HIV protease inhibitor ritonavir increases endothelial monolayer permeability

BBRC Biochemical and Biophysical Research Communications 335 (2005) 874–882 www.elsevier.com/locate/ybbrc

HIV protease inhibitor ritonavir increases endothelial monolayer permeability q Changyi Chen a,*, Xiang-Huai Lu b, Shaoyu Yan a, Hong Chai a, Qizhi Yao a a

Molecular Surgeon Research Center, Division of Vascular Surgery and Endovascular Therapy, Michael E. DeBakey Department of Surgery, Baylor College of Medicine, Houston, TX 77030, USA b Department of Medicine, Emory University School of Medicine, Atlanta, GA 30322, USA Received 22 July 2005 Available online 8 August 2005

Abstract HIV protease inhibitors (PIs) are often associated with metabolic and cardiovascular complications although they are effective anti-HIV drugs. In this study, we determined whether HIV PI ritonavir could increase endothelial permeability, one of the important mechanisms of vascular lesion formation. Human dermal microvascular endothelial cells (HMECs) treated with ritonavir showed a significant increase of endothelial permeability in a dose- and time-dependent manner assayed with a transwell system. Ritonavir significantly reduced the mRNA levels of tight junction proteins zonula occluden-1, occludin, and claudin-1 by 40–60% as compared to controls (P < 0.05) by real-time PCR analysis. Protein levels of these tight junction molecules were also substantially reduced in the ritonavir-treated cells. In addition, HMECs treated with ritonavir (7.5, 15, and 30 lM) showed a substantial increase of superoxide anion production by 10%, 32%, and 65%, respectively, as compared to controls. Antioxidants (EGCG and SeMet) effectively reduced ritonavir-induced endothelial permeability. Furthermore, ritonavir activated ERK1/2 (phosphorylation), but not P38 and JNK. Specific ERK1/2 inhibitor, PD89059, significantly abolished ritonavir-induced endothelial permeability by 92%. Thus, HIV PI ritonavir increases endothelial permeability, decreases levels of tight junction proteins, and increases superoxide anion production. ERK1/2 activation is involved in the signal transduction pathway of ritonavir-induced endothelial permeability.
2005 Elsevier Inc. All rights reserved. Keywords: HIV protease inhibitor; Ritonavir; Endothelial cell; Permeability; Barrier function; Tight junction molecule; Oxidative stress; Superoxide; ERK1/2

HIV protease is an aspartyl endopeptidase that catalyzes the cleavage of HIV gag-pol polyproteins, allowing maturation and budding of the developing q Abbreviations: BH4, tetrahydrobiopterin; ECL, enhanced chemiluminescent; EGCG, epigallocatechin gallate; eNOS, endothelial nitric oxide synthase; HAART, highly active antiretroviral therapy; HMEC, human dermal microvascular endothelial cell line; IFN-c, interferon-c; JAM, junction adhesion molecule; LDL, low density lipoprotein; MAPK, mitogen-activated protein kinases; O2
, superoxide anion;  OH, hydroxyl radical; PI, HIV protease inhibitor; RFU, relative fluorescence units; ROS, reactive oxygen species; SeMet, seleno-Lmethionine; TNF-a, tumor necrosis factor-a; TX-Dex, Texas redlabeled 70-kDa dextran; ZO, zonula occludens. * Corresponding author. Fax: +1 713 798 6633. E-mail address: [email protected] (C. Chen).

0006-291X/$ - see front matter
2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2005.07.155

virion. Several HIV protease inhibitors (PIs) including ritonavir (Norvir), saquinavir (Invirase and Fortovase), indinavir (Crixivan), nelfinavir (Viracept), and amprenavir have been developed on the basis of detailed knowledge of HIV protease tertiary and quaternary structure [1]. These HIV PIs specifically inhibit HIV protease, but not human proteases. HIV PIs have been one of the most significant advances of the past decade in controlling HIV infection. The current goal of antiviral therapy is to maintain maximal suppression of viral replication using highly active antiretroviral therapy (HAART) [2]. This usually involves a combination of reverse transcriptase inhibitors and a HIV PI.

C. Chen et al. / Biochemical and Biophysical Research Communications 335 (2005) 874–882

Despite their clinical success in controlling HIV virus load, HIV PIs are often associated with a number of metabolic side effects including the elevation of plasma cholesterol and triglycerides, which may be associated to the risk of premature development of atherosclerosis [3]. As the population of HIV patients ages and antiretroviral therapy increasingly prolongs their life span, management of drug-related complications may become more important. However, the mechanisms of HIV PIassociated cardiovascular disease are unclear. On one hand, PIs could indirectly affect vascular functions via their effects on lipid and glucose metabolism [4]. On the other hand, PIs could direct cause endothelial dysfunction or injury though unknown mechanisms which are not related to human cellular proteases and clinically metabolic disorders. Studies in healthy subjects confirm a role of PI indinavir in endothelial dysfunction with reduced endothelial nitric oxide production [5]. Our recent investigations in both porcine arteries and human endothelial cells clearly demonstrated that PI ritonavir directly impaired vasomotor activities and endothelial nitric oxide synthase (eNOS) expression through the mechanism of oxidative stress [6–9]. Since atherosclerosis and its progression are associated with vascular tissue inflammation and endothelial dysfunction or injury, we have logically hypothesized that HIV PIs may affect endothelial barrier function. Ritonavir was selected for the current study because it is one of the most commonly used HIV PIs as part of HAART. Clinical studies also demonstrated ritonavir is often associated with vascular complications. The maximal plasma concentration of the clinical dose of RTV is around 15 lM [10]. Normal endothelial cells constitute a macromolecular barrier between the blood vessels and underlying tissues. Injury to the endothelial cells could increase endothelial permeability, which is considered one of the critical events in the development of atherosclerosis [11,12]. The endothelial barrier function is maintained by endothelial junction structures including tight junction, adherence junction, and gap junction. Paracellular permeability of endothelial cells is highly dependent on tight junctions, which form between adjacent endothelial cells and bring their membranes in close contact, thus creating a high resistance pathway to paracellular flux [13]. Tight junctions are comprised of numerous proteins, with the best characterized being zonula occludens (ZOs), claudins, occludin, and junction adhesion molecule (JAM). ZOs are cytoplasmic proteins, whereas claudins, occludin, and JAM are putative transmembrane proteins [14]. The objective of this study was to determine the effect of HIV PI ritonavir on endothelial monolayer permeability and junction protein expression as well as to explore possible molecular mechanisms. The roles of oxidant stress and mitogen-activated protein kinases (MAPKs) were investigated.

