HIV-1 infection of human placental villous tissue in vitro

Trophoblast Research 12:205-223, 1998

H I V - 1 I N F E C T I O N OF H U M A N P L A C E N T A L VILLOUS TISSUE IN VITRO

Bruno M. Polliotti I, Asad U. Sheikh 1, Shambavi Subbarao 4, Scott S. Keesling 5, George R. Lee 5, Joseph Caba 5, Maurice Panigel 5, Richard Reichman 3, Andr6 J. Nahmias 5 and Richard K. Miller 1'2 1Departments of Obstetrics and Gynecology and 2Environmental Medicine 3Department of Medicine, Division of Infectious Diseases University of Rochester Rochester, New York USA 4National Center for Infectious Diseases Centers for Disease Control and Prevention Atlanta, Georgia USA 5Department of Pediatrics Emory University Atlanta, Georgia USA

INTRODUCTION Fifteen years' intensive investigation of perinatal HIV-1 infection has yielded more questions than answers. Nevertheless, using anti-HIV therapy, the vertical transmission rate from mothers to their offspring has been reduced from 25-30% to 5-8% (ACTG 076, Connor et al., 1994). The reason for the remaining cases of neonatal infection is unknown, but they m a y represent failure of treatment in utero. Materno-fetal transmission of HIV-1 infection does not occur exclusively at delivery; babies detected with HIV-1 in the first eight days of life are considered to have been infected prior to delivery (Ehrnst et al., 1992; Duliege et al., 1995). Vertical transmission of HIV-1 during pregnancy has been observed during the third trimester (Ehrnst et al., 1991) and during early stages of gestation (Maury et al., 1989; Brossard et al., 1995). The placenta plays a combined role as a "barrier", explaining the low transmission rate of HIV-1 to the infants, and as a modulator of infection (Valente and Main, 1990; Miller and Thiede, 1994). Clearly the placenta is an important interface between the infected mother and uninfected fetus, but it m a y also prove to be an infectious reservoir for the fetus (Backe et al., 1993; Brossard et al., 1995). The role of the placenta in protecting or exposing the fetus to infection requires elucidation. The placenta could be infected in utero (Jauniaux et al., 1988), but the factors resulting in infection remain unknown. Factors that produce fetal infection m a y also have a role in producing placental infection. Maternal viral titer has been identified as a significant determinant of mother-to-child HIV-1 transmission (Weiser et al., 1994). Higher viral titers were observed in mothers who transmitted HIV-1 to their offspring (Borkowsky et al., 1994). Vertical transmission is also correlated with the maternal viral 205 9

of Rochester

206

Polliotti et al.

phenotype and the viral genotype. The biological phenotype of the mother's virus (rapid/high growing or slow/low growing viruses) has served as a complementary marker to CD4+ lymphocyte counts and p24 antigenemia in predicting the risk of transmission (Scarlatti et al., 1993). Hypervariable domains (env V1 and V2) are markers of viral genotypes and serve to track viral transmission among individuals (Lamers et al., 1994). Examination of the hypervariable domains has documented transmission of only one or more than one of the maternal viral strains to the fetus (Lamers et al., 1994; Briant et al., 1995). In addition, T-cell line tropism (lymphocyte and macrophage) of maternal virus appears to be involved in the mother-to-child transmission of HIV-1 (Kliks et al., 1994; Reinhardt et al., 1995). Availability of suitable systems would permit study of the importance of these factors in placental infection and provide insight into mechanisms resulting in vertical transmission. Crucial to evaluation of the placental role in modulating fetal HIV-1 infectivity and the relationship of clinical correlates to placental infection is the availability of appropriate in vitro experimental systems which could be easily studied and maintain comparability with in vivo findings. Numerous approaches, including isolated cells, permanent cell lines, placental explants and placental perfusions, have been used. Each model has provided interesting and sometimes contradictory data. Isolated cell cultures are an attractive model to study infection. However, except for fetal and maternal blood cells in the placenta, all other cells are associated in different layers (syncytiotrophoblast, cytotrophoblast, and stroma) and must be "isolated" prior to use. Cell dissociation is achieved by harsh treatment with digestive enzymes (DNase, trypsin, or collagenase). Isolation of undifferentiated trophoblast cells (Mano and Chermann, 1991; Douglas and King, 1994), syncytiotrophoblast (Douglas et al., 1993; T6th et al., 1994), cytotrophoblast cells (Douglas et al., 1991), stromal cells (Schwartz et al., 1995) and Hofbauer cells (Kesson et al., 1993; Melendez-Guerrero et al., 1994) from first, second and third trimester placentae has been reported. These studies demonstrate infection in many of these cell types with several HIV-1 strains. However, HIV-1 infectivity is limited in some cell types such as trophoblast cells (Douglas and King, 1994), possibly reflecting changes in cellular properties resulting from cell isolation. Thus, data gathered from isolated cell studies may have limited applicability to the in vivo state. Trophoblast-derived malignant cell lines, BeWo, JAr, JEG-3 and ENAMI, are frequently used to investigate HIV-1 infection of human placenta. Except for one publication (McGann et al., 1994), studies demonstrate these cells can be infected (Zachar and Ebbesen, 1991; Bourinbaiar and Nagorny, 1993; David et al., 1995). When infectivity of permanent cells is compared with difficulty in infecting primary trophoblast cells, questions are raised concerning differences that occur in primary trophoblast cell cultures and how these differences relate to the in vivo situation. In contrast to isolated cell cultures and permanent cell lines, tissue organ systems like placental explants maintain the normal cell-cell and cell-matrix interactions and are more likely to reflect the in vivo state. Compared to the large number of publications using a variety of isolated cells, few studies have used placental villous explants. First and third trimester tissues (Maury et al., 1989; Amirhessami-Aghili and Spector, 1991) have been reported infected with HIV-1, as monitored by reverse transcriptase activity, p24 antigen production, Western immunoblot detection of gag proteins, and positive PCR amplification of viral DNA. The earlier studies have some inconsistencies and technical limitations. For example, CD4 receptor and CD4 antigen on trophoblast cells have been

HIV-1 Infection of Placental Tissue

207

identified (Maury et al., 1989; Amirhessami-Aghili and Spector, 1991), a finding that later was not replicated (Lairmore et al., 1993). Dual perfusion of the isolated human placental lobule provides the opportunity for studying the transfer of virus from mother to fetus for shorter periods of investigation. Coxsackie B, Echo 11, and cytomegalovirus all have been studied under perfusion conditions for periods of up to 18 hours (Amstey et al., 1988; Mi~hlemann et al., 1995). However, efforts to study HIV-1 have been limited by the technical and logistical constraints. Preliminary studies of a mixture of H1V-1 strains have been performed without the appearance of the HIV-1 in the fetal circuit (Polliotti, unpublished observations), in agreement with the Coxsackie B, Echo 11 and cytomegafovirus studies. The aim of this study was to establish that the placental explant could be infected with HIV-1 in vitro and to explore issues of susceptibility by examination of early (first trimester) and late (third trimester) gestation tissue using three different viral strains. Two strains were well-characterized laboratory varieties of HIV-1 and the third strain was isolated from an infected human neonate. MATERIAL A N D METHODS Chorionic Villus Culture

Human placental villous explants can be cultured for more than six days with good preservation of the structural organization in the different cell layers (Polliotti et al., 1995). The viability of the tissue has been established using glucose consumption, lactate and hCG production, as well as histologic examination using hematoxylin and eosin (H&E) staining. First trimester placental tissue (6-10 weeks) was obtained following vacuum extraction from elective pregnancy terminations for psychosocial reasons. Full term tissue (38-41 weeks) was obtained from vaginal deliveries or cesarean sections of uncomplicated normal pregnancies. All patients were healthy and HIV-1 negative; however, each placenta was also tested for the absence of HIV-1 antibodies in the fetal blood (SUDS HIV-1 test, Murex Diagnostics, Norcross, GA, USA) prior to experimentation. Tissues were obtained after receiving patient consent. The protocols had been approved by the appropriate institutional research review boards. Placentae were collected and prepared in sterile phosphate-buffered saline (PBS) with antibiotics (penicillin and streptomycin, Herndon, VA, USA) on ice at 4~ within 20 minutes of delivery. Tissues were minced into small sections (< l m m 3) and thoroughly rinsed in excess sterile PBS and culture medium (containing antibiotics) to eliminate maternal blood and reduce the risk of contamination by septic manipulation. Villous tissue was then placed in 6-well culture plates containing small Transwell T M inserts (Coming Costar, Cambridge, MA, USA). The tissue was covered with culture medium on the surface of the insert membrane. Culture medium consisted of RPMI 1640 (Mediatech, Herndon, VA, USA), supplemented with 10% fetal calf serum (Mediatech, Herndon, VA, USA), 2 mM L-glutamine, 1 mM pyruvate and antibiotics (100 I U / m l penicillin and 100 mg streptomycin). Tissue samples (approximately 100 mg wet weight) were incubated in a total of 4 ml of medium. The medium was replaced every 24 hours and culture plates were placed on an orbital shaker in a tissue culture incubator (37~ in water-saturated atmosphere containing 5% CO 2 95% O2). On the final day of study, the

208

Polliotti et al.

explants were divided into aliquots. One aliquot was stored at -80~ and the second aliquot fixed in 10% buffered formaldehyde. Placental specimens were also collected immediately before incubations, and paraffin sections were stained (H&E). Viral Strains

Three viral strains were used to infect placental tissue: a lymphocytotropic strain, IIIB (HTLV-IIIB/H9, NIH, Bethesda, MD, USA); a monocytotropic strain, Ba-L (HIV-1 BaL, NIH, Bethesda, MD, USA); and a wild type strain, VI-5 isolated in our laboratory from an infected baby that was HIV-1 positive at birth (by both PCR and viral culture). The HIV-1 wild-type strain was obtained by co-culturing the baby's peripheral blood mononuclear cells (PBMCs) with phytohemagglutinin-A purified (PHA-P) stimulated healthy donor PBMCs (5 ~tg/ml, Sigma, St Louis, IL, USA). The virus obtained from coculture m e d i u m was then cloned using ten-fold successive dilutions. The last dilution with remaining infectivity was regarded as the most infectious and dominant strain. This viral isolate was used to infect a large amount of PHA-stimulated, healthy donor PBMCs in order to produce sufficient virus for all experiments. After production, filtration and concentration b y ultra-centrifugation, virus was aliquoted and stored at -80~ A minimum infectious dose was defined for each virus: it represented the highest dilution of the virus that remained able to infect normal PBMCs (healthy donor PBMCs stimulated with PHA-P). I n f e c t i o n Protocol

Free virus was used instead of co-culture with infected lymphocytes because the inoculum could be completely removed, whereas by co-culture technique the inoculum could not be removed (demonstrated during preliminary experiments). An equivalent dose of each virus (1000X the minimum infectious dose) was added to the culture, and the placental tissue was exposed for 24 hours to the inoculum (free virus). This high dose of viral inoculum was selected to ensure the m a x i m u m chance for infection to occur, and as the m a x i m u m dose that could be completely removed by rinsing based on preliminary studies. After incubation, the tissue was extensively rinsed in an excess of medium (6X 50 ml per well). The contamination by the inoculum was negligible (verified by the absence of p24 in the rinsing and culture medium after 1 hour of incubation and by absence of infection in susceptible cells after exposure to the same media). The culture was continued for five days post-inoculation with replacement of the medium every 24 hours (for a total of six days of culture). Negative control experiments consisted of explants exposed to m e d i u m alone (i.e. virus unexposed) and cultured for a total of six days. Each experimental condition and unexposed control was performed in duplicate in at least three different placentae. Infectivity of the aliquots of virus used in these experiments was confirmed by exposure of susceptible PBMCs to each strain. The cells and m e d i u m were also analyzed for the presence of viral DNA and p24, respectively.

HIV-1 Infection of Placental Tissue

209

p24 Antigen Evaluation Infection of placental tissue was detected using the HIV p24 antigen in the culture supernatant. The supernatant was aliquoted and stored (-80~ Detection of HIV p24 antigen was via an enzyme-linked immunosorbent assay, ELISA (Vironostika| Organon Technika, Durham, NC, USA). The basis of this colorimetric assay was the capture of p24 (following lysis of virus) by immobilized anti-HIV-1 antibody. A second HIV-1 antibody conjugated to peroxidase recognized the bound antigen. Subsequently, substrate was catalyzed to a colored product that was quantitated spectrophotometrically. When p24 was not directly detectable in the culture medium (sensitivity of the assay: l p g / m l ) , a coculture with PBMC was performed to amplify the amount of HIV-1 virus and improve the level of detection. P24 production was expressed in pg of p24 per mg of wet tissue per 24 hours. HIV-1 D N A Amplification and Detection At the end of incubation, polymerase chain reaction (PCR) was used to amplify conserved regions of the gag gene from tissue lysates. To prepare DNA lysates, placental tissue was washed in PBS to remove traces of fixative solution (buffered formalin). Small pieces of tissue (1-3 rnm 3) were then placed in sterile microfuge tubes. The tissues were digested for 3 hours at 56~ in lysis buffer (50 mM KC1; 10 m M Tris-HC1, p H 8.3; 2.5 mM MgC12; 25 mM EDTA; 0.45% NP40 and 0.45% Tween 20). Proteinase K was added to obtain a final concentration of 400 ~tg/ml. Following digestion, all tubes containing tissue lysates were incubated at 95~ for 15 minutes in order to inactivate proteinase K. The lysates were then used in the PCR reaction. Two non-overlapping regions of the gag gene were amplified to increase the likelihood of detecting HIV-1 DNA. The two primer pairs used were: JM850/JM851 and JM852/JM853, (Kindly provided by Dr. Marcia Kalish, CDC, Atlanta, GA, USA). For each gag gene primer, the (5'-3') sequence was:

JM850=AGTGGGGGGACATCAAGCAGCCATGCAAAT JM851=TGCTATGTCACTTCCCTTGGTTCTCTC JM852= ATAATCCACCTATCCCAGTAGGAGAAAT JM853=TTTGGTCCTTGTCTTATGTCCAGAATGC For PCR amplification, undiluted lysates and 10-fold and 100-fold dilutions of the lysates were used in order to dilute potential inhibitors of the PCR reaction. A standard 100 gl PCR reaction consisted of 25 gl of lysates (undiluted or diluted), 10 mM Tris-HC1 p H 8.3, 50 mM KC1, 0.025 mM EDTA, 2.5 mM MgC12, 0.2 mM dNTP, 2.5 units Taq DNA polymerase and 0.02 gg of each primer-pair. Amplifications were conducted in duplicate for each sample using each set of gag specific primer-pairs for 40 cycles with the two step PCR cycling profile: thermal ramping to 95~ for 1 minute, 65~ for 4 minutes, with a Perkin-Elmer model 480 thermocycler (Perkin-Elmer Cetus, Norwalk, CT, USA). Detection of HIV-1 DNA was conducted using a hybridization protection assay (HPA - Gen-Probe Inc., San Diego, CA, USA), which uses the two sets of acridinium ester-labeled probes specific for two regions of the gag gene (amplified by the primer pairs JM850-JM851 and JM852/JM853) (Ou et al., 1990).

210

Polliotti et al.

Syncytium Induction

The identifying characteristics of the laboratory strains were confirmed and those of the clInical isolate determined by testing their capacity to induce formation of syncytium (Harada et al., 1985; Japour et al., 1993; Koot et al., 1993). This was done by a standard assay utilizing MT-2 cells, which are human T-cells isolated from cord blood lymphocytes and transformed with HTLV-1 virions (NIH, Bethesda, MD, USA) (NIAID, NIH, 1993). Clinically, the presence of syncytium-inducing (SI) variants has been associated with rapid progression to AIDS and a lower survival rate. MT-2 cells (50,000 per well) were cultured with and without the virus, and formation of syncytium was examIned every two or three days for 14 days. When syncytium formation was observed within this time period, the strain was identified as SI. If there were no syncytia formed, the strain was labeled as non-syncytium-inducing (NSI). These experiments included negative and positive controls and were performed in duplicate. Virus Inhibition

Blocking viral replication with HIV-Ig verified that changes in p24 concentrations were due to active production rather than carryover from the inoculum. This mixture of antibodies inhibits viral replication by preventing cellular uptake of the virus without demonstratIng cellular toxicity observed with other anti-HIV drugs (Hallenberger et al., 1992; Phillips and Bourinbaiar, 1992) (HIV Immune Human Globulin, NIH, Bethesda, MD, USA). First trimester explants were selected for these experiments. A 1/100 final concentration of HIV-Ig was applied into each well with an explant one hour prior to adding the virus. Statistical Analysis

Data were analyzed by analysis of variance (ANOVA) between and within groups and over time, or by paired Student's t-test where appropriate. Crunch Statistical Package (Version 4, Crunch Software Corporation, Oakland, CA, USA) was used to perform these analyses. Differences were considered significant when P < 0.05. RESULTS

Viability of the placental explants (first and third trimester) in culture during 6 days was confirmed using human chorionic gonadotropin (hCG) release, lactate production, glucose consumption and histologic examination. In each experiment, these parameters remained stable throughout the incubation. Histological analysis of viral exposed and unexposed tissues revealed minimal modifications after 6 days of culture, as previously described (Polliotti et al., 1995). In addition to these biochemical and morphological evaluations, p H and bicarbonate concentration were controlled each day and remained stable, reflecting consistent conditions for tissue culture. In both first and third trimester tissue, culture medium pH (7.40 + 0.15), and concentrations of bicarbonate (16.2 + 4.5 raM), glucose (0.5 + 0.2 m M / m g ) and lactate (0.9 + 0.2 m M / m g ) remained stable during the six days of culture. The daily hCG production was also constant and at levels appropriate for gestational age (first trimester 40 + 20 mIU/mg; third trimester 0.30 _+0.15 mIU/mg).

211

HIV-1 Infection of Placental Tissue

12 10 84 A

8E e~

Inoculation Rinse

t

?,............. ;,............. ~,............*,............. t 2

3

4

5

6

T i m e (day)

2 84 1-0

~

inoculation

Rinie

T '

"

'

.

.

.

.

,

,

.

.

.

"(~ . . . . . . . . . . . . . 0 . . . . . . . . . . . . . . 0 . . . . . . . . . . . . . .

I

I

I

I

I

2

3

4

5

6

T i m e (day)

Figure la (upper). p24 production during the incubation of first trimester villous tissue. The tissue was exposed for 24 hours to the viral inoculum (day 1) followed by an intensive rinse. The p24 kinetic is shown after day i (post-inoculation) to present only the endogenous production of p24. Results are expressed in pg of p 2 4 / m g of wet tissue/24 hours (mean + SD); ( * ) values significantly different (P<0.05) from those observed with IIIB using ANOVA within groups (N >_6). For example at D6: Ba-L versus IIIB, F=16.5, P = 0.002; VI-5 versus IIIB, F = 18.7, P =0.002. Figure lb (lower). p24 production during the incubation of full term villous tissue. The tissue was exposed for 24 hours to the viral inoculum (day 1) followed by an intensive rinse. The p24 kinetic is shown after day 1 (post-inoculation) to present only the endogenous production of p24. Results are expressed in pg of p 2 4 / m g of wet tissue/24 hours (mean + SD); ( * ) values significantly different (P < 0.05) of those observed with IIIB strain using ANOVA within groups (N >__ 6). For example, at D6: Ba-L versus IIIB, F = 13.8, P = 0.004; VI-5 versus IIIB, F = 14.6, P = 0.003.

212

Polliotti et al.

Using this experimental system, first and third trimester h u m a n placental tissue was infected with strains Ba-L and VI-5, but not with IIIB (Figures la and lb). Detectable production of p24 was observed using Ba-L and VI-5 strains to infect the tissue. P24 concentration was very low in culture m e d i u m 24 hours after the elimination of the inoculum (day 2 - D2), and then increased significantly (D3) before gradually decreasing (D4 - D6) (Figurea la and lb). With the IIIB strain, the p24 detected remained at levels consistent with gradual release of cell surface bound p24 resulting from p24 present in the inoculum (i.e. washout of contaminating p24). In these explants, p24 never increased post-inoculation. P24 remained undetectable despite 21 days of co-culture of H9 cells with media from IIIB exposed tissue. This result demonstrates the complete absence of infection of explants by IIIB. P24 concentrations were significantly higher in Ba-L exposed first trimester explants than third trimester explants (F=8.0, P=0.007). This effect was evident during the fourth and fifth days of culture. In contrast, there was no significant difference in p24 concentrations between first and third trimester explants after exposure to VI-5 or IIIB strains. No significant changes in secretion of estradiol, h u m a n chorionic gonadotropin or progesterone were observed between infected and non-infected (unexposed or IIIB exposed) tissue (Figures 2a and 2b). Preincubation of first trimester placental explants with HIV-Ig followed by exposure to each viral strain did not produce an increase in p24 concentrations following either Ba-L or VI-5 exposure (Figures 3a and 3b). In contrast, explants run in parallel but not preincubated with HIV-Ig had significant increases in p24 levels by D3 (Figures 3a and 3b). However, there was no significant difference in p24 concentration with or without HIV-Ig incubation followed by IIIB exposure (Figure 3c). In all experiments, the first p24 concentration (D1) was high and, after rinsing away the inoculum, was largely removed. This phenomenon is known as inoculation carryover and is generally acknowledged to occur more frequently with use of free viral inoculation. Detection of viral DNA was performed following lysis of the villous tissue and PCR amplification with two primer pairs at the end of the culture (D6). Viral DNA was detected only in tissue exposed to the viral strains Ba-L and VI-5 (Table 1). Detection of viral DNA in tissue infected with Ba-L virus was more sensitive (dilution 1/10) using the second pair of primers (JM852/JM853) than was observed with undiluted lysate using the first pair of primers (JM850/JM851). No difference was observed between the two pairs of primers after infection with VI-5 virus (both positive detection at dilution 1/10). The negative control (unexposed) and the tissue exposed to the IIIB strain did not contain any detectable viral DNA. This absence of a positive DNA-PCR reaction observed with IIIB is highly significant; IIIB DNA was identified in PBMCs, but was undetectable in the placental explants at D6, suggesting that susceptible maternal or fetal monocytes had been removed during preparation of the explants (Table 2). Examination for syncytium formation by the MT-2 assay confirmed that IIIB remained an SI strain and Ba-L remained a NSI strain. The wild-type strain, VI-5, was identified as a NSI variety.

213

HIV-1 Infection of Placental Tissue

150

-

I [][] Progesterone Estradiol 1 ~hCG

e.

0o 100,

50

Ba-L VI-5 IIIB

Ba-L VI-5 IIIB

Ba-L VI-5 IIIB

150 -

I

~rlEstradiol 1 [] Progesterone ~-~!hCG

"E

0o 100 "6 o~

50

Ba-L VI-5 IIIB

Ba-L VI-5 IIIB

Ba-L VI-5 IIIB

Figure 2a (upper). First trimester hormonal secretion by the placental explants at day 3 post-infection with Ba-L, VI-5 and IIIB viral strains. The results are expressed as % of control secretion per 24 hours incubation without virus exposure (mean _+ SD). Mean value of the control was 152.6 p g / m g estradiol, 0.535 n g / m g progesterone and 41.45 m I U / m g hCG. (N = 6 with Ba-L; N = 4 with VI-5 and IIIB). Figure 2b (lower). Third trimester hormonal secretion by the placental explants at day 3 post-infection with Ba-L, VI-5 and IIIB viral strains. The results are expressed as % of control secretion per 24 hours incubation without virus exposure (mean + SD). Mean value of the control was 142.8 p g / m g estradiol, 0.197 n g / m g progesterone and 0.28 m I U / m g hCG. (N = 6 with Ba-L; N = 4 with VI-5 and IIIB).

Polliotti et al.

214

200 -

180" 14 ~

\ lO ~

4-

't o

1

2

3

4

5

6

"rime (day)

200 180-

9~ Vk5/HIV(1

14 ~' ~"

6 4 2.....

v 1

2

e

~-

-~

3

4

5

15

?

r

r

4

5

6

TimD ( d a y ) 200 -

18014 ~

~8~

e4i 2-

1

2

3 "~me ( d a y )

Figure 3a (upper). Example of viral infection and treatment with HIVqg from a single first trimester human placenta (9 weeks gestation): p24 production during the incubation of placental tissue with (o) and without ([7) HIV-Ig inhibitor added to the inoculum (one hour) before infection. The tissue was exposed for 24 hours to the Ba-L strain (day 1) followed by an intensive rinse. Results are expressed in pg of p24/mg of wet tissue/24 hours. Figure 3b (middle). Example of viral infection and treatment with HIV-Ig from a single first trimester human placenta (9 weeks gestation): p24 production during the incubation of placental tissue with (o) and without (A) HIV-Ig inhibitor added to the inoculum (one hour) before infection. The tissue was exposed for 24 hours to the VI-5 strain (D1) followed by an intensive rinse. Results are expressed in pg of p24/mg of wet tissue/24 hours. Figure 3c (lower), Example of viral infection and treatment with HIV-Ig from a single first trimester human placenta (9 weeks gestation): p24 production during the incubation of placental tissue with (o) and without (0) HIV-Ig inhibitor added to the inoculum (one hour) before infection. The tissue was exposed for 24 hours to the IIIB strain (D1) followed by an intensive rinse. Results are expressed in pg of p24/mg of wet tissue/24 hours.

