hKv4.3 Channel Characterization and Regulation by Calcium Channel Antagonists

Biochemical and Biophysical Research Communications 281, 452– 460 (2001) doi:10.1006/bbrc.2001.4396, available online at http://www.idealibrary.com on

hKv4.3 Channel Characterization and Regulation by Calcium Channel Antagonists Thierry P. G. Calmels, 1 Jean-Franc¸ois Faivre, 1,2 Brigitte Cheval, Jean-Luc Javre´, Sabine Rouanet, and Antoine Bril Department of Cardiovascular Pharmacology, SmithKline Beecham Laboratories Pharmaceutiques, 4 Rue du Chesnay Beauregard, 35760 Saint-Gre´goire, France

Received December 26, 2000

Relative expression pattern of short and long isoforms of hKv4.3 channels was evaluated by RT-PCR and RPA. Electrophysiological studies were performed in HEK293 cells transfected with short or long hKv4.3 cDNA. The long variant L-hKv4.3 was the only form present in lung, pancreas, and small intestine. The short variant S-hKv4.3 was predominant in brain whereas expression levels of the two isoforms were similar in cardiac and skeletal muscles. Properties of the ionic channels encoded by L-hKv4.3 and S-hKv4.3 cDNAs were essentially similar. Cadmium chloride and verapamil inhibited hKv4.3 current (with EC50s of 0.110 ⴞ 0.004 mM and 492.9 ⴞ 15.1 ␮M, respectively). Verapamil also accelerated current inactivation. Another calcium channel antagonist nicardipine was found inactive. In conclusion, this study confirms that both isoforms underlie the transient outward potassium current. Moreover, calcium channel inhibitors markedly affect hKv4.3 current, an effect which must be considered when evaluating transient outward potassium channel properties in native tissues. © 2001 Academic Press

Key Words: heart; K-channel; I to current; Kv4.3; calcium channel antagonist; tissue localisation; RT-PCR; Rnase protection assay.

The transient outward potassium current I to plays a major role in the repolarisation process of many different cell types. In cardiac myocytes, it is involved in the early repolarization phase of the action potential and its modulation is known to affect notably the shape of cardiac action potential (1, 2). The physiological and pathophysiological relevance of this current has been well established: In normal heart, the density of the I to current is not uniformely distributed and this current 1

Both authors contributed equally to this study. To whom correspondence should be addressed. Fax: (33) 2 99 28 04 44. E-mail: [email protected]. 2

0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

is considered as an important determinant of the electrophysiological heterogeneity characterized in the different cardiac cell types (3, 4). On another hand, in pathological situations, and particularly in congestive heart failure, I to current density is reduced, an effect which at least in part explains the prolongation of the cardiac action potential observed in these pathological conditions (5–7). The cardiac I to current is activated by membrane depolarization in a voltage range similar to that of the L-type calcium current (I Ca-L) (see (8)). Because I Ca-L is present in all cardiac cells where I to is expressed, the characterization of I to in native cardiac cells requires the previous inhibition of the I Ca-L current. This strategy has been used indeed in most of the studies aimed at characterizing the I to current in cardiac cells. Interestingly, several reports indicate that calcium channel antagonists can interfere with native potassium channels (9 –11) including I to channels (12–14). However, data evaluating the direct influence of calcium channel inhibitors on the I to current are scarce because of the obvious difficulty to record I to in real control conditions. The recent identification of the molecular correlate for the cardiac I to current (15) gives an interesting opportunity to address specifically this question. It is now generally accepted that Kv4.3 underly the transient outward potassium current in human heart (5, 16, 17). The distribution pattern of the two known hKv4.3 isoforms differing by a 19 amino acid insert was evaluated in different tissues by RT-PCR methodology. The relative expression of both isoforms was assessed using RNAse protection assay. The properties of the channels encoded by both isoforms were found essentially similar. Finally, the effects of typical calcium channel inhibitors on the hKv4.3 were evaluated by investigating the effects of cadmium chloride, verapamil and nicardipine as representatives for inorganic blockers, phenylalkilamines and dihydropyridines, respectively.

452

Vol. 281, No. 2, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

MATERIALS AND METHODS Determination of the expression pattern of hKv4.3 isoforms by RT-PCR. Human total RNA isolated from heart, lung, brain, skeletal muscle, small intestine, and pancreas (Clontech, Palo Alto, CA) was used to perform reverse transcriptase (RT) followed by PCR reactions using MasterAmp RT-PCR kit (Epicentre Technologies, Madison, WI). Primers for the two splice variants were designed on each side of the 19 AA insertion as follows: forward primer, 5⬘CACCCCAGAAGAGGAGCACAT 3⬘ and reverse primer, 5⬘AGTAGCTGGCAGGTTAGAATT 3⬘. Determination of the expression pattern of hKv4.3 isoforms by RNAse protection assay. Ribonuclease protection assay was performed using RPA II kit (Ambion). A 322-bp fragment of the long human Kv4.3 (1-hKv4.3) cDNA isoform, which contained the 19 amino acids insertion, was amplified by PCR (forward primer, 5⬘CACCCCAGAAGAGGAGCACAT 3⬘ and reverse primer, 5⬘AGTAGCTGGCAGGTTAGAATT 3⬘) and subcloned into pBluescript KS(⫹) (Stratagene) that was used as template for the synthesis of a 400-base antisense RNA probe. pTRI-hu-cyclophilin (Ambion) was used as internal control to generate a 138-base probe. Both probes were synthesized with T7 and T3 RNA polymerases for hKv4.3 and cyclophilin probes, respectively, using the in vitro Maxiscript transcription kit (Ambion) in presence of 50 pmoles of [␣- 32P]UTP (800 Ci/ mmole). Twenty micrograms of total human RNA (Clontech) hybridized with probes that were digested with RNAse MIX (1:100 dilution). Electrophysiological recordings. Whole-cell configuration of the patch-clamp technique (18) was applied on HEK293 cells transfected with the short or the long hKv4.3 cDNA subcloned into mammalian expression vector pHook2 (Invitrogen Co., San Diego, CA). Transfection, cell culture, cell selection conditions, and electrophysiological recording were described previously (19). The amplitude of the transient outward potassium current recorded in HEK293 cells transfected with short or long hKv4.3 cDNA was measured as the time-dependent amplitude of the current evoked by depolarising pulses. Data analysis. Results are expressed as mean ⫾ SEM. Electrophysiological analysis was performed by a microcomputer using pClamp software (Axon Instruments). Curve fitting was done by nonlinear regression analysis using single Boltzmann or exponential function and the standard Logistic algorithm provided by Origin 4.1 (MicroCal Software).

RESULTS Tissue Distribution of Human mRNA Isoforms Encoding hKv4.3 Splice Variants RT-PCR was performed on the total RNA from different human tissues. Two fragments of 265 bp and 322 bp were generated as visualized on agarose gel and corresponded to the short (S-hKv4.3) and the long (L-hKv4.3) splice variants, respectively (Fig. 1A). L-hKv4.3 is the only isoform detected in lung, pancreas, and small intestine whereas both S-hKv4.3 and L-hKv4.3 are present in heart, brain and skeletal muscle. Respective expression level of both hKv4.3 spliced variants was determined by RNAse protection assay in several human tissues (Fig. 1B). Highest levels of hKv4.3 gene expression combining both short and long isoform were observed in brain and heart. In skeletal muscle, hKv4.3 is detected at lower level. In other

tissues, pancreas, small intestine, and lung, the level of expression observed for both hKv4.3 isoforms was very low. In addition, as observed with RT-PCR experiments, only the long isoform was identified in human lung, