in the connective tissue in addition
to the loss of tubule epithelial integrity was determined. However, in the hepatopancreas of Aliaga mussel, vacuolar degeneration and cell loss due to necrosis as well as hemolytic infiltration in the vesicular connective tissue was monitored, although preserving tubular epithelial integrity in the digestive tubules [Fig. 2(C-D)]. Histological structure such as cilia, hemo-lymphatic vessels and gills had normal appearance without major pathological alterations except some degenerative changes in the epithelial cells in the most of the examined mussels of Urla [Fig. 3(E-F)]. In Foca unlike Urla, degeneration, necrotic changes and cellular swelling in the epithelial cells of the frontal region of the gill filaments has been identified. Similarly, contractions and adhesions in the hemo-lymphatic vessels in parallel to ciliar degeneration and erosion in the lateral and frontal regions are remarkable [Fig. 3(A-B)]. When compared to control, in Aliaga-mussels, contractions and adhesions in the hemolymphatic vessels with ciliar erosion has been reported although the epithelial cells of the frontal and lateral regions of the gill filaments has normal histological appearance [Fig. 3(C-D)].
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
5
Fig. 4. Initiator caspases genes (Caspase-2, Caspase-8) expression levels of mussel tissues. * Statistically significant difference from control area (Urla) (p b 0.05).
3.3. Determination of Gene Expression Profile and TUNEL assay The caspase activities results suggest that apoptotic process which resulted in the death of cells can not be repaired has begun in the hepatopancreas and gill tissues of Aliaga and Foca mussels [Figs. 4 and 5]. Initiator caspase-2 and caspase-8 showed the highest expression values, reaching a 12 and 8-fold change maximum value over the control in Aliaga-gill and hepatopancreas tissue, respectively. While executioner caspase-3/7–1, − 3/7–2, − 3/7–3 and −3/7–4 exhibited control close changes in Foca-gill tissue, especially caspase-3/7–3 was significantly inhibited as well as caspase-3/7–4 showed the highest expression values in Aliaga-gill tissue. Expression of all executioner caspase tends to show an increased expression in Aliaga and Foca-hepatopancreas tissues. By labeling the terminal end of nucleic acids, TUNEL is a quantitative method to determine cells undergoing apoptosis. When compared with control animals [Figs. 6(E-F), 7(E-F)], there were significantly higher in gills and hepatopancreas tissue of mussels of both Aliaga and Foca in terms of immunoreactive cells. Foça region [Fig. 6(A-B)] is represented showing more common immunoreactivity according to hepatopancreas
tissues of Aliaga [Fig. 6(C-D)]. Similarly, TUNEL expression in gill cells was observed less in Aliaga mussels [Fig. 7(C-D)] as compared with Foca mussels [Fig. 7(A-B)]. 4. Discussion Hepatopancreas and gill tissues of mussel are the main biomonitoring tools used for evaluation of environmental pollutants on a marine ecosystem taking into account criteria such as damage of tissues, membranes lipid peroxidation, protein damages and DNA alteration. Also, these organs are the junction involved in nutrition, respiration, absorption, digestion, and enzymatic activity and the prosses of accumulation and biotransformation of toxic contaminants into the water (Regoli, 1998; Lionetto et al., 2003; Gomez-Mendikute et al., 2005). In this study, the size of the pollution in Aliaga and Foca are interpreted by considering histopathological changes and gene expression profiles in mussel hepatopancreas and gill tissues. Histopathological examinations are rapid, easily, operated, reliable, comparatively inexpensive and sensitive techniques used in the interpretation of tissue changes against stress caused by pollution indicator.
Fig. 5. Effector caspase genes (Caspase-3/7–1, Caspase-3/7–2, Caspase-3/7–3 and Caspase-3/7–4) expression levels of mussel tissues. * Statistically significant difference from control area (Urla) (p b 0.05).
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
6
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
Fig. 6. TUNEL expression alterations in the hepatopancreas tissue of mussels, M. galloprovincialis L. A (40X), B (100X) Mussels of Foca area. C (40X), D (100X) Mussels of Aliaga area. E (40X), F (100X) Mussels of Urla area as control.
The other major advantages of this method are provide a comparative analysis of lasting effect, the mechanism of action and the severity of stress in stressed organism (Sreeram and Menon, 2005). Hepatopancreas consists of several digestive tubules held together by a fine fibrous connective tissue. The digestive tubule which involved in digestion and absorption is lined by two kinds of cells, the digestive and basophilic cells as well as the distal blind ending. Also, gill curtain-like structures consisting of parts numerous W-shaped (or double V) filaments which take shape two demibranchs as well as branchial nerve and branchial haemolymph vessels along the dorsal margin of the mantle. Each demibranch (V) is comprised of inner descending (gill axis) and outer ascending lamella (Yonge, 1926; Owen, 1973; Sunila, 1987; Gosling, 2003). In present investigation, digestive tubules and epithelial cells of digestive glands of M. galloprovincialis L. collected from Urla (control group) was healtful and the length of them was normal and equal. At the same time there was no change in stromal connective tissue. While damage and disruption in digestive tubules in Foca mussels was observed, integrity of digestive tubules for Aliaga mussels was preserved. This phenomenon can be explained that the cells of digestive tubule by showing different sensitivity to pollutant indicators. However, serious dysfunction such as pyknotic nuclei and eosinophilic cytoplasm in epithelial cells as well as irregularities in vesicular connective tissue cells resulting in haemocyte infiltration and tissue necrosis on both Aliaga and Foca mussels has been demonstrated. Haemocytes,
dysfunction of ciliated epithelial cells, swelling and hyperplasia of haemolymph channels in gill are important signs of exposure to potentially harmful. Appearance of these formations (or granuloma) was reported more frequently in Foca gill tissue than in Aliaga mussels in this study. The source of these differences compared to control may be related to accumulate both metals in gill and hepatopancreas and different metals in the same tissue of mussels in different regions. Similar histopathological changes in hepatopancreas and gills were recorded by earlier workers on bivalves exposed to variety of pollutants (Nolan et al., 1984; Carles et al., 1986; Widdows and Donkin, 1992). There are still missing pieces to reveal a detailed mechanistic map of histological studies which performed to express of the cell response suchs as single strand breaks and the production of free radicals caused by environmental toxic stimuli. The apoptotic process of cell is considered to be one of the best methods used to elucidate this mechanism (Sweet et al., 1999; Terahara and Takahashi, 2008). Apoptosis or programmed cell death is an important crossroads in managing critical events such as eliminate abnormal cells, maintenance of tissue homeostasis; respond to environmental toxicants in both vertebrates and invertebrates. Apoptotic program of cells have been intensively worked in many models such as Caenorhabditis and Drosophila and consequently the signaling pathways involved in processes that lead to apoptosis in molluscs cells has shown a strong connection in terms of molecular and functional similarity with those seen in vertebrates (Romero et al.,
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
2011). In the light of these similarities, apoptosis has been widely used to understand the immun system reactions and/or toxic respond created by metals, pesticides and parasites in invertebrates as well as is used as an indicator of many answers in higher organisms. Apoptosis has characteristics such as chromatin condensation, cell shrinkage and DNA fragmentation and these differences can be verified by TUNEL assay and caspase activation in addition to histologic studies. TUNEL assay is based on the observation of DNA fragmentation and DNA strand breaks leaving 3′-OH end groups. In this technique, apoptotic cells can be distinguished from other cell deaths thanks to characteristic specialized changes, i.e. typically intensely purple blue masses variable in size and rounded or oval bodies (Wijsman et al., 1993; Strater et al., 1996). Caspase family plays a key role in the management of signal transmission in both extrinsic and intrinsic apoptotic pathways. It is synthesized as inactive pro-enzymes (zymogens) and is activated by proteolytic cleavage (Salvesen and Dixit, 1997). Caspases are generally classified at two groups as initiator caspases: −2, −8, −9, and −10 and executioner caspases: −3, −6, and −7 in mammalia. Although the apoptotic genes functioning in invertebrata appear to be based on the similar system as that previously described for vertebrates, apoptosis in bivalve molluscs exhibits some differences with various environmental stress such as metal and pesticide pollutants and pathogens. According to the results of a study that examined the effect of these variations on the caspase family, while the initiator caspases are classified with caspase-2-like and caspase-8-like genes, the executioner group was composed of 4 members, called caspase-3/7–1, −3/7–2, −3/7–3 and −3/ 7–4, showing similarities with caspase-3/7 (Romero et al., 2011).
7
In this study, increases in caspase gene expression and TUNEL immunoreactivity in the tissues of mussels more exposed to environmental contaminants were found in confirmation to histopathological changes, especially in hepatopancreas tissue. Hepatopancreas more affected by organic and inorganic pollutants beause it is metabolically active region where many vital biological events ocur. Apoptosis is an essential process to eliminate defects caused by these agents in mussel (Usheva et al., 2006; EI-Shenawy et al., 2009). The observed high expression of caspase-2 and caspase-8 in both Aliaga and Foca hepatopancreas tissues compared to controls might explained by the apoptosis process metals-induced. Similarly, all executioner caspases of both area hepatopancreas tissue expression were significantly upregulated in comparison with control except for caspase-3/7–3 gene of Aliaga. Given caspase expression of gill tissue, significant increase in caspase-2 and caspase-3/7–4 of Aliaga where intense industrial and shipping activities is an expected result. However, although commonly observed TUNEL immunoreactivity in gill tissue, downregulation of caspase-8 gene in Aliaga and caspase-8 and caspase-2 genes in Foca can be associated with preference other apoptotic pathway. It is a remarkable details that appearance of a decrease or no change in executioner caspases between them. One plausible answer is to the clarify of this case that each executioner caspase are specialized to manage a different warning. This review supports the view that can vary between organisms of executioner caspase and they encode different proteins rather than different isoforms of the same protein put forward by Romero et al. (2011). Recent years, several researches has been performed about impairment of ecosystem in Aliaga Bay for both biological aspects and change in content of the pollutants such as metals and pesticides and frequency of
Fig. 7. TUNEL expression alterations in the hepatopancreas tissue of mussels, M. galloprovincialis L. A (40X), B (100X) Mussels of Foca area. C (40X), D (100X) Mussels of Aliaga area. E (40X), F (100X) Mussels of Urla area as control.
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
8
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
micronuclei in the tissues of several marine organisms (Küçüksezgin et al., 2008; Esen et al., 2010; Sen et al., 2010; Pazi, 2011; Neşer et al., 2012). With this in mind, in general our results agree with previous studies assessment of pollution level using mussel as a bioindicator species in coastal environments all over the World (Widdows et al., 1981; Schiedek et al., 2006; Moschino et al., 2011; Dallas et al., 2013). Similarly, the highest pollution concentration was observed in the mussel digestive gland as compared to gill by histochemical and analytical techniques (Domouhtsidou and Dimitriadis, 2000; Box et al., 2007; Lima et al., 2007). In conclusion, this is the first report to show the impact on M. galloprovincialis L. tissue of pollution in Aliaga and Foca area. Although different polluting potential of the two regions, histolopathology, TUNEL and caspase test results were found to be similar. The overall results showed that hepatopancreas is more sensitive than the gill damage caused by environmental pollutants. These tissues might be used as an early warning system and monitoring of pollution in marine ecosystem. However, it is recommended that further studies are required to determine whether a threat to human of mussels which consumed as food. Declaration of interest The authors declare no conflicts of interest. Acknowledgement The study is supported by Ege University BAP project (2012ÇSUAM-003). References Box, A., Sureda, A., Galgani, F., Pons, A., Deudero, S., 2007. Assessment of Environmental Pollution at Balearic Islands Applying Oxidative Stress Biomarkers in The Mussel Mytilus galloprovincialis. Comp. Biochem. Physiol. C 146, 531–539. Cajaraville, M.P., Bebianno, M.J., Blaso, J., Porte, C., Sarasquete, C., Viarengo, A., 2000. The use of biomarkers to assess the impact pollution in coastal environments of the Iberian Peninsula: a practical approach. Sci. Total Environ. 247, 295–311. Carles, D., Henry, M., Siron, R., Giusti, G., 1986. Induction of ultrastructural alterations in the digestive gland of Mytilus galloprovincialis(L.) by crude oil. In: CS, G., J-M, D.H. (Eds.), Strategies and advanced techniques for marine pollution studies: Mediterranean Sea. NATO ASI Series, Springer-Verlag, Berlin Heidelberg G9, pp. 461–462. Dallas, L.J., Cheung, V.V., Fisher, A.S., Jha, A.N., 2013. Relative sensitivity of two marine bivalves for detection of genotoxic and cytotoxic effects: A field assessment in the Tamar Estuary, South West England. Environ. Monit. Assess. 185, 3397–3412. Depledge, M.H., 1994. The rational basis for the use of biomarkers as ecotoxicological tools. In: Fossi, M.C., Leonzio, C. (Eds.), Nondestructive biomarkers in vertebrates. Lewis Publishers, Boca Raton, pp. 261–285. Domouhtsidou, G.P., Dimitriadis, V.K., 2000. Ultrastructural Localization of Heavy Metals (Hg, Ag, Pb, and Cu) in Gills and Digestive Gland of Mussels, Mytilus galloprovincialis (L.). Arch. Environ. Contam. Toxicol. 38, 472–478. EI-Shenawy, N.S., Moawad, T.I.S., Mohallal, M.E., AbdelNabi, I.M., Taha, I.A., 2009. Histopathologic biomarker response of clam Ruditapes decussates to organophosphorus pesticide Reldan and Roundup: A laboratory study. Ocean Sci. J. 44 (1), 27–34. Esen, E., Küçüksezgin, F., Uluturhan, E., 2010. Assessment of trace metal pollution in surface sediments of Nemrut Bay, Aegean Sea. Environ. Monit. Assess. 160, 257–266. Gomez-Mendikute, A., Elizondo, M., Venier, P., Cajaraville, M.P., 2005. Characterization of mussel gill cells in vivo and in vitro. Cell Tissue Res. 321, 131–140. Gosling, E., 2003. Bivalve molluscs –Biology, Ecology and Culture. Blackwell, United Kingdom. Hellawell, J.M., 1986. Biological Indicators of Freshwater Pollution and Environmental Management. Applied Science Publishers, London. Kerr, J.F., Wyllie, A.H., Currie, A.R., 1972. Apoptosis: A basic biological phenomenon with wide-ranging implications in tissue kinetics. Br. J. Cancer 26, 239–257. Küçüksezgin, F., Kayatekin, B.M., Uluturhan, E., Uysal, N., Acikgoz, O., Gonenc, S., 2008. Preliminary Ġnvestigation of Sensitive Biomarkers of Trace Metal Pollution in Mussel (Mytilus galloprovincialis) From Izmir Bay (Turkey). Environ. Monit. Assess. 141, 339–345. Lima, I., Moreira, S.M., Osten, J., Soares, A.M.V.M., Guilhermino, L., 2007. Biochemical Responses of the Marine Mussel Mytilus galloprovincialis to Petrochemical Environmental Contamination Along The North-Western Coast of Portugal. Chemosphere 66, 1230–1242. Lionetto, M.G., Caricato, R., Giordano, M.E., Pascariello, M., Marinosci, L., Schettino, T., 2003. Integrated use of biomarkers (acetylcholinesterase and antioxidant enzymes activities) in Mytilus galloprovincialis and Mullus barbatus in an Italian coastal marine area. Mar. Pollut. Bull. 46, 324–330. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods 25, 402–428.
Micic, M., Bihari, N., Labura, Z., Muller, W., Batel, R., 2001. Induction of apoptosis in the blue mussel Mytilus galloprovincialis by tri-n-butyltin chloride. Aquat. Toxicol. 55, 61–73. Moschino, V., Delaney, E., Meneghetti, F., Da Ros, L., 2011. Biomonitoring approach with mussel Mytilus galloprovincialis (Lmk) and clam Ruditapes philippinarum (Adams and Reeve, 1850) in the Lagoon of Venice. Environ. Monit. Assess. 177, 649–663. Neşer, G., Kontas, A., Ünsalan, D., Uluturhan, E., Altay, O., Darılmaz, E., Küçüksezgin, F., Tekoğul, N., Yercan, F., 2012. Heavy metals contamination levels at the Coast of Aliağa (Turkey) ship recycling zone. Mar. Pollut. Bull. 64, 882–887. Nolan, C., Duke, E., Lorenzon, G., Sabbioni, E., Marafante, E., 1984. Heavy metal uptake and intracellular binding in isolated gill preparations of Mytilus galloprovincialis L. Sci. Total Environ. 40, 83–92. Owen, G., 1973. The fine structure and histochemistry of the digestive diverticula of the protobranchiate bivalve Nucula sulcata. Proc. R. Soc. Lond. B 183, 249–264. Pazi, I., 2011. Assessment of heavy metal contamination in Candarli Gulf sediment, Eastern Aegean Sea. Environ Monit Assess. 174, 199–208. Perry, K., Lynn, J., 2009. Detecting physiological and pesticide-induced apoptosis in early developmental stages of invasive bivalves. Hydrobiologia 628, 153–164. Rainbow, P.S., 1996. Biomonitoring of heavy metal availability in the marine environment. Environ. Pollut. 94, 244. Regoli, F., 1998. Trace metals and antioxidant enzymes in gills and digestive gland of the mediterranean mussel Mytilus galloprovincialis. Arch. Environ. Contam. Toxicol. 34 (1), 48–63. Romero, A., Este'vez-Calvar, N., Dios, S., Figueras, A., Novoa, B., 2011. New Insights into the Apoptotic Process in Mollusks: Characterization of Caspase Genes in Mytilus galloprovincialis. PLoS One 6 (2), 17003. Salvesen, G.S., Dixit, V.M., 1997. Caspase activation: The induced-proximity model. Cell 91, 443–446. Santos, L.H.M.L.M., Araujo, A.N., Fachini, A., Pena, A., Deleure-Matos, C., Montene-gro, M.C.B.S.M., 2010. Ecotoxicological aspects related to the presence of pharmaceuticals in the aquatic environment. J. Hazard. Mater. 175, 45–95. Schiedek, D., Broeg, K., Barsiene, J., Lehtonen, K.K., Gercken, J., Pfeifer, S., Vuontisjärvi, H., Vuorinen, P.J., Dedonyte, V., Koehler, A., Balk, L., Schneider, R., 2006. Biomarker responses as indication of contaminant effects in blue mussel Mytilus edulis and female eelpout Zoarces viviparous from the southwestern Baltic Sea. Mar. Pollut. Bull. 53, 387–405. Schwartzman, R.A., Cidlowski, J.A., 1993. Apoptosis: the biochemistry and molecular biology of programmed cell death. Endocr. Rev. 14, 133–151. Sen, A., Ulutas, O.K., Tutuncu, B., Ertas, N., Cok, I., 2010. Determination of 7ethoxyresorufin-o-deethylase (EROD) induction in leaping mullet (Lizasaliens) from the highly contaminated Aliaga Bay, Turkey. Environ. Monit. Assess. 165, 87–96. Shugart, L.R., McCarthy, J.F., Halbrool, R.S., 1992. Biological markers of environmental and ecological contamination: an overview. Risk Analysis. 12, 353–360. Snedecor, G.W., Cochran, W.G., 1968. Statistical Methods. Oxford and IBD Publishing, Calcutta. Sponza, D., Karaoğlu, N., 2002. Environmental geochemistry and pollution studies of Aliağa metal industry district. Environ. Int. 27, 541–553. Sreeram, M.P., Menon, N.R., 2005. Histopathological changes in the hepatopancreas of the penaeid shrimp Metapenaeus dobsoni exposed to petroleum hydrocarbons. J. Mar. Biol. Assoc. India 47, 160–168. Strater, J., Walczak, H., Krammer, P.H., Moller, P., 1996. Simultaneous in situ detection of mRNA and apoptotic cells by combined hybridization and TUNEL. J. Histochem. Cytochem. 44, 1497–1499. Sunila, I., 1987. Histopathology of mussels (Mytilus edulis L.) from the Tvarminne area, the Gulf of Finland (Baltic Sea). Ann. Zool. Fenn. 24, 55–69. Sweet, L.I., Passino-Reader, Meier, P.G., Omann, G.M., 1999. Xenobiotic Ġnduced Apoptosis: Significance and Potential Application As A General Biomarker of Response. Biomarkers 4, 237–253. Terahara, K., Takahashi, K., 2008. Mechanisms and Ġmmunological Roles of Apoptosis in Molluscs. Curr. Pharm. Des. 14, 131–137. Tittel, J.N., Steller, H., 2000. A comparison of programmed cell death between species. Genome Biol. 1, 1–6. Tsangaris, C., Strogyloudi, E., Papathanassiou, E., 2004. Measurements of biochemical markers of pollution in mussels Mytilus galloprovincialis from coast areas of the Saronikos Gulf. Mediterr. Mar. Sci. 5, 175–186. Usheva, L.N., Vaschenko, M.A., Durkina, V.B., 2006. Histopathology of the digestive gland of bivalve mollusk Crenomytilus grayanus (Dunker 1853) from South Western Peter, The great Bay, Sea of Japan. Russ. J. Mar. Biol. 32, 166–172. Viarengo, A., Canesi, L., 1991. Mussels as biological indicators of pollution. Aquaculture 94, 225–243. Widdows, J., Donkin, P., 1992. Mussels and environmental contaminants: bioaccumulation and physiological aspects. In: Gosling, E. (Ed.), The Mussel Mytilus: Ecology, Physiology, Genetics and culture. Elsevier Press, Amsterdam, pp. 383–464. Widdows, J., Bayne, B.L., Donkin, P., Livingstone, D.R., Lowe, D.M., Moore, M.N., Salked, P.N., 1981. Measurement of the responses of mussels to environmental stress and pollution at Sullon Voe: a base-line study. Proc. R. Soc. Edinb. 80, 323–383. Wijsman, J.H., Jonker, R.R., Keijzer, R., van de Velde, C.J.H., Cornelisse, C.J., van Dierendonck, J.H., 1993. A new method to detect apoptosis in paraffin sections: In situ end-labeling of fragmented DNA. J. Histochem. Cytochem. 41, 7–12. Wu, R.S.S., Siu, W.H.L., Shin, P.K.S., 2005. Induction, adaptation and recovery of biological responses: Implications for environmental monitoring. Mar. Pollut. Bull. 51, 623–624. Yonge, C.M., 1926. The digestive diverticula in the lamellibranchs. Trans. R. Soc. Edinb. 54, 703–718.
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
Contents lists available at ScienceDirect
Marine Pollution Bulletin journal homepage: www.elsevier.com/locate/marpolbul
Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants Altuğ Yavaşoğlu a, Dilara Özkan b, Adem Güner b, Selma Katalay c, Fatih Oltulu a, N.Ülkü Karabay Yavaşoğlu b,d,⁎ a
Ege University, Faculty of Medicine, Department of Histology and Embriology 35100 Bornova-, Izmir, Turkey Ege University, Faculty of Science, Department of Biology 35100 Bornova-, Izmir, Turkey Celal Bayar University, Faculty of Science and Art, Department of Biology Muradiye-, Manisa, Turkey d Ege University, Center for Drug Research & Development and Pharmacokinetic Applications 35100 Bornova-, Izmir, Turkey b c
a r t i c l e
i n f o
Article history: Received 15 March 2016 Received in revised form 30 May 2016 Accepted 31 May 2016 Available online xxxx Keywords: Mytilus galloprovincialis L. apoptosis histopathology TUNEL assay caspase RT-PCR
a b s t r a c t Marine bivalve mussels, especially Mytilus species are an earlywarning system used for determining of damage caused by the various aquatic pollutions. In the present study, Mytilus galloprovincialis L. (black mussel) have been utilised as a biomonitoring organism to reveal environmental pollution in the Aliaga, Foca and Urla where located along the Izmir Coast of Turkey. Mussels were collected at these areas and gill and hepatopancreas (digestive gland) tissues were excised. mRNA expressions of initiator (caspase-2 and −8) and executioner (caspase −3/7–1, −3/7–2, −3/7–3 and −3/7–4) caspases of mussels tissues in areas exposed to pollution agent have been observed. TUNEL immunoreactivity in paralel to histopathological changes in both Aliaga and Foca areas were compared with Urla. This study is the first report to reveal the pollution with apoptotic expression on mussels in the coast of Turkey. © 2016 Elsevier Ltd. All rights reserved.
1. Introduction Environmental pollution has emerged as an ever-growing problem with the development of technology and industrialization. However, ecotoxicology has gained popularity to protect endangered species against threats caused by pollution in more recent times (Shugart et al., 1992; Santos et al., 2010). Pollution-exposed organisms in the ecosystem such as land, air and sea may react in various ways. Although potential risks of various pollutants in seas and oceans were determined by chemical parameters, these values were not much idea about their effects on viability (Depledge, 1994; Tsangaris et al., 2004; Wu et al., 2005). The majority of immobile organisms living on the bottom have used as bioindicators of pollution in aquatic ecosystems. At this method, response generated against chemicals accumulating in body fluids, cells or tissues of organisms is based measuring the biochemical and cellular bases (Hellawell, 1986; Rainbow, 1996). Because of the mussels such as Mytilus galloprovincialis L. (black mussel) is a sessile, selective filterfeeding sedentary organism and widely distributed as well as have a big capacity to accumulate pollutants (pesticides, hydrocarbons, metals, etc.), they are one of the most convenient indicator organisms using for monitoring the toxicity and risk in the coastal environments in recent years (Viarengo and Canesi, 1991; Cajaraville et al., 2000). ⁎ Corresponding author at: Ege University, Faculty of Science, Department of Biology, 35100 Bornova, Izmir, Turkey. E-mail address: [email protected] (N.Ü.K. Yavaşoğlu).
Apoptosis is a tightly regulated stepwise progression that leads to disruption of cell content via exrinsic or intrinsic pathway by various environmental or natural stressors in both vertebrates and invertebrates (Tittel and Steller, 2000). Cells undergo apoptosis are characterized by a series of morphological and biochemical changes such as protein cleavage, cell shrinkage with smaller cells in size, the dense of cytoplasm, degradation of DNA which is often used to identify an apoptotic cell (Kerr et al., 1972; Schwartzman and Cidlowski, 1993). Caspase proteins are synthesized in the early stages of apoptosis and these proteins are involved in the hydrolysis of many cellular components. Caspases depending on their function in the apoptotic process are classified as the initiator (casp-2 or − 8) and effector (casp-3 or −7). Caspases in the heart of apoptosis has two basic tasks as transmitting the cell death signal and fragmentation of many cellular proteins that cause changes in apoptosis (Salvesen and Dixit, 1997). With this in mind, apoptosis is one of the important vehicles used for monitoring the pollution in many aquatic organisms. Changes in apoptosis-related proteins have been studied intensively in many aquatic species, especially in M. galloprovincialis L. (Micic et al., 2001; Perry and Lynn, 2009). DNA damage which indicator of cumulative cells damage of hepatopancreas (digestive gland) or gill in mussels can be detected with various types of caspase activity and the TUNEL (tdt-mediated dUTP nick-end labeling) assays. Aliaga where located along the Aegean Coast and northwest of Izmir municipality has become the industrial city losing its agricultural character with the announcement as heavy industrial area in 1997. There
http://dx.doi.org/10.1016/j.marpolbul.2016.05.084 0025-326X/© 2016 Elsevier Ltd. All rights reserved.
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
2
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
Fig. 1. The study area and sampling stations.
are various industrial facilities for different purposes, including machine-chemical industry, Tüpraş, Petkim (a petro chemistry plant), liquefied gas storage and filling plants, fuel storage and distribution facilities, iron–steel factories, fertilizer factory, electric power plant, ship recycling facilities, paper mills and fertilizer plants. Industrial plants established in Aliaga and Nemrut Bay where the neighboring of Aliaga town and many regions of the province of Izmir meets the water needs from the Güzelhisar Dam. In Foca unlike Aliaga, Gediz river-fed agriculture constitutes a significant portion of the economy and it is one marine protected areas established in Turkey (Sponza and Karaoğlu, 2002; Esen et al., 2010). Various heavy metals and xenobiotics caused by industrial plants located in around and Aliaga Bay can be dangerous to aquatic life. Begin to be included in the food chain of aquatic organisms affected by the pollution poses a risk in terms of all organisms and ultimately agents-not metabolized can reach higher concentrations to other higher organisms. The aim of this study was to assess histopatological effects and the level of apoptosis in M. galloprovincialis L. heptopancreas and gill tissues which are a key ring of this chain collected from different stations. 2. Material and Methods 2.1. Specimen Collection Fifty individuals which about same in size of mussels were collected in October and November 2012 at Aliaga Fishing Ports and Old Foca stations along the coast of the Aegean Sea. For comparative purposes, Urla also situated at a distance of 35 km from Izmir was selected as control
area (Fig. 1). The mussels were kept at +4 ° C in seawater during transfer back to the laboratory, and then the hepatopancreas and gill tissues were excised and immediately frozen in liquid nitrogen and the tissue was stored at −80 °C by using the TriPure Isolation Reagent (Roche Applied Science, Penzberg, Germany). Research have been carried out with the permission of Turkish Republic, General Directorate of Fisheries and Aquaculture of Ministry of Food, Agriculture and Livestock (Number: 83,364,995–67,852,565/140.03.03–3040) and General Directorate of Nature Protection and National Parks of Livestock and Ministry of Forestry and Water Affairs (Number: 80,202,595–488.04/358). 2.2. RNA preparation and RT-PCR Total RNAs collected separately from mussels gill and hepatopancreas were isolated using the TriPure Isolation reagent (Roche, Switzerland, cat. no. 11,667,157,001). The RNA isolation quality was controled by NanoDrop (NanoDrop ND-2000c, Thermo Scientific, USA). From each sample, 1 μg RNA was used for cDNA synthesis. First-strand complementary DNAs (cDNAs) were synthesized with Transcriptor First Strand cDNA Synthesis kit (Roche, cat. no. 04,379,012,001) using total RNA. Primer and probe sets were chosen from the Universal Probe Library (Roche Applied Science). Real-time polymerase chain reaction (RTPCR) analysis of Casp-2, Casp-3/7–1, Casp-3/7–2, Casp-3/7–3, Casp-3/ 7–4 and Casp-8 was performed on the LightCycler v.1.5 instrument (Roche Applied Science). Relative ratios were calculated by normalizing gene expression levels of each sample with the house-keeping gene Beta actin. The primers used are shown in Table 1. Results were expressed as ΔCt (Livak and Schmittgen, 2001).