215

HIV-1 Infection of Placental Tissue

Table I DNA-PCR using two sets of gag primers (JM 850/JM851 and JM852/JM853). For amplification, the tissue lysates were used undiluted (D* direct amplification) as well as 10-fold and 100-fold diluted. Results of two different incubations for first and third trimester tissue.

Incubation Placental

Experimental condition

Incubation Placental

First trimester tissue (n=2)

Third trimester tissue(n=2)

JM850/JM851

JM852/JM853

JM850/JM851

IM852/IM853

D* xl0 xl00

D* xl0 xl00

D* xl0 xl00

D* xl0 xl00

Ba-L virus

+1-

+

+

+

+

+

VI-5 v i r u s

+

+

+

+

+

+

Control

+

-

+

IIIBvirus

Table 2 Relative infectivity of PBMC (from normal donors) and placental explant in vitro. Infectivity was assessed by p24 antigen release in culture medium and by DNA-PCR detection at the end of the culture (day 5 for the placental explants and day 14 for the PBMC).

Viral

PBMC

Placental explants

Strain

p24

PCR

p24

PCR

B A -L

++

++

+++

+++

VI-5

++

++

+++

+++

+++

+++

IIIB

216

Polliotti et al.

DISCUSSION The placenta appears to play a central role in the in utero transmission of HIV-1. Some of the factors involved in transmission were investigated in the current studies. These experL'~nents clearly demonstrate that placental villous tissue can be infected in vitro with HIV-1. Additionally, HIV-1 infection did not noticeably affect physiologic functions of villous tissue for the duration of these experiments. The susceptibility of placenta to infection is at least partially dependent upon the viral strain to which it is exposed. First and third trimester placentae are both susceptible to infection. The first issue in evaluating this system was to define HIV-1 infection. A reasonable definition would include the presence of viral DNA in exposed tissue. However, this finding was insufficient to establish infection because of the possibility of uptake of small DNA fragments in the absence of intact virions. Generation of a unique viral product, in this case the core protein p24, at levels that increase with time, also supports the presence of a productive infection. However, one potential weakness with the use of free virus for infection is that a number of virion particles could be damaged during-the preparation and could release a large amount of p24 into the inoculum producing carryover contamination. The high concentration of p24 in the inoculating medium from the first 24 hours of culture supports the concept that this phenomenon is present (Figures 3a, 3b, 3c). P24 readily adheres to cell membranes and can diffuse out into the m e d i u m over time. In order to address this aspect, blockade of viral uptake with HIV-Ig, that would prevent infection from occurring, would be expected to result in no significant increase in p24 concentration. There was no rise in p24 production during the five days of culture following removal of inoculum after exposure to any of the viral strains used, which indicates that infection had not occurred. The increase in p24 levels in this system represents production of new p24 due to active infection. The placental explant system demonstrates both the presence of viral DNA and production of p24, thus fulfilling the criteria for infection. An important consideration was the effect of HIV-1 infection on the placental explants. In utero infection has not been consistently associated with cytological changes. Data on the effect of infection on the function of the placenta or its ability to act as an endocrine organ is limited (Amirhessami-Aghili and Spector, 1991). However, the lack of consistent fetal growth abnormalities or recurrent pregnancy losses suggests that adequate placental function is retained. Our previous experience with placental explants had enabled us to establish parameters for normal physiologic and endocrine function. There was no measurable perturbation of these functions in infected first or third trimester placentae. Furthermore, there were no histologic changes evident on H&E stained sections compared with concurrent controls or tissue collected before incubation (data not shown). Thus, the infected placental explant maintained its physiologic characteristics as did the infected placenta in utero. Numerous factors have been associated with susceptibility to HIV-1 infection. These included viral strain, mode of presentation of virus (free versus through infected lymphocytes) and types of cell being infected. In these studies, two out of three strains of virus infected the placental explants. The similarities and differences between the infecting strains and non-infecting strains were not extensively examined. However, a standard assay to evaluate viral phenotype demonstrated that, in this study, both infecting strains were of the NSI variety, while the non-infecting strain was an SI type. Vertical transmission of HIV-1 observed in other studies appears to be correlated with

HIV-1 Infection of Placental Tissue

217

viral phenotype, with preferential infection with NSI strains both in vivo and in vitro (Reynolds-Kohler et al., 1991; Scarlatti et al., 1993; Reinhardt et al., 1995). In addition, early detection of neonatal HIV-1 infection was associated with the NSI phenotype (Palasanthiran et al., 1994). Whether viral tropism or other viral characteristics were primary determinants of placental infectivity must be examined further. Debate exists about whether the efficiency of HIV-1 infection is increased by cell-mediated over free virus presentation. This study does not address the issue of differences in efficiency of infectivity. Rather, an excessive dose of viral inoculum (1000X the minimum infectious dose that infects PBMCs) was used to ensure the m a x i m u m chance for infection to occur. Free virus was able to infect placental explants. The clinical implications are important because both free viruses (maternal viremia) and infected monocytes are present in utero. Variation in susceptibility to infection has been demonstrated in other studies. In the current studies, all three viruses could infect PBMCs, but only two infected placental explants. The experiments, which suggested absence of contaminating maternal or fetal PBMCs, would support the premise that those strains that infected the explants must have infected specific cell types within the tissue. In a companion article, Sheikh et al. (1998) demonstrate cellular localization of HIV-1 in placental explants within some syncytiotrophoblast, Hofbauer cells and stromal cells. Thus, the current studies demonstrate that the placental explant is susceptible to HIV-1 infection by some viral strains, that they could be infected with free virus, and that infection must have occurred in cells of placental origin. As in the in utero situation, placental explants from first and third trimester could be infected. The time course of change in p24 concentrations is comparable for both viral strains in the first and third trimester; the highest concentrations tend to be present on the third day of culture. This suggests that viral infection took at least 24-48 hours to be established after inoculation with free virus, which potentially limits the use of systems where less time is available for study. Although the first trimester Ba-L exposed explants tended to have significantly higher p24 concentrations late in the culture period, the actual differences were small and the importance of this finding is unclear. Both first and third trimester placental explants are susceptible to infection and it is unclear if there are significant differences in infectivity between these groups. The current studies demonstrated that the placental explant system provides a valid in vitro model to study issues of HIV-1 infectivity. The advantage of the placental explant over other in vitro systems resides largely in the limitations of the latter. Isolated cells represent the simplest model, but also the one that is least similar to in vivo conditions. In the blood, cells are naturally independent, and the placenta contains a large amount of maternal and fetal blood. With this exception, however, the cells constituting the placenta are associated with specific cell-cell and cell-matrix interactions. Separation of these cells from their normal interactions substantially modifies them (Douglas and King, 1994). Immortalized permanent cell lines have been created from primary isolates or choriocarcinoma by transfection or irradiation. However, these techniques significantly modify cellular characteristics. One of the best examples is the loss of CD4 receptors observed in choriocarcinoma cells and some primary cell isolates (Zachar et al., 1991a, b; Mano and Chermann, 1991). A second restriction imposed by isolated cells is the limited time when cells can be used, from a few days to a few weeks. In the hierarchy of experimental models, dual perfusion of the isolated human placental lobule represents the highest level of complexity and appears most similar to the in vivo condition. In successful perfusions, the cotyledon is preserved for periods of 24 to 48 hours (Miller et al., 1985, 1989; Polliotti et al., 1996). The time allowed for perfusion

218

Polliotti et al.

remains too limited to study infectivity, but sufficient for transfer and kinetic studies. Placental explants preserve the relationship between different cellular and matrix layers, do not show significant changes in cellular properties, and have a useful life of 7-11 days (Genbacev et al., 1992, 1993; Polliotti et al., 1995). An earlier investigation using placental explants demonstrated infectivity with HIV-1 (Amirhessami-Aghili and Spector, 1991). However, significant questions can be raised about the viability of the model. For example, these authors reported progressive decreases in both progesterone and hCG concentrations, which implied that villous function may be impaired. Furthermore, infection was documented by measuring p24 concentrations only. Amirhessami-Aghili and Spector (1991) demonstrated only a progressive decrement in p24 concentrations. This raised the possibility that the effect documented in their system reflected washout of p24 from the inoculation carryover rather than true production. In contrast, in the current studies, infection is well documented, as described above. Although p24 concentrations remain elevated, the gradual decline in their levels after increasing by the third day of culture is unexplained. It may represent fewer uninfected, susceptible cells available for infection and a conversion from active to latent viral life cycle. Only a limited number of cells (higher in first trimester than in third trimester tissue) could be potentially infected by HIV-1. During the post-inoculation days of incubation, the cells were progressively infected. When this occurred, the production of p24 did not continue to increase and, as the medium was replaced every day, the apparent release of p24 in the culture medium decreased. As in the current studies, Maury et al. (1989) reported successfully infecting placental explants. However, in their study, viral product reverse transcriptase was first detected nine days post-inoculation, possibly indicating that a substantial amount of time lapses before productive viral infection occurs. In contrast, we found the presence of elevated p24 concentrations indicative of productive infection within 48-72 hours of inoculation. Productive infection appears to be readily established in the current system. An additional issue present with the explant system was the exposure of raw surface directly to virus in the medium, thus potentially exposing damaged cells to virus. In separate studies reported in a companion article, multiple sections of tissue were examined and infectivity demonstrated consistently throughout (Sheikh et al., 1998). It was unlikely that tissue could be so extensively damaged to allow leakage of virus into it without altering the numerous physiologic functions evaluated. Infection of first and third trimester placental explants has been demonstrated in these studies. Selectivity of infection, dependent upon viral strain used, was observed. Elsewhere, virus has been localized to specific cell types (Sheikh et al., 1998). Screening of many more strains of HIV-1 is underway to establish the range of viral susceptibility. However, the current data demonstrate that the placental explant system is infected by HIV-1 and, thus, this model would be useful for exploring the role of the placenta in the transmission of HIV-1. SUMMARY

The role of the placenta in the materno-fetal transmission of HIV-1 infection remains unexplained despite continuing progress. Among the many different experimental models (animal, isolated cells, placental tissue and isolated placental perfusion), we have selected human placental villous tissue culture as the one closest to the in utero condition associated with HIV infectivity and allowing experimentation for an

HIV-1 Infection of Placental T i s s u e

219

adequate period of time. The aim of this study was to investigate infectivity of several HIV-1 strains in human placental explants. Two laboratory strains, Ba-L and IIIB, and VI-5 (isolated from an HIV-positive baby) were utilized. Ba-L and VI-5 were Non-Syncytium-Inducing (NSI), and IIIB was Syncytium-Inducing (SI). Placental explants (first trimester and full term) were incubated for 24 hours with free virus of each strain, then intensively rinsed to remove the inoculum. After an additional five days of culture, explants were examined for infection by detection of p24 in the culture medium and by PCR amplification of viral DNA using two pairs of gag gene primers. Ba-L and VI-5 (NSI) infected both first and third trimester placental tissue. Positive indications of viral infection included increasing p24 production during the third day post-inoculation, which remained sustained for three days; and positive DNA-PCR detection in explants on day 6. As a control for infectivity, p24 increases could be completely abolished using HIV-Ig. Strain IIIB (SI) did not infect placental tissue as determined by lack of p24 release and absence of viral DNA by PCR detection. Free HIV-1 could infect the intact human placental villus and, as observed in vivo, NSI HIV-1 strains appeared more successful in infecting in vitro human placental tissue of first and third trimesters. ACKNOWLEDGEMENTS

The authors would like to thank Drs. Marcia Kalish (CDC, Atlanta, GA, USA) and Lisa Demeter (University of Rochester, Rochester, NY, USA) for their cooperation. We are particularly indebted to the labor and delivery staff of Grady Memorial Hospital (Atlanta, GA, USA) and of Strong Memorial Hospital and Highland Hospital (Rochester, NY, USA) for their assistance in obtaining placentae. We thank also Mrs. Carine Nandanc6 for her editorial assistance. This work was supported by NIH grants # R01-AI32319 and AI-32341. REFERENCES

Amirhessami-Aghili, N. and Spector, S.A. (1991) Human immunodeficiency virus type 1 infection of human placenta: Potential route for fetal infection. J. Virol. 65, 22312236. Amstey, M.S., Miller, R.K., Menegus, M.A. and di Sant'Agnese, P.A. (1988) Enterovirus in pregnant women and the perfused placenta. Am. J. Obstet. Gynecol. 158, 775-782. Backe, E., Unger, M., Jimenez, E., Siegel, G., Schafer, A. and Vogel, M. (1993) Fetal organs infected by HIV-1. AIDS Res. Hum. Retroviruses 6, 896-897. Borkowsky, W., Krasinski, K., Cao, Y., Ho, D., Pollack, H., Moore, T., Chen, S.H., Allen, M. and Tao, P.T. (1994) Correlation of perinatal transmission of human immunodeficiency virus type 1 with maternal viremia and lymphocyte phenotypes. J. Pediatr. 125, 345-351. Bourinbaiar, A.S. and Nagorny, R. (1993) Human immunodeficiency virus type 1 infection of choriocarcinoma-derived trophoblasts. Acta Virol. 37, 21-28.