875

Materials and methods Cells and reagents. Human dermal microvascular endothelial cell (HMEC) line was obtained from Dr. Wright S. Caughman, Department of Dermatology, Emory University (Atlanta, GA). HMECs were plated and grown in MCDB 131 medium supplemented with human recombinant epidermal growth factor (rhEGF, 10 ng/ml), penicillin (100 U/ml), streptomycin (100 lg/ml), L-glutamine (2 mM) (GibcoBRL, Gaithersburg, MD), hydrocortisone (2.0 lg/ml, Sigma, St. Louis, MO), and fetal bovine serum (FBS, 10%, Mediatech, Herndon, VA). The cells were then grown in a 37 C incubator with 5% CO2 and 95% humidity. Pure ritonavir powder was obtained from the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH. Ritonavir was dissolved in DMSO at the desired concentrations (5–30 lM) and the final concentration of DMSO in the experiments was adjusted to less than 0.1% (v/v), which was used in all controls. Mouse anti-human ZO-1, occludin antibodies, and rabbit anti-human claudin-1 antibody were obtained from ZYMED (South San Francisco, CA). Mouse anti-human F11R (JAM) and CD144 (VE-cadherin-5) antibodies were obtained from BD Biosciences (San Diego, CA). Monoclonal antibodies against human activated ERK1/2, JNK, and P38 MAPK, and alkaline phosphatase (AP) conjugated goat antimouse IgG were obtained from Sigma (St. Louis, MO). Protein kinase inhibitors including PD98059 (specific ERK1/2 inhibitor), SB303580 (specific P38 MAPK inhibitor), wortmannin (specific inositol 1,4,5trisphosphate kinase, IP3k, inhibitor), and staurosporine (a broad range protein kinase inhibitor) were obtained from Calbiochem (San Diego, CA). Staurosporine inhibits CaM kinase, myosin light chain kinase, protein kinase A, protein kinase C, and protein kinase G. Lucigenin was obtained from Molecular Probe (Eugene, OR). Antioxidant epigallocatechin gallate (EGCG) was obtained from Calbiochem (San Diego, CA), and Seleno-L-Methionine (SeMet) was obtained from Sigma (St. Louis, MO). Texas red-labeled 70-kDa dextran (TX-Dex, 1 mg/ml) was obtained from Molecular Probe (Eugene, OR). Cell permeability assay. Permeability across the endothelial cell monolayer was assessed in a two-chamber system by a clear filter membrane, which has 6.5 mm diameter and 0.4 lm pore size (Corning Inc., Corning, NY). Both chambers contained growth medium MCDB 131 with all the supplements. Whereas, the upper chamber containing the HMEC monolayer had a volume of 200 ll, the lower chamber had a volume of 1 ml. HMECs were plated at 1 · 105 cells/ml and grown until confluence (3–5 days after plating) before the experiments. The cells were then treated with ritonavir at either different concentrations (dose-dependent) for 24 h or a fixed concentration (15 lM) for different time points (time-course). Ritonavir (15 lM) with a protein kinase inhibitor (20 lM PD98059, 1.2 lM SB303580, 10 nM wortmannin, or 50 nM staurosporine) or an antioxidant (2 lM EGCG or 100 lM SeMet) was also included in this assay. Prior to the experiments, the medium was replaced with pre-warmed 1· HanksÕ balanced salt solution (HBSS) obtained from Mediatech (Herndon, VA). The upper chambers received TX-Dex in the HBSS and then incubated at 37 C for 1 h. The amount of TX-Dex in the upper and lower chambers was measured with a fluorometer using an excitation wavelength of 596 nm and an emission wavelength of 622 nm (FLx800, Bio-Tek Instruments, Winooski, VT). The amount of tracer that penetrated through the HMEC monolayers was calculated as previously described [15]. Real-time RT-PCR. HMECs were treated with ritonavir for 24 h. Total cellular RNA was then extracted by guanidinium isothiocyanate (Trizol reagent). Total RNA (0.5 lg) was reverse-transcribed into cDNA using the iScipt cDNA synthesis kit (Bio-Rad) following the manufacturerÕs instructions. Primers for ZO-1, occludin, claudin-1, JAM, and VE-cadherin were designed via the Beacon Designer 2.1 software (Bio-Rad) and the details of primers are listed in Table 1. The primer sequence for the housekeeping gene, b-actin, is as follows: sense: 5 0 CTGGAACGGTGAAGGTGACA 3 0 ; and antisense: 5 0

876

C. Chen et al. / Biochemical and Biophysical Research Communications 335 (2005) 874–882

Table 1 Genes of junction proteins and sequences of PCR primers Gene

GenBank Accession No.

Forward primer

Reverse primer

ZO-1 Occludin Claudin-1 JAM VE-cadherin

ZM_175610 NM_002538 AF134160 AF111713 X79981

TGGTGTCCTACCTAATTCAACTCA ACAGAGCAAGATCACTATGAGACA CCAGTCAATGCCAGGTACGAAT AAGACACTGGGACATACACTTGT CAACTGGCCTGTGTTCACGC

CGCCAGCTACAAATATTCCAACA TGTTGATCTGAAGTGATAGGTGGA TTGGTGTTGGGTAAGAGGTTGTT CGATGAGCTTGACCTTGACCT ATCCACTGCTGTCACAGAGATGA

AAGGGACTTCCTGTAACAATGCA 3 0 . The quality of the individual pair of primers was confirmed by running a regular PCR before real-time PCR analysis to make sure that there were no detectable primer dimer and non-specific products yielded. The iQ SYBR green Supermix Kit and iCycler iQ Real-time PCR detection system (BioRad, Hercules, CA) were used in real-time PCR. The relative gene expression for each sample was calculated as 2(40
Ct) as previously described [7]. The gene expression for each target gene in each sample was normalized to b-actin expression. The relative amount of mRNA levels of gene of interest was calculated based on the formula 2^ ½C tðb-actinÞ
C tðgeneÞ . Data are expressed as means ± SD of three separate experiments. Western blot. HMECs were treated with ritonavir for 24 h. Cells were lysed with ice-cold lysis buffer. Forty micrograms of lysate protein was loaded and separated with 10% SDS–polyacrylamide gel electrophoresis and then transblotted overnight at 4 C onto the Hybond-P PVDF membrane (Amersham Biosciences). After blocking with 5% non-fat dried milk, the membrane was probed with the respective primary antibody for ZO-1, occludin, claudin-1, JAM, VEcadhern, or b-actin at room temperature for 1 h. The membrane was then washed three times with 0.1% Tween 20–TBS and then incubated in the horseradish peroxidase-linked secondary antibody for 50 min at room temperature. The membrane was washed three times with 0.1% Tween 20–TBS, and the immunoactive bands were detected by using enhanced chemiluminescent (ECL) plus reagent kit. The band density for the target protein in each sample was measured with AlphaEaseFC 3.1.2 software (Alpha Innotech, San Leandro, CA) and was normalized to b-actin expression. Phosphorylation of MAPKs represents the activation state of the enzymes [16]. HMECs were seeded at 5 · 105 cells per plate on 150 mm plates and grown until confluence (3–5 days). The medium was then changed to MCDB 131 without the supplement but with 0.1% DMSO or 15 lM ritonavir at 37 C for 24 h. After treatments, cells were lysed as described above. Equal amounts of total protein (30 lg) were electrophoresed on 10% SDS polyacrylamide gels. The gels were transferred and blotted using the anti-phosphorylated MAPK antibodies diluted as per manufacturerÕs recommendation and then followed with HRP-labeled goat anti-mouse IgG (1:5000) as secondary antibody. Blots were developed and the band density was determined as described above. Superoxide anion analysis. Superoxide anion production by HMEC monolayers was measured in white 35 mm plates at the density of 1 · 105 cells per plate with Sirius Luminometer and FB12 software (Berthold, Bad Wildbad, Germany) using lucigenin-amplified chemiluminescence [9]. After treatment with ritonavir with or without an antioxidant for 24 h, cells were washed with HBSS and incubated in a standard mixture containing 100 ll of 1 mM Hepes in HBSS without phenol red, pH 7.4, 100 ll carbonate buffer, pH 10.4, and 50 ll lucigenin (final concentration 200 lM). Superoxide anion generation was measured continuously over a period of 40 min (kinetics mode, 12 s per data point). Blind values were obtained by measuring standard mixtures without cells. The kinetic data were presented using one representative experiment out of three separate experiments. Statistical analysis was performed using the average of 20 data points around 25 min, where the peak reaction usually occurs. Statistical analysis. Statistical analysis was performed with Microsoft Excel software (Seattle, WA). Data are reported as

means ± standard error (SE). Comparisons were made with paired StudentÕs t test and the difference was considered significant at P < 0.05.

Results Ritonavir increases endothelial permeability We first tested the effect of ritonavir on paracellular permeability of HMECs using a transwell system with a fluorescence-labeled dextran tracer. Confluent HMEC monolayer was treated with several concentrations of ritonavir ranging from 5 to 30 lM for 24 h. A significant increase of endothelial permeability was observed in a dose-dependent manner in response to ritonavir treatment (Fig. 1A). At 15 and 30 lM of ritonavir, the permeability showed an increase by 56 ± 10% and 129 ± 9%, respectively, as compared to controls (n = 4, P < 0.05). In order to understand the kinetics of ritonavir-induced endothelial permeability, HMECs were treated with ritonavir (15 lM) at different time points. The endothelial permeability was significantly increased by 29 ± 7% at 6 h (P < 0.05) and by 61 ± 1%, 56 ± 18%, and 114 ± 5% at 12, 24, and 48 h, respectively (P < 0.001) (Fig. 1B). Ritonavir decreases the expression of endothelial tight junction molecules but not VE-cadherin To determine whether ritonavir could affect endothelial junctions, both mRNA and protein levels of four tight junction molecules (ZO-1, occludin, claudin-1, and JAM) and the adherence junction molecule VE-cadherin were analyzed using real-time PCR (Fig. 2A) and Western blot (Fig. 3), respectively. Ritonavir (15 and 30 lM) significantly reduced ZO-1 mRNA by 48% and 54%, respectively, as compared to controls (P < 0.05). All three doses of ritonavir (7.5, 15, and 30 lM) significantly reduced occludin mRNA levels by 43%, 61%, and 60%, respectively (P < 0.05). Ritonavir at 30 lM reduced claudin-1 mRNA by 41% (P < 0.05). Although ritonavir reduced JAM mRNA levels, it was not statistically significant. The relative mRNA levels for VE-cadherin were 0.00231, 0.00117, 0.00217, and 0.00148 in response to the treatment of ritonavir (0, 7.5, 15, and 30 lM), respectively, showing no statistical differences. Moreover, protein levels (band density standardized

Occludin

100 ** 75

*

50 *

0.010

JAM

0.008 *

0.006

** 0.004 **

0.002 **

**

**

7.5

15

30

0.000

5

10

15

20

0 Control

30

Ritonavir Concentration (µM)

Permeability (% of Control)

Claudin-1

*

0

B

ZO-1

**

125

25

877

0.012

150

Relative mRNA Levels

Permeability (% of Control)

C. Chen et al. / Biochemical and Biophysical Research Communications 335 (2005) 874–882

Ritonavir Concentration (µM)

B

140

ZO-1

**

120

Occludin

100 80

**

Claudin-1

**

60

JAM

40

*

20

β-Actin

0 3

6

12

24

48

Incubation Time (hours)

0 Control

7.5

15

30

Ritonavir Concentration (µM) Fig. 1. Ritonavir increases endothelial permeability. Endothelial permeability was tested by using a transwell system with a fluorescence-labeled dextran tracer. (A) Dose-dependent study. HMECs were treated with serial concentrations of ritonavir for 24 h, and endothelial permeability was significantly increased at all doses of ritonavir treatments (n = 4) as compared to controls, which were cells with DMSO treatment without ritonavir. (B) Time-course study. HMECs were treated with ritonavir (15 lM) for different periods of time, and endothelial permeability was significantly increased after 6-h incubation (n = 4) as compared to controls. *P < 0.05 and **P < 0.001 as compared to controls.

with b-actin) of these tight junction molecules were reduced in ritonavir-treated cells. Ritonavir (15 and 30 lM) reduced 10% and 28% for ZO-1; 36% and 39% for occludin; 23% and 37% for claudin-1; and 21% and 19% for JAM, respectively (Fig. 2B). VE-cadherin/b-actin band density ratios were 0.83, 0.79, 0.78, and 0.81 in response to ritonavir treatment (0, 7.5, 15, and 30 lM), respectively, showing no substantial differences. Ritonavir increases superoxide anion production from HMECs Many studies have shown that an increased production of oxygen-derived free radicals such as superoxide anion and hydroxyl peroxide is one of the important molecular mechanisms of endothelial damage, which increases endothelial permeability [2,14]. To determine

Fig. 2. Ritonavir decreases the mRNA and protein levels of endothelial tight junction molecules. HMECs were treated with ritonavir (7.5, 15, and 30 lM) for 24 h. (A) The mRNA levels of endothelial tight junction molecules were determined by real-time PCR. The mRNA level of each gene in each sample was normalized to that of b-actin. Relative mRNA level was presented as 2^ ½C tðb-actinÞ
C tðgeneÞ . Ritonavir significantly reduced mRNA levels of ZO-1, occludin, and claudin-1 as compared to controls (n = 3). Although ritonavir also reduced JAM mRNA levels, it was not statistically significant. (B) The protein levels of endothelial tight junction molecules were determined by Western blot. The protein levels of tight junction molecules were reduced in ritonavir-treated cells. ZO-1, zonula occluden-1. JAM, junction adhesion molecule. *P < 0.05 and **P < 0.001 as compared to controls.

whether this mechanism is involved in ritonavir-induced endothelial permeability, superoxide anion production from ritonavir-treated endothelial cells was analyzed by a lucigenin-amplified chemiluminescence assay. HMECs treated with ritonavir (7.5, 15, and 30 lM) for 24 h revealed a substantial increase of superoxide anion production by 10%, 32%, and 65%, respectively, as compared to controls (Figs. 3A and B). Two antioxidants, EGCG (2 lM) and SeMet (100 lM), were included in the study of ritonavir-enhanced superoxide anion production. SeMet completely abolished ritonavir-enhanced superoxide anion production at both 15 and 30 lM ritonavir treatments and EGCG inhibited ritonavir-enhanced superoxide anion production by 61%

C. Chen et al. / Biochemical and Biophysical Research Communications 335 (2005) 874–882

15 mM RTV 7.5 mM RTV Control

20000 18000

RLU/ml

16000 14000 12000 10000 8000 6000 4000 2000

5

10

15

20

25

30

35

Time (minute)

RLU/ml (% of Control)

B

**

1.5 *

1

* *

60 40 20 0 15 -

15 + -

15 +

0.5

7.5

0 Control

and 45% at 15 and 30 lM ritonavir treatments, respectively (Fig. 3C). Furthermore, whether antioxidants could inhibit ritonavir-induced endothelial permeability was also determined. HEMCs were treated with ritonavir (15 lM) with or without antioxidant EGCG (2 lM) or SeMet (100 lM) for 24 h and endothelial permeability was analyzed. EGCG and SeMet significantly reduced ritonavir-induced cell permeability by 41% and 32%, respectively (Fig. 4, P < 0.05).