Table 1 The primers and genes used for measuring the expression level of apoptosis. Gene name
Forward pimer
Reverse primer
Beta Actin Casp-2 Casp-3/7–1 Casp-3/7–2 Casp-3/7–3 Casp-3/7–4 Casp-8
5’AACCGCCGCTTCTTCATCTTC 5’GATATATGACAAGGGTGGCAATG 5’GATCTTGGAAGTGGTGTAGAACG 5’CCTGTAGAGGAGGAGGATTAGGAC 5’CAATGTGTAAAAACGAGAGACATTG 5’GATTTCCTTGAAGTCTTTTCTACGTC 5’CCCAACCAGTAGTAACACCAGAC
5’TACCACCAGACAAGACGG 5’GACTTTACAGCATCCAGGACATC 5’CACTGCTAGGAAATCTGCTTCAT 5’GGAAGGATCCATAACCAGCAG 5’GTTAGTATATGCCCACTGTCCATTC 5’AATATCATCGTCTTCCTGGATGTTAT 5’GTATGAACCATGCCCCTATATCA
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx Table 2 Lengths, widths and weights averages of mussels, M.galloprovincialis L.
Urla Foca Aliaga
Length (cm)
Width (cm)
Weight (gr)
4.82 ± 0.36 4.78 ± 0.13 4.31 ± 0.09
2.64 ± 0.12 2.97 ± 0.10 2.73 ± 0.09
2.71 ± 0.08 2.85 ± 0.12 2.82 ± 0.24
Values are presented mean ± SEM.
2.3. Histological Examination For light microscopic examination, gills and hepatopancreas were fixed by 4% paraformaldehyde (Sigma Chemical, St.Louis, MO) for 24 h, at 48 °C and processed for embedding in paraffin wax using routine protocols. After routine processing, paraffin sections of each tissue were cut into 5 μm thickness and stained with haematoxylin and eosin (H&E). 2.4. Analysis of Apoptosis in Tissue Section Apoptosis in the hepatopancreas and gill cells was defined and quantitated as previously described by Promega DeadEnd™ Colorimetric
3
Apoptosis Detection System (TUNEL) (Promega Corp., Madison, U.S.A., Cat No: G7130). For TUNEL, cells were fixed in 4% paraformalde-hyde solution for 25 min at room temperature, rinsed in phosphate buffered saline (PBS) and permeabilized by immersing the slides in 20 μg/ml Proteinase K solution. Tissues were incubated with terminal deoxynucleotidyl transferase (rTdT) reaction mixture containing biotinylated nucleotides and rTdT at 37 °C for 60 min, rinsed with sodium chloride-sodium citrate buffer (SSC) and PBS. Streptavidin horseradish peroxidase (HRP) was added to each slide and incubates for 30 min at room temperature. Slides were then stained with diamino benzidyne system (DAB). For each group, a minimum of 2000 cells were assessed.
2.5. Statistical Analyses The weight, width and height averages of the mussels were presented as the mean ± standard error mean (SEM). Comparisons of tissue expression analyses results were made between control area and other areas using one-way analysis of variance (ANOVA) followed by a Tukey post hoc test. Values of p ≤ 0.05 were regarded as statistically significant (Snedecor and Cochran, 1968).
Fig. 2. Histopathological alterations in the hepatopancreas of mussels, M. galloprovincialis L. H&E stain; A (40X), B (100X) Mussels of Foca area: degeneration in the digestive tubules (dt) and cell loss due to necrosis (*), hemolytic widespread infiltration (hi) in the connective tissue (ct) as well as pyknotic nuclei (pn) in epithelial cells (ec). C (20X), D (100X) Mussels of Aliaga area: cell loss due to necrosis (*) and hemolytic widespread infiltration (hi) in the connective tissue (ct). E (40X), F (100X) Mussels of Urla area as control.
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
4
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
Fig. 3. Histopathological alterations in the gill tissue of mussels, M.galloprovincialis L. H&E stain; A (40X), B (100X) Mussels of Foca area: ciliar (s) degeneration and erosion in the lateral (LB) and frontal regions (FB) and cellular swelling (*) in the epithelial cells (ge). C (40X), D (100X) Mussels of Aliaga area: contractions and adhesions in the hemo-lymphatic vessels (v) with ciliar erosion (s). E (40X), F (100X) Mussels of Urla area as control.
3. Results 3.1. Weights, widths and heights of mussels The total tissue weights of the collected mussels were scaled with precision scales, the lengths and widths of them with a ruler were measured and the average was taken. The results are shown in Table 2. 3.2. Histopathological findings Histological changes were observed in the hepatopancreas and gills of mussels compared with control. While digesive tubules, tubular epithelial cells and stromal connective tissues in the hepatopancreas collected from Urla has a normal appearance [Fig. 2(E-F)], degeneration in the digestive tubules and cell loss due to necrosis in the hepatopancreas tissue from Foca was observed [Fig. 2(A-B)]. At the same time, eosinophilic cytoplasm and pyknotic nuclei in epithelial cells and hemolytic widespread infiltration in the connective tissue in addition
to the loss of tubule epithelial integrity was determined. However, in the hepatopancreas of Aliaga mussel, vacuolar degeneration and cell loss due to necrosis as well as hemolytic infiltration in the vesicular connective tissue was monitored, although preserving tubular epithelial integrity in the digestive tubules [Fig. 2(C-D)]. Histological structure such as cilia, hemo-lymphatic vessels and gills had normal appearance without major pathological alterations except some degenerative changes in the epithelial cells in the most of the examined mussels of Urla [Fig. 3(E-F)]. In Foca unlike Urla, degeneration, necrotic changes and cellular swelling in the epithelial cells of the frontal region of the gill filaments has been identified. Similarly, contractions and adhesions in the hemo-lymphatic vessels in parallel to ciliar degeneration and erosion in the lateral and frontal regions are remarkable [Fig. 3(A-B)]. When compared to control, in Aliaga-mussels, contractions and adhesions in the hemolymphatic vessels with ciliar erosion has been reported although the epithelial cells of the frontal and lateral regions of the gill filaments has normal histological appearance [Fig. 3(C-D)].