220

Polliotti et al.

Briant, L., Wade, C.M., Puel, J., Brown, A.J.L. and Guyader, M. (1995) Analysis of envelope sequence variants suggests multiple mechanisms of mother-to-child transmission of human immtmodeficiency virus type 1. J. Virol. 69, 3778-3788. Brossard, Y., Aubin, J.T., Mandelbrot, L., Bignozzi, C., Brand, D., Chaput, A., Roume, J., Mulliez, N., Mallet, F. and Agut, H. (1995) Frequency of early in utero HIV-1 infection: A blind DNA polymerase chain reaction study on 100 fetal thymuses. AIDS Res. Hum. Retroviruses 9, 359-366. Connor, E.M., Sperling, R.S., Gelber, R., Kiselev, P., Scott, G., O'Sullivan, M-J., VanDyke, R., Bey, M., Shearer, W., Jacobson, R.L., Jimenez, E., O'Neill, E., Bazin, B., Delfraissy, J.-F., Culnane, M., Coombs, R., Elkins, M., Moye, J., Stratton, P. and Balsley, J. (1994) Reduction of materno-infant transmission of human immtmodeficiency virus type 1 with Zidovudine treatment. N. EngI. J. Med. 331, 1173-1180. David, F.J., Tran, H.C., Autran, B., Serpent, B., Vaquero, C., Djian, V., Menu, E., BarreSinoussi, F. and Chaouat, G. (1995) HIV infection of choriocarcinoma cell lines derived from human placenta: the role of membrane CD4 and Fc-Rs into HIV entry. Virology 208, 784-788. Douglas, G.C. and King, B.F. (1994) Isolated trophoblast cells for studies of placental infection: Advantages and precautions. Trophoblast Res. 8, 247-250. Douglas, G.C., Fry, G.N., Thirkill, T., Holmes, E., Hakim, H., Jennings, M. and King, B.F. (1991) Cell-mediated infection of human placental trophoblast with HIV in vitro. AIDS Res. Hum. Retroviruses 7, 735-740. Douglas, G.C., Sloan, C.L., Hovanes, K., Thirkill, T., Fry, G.H., Hakim, H., Schmerl, S., Jennings, M. and King, B.F. (1993) Adhesion of lymphocytic cells to human trophoblast cells in vitro. J. Reprod. Immunol. 24, 65-80. Duliege, A.M., Amos, C.I., Felton, S., Biggar, R.J. and Goedert, J.J. (1995) Birth order, delivery route, and concordance in the transmission of human immunodeficiency virus type 1 from mother to twins. International Registry of HIV-Exposed Twins. J. Pediatr. 126, 625-632. Ehrnst, A., Lindgren, S., Belfrage, E., Sonnerborg, A., Dictor, M., Johansson, B. and Bohlin, A.B. (1992) Intrauterine and intrapartum transmission of HIV. Lancet 339, 245-246. Ehrnst, A., Lindgren, S., Dictor, M., Johansson, B., Sormerborg, A., Czajkowski, J., Sundin, G. and Bohlin, A.B. (1991) HIV in pregnant women and their offspring: Evidence for late transmission. Lancet 338, 203-207. Genbacev, O., Schubach, S. and Miller, R.K. (1992) Villous culture of first trimester human placenta: Model to study extravillous trophoblast (EVT) differentiation. Placenta 13, 439-461.

HIV-1 Infection of Placental Tissue

221

Genbacev, O., White, T. and Miller, R.K. (1993) Human trophoblast cultures: Model for implantation and reproductive toxicology. Reprod. Toxicol. 7, 75-94. Harada, S., Koyanagi, Y. and Yamamoto, N. (1985) Infection of HTLV-III/LAV in HTLV1 carrying cells MT-2 and MT-4 and application in a plaque assay. Science 229, 563-566. Hallenberger, S., Bosch, V., Angliker, H., Shaw, E., Klenk, H.D. and Gartens, W. (1992) Inhibition of furin-mediated cleavage activation of HIV-1 glycoprotein gp160. Nature 360, 358-361. Japour, A.J., Fiscus, S., Mayers, D., Reichelderfer, P. and Kuritzkes, D. (1993) A microtiter MT-2 syncytia assay. IX International Conference on AIDS. PO-B41-2484; Vol. I, Berlin, Germany, p. 549. Jauniaux, E., Nessman, C., Imbert, M.C., Meuris, S., Puissant, F. and Hustin, J. (1988) Morphological aspects of the placenta in HIV pregnancies. Placenta 9, 633-642. Kesson, A.M., Fear, W.R., Kazazi, F., Mathijs, J.M., Chang, J., King, N.J. and Curu~ingham, A.L. (1993) Human immunodeficiency virus type 1 infection of human placental macrophages in vitro. J. Infect. Dis. 168, 571-579. Kliks, S.C., Wara, D.W., Landers, D.V. and Levy, J.A. (1994) Features of HIV-1 that could influence maternal-child transmission. JAMA 272, 467-474. Koot, M., Keet, I.P., Vos, A.H., de Goede, R.E., Roos, M.T., Coutinho, R.A., Miedema, F., Schellenkens, P.T. and Tersmette, M. (1993) Prognostic value of HIV-1 syncytium-inducing phenotype for rate of CD4+ cell depletion and progression to AIDS. Ann. Intern. Med. 118, 691-688. Lairmore, M.D., Cuthbert, P.S., Utley, L.L. Morgan, C.J., Dezzutti, C.S., Anderson, C.L. and Sedmak, D.D. (1993) Cellular localization of CD4 in the human placenta. J. Immunol. 151, 1673-1781. Lamers, S.L., Sleasman, J.W., She, J.X., Barrie, K.A., Pomeroy, S.M., Barrett, D.J. and Goodenow, M.M. (1994) Persistence of multiple maternal genotypes of human immunodeficiency virus type 1 in infants infected by vertical transmission. J. Clin. Invest. 93, 380-390. Mano, H. and Chermann, J.C. (1991) Replication of human immunodeficiency virus type 1 in primary cultured placental cells. Res. Virol. 142, 95-104. Maury, W., Potts, B.J. and Rabson, A.R. (1989) HIV-1 infection of first-trimester and term human placental tissue: A possible mode of materno-fetal transmission. J. Infect. Dis. 160, 583-588. McGann, K.A., Collman, R., Kolson, D.L., Gonzalez-Scarano, F., Coukos, G., Courifaris, C., Strauss, J.F. and Nathanson, N. (1994) Human immunodeficiency virus type 1 causes productive infection of macrophages in primary placental cell cultures. J. Infect. Dis. 169, 746-753.

222

Polliotti et al.

Melendez-Guerrero, L., Holmes, R., Backe, E., Polliotti, B.M., lbegbu, C., Lee, F., Panigel, M., Schwartz, D., Huddleston, J. and Nahmias, A. (1994) In vitro infection of Hofbauer cells with a monocyte-tropic strain of HIV-1. Trophoblast Res. 8, 33-45. Miller, R.K., Wier, P.J., Shah, Y., di Sant'Agnese, P.A. and Perez D'Gregorio, R. (1989) Criteria for in vitro dual perfusions in the human placental lobule: Perfusions in excess of 12 hours. In: Placenta as a Model and a Source, (eds.) O. Genbacev, A. Klopper and R. Beaconsfield. Plenum Press: New York and London, pp. 27-38. Miller, R.K., Wier, P.J., Maulik, D. and di Sant'Agnese, P.A. (1985) Human placenta in vitro: Characterization during 12h of dual perfusion. Contr. Gynec. Obstet. 13, 7784. Miller, R.K. and Thiede, H.A. (eds) (1994) HIV Perinatal Infections And Therapy: Role Of The Placenta. Rochester:University of Rochester Press. Miihlemann, K., Menegus, M.A. and Miller, R.K. (1995) Cytomegalovirus in the perfused human term placenta in vitro. Placenta 16, 367-373. NIAID, NIH. (1993) ACTG Virology Manual for HIV Laboratories,. (ed.) F.B. Hollinger, Bethesda, MD, USA. Ou, C.Y.,McDonough, S.H., Cabanas, D., Ryder, T., Harper, M., Moore, J. and Schochetman, G. (1990) Rapid and quantitative detection of enzymatically amplified HIV-1 DNA using chemiluminescent oligonucleotide probes. AIDS Res. Hum. Retroviruses 6, 1323-1329. Palasanthiran, P., Ziegler, J.B., Dwyer, D.E., Robertson, P., Leigh, D. and Cunningham, A.L. (1994) Early detection of human immunodeficiency virus type 1 infection in Australian infants at risk of perinatal infection and factors affecting transmission. Pediatr. Infect. Dis. J. 13, 1083-1090. Phillips, D.M. and Bourinbaiar, A.S. (1992) Mechanism of HIV spread from lymphocytes to epithelia. Virology 186, 261-273. Polliotti, B.M., Abramowsky, C., Schwartz, D.A., Keesling, S.S., Lee, G.R., Caba, J., Zhang, W., Panigel, M. and Nahmias, A.J. (1995) Culture of first-trimester and full-term human chorionic villus explants: role of human chorionic gonadotropin and human placental lactogen as a viability index. Early Pregnancy 1, 270-280. Polliotti, B.M., Holmes, R., Cornish, J.D., Hulsey, M., Keesling, S., Schwarrz, D., Abramowsky, C.R., Huddleston, J. Panigel, M. and Nahmias, A.J. (1996) Longterm perfusion of isolated human placental lobules with improved oxygenation for infectious diseases research. Placenta 17, 57-68. Reinhardt, P.P., Reinhardt, B., Lathey, J.L., Spector, S.A. and Mosier, D.E. (1995) Human cord blood mononuclear cells are preferentially infected by non-syncytiuminducing, macrophages-tropic human immunodeficiency virus type 1 isolates. J. Clin. Microbiol. 33, 292-297.

HIV-1 Infection of Placental Tissue

223

Reynolds-Kohler, C., Wiley, C. and Nelson, J.A. (1991) Cells infected by human immunodeficiency virus in vivo. Adv. Exp. Med. Biol. 300, 27-44. Scarlatti, G., Hodara, V., Rossi, P., Muggiasca, L., Bucceri, A., Albert, J. and Fenyo, E.M. (1993) Transmission of human immunodeficiency virus type 1 (HIV-1) from mother-to-child correlates with viral phenotype. Virology 197, 624-629. Schwartz, D.H., Sharma, U.K., Perlman, E.J. and Blakemore, K. (1995) Adherence of human immunodeficiency virus-infected lymphocytes to fetal placental cells: A model of materno-fetal transmission. Proc. Natl. Acad. Sci. USA 92, 978-982. Sheikh, A.U., Polliotti, B.M. and Miller, R.K. (1998) In situ PCR discriminates between infected and uninfected human placental explants in vitro after exposure to HIV. Trophoblast Res. 12, 191-204. T6th, F.D., Mosborg-Petersen, P., Kiss, J., Aboagye-Mathiesen, G., Zdravkovic, M., Hager, H., Aranyosi, J., Lamp6, L. and Ebbesen, P~ (1994) Antibody-dependent enhancement of HIV-1 infection in human term syncytiotrophoblast cells cultured in vitro. Clin. Exp. Immunol. 96, 389-394. Valente, P. and Main, E.K. (1990) Role of the placenta in perinatal transmission of HIV. Obstet. Gynec. Clin. North Am. 17, 607-616. Weiser, B., Nachman, S., Tropper, P., Viscosi, K.H., Grimson, R., Baxter, G., Fang, G., Reyelt, C., Hutcheon, N. and Burger, H. (1994) Quantitation of human immunodeficiency virus type 1 during pregnancy: relationship of viral titer to mother-to-child transmission and stability of viral load. Proc. Natl. Acad. Sci. USA 91, 8037-8041. Zachar, V. and Ebbesen, P. (1991) In vitro productive infection of human malignant trophoblast cell line JAr with human immunodeficiency virus type 1 (HIV-1). Acta Virol. 35, 464-468. Zachar, V., Norskov-Lauritsen, N., Juhl, C., Spire, B., Chermann, J.C. and Ebbesen, P. (1991a) Susceptibility of cultured human trophoblasts to infection with human immunodeficiency virus type 1. J. Gen. Virol. 72, 1253-1260. Zachar, V., Spire, B., Hirsch, I., Chermann, J.C. and Ebbesen, P. (1991b) Human transformed trophoblast-derived cells lacking CD4 receptor exhibit restricted permissiveness for human immunodeficiency virus type 1. J. Virol. 65, 2102-2107.