15

30

Ritonavir Concentration (µM)

RLU/ml (% of Control)

80

Fig. 4. Antioxidants inhibit ritonavir-induced endothelial permeability. Endothelial permeability was tested by using a transwell system with a fluorescence-labeled dextran tracer. HEMCs were treated with ritonavir with or without antioxidant EGCG or SeMet for 24 h. Both EGCG and SeMet significantly inhibited ritonavir-induced endothelial permeability (n = 3). RTV, ritonavir; EGCG, epigallocatechin gallate; SeMet, seleno-L-methionine. *P < 0.05 compared to ritonavir-treated groups.

2

0

C

100

RTV (µM) EGCG SeMet

0

0

Permeability (% of Control)

878

P<0.001

2.5 ** 2

P<0.001

ERK1/2 is involved in the ritonavir-induced endothelial permeability

1.5 ** 1

0.5 0

RTV (mM) EGCG SeMet

0 -

15 -

15 + -

15 +

30 -

30 + -

30 +

Fig. 3. Ritonavir increases superoxide anion production from HMECs. Superoxide anion production was analyzed by a lucigenin-amplified chemiluminescence assay. (A) Representative kinetic recordings. HMECs treated with ritonavir for 24 h showed substantial increases of superoxide anion production during 40 min continuous recordings. (B) Optimal response. Superoxide anion production was compared between the ritonavir-treated and control groups at the stage with optimal responses (at 25 min of recordings). There was a significant increase of superoxide anion production in the ritonavir-treated groups as compared to control groups (n = 4). (C) Superoxide anion production was analyzed at the optimal response (at 25 min of recordings). Antioxidant SeMet completely abolished ritonavir-enhanced superoxide anion production and EGCG partially reduced ritonavir-enhaced superoxide anion production (n = 4). RLU: relative luminescence unit. *P < 0.05 and **P < 0.001 as compared to controls. RTV, ritonavir; EGCG, epigallocatechin gallate; SeMet, seleno-L-methionine.

To determine whether MAPKs could be involved in signal transduction pathways of ritonavir-induced endothelial permeability, the activation status of three major MAPKs (ERK1/2, JNK, and P38) was determined by Western blot analysis, in which monoclonal antibodies specifically against phosphorylated corresponding MAKPs were used. Clearly, ritonavir treatment (15 lM) for 24 h substantially activated ERK1/2 but not JNK and P38 MAPKs of HMECs (Figs. 5A and B). Specific ERK1/2 inhibitor, PD89059 (20 lM), significantly abolished ritonavir-induced endothelial permeability by 92%, while specific P38 MAPK inhibitor, SB303580 (1.2 lM), had a limited effect on ritonavir-enhanced endothelial permeability (33%) (Fig. 6A). Furthermore, a broad range protein kinase inhibitor, staurosporine (50 nM), and a specific IP3K inhibitor, wortmannin (10 nM), significantly abolished ritonavirinduced endothelial permeability by 70% and 38%, respectively (Fig. 6B), indicating that other upstream protein kinases and IP3K were also involved in the signal transduction pathway of ritonavir-mediated effects.

C. Chen et al. / Biochemical and Biophysical Research Communications 335 (2005) 874–882

RTV

Permeability (% of Control)

Control

ERK 1 ERK 2

JNK

P38 MAPK

Control 15 mM RTV

180 160

70 60 50 40 30 20 10

0 RTV (mM) PD98059 SB303580

**

15 -

15 + -

15 +

140

B

120 100 80 60 40 20 0

ERK1/2

JNK

P38

Fig. 5. Effect of ritonavir on the activation of endothelial MAPKs. Activation of three major MAPKs (ERK1/2, JNK, and P38) was determined with Western blot analysis using monoclonal antibodies specifically against each of the phosphorylated MAKPs. HMECs treated with ritonavir for 24 h substantially activated ERK1/2 but not JNK and P38 MAPKs of HMECs. (A) Western blot for activated MAPKs. (B) Protein band density comparison between the ritonavirtreated and control groups.

Discussion In this study, we provide strong evidence, for the first time, that HIV PI ritonavir significantly increases human endothelial monolayer permeability in the transwell system. The underlying molecular mechanism may be related to the direct effects of ritonavir on the endothelial tight junction structure, oxidative stress, and ERK1/2 signal transduction pathways. These data provide a better understanding of the molecular mechanism of HIV PI-associated cardiovascular complications and suggest a novel approach in preventing these complications. Globally, HIV infection continues to be a major health care problem. At the end of year 2003, 38 million persons were HIV-infected, with 5 million newly infected and 3 million patients dead [17]. As HAART has successfully been applied to HIV patients, the mortality has substantially declined in recent years. Unfortunately, this therapy does not eradicate HIV. Although HIV infection is not considered a terminal disease, it does become a chronic disease, in which chronic organ damage from drug-related complications or having continuous virus presence in the body is becoming more prevalent.

Permeability (% of Control)

Band Density (% of Control)

B

879

60 50 40 * 30 20

**

10

0 RTV (mM) SSR WMN

15 -

15 + -

15 +

Fig. 6. Effect of protein kinase inhibitors on ritonavir-induced permeability of human endothelial cells. Endothelial permeability was tested by using a transwell system with a fluorescence-labeled dextran tracer. (A) Specific MAPK inhibitors. HEMCs were treated with ritonavir and the specific ERK1/2 inhibitor PD89059 for 24 h, and ritonavir-induced endothelial permeability was significantly abolished. However, the specific P38 MAPK inhibitor SB303580 had a limited effect on ritonavir-induced endothelial permeability (n = 4). (B) Other protein kinase inhibitors. The broad range protein kinase inhibitor staurosporine and IP3K inhibitor wortmannin significantly inhibited ritonavir-induced endothelial permeability (n = 4). RTV, ritonavir; SSR, staurosporine; WMN, wortmannin. *P < 0.05 and **P < 0.001 as compared to ritonavir-treated groups.