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
5
Fig. 4. Initiator caspases genes (Caspase-2, Caspase-8) expression levels of mussel tissues. * Statistically significant difference from control area (Urla) (p b 0.05).
3.3. Determination of Gene Expression Profile and TUNEL assay The caspase activities results suggest that apoptotic process which resulted in the death of cells can not be repaired has begun in the hepatopancreas and gill tissues of Aliaga and Foca mussels [Figs. 4 and 5]. Initiator caspase-2 and caspase-8 showed the highest expression values, reaching a 12 and 8-fold change maximum value over the control in Aliaga-gill and hepatopancreas tissue, respectively. While executioner caspase-3/7–1, − 3/7–2, − 3/7–3 and −3/7–4 exhibited control close changes in Foca-gill tissue, especially caspase-3/7–3 was significantly inhibited as well as caspase-3/7–4 showed the highest expression values in Aliaga-gill tissue. Expression of all executioner caspase tends to show an increased expression in Aliaga and Foca-hepatopancreas tissues. By labeling the terminal end of nucleic acids, TUNEL is a quantitative method to determine cells undergoing apoptosis. When compared with control animals [Figs. 6(E-F), 7(E-F)], there were significantly higher in gills and hepatopancreas tissue of mussels of both Aliaga and Foca in terms of immunoreactive cells. Foça region [Fig. 6(A-B)] is represented showing more common immunoreactivity according to hepatopancreas
tissues of Aliaga [Fig. 6(C-D)]. Similarly, TUNEL expression in gill cells was observed less in Aliaga mussels [Fig. 7(C-D)] as compared with Foca mussels [Fig. 7(A-B)]. 4. Discussion Hepatopancreas and gill tissues of mussel are the main biomonitoring tools used for evaluation of environmental pollutants on a marine ecosystem taking into account criteria such as damage of tissues, membranes lipid peroxidation, protein damages and DNA alteration. Also, these organs are the junction involved in nutrition, respiration, absorption, digestion, and enzymatic activity and the prosses of accumulation and biotransformation of toxic contaminants into the water (Regoli, 1998; Lionetto et al., 2003; Gomez-Mendikute et al., 2005). In this study, the size of the pollution in Aliaga and Foca are interpreted by considering histopathological changes and gene expression profiles in mussel hepatopancreas and gill tissues. Histopathological examinations are rapid, easily, operated, reliable, comparatively inexpensive and sensitive techniques used in the interpretation of tissue changes against stress caused by pollution indicator.
Fig. 5. Effector caspase genes (Caspase-3/7–1, Caspase-3/7–2, Caspase-3/7–3 and Caspase-3/7–4) expression levels of mussel tissues. * Statistically significant difference from control area (Urla) (p b 0.05).
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
6
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
Fig. 6. TUNEL expression alterations in the hepatopancreas tissue of mussels, M. galloprovincialis L. A (40X), B (100X) Mussels of Foca area. C (40X), D (100X) Mussels of Aliaga area. E (40X), F (100X) Mussels of Urla area as control.
The other major advantages of this method are provide a comparative analysis of lasting effect, the mechanism of action and the severity of stress in stressed organism (Sreeram and Menon, 2005). Hepatopancreas consists of several digestive tubules held together by a fine fibrous connective tissue. The digestive tubule which involved in digestion and absorption is lined by two kinds of cells, the digestive and basophilic cells as well as the distal blind ending. Also, gill curtain-like structures consisting of parts numerous W-shaped (or double V) filaments which take shape two demibranchs as well as branchial nerve and branchial haemolymph vessels along the dorsal margin of the mantle. Each demibranch (V) is comprised of inner descending (gill axis) and outer ascending lamella (Yonge, 1926; Owen, 1973; Sunila, 1987; Gosling, 2003). In present investigation, digestive tubules and epithelial cells of digestive glands of M. galloprovincialis L. collected from Urla (control group) was healtful and the length of them was normal and equal. At the same time there was no change in stromal connective tissue. While damage and disruption in digestive tubules in Foca mussels was observed, integrity of digestive tubules for Aliaga mussels was preserved. This phenomenon can be explained that the cells of digestive tubule by showing different sensitivity to pollutant indicators. However, serious dysfunction such as pyknotic nuclei and eosinophilic cytoplasm in epithelial cells as well as irregularities in vesicular connective tissue cells resulting in haemocyte infiltration and tissue necrosis on both Aliaga and Foca mussels has been demonstrated. Haemocytes,
dysfunction of ciliated epithelial cells, swelling and hyperplasia of haemolymph channels in gill are important signs of exposure to potentially harmful. Appearance of these formations (or granuloma) was reported more frequently in Foca gill tissue than in Aliaga mussels in this study. The source of these differences compared to control may be related to accumulate both metals in gill and hepatopancreas and different metals in the same tissue of mussels in different regions. Similar histopathological changes in hepatopancreas and gills were recorded by earlier workers on bivalves exposed to variety of pollutants (Nolan et al., 1984; Carles et al., 1986; Widdows and Donkin, 1992). There are still missing pieces to reveal a detailed mechanistic map of histological studies which performed to express of the cell response suchs as single strand breaks and the production of free radicals caused by environmental toxic stimuli. The apoptotic process of cell is considered to be one of the best methods used to elucidate this mechanism (Sweet et al., 1999; Terahara and Takahashi, 2008). Apoptosis or programmed cell death is an important crossroads in managing critical events such as eliminate abnormal cells, maintenance of tissue homeostasis; respond to environmental toxicants in both vertebrates and invertebrates. Apoptotic program of cells have been intensively worked in many models such as Caenorhabditis and Drosophila and consequently the signaling pathways involved in processes that lead to apoptosis in molluscs cells has shown a strong connection in terms of molecular and functional similarity with those seen in vertebrates (Romero et al.,
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
2011). In the light of these similarities, apoptosis has been widely used to understand the immun system reactions and/or toxic respond created by metals, pesticides and parasites in invertebrates as well as is used as an indicator of many answers in higher organisms. Apoptosis has characteristics such as chromatin condensation, cell shrinkage and DNA fragmentation and these differences can be verified by TUNEL assay and caspase activation in addition to histologic studies. TUNEL assay is based on the observation of DNA fragmentation and DNA strand breaks leaving 3′-OH end groups. In this technique, apoptotic cells can be distinguished from other cell deaths thanks to characteristic specialized changes, i.e. typically intensely purple blue masses variable in size and rounded or oval bodies (Wijsman et al., 1993; Strater et al., 1996). Caspase family plays a key role in the management of signal transmission in both extrinsic and intrinsic apoptotic pathways. It is synthesized as inactive pro-enzymes (zymogens) and is activated by proteolytic cleavage (Salvesen and Dixit, 1997). Caspases are generally classified at two groups as initiator caspases: −2, −8, −9, and −10 and executioner caspases: −3, −6, and −7 in mammalia. Although the apoptotic genes functioning in invertebrata appear to be based on the similar system as that previously described for vertebrates, apoptosis in bivalve molluscs exhibits some differences with various environmental stress such as metal and pesticide pollutants and pathogens. According to the results of a study that examined the effect of these variations on the caspase family, while the initiator caspases are classified with caspase-2-like and caspase-8-like genes, the executioner group was composed of 4 members, called caspase-3/7–1, −3/7–2, −3/7–3 and −3/ 7–4, showing similarities with caspase-3/7 (Romero et al., 2011).
7
In this study, increases in caspase gene expression and TUNEL immunoreactivity in the tissues of mussels more exposed to environmental contaminants were found in confirmation to histopathological changes, especially in hepatopancreas tissue. Hepatopancreas more affected by organic and inorganic pollutants beause it is metabolically active region where many vital biological events ocur. Apoptosis is an essential process to eliminate defects caused by these agents in mussel (Usheva et al., 2006; EI-Shenawy et al., 2009). The observed high expression of caspase-2 and caspase-8 in both Aliaga and Foca hepatopancreas tissues compared to controls might explained by the apoptosis process metals-induced. Similarly, all executioner caspases of both area hepatopancreas tissue expression were significantly upregulated in comparison with control except for caspase-3/7–3 gene of Aliaga. Given caspase expression of gill tissue, significant increase in caspase-2 and caspase-3/7–4 of Aliaga where intense industrial and shipping activities is an expected result. However, although commonly observed TUNEL immunoreactivity in gill tissue, downregulation of caspase-8 gene in Aliaga and caspase-8 and caspase-2 genes in Foca can be associated with preference other apoptotic pathway. It is a remarkable details that appearance of a decrease or no change in executioner caspases between them. One plausible answer is to the clarify of this case that each executioner caspase are specialized to manage a different warning. This review supports the view that can vary between organisms of executioner caspase and they encode different proteins rather than different isoforms of the same protein put forward by Romero et al. (2011). Recent years, several researches has been performed about impairment of ecosystem in Aliaga Bay for both biological aspects and change in content of the pollutants such as metals and pesticides and frequency of
Fig. 7. TUNEL expression alterations in the hepatopancreas tissue of mussels, M. galloprovincialis L. A (40X), B (100X) Mussels of Foca area. C (40X), D (100X) Mussels of Aliaga area. E (40X), F (100X) Mussels of Urla area as control.
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084
8
A. Yavaşoğlu et al. / Marine Pollution Bulletin xxx (2016) xxx–xxx
micronuclei in the tissues of several marine organisms (Küçüksezgin et al., 2008; Esen et al., 2010; Sen et al., 2010; Pazi, 2011; Neşer et al., 2012). With this in mind, in general our results agree with previous studies assessment of pollution level using mussel as a bioindicator species in coastal environments all over the World (Widdows et al., 1981; Schiedek et al., 2006; Moschino et al., 2011; Dallas et al., 2013). Similarly, the highest pollution concentration was observed in the mussel digestive gland as compared to gill by histochemical and analytical techniques (Domouhtsidou and Dimitriadis, 2000; Box et al., 2007; Lima et al., 2007). In conclusion, this is the first report to show the impact on M. galloprovincialis L. tissue of pollution in Aliaga and Foca area. Although different polluting potential of the two regions, histolopathology, TUNEL and caspase test results were found to be similar. The overall results showed that hepatopancreas is more sensitive than the gill damage caused by environmental pollutants. These tissues might be used as an early warning system and monitoring of pollution in marine ecosystem. However, it is recommended that further studies are required to determine whether a threat to human of mussels which consumed as food. Declaration of interest The authors declare no conflicts of interest. Acknowledgement The study is supported by Ege University BAP project (2012ÇSUAM-003). References Box, A., Sureda, A., Galgani, F., Pons, A., Deudero, S., 2007. Assessment of Environmental Pollution at Balearic Islands Applying Oxidative Stress Biomarkers in The Mussel Mytilus galloprovincialis. Comp. Biochem. Physiol. C 146, 531–539. Cajaraville, M.P., Bebianno, M.J., Blaso, J., Porte, C., Sarasquete, C., Viarengo, A., 2000. The use of biomarkers to assess the impact pollution in coastal environments of the Iberian Peninsula: a practical approach. Sci. Total Environ. 247, 295–311. Carles, D., Henry, M., Siron, R., Giusti, G., 1986. Induction of ultrastructural alterations in the digestive gland of Mytilus galloprovincialis(L.) by crude oil. In: CS, G., J-M, D.H. (Eds.), Strategies and advanced techniques for marine pollution studies: Mediterranean Sea. NATO ASI Series, Springer-Verlag, Berlin Heidelberg G9, pp. 461–462. Dallas, L.J., Cheung, V.V., Fisher, A.S., Jha, A.N., 2013. Relative sensitivity of two marine bivalves for detection of genotoxic and cytotoxic effects: A field assessment in the Tamar Estuary, South West England. Environ. Monit. Assess. 185, 3397–3412. Depledge, M.H., 1994. The rational basis for the use of biomarkers as ecotoxicological tools. In: Fossi, M.C., Leonzio, C. (Eds.), Nondestructive biomarkers in vertebrates. Lewis Publishers, Boca Raton, pp. 261–285. Domouhtsidou, G.P., Dimitriadis, V.K., 2000. Ultrastructural Localization of Heavy Metals (Hg, Ag, Pb, and Cu) in Gills and Digestive Gland of Mussels, Mytilus galloprovincialis (L.). Arch. Environ. Contam. Toxicol. 38, 472–478. EI-Shenawy, N.S., Moawad, T.I.S., Mohallal, M.E., AbdelNabi, I.M., Taha, I.A., 2009. Histopathologic biomarker response of clam Ruditapes decussates to organophosphorus pesticide Reldan and Roundup: A laboratory study. Ocean Sci. J. 44 (1), 27–34. Esen, E., Küçüksezgin, F., Uluturhan, E., 2010. Assessment of trace metal pollution in surface sediments of Nemrut Bay, Aegean Sea. Environ. Monit. Assess. 160, 257–266. Gomez-Mendikute, A., Elizondo, M., Venier, P., Cajaraville, M.P., 2005. Characterization of mussel gill cells in vivo and in vitro. Cell Tissue Res. 321, 131–140. Gosling, E., 2003. Bivalve molluscs –Biology, Ecology and Culture. Blackwell, United Kingdom. Hellawell, J.M., 1986. Biological Indicators of Freshwater Pollution and Environmental Management. Applied Science Publishers, London. Kerr, J.F., Wyllie, A.H., Currie, A.R., 1972. Apoptosis: A basic biological phenomenon with wide-ranging implications in tissue kinetics. Br. J. Cancer 26, 239–257. Küçüksezgin, F., Kayatekin, B.M., Uluturhan, E., Uysal, N., Acikgoz, O., Gonenc, S., 2008. Preliminary Ġnvestigation of Sensitive Biomarkers of Trace Metal Pollution in Mussel (Mytilus galloprovincialis) From Izmir Bay (Turkey). Environ. Monit. Assess. 141, 339–345. Lima, I., Moreira, S.M., Osten, J., Soares, A.M.V.M., Guilhermino, L., 2007. Biochemical Responses of the Marine Mussel Mytilus galloprovincialis to Petrochemical Environmental Contamination Along The North-Western Coast of Portugal. Chemosphere 66, 1230–1242. Lionetto, M.G., Caricato, R., Giordano, M.E., Pascariello, M., Marinosci, L., Schettino, T., 2003. Integrated use of biomarkers (acetylcholinesterase and antioxidant enzymes activities) in Mytilus galloprovincialis and Mullus barbatus in an Italian coastal marine area. Mar. Pollut. Bull. 46, 324–330. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods 25, 402–428.
Micic, M., Bihari, N., Labura, Z., Muller, W., Batel, R., 2001. Induction of apoptosis in the blue mussel Mytilus galloprovincialis by tri-n-butyltin chloride. Aquat. Toxicol. 55, 61–73. Moschino, V., Delaney, E., Meneghetti, F., Da Ros, L., 2011. Biomonitoring approach with mussel Mytilus galloprovincialis (Lmk) and clam Ruditapes philippinarum (Adams and Reeve, 1850) in the Lagoon of Venice. Environ. Monit. Assess. 177, 649–663. Neşer, G., Kontas, A., Ünsalan, D., Uluturhan, E., Altay, O., Darılmaz, E., Küçüksezgin, F., Tekoğul, N., Yercan, F., 2012. Heavy metals contamination levels at the Coast of Aliağa (Turkey) ship recycling zone. Mar. Pollut. Bull. 64, 882–887. Nolan, C., Duke, E., Lorenzon, G., Sabbioni, E., Marafante, E., 1984. Heavy metal uptake and intracellular binding in isolated gill preparations of Mytilus galloprovincialis L. Sci. Total Environ. 40, 83–92. Owen, G., 1973. The fine structure and histochemistry of the digestive diverticula of the protobranchiate bivalve Nucula sulcata. Proc. R. Soc. Lond. B 183, 249–264. Pazi, I., 2011. Assessment of heavy metal contamination in Candarli Gulf sediment, Eastern Aegean Sea. Environ Monit Assess. 174, 199–208. Perry, K., Lynn, J., 2009. Detecting physiological and pesticide-induced apoptosis in early developmental stages of invasive bivalves. Hydrobiologia 628, 153–164. Rainbow, P.S., 1996. Biomonitoring of heavy metal availability in the marine environment. Environ. Pollut. 94, 244. Regoli, F., 1998. Trace metals and antioxidant enzymes in gills and digestive gland of the mediterranean mussel Mytilus galloprovincialis. Arch. Environ. Contam. Toxicol. 34 (1), 48–63. Romero, A., Este'vez-Calvar, N., Dios, S., Figueras, A., Novoa, B., 2011. New Insights into the Apoptotic Process in Mollusks: Characterization of Caspase Genes in Mytilus galloprovincialis. PLoS One 6 (2), 17003. Salvesen, G.S., Dixit, V.M., 1997. Caspase activation: The induced-proximity model. Cell 91, 443–446. Santos, L.H.M.L.M., Araujo, A.N., Fachini, A., Pena, A., Deleure-Matos, C., Montene-gro, M.C.B.S.M., 2010. Ecotoxicological aspects related to the presence of pharmaceuticals in the aquatic environment. J. Hazard. Mater. 175, 45–95. Schiedek, D., Broeg, K., Barsiene, J., Lehtonen, K.K., Gercken, J., Pfeifer, S., Vuontisjärvi, H., Vuorinen, P.J., Dedonyte, V., Koehler, A., Balk, L., Schneider, R., 2006. Biomarker responses as indication of contaminant effects in blue mussel Mytilus edulis and female eelpout Zoarces viviparous from the southwestern Baltic Sea. Mar. Pollut. Bull. 53, 387–405. Schwartzman, R.A., Cidlowski, J.A., 1993. Apoptosis: the biochemistry and molecular biology of programmed cell death. Endocr. Rev. 14, 133–151. Sen, A., Ulutas, O.K., Tutuncu, B., Ertas, N., Cok, I., 2010. Determination of 7ethoxyresorufin-o-deethylase (EROD) induction in leaping mullet (Lizasaliens) from the highly contaminated Aliaga Bay, Turkey. Environ. Monit. Assess. 165, 87–96. Shugart, L.R., McCarthy, J.F., Halbrool, R.S., 1992. Biological markers of environmental and ecological contamination: an overview. Risk Analysis. 12, 353–360. Snedecor, G.W., Cochran, W.G., 1968. Statistical Methods. Oxford and IBD Publishing, Calcutta. Sponza, D., Karaoğlu, N., 2002. Environmental geochemistry and pollution studies of Aliağa metal industry district. Environ. Int. 27, 541–553. Sreeram, M.P., Menon, N.R., 2005. Histopathological changes in the hepatopancreas of the penaeid shrimp Metapenaeus dobsoni exposed to petroleum hydrocarbons. J. Mar. Biol. Assoc. India 47, 160–168. Strater, J., Walczak, H., Krammer, P.H., Moller, P., 1996. Simultaneous in situ detection of mRNA and apoptotic cells by combined hybridization and TUNEL. J. Histochem. Cytochem. 44, 1497–1499. Sunila, I., 1987. Histopathology of mussels (Mytilus edulis L.) from the Tvarminne area, the Gulf of Finland (Baltic Sea). Ann. Zool. Fenn. 24, 55–69. Sweet, L.I., Passino-Reader, Meier, P.G., Omann, G.M., 1999. Xenobiotic Ġnduced Apoptosis: Significance and Potential Application As A General Biomarker of Response. Biomarkers 4, 237–253. Terahara, K., Takahashi, K., 2008. Mechanisms and Ġmmunological Roles of Apoptosis in Molluscs. Curr. Pharm. Des. 14, 131–137. Tittel, J.N., Steller, H., 2000. A comparison of programmed cell death between species. Genome Biol. 1, 1–6. Tsangaris, C., Strogyloudi, E., Papathanassiou, E., 2004. Measurements of biochemical markers of pollution in mussels Mytilus galloprovincialis from coast areas of the Saronikos Gulf. Mediterr. Mar. Sci. 5, 175–186. Usheva, L.N., Vaschenko, M.A., Durkina, V.B., 2006. Histopathology of the digestive gland of bivalve mollusk Crenomytilus grayanus (Dunker 1853) from South Western Peter, The great Bay, Sea of Japan. Russ. J. Mar. Biol. 32, 166–172. Viarengo, A., Canesi, L., 1991. Mussels as biological indicators of pollution. Aquaculture 94, 225–243. Widdows, J., Donkin, P., 1992. Mussels and environmental contaminants: bioaccumulation and physiological aspects. In: Gosling, E. (Ed.), The Mussel Mytilus: Ecology, Physiology, Genetics and culture. Elsevier Press, Amsterdam, pp. 383–464. Widdows, J., Bayne, B.L., Donkin, P., Livingstone, D.R., Lowe, D.M., Moore, M.N., Salked, P.N., 1981. Measurement of the responses of mussels to environmental stress and pollution at Sullon Voe: a base-line study. Proc. R. Soc. Edinb. 80, 323–383. Wijsman, J.H., Jonker, R.R., Keijzer, R., van de Velde, C.J.H., Cornelisse, C.J., van Dierendonck, J.H., 1993. A new method to detect apoptosis in paraffin sections: In situ end-labeling of fragmented DNA. J. Histochem. Cytochem. 41, 7–12. Wu, R.S.S., Siu, W.H.L., Shin, P.K.S., 2005. Induction, adaptation and recovery of biological responses: Implications for environmental monitoring. Mar. Pollut. Bull. 51, 623–624. Yonge, C.M., 1926. The digestive diverticula in the lamellibranchs. Trans. R. Soc. Edinb. 54, 703–718.
Please cite this article as: Yavaşoğlu, A., et al., Histopathological and apoptotic changes on marine mussels Mytilus galloprovincialis (Lamark, 1819) following exposure to environmental pollutants..., Marine Pollution Bulletin (2016), http://dx.doi.org/10.1016/j.marpolbul.2016.05.084