Drugs such as HIV PIs used for the treatment of HIV infection have been associated with a variety of cardiovascular complications, including dyslipidemia, lipodystrophy, and insulin resistance syndromes that can further accentuate the development of atherosclerosis [18]. Recently, our laboratory and others have discovered that HIV PIs are able to directly affect several types of cells including endothelial cells [19], lymphocytes [20], and adipocytes [21]. Of particular significance, our studies show that endothelial damage or dysfunction induced by HIV PIs may contribute to vascular disease formation [6–9]. Endothelial cells form a monolayer that serves as a macromolecular barrier between the blood vessels and underlying tissues. In addition, endothelial cells have

880

C. Chen et al. / Biochemical and Biophysical Research Communications 335 (2005) 874–882

many synthetic and metabolic properties, including the regulation of thrombosis and thrombolysis, platelet adherence, modulation of vascular tone and blood flow, and regulation of immune and inflammatory responses by controlling leukocyte, monocyte, and lymphocyte interactions within the vessel wall. Perturbations of endothelial structure and function may also result in many pathological states. Indeed, injury to endothelial cells or endothelial cell dysfunction is considered one of the critical events in the development of atherosclerosis. It has been well established that once atherosclerosis develops, the endothelial permeability of the vessel wall increases markedly [5]. Several biological factors can influence endothelial permeability. Inflammatory mediators, such as thrombin or histamine, are well-known factors which increase permeability across the endothelium [22]. Tumor necrosis factor-a (TNF-a) or interferon-c (IFN-c) enhances paracellular permeability of microvascular endothelial cells [23]. Our previous study has demonstrated that HIV PI ritonavir directly induced cytotoxicity of human endothelial cells in vitro [19]. In the present study, we have further demonstrated that ritonavir increased endothelial permeability in vitro. Our previous study [19] has demonstrated that ritonavir could induce cytotoxicity in HMECs with special experimental conditions which included serum starvation for 24 h before experiments and the low serum (1%) medium without supplement of growth factors during the experiments. However, current study was to study the effects of ritonavir on HMEC permeability with use of the different model system and experimental conditions as compared to the study described above. In order to avoid ritonavir-induced cytotoxicity, HMECs had not undergone serum starvation. Instead, cells were cultured in the transwell plate for 3–5 days with growth medium which was supplemented with human recombinant epidermal growth factor and 10% fetal bovine serum before experiments. The cells were then treated with ritonavir at either different concentrations or different time points with the same growth medium. At these conditions, endothelial permeability, but not cell viability, was significantly affected with ritonavir treatment. Our recent data also showed that ritonavir had no effect on cell survival with the growth factor containing and serum rich medium [9]. Furthermore, HMEC line is a well-characterized and highly purified cell population, which we have previously used to study endothelial function or dysfunction in several studies [19,24]. Although our in vitro findings are very exciting, they may not be directly applicable to in vivo situations. Thus, animal and human studies to determine the effect and mechanisms of HIV PIs on endothelial barrier function are warranted. The endothelial barrier function is maintained mainly by endothelial junction structures including tight junction, adherence junction, and gap junction. Human atherosclerosis develops preferentially in the regions of

vessels exposed to low mean shear stress [25] and in regions of decreased numbers of tight junctions [26]. To date, there is no published information about the effect of HIV PIs on endothelial junctions. In this present study, we show that HIV PI ritonavir significantly decreases tight junction protein expression in HMECs, but has no effect on VE-cadherin expression. Decreased levels of tight junction proteins such as ZO-1, occludin, and claudin-1 may contribute to the damage of tight junction and barrier function of endothelial cells in response to the treatment of ritonavir. Oxidative stress is one of the important factors which increase endothelial permeability. Reactive oxygen species (ROS) (e.g., O2
, H2O2, and OH) and nitrogen species (e.g., NO, ONOO–) cause endothelial barrier dysfunction in response to TNF-a through alterations in the cytoskeleton and extracellular matrix [27]. ROS are known to quench NO [28]. Thus, NO synthesis inhibition can potentiate agonist-induced increases in vascular permeability or increase basal microvascular permeability via an alteration of endothelial actin cytoskeleton [29]. This study has demonstrated that HIV protease PI ritonavir at concentrations equivalent to the therapeutic levels was able to induce superoxide anion (O2
) production in the human endothelial cells. This effect was specific because two antioxidant compounds EGCG and SeMet were able to block the ritonavir-induced superoxide production and endothelial permeability. EGCG is the major catechin derived from green tea. It is well known that EGCG is an efficient scavenger of ROS [30]. Several studies have shown that EGCG can undergo electron transfer (or H-atom transfer) to reduce cellular oxidant levels including hydroxyl radical (OH), O2
, peroxyl radical, singlet oxygen, peroxynitrite, and hydrogen peroxide [31]. SeMet is the major component of dietary selenium, of which the recommended daily allowance by the U.S. Food and Drug Administration is 50 lg per day. SeMet has potent antioxidative effects by the mechanisms of intramolecular transsulfuration reaction to form selenocystein, which increases the activities of internal antioxidant enzymes glutathione peroxidase and thioredoxin reductase [32]. Both EGCG and SeMet were selected in the current study because of different mechanisms of their potent antioxidant actions, low toxicity, and readiness for animal or human use. Findings from the current study suggest that ritonavir-induced oxidative stress may be one of the molecular mechanisms involved in the damage of endothelial barrier function. Accordingly, the use of antioxidants may be a novel strategy in preventing ritonavir-associated cardiovascular complications in HIV patients. Potential enzymatic sources of ROS in mammalian cells include the mitochondrial respiration, arachidonic acid pathway enzymes lipoxygenase and cyclooxygenase, cytochrome p450s, xanthine oxidase, NADH/

C. Chen et al. / Biochemical and Biophysical Research Communications 335 (2005) 874–882

NADPH oxidases, NO synthase, peroxidases, and other hemoproteins [33]. However, the sources of ritonavir-induced ROS are unknown. Our previous study has indicated that ritonavir was able to cause mitochondrial DNA damage in human endothelial cells [19]. Our recent investigation with porcine arteries has indicated that ritonavir also increased NADH/NADPH oxidase activity [8]. Thus, both mitochondrial respiration and NADH/NADPH oxidase could be the sources of ritonavir-induced ROS in human endothelial cells. Signal transduction pathways of ritonavir effects were investigated in this study. The results clearly show that ERK1/2 MAKP activation was involved in the ritonavir-induced endothelial permeability, but not JNK and P38 MAPKs. It is well known that ERK1/2 is a redox sensitive enzyme. Current study clearly showed that ritonavir significantly increased superoxide anion production and activation of ERK1/2 in human endothelial cells. ERK1/2 specific inhibitor effectively blocked ritonavirinduced endothelial permeability. Furthermore, upstream protein kinases and IP3K were also involved in the signal transduction pathway of ritonavir-mediated effects because a broad range protein kinase inhibitor, staurosporine, and a specific IP3K inhibitor, wortmannin, significantly abolished ritonavir-induced endothelial permeability. In summary, HIV PI-associated cardiovascular complications are significant clinical problems, for which the underlying mechanisms are still unclear. Impairment of endothelial barrier function resulting from loss of integrity of endothelial junction structures could be one of the important factors involved in vascular disease formation. This study demonstrates a clear link between HIV PI ritonavir and in vitro endothelial permeability, for which the increase of oxidative stress and activation of ERK1/2 may be the molecular mechanism. Consequently, reducing oxidative stress or inhibiting ERK1/ 2 activation may be a new strategy in preventing ritonavir-associated cardiovascular complications. Acknowledgments This work was partially supported by National Institutes of Health Grants R01 HL61943, R01 HL65916, R01 HL72716, R01 EB002436 (to C. Chen) as well as R01 DE15543 (to Q. Yao). The following reagent was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: ritonavir from Abbott Laboratories (Chicago, IL). References [1] A.G. Tomasselli, R.L. Heinrikson, Targeting the HIV-protease in AIDS therapy: a current clinical perspective, Biochim. Biophys. Acta 1477 (2000) 189–214.

881

[2] Department of Health and Human Services (DHHS). Guidelines for the use of antiretroviral agents in HIV-infected adults and adolescents, http://www.aidsinfo.nih.gov. [3] B. Gallet, M. Pulik, P. Genet, P. Chedin, M. Hiltgen, Vascular complications associated with use of HIV protease inhibitors, Lancet 351 (1998) 1958–1959. [4] J.H. Stein, M.A. Klein, J.L. Bellehumeur, P.E. McBride, D.A. Wiebe, J.D. Otvos, J.M. Sosman, Use of human immunodeficiency virus-1 protease inhibitors is associated with atherogenic lipoprotein changes and endothelial dysfunction, Circulation 104 (2001) 257–262. [5] S. Stender, E. Hjelms, In vivo transfer of cholesteryl ester from high and low density plasma lipoproteins into human aortic tissue, Atherosclerosis 8 (1988) 252–262. [6] H. Chai, S. Yan, P. Lin, A.B. Lumsden, Q. Yao, C. Chen, Curcumin blocks HIV protease inhibitor ritonavir-induced vascular dysfunction in porcine coronary arteries, J. Am. Coll. Surg. 200 (2005) 820–830. [7] H. Chai, W. Zhou, P. Lin, A. Lumsden, Q. Yao, C. Chen, Ginsenosides block HIV protease inhibitor ritonavir-induced vascular dysfunction of porcine coronary arteries, Am. J. Physiol. Heart Circ. Physiol. 288 (2005) H2965–H2971. [8] B.S. Conklin, W. Fu, P.H. Lin, A.B. Lumsden, Q. Yao, C. Chen, HIV protease inhibitor ritonavir decreases endothelium-dependent vasorelaxation and increases superoxide in porcine arteries, Cardiovasc. Res. 63 (2004) 168–175. [9] W. Fu, H. Chai, Q. Yao, C. Chen, Effects of HIV protease inhibitor ritonavir on vasomotor function and endothelial nitric oxide synthase expression, J. Acquir. Immune Defic. Syndr. 39 (2005) 152–158. [10] M.E. Staff, PhysiciansÕ Desk Reference 2004. 57 ed.: Medical Economics (2004). [11] L.B. Nielsen, B.G. Nordestgaard, S. Stender, K. Kjeldsen, Aortic permeability to LDL as a predictor of aortic cholesterol accumulation in cholesterol fed rabbit, Arterioscler. Thromb. 12 (1992) 1402–1409. [12] C.H. Kao, J.K. Chen, J.S. Kuo, V.C. Yang, Visualization of the transport pathways of low density lipoproteins across the endothelial cells in the branched regions of rat arteries, Atherosclerosis 116 (1995) 27–41. [13] B.R. Stevenson, B.H. Keon, The tight junction: morphology to molecules, Annu. Rev. Cell Dev. Biol. 14 (1998) 89–109. [14] H. Ozaki, K. Ishii, H. Horiuchi, H. Arai, T. Kawamoto, Okawa, A. Iwamatsu, T. Kita, Cutting edge: combined treatment of TNFa and IFN-c causes redistribution of junctional adhesion molecule in human endothelial cells, J. Immunol. 163 (1999) 553–557. [15] W. Wang, W.L. Dentler, R.T. Borchard, VEGF increases BMEC monolayer permeability by affecting occludin expression and tight junction assembly, Am. J. Physiol. 280 (2001) H434–H440. [16] K.K. Griendling, C.A. Minieri, J.D. Ollerenshaw, J.D. Alexander, Angiotensin II stimulates NADH and NADPH oxidase activity in cultured vascular smooth muscle cells, Circ. Res. 74 (1994) 1141– 1148. [17] UNAIDS/WHO, Report on the global AIDS epidemic, www.unaids.org. 2004. Cardiovascular and metabolic complications of HIV infection, Cardiol. Rev. 8 (2000) 260–268. [18] G. Krishnaswamy, D.S. Chi, J.L. Kelley, F. Sarubbi, J.K. Smith, A. Peiris, The cardiovascular and metabolic complications of HIV infection, Cardiol. Rev. 8 (2000) 260–268. [19] D.S. Zhong, X.H. Lu, B.S. Conklin, P.H. Lin, A.B. Lumsden, Q. Yao, C. Chen, HIV protease inhibitor ritonavir induces cytotoxicity of human endothelial cells, Arterioscler. Thromb. Vasc. Biol. 22 (2002) 1560–1566. [20] M.B. Lucia, S. Rutella, G. Leone, S. Vella, R. Cauda, HIVprotease inhibitors contribute to P-glycoprotein efflux function defect in peripheral blood lymphocytes from HIV-positive patients receiving HAART, JAIDS 27 (2001) 321–330.

882

C. Chen et al. / Biochemical and Biophysical Research Communications 335 (2005) 874–882

[21] P. Domingo, X. Matias-Guiu, R.M. Pujol, E. Francia, E. Lagarda, M.A. Sambeat, G. Vazquez, Subcutaneous adipocyte apoptosis in HIV-1 protease inhibitor-associated lipodystrophy, AIDS 13 (1999) 2261–2267. [22] H. Lum, A.B. Malik, Mechanisms of increased endothelial permeability, Can J. Physiol. Pharmacol. 74 (1996) 787–800. [23] M.S. Blum, E. Toninelli, J.M. Anderson, M.S. Balda, J. Zhou, L. OÕDonnell, R. Pardi, J.R. Bender, Cytoskeletal rearrangement mediates human microvascular endothelial tight junction modulation by cytokines, Am. J. Physiol. Heart Circ. Physiol. 273 (1997) H286–H294. [24] R. Zhao, X. Chen, Q. Yao, C. Chen, TNF-a stimulates interleukin-8 and endothelin-1 expression in human endothelial cells, Biochem. Biophys. Res. Commun. 327 (2005) 985–992. [25] R. Krams, J.J. Wentzel, J.A. Oomen, R. Vinke, J.C. Schuurbiers, P.J. de Feyter, P.W. Serruys, C.J. Slager, Evaluation of endothelial shear stress and 3D geometry as factors determining the development of atherosclerosis and remodeling in human coronary arteries in vivo, Arteriscler. Thromb. Vasc. Biol. 17 (1997) 2061–2065. [26] M. Okano, Y. Yoshida, Junction complexes of endothelial cells in atherosclerosis-prone and atherosclerosis-resistant regions on flow dividers of brachiocephalic bifurcations in the rabbit aorta, Biorheology 31 (1994) 155–161.

[27] M. Aslan, T.M. Ryan, T.M. Townes, L. Coward, M.C. Kirk, S. Barbes, C.B. Alexander, S.S. Rosenfeld, B.A. Freeman, Nitric oxide-dependent generation of reactive species in sickle cell disease: actin tyrosine nitration induces defective cytoskeletal polymerization, J. Biol. Chem. 278 (2003) 4194–4204. [28] G.M. Rubanyi, P.M. Vanhoutte, Superoxide anions and hyperoxia inactivate endothelium-derived relaxing factor, Am. J. Physiol. 250 (1986) H822–H827. [29] A.L. Baldwin, G. Thurston, H. al Naemi, Inhibition of nitric synthesis increases venular permeability and alters endothelial actin cytoskeleton, Am. J. Physiol. 274 (1998) H1776–H1784. [30] S.R. Husain, J. Cillard, P. Cillard, Hydroxyl radical scavenging activity of flavonoids, Phytochemistry 26 (1987) 2489–2491. [31] K. Nagai, M.H. Jiang, J. Hada, T. Nagata, Y. Yajima, S. Yamamoto, T. Nishizaki, (
)-Epigallocatechin gallate protects against NO stress-induced neuronal damage after ischemia by acting as an anti-oxidant, Brain Res. 956 (2002) 319–322. [32] C.B. Allan, G.M. Lacourciere, T.C. Stadtman, Responsiveness of selenoproteins to dietary selenium, Annu. Rev. Nutr. 19 (1999) 1– 16. [33] H. Cai, D.G. Harrison, Endothelial dysfunction in cardiovascular diseases: the role of oxidant stress, Circ. Res. 87 (2000) 840–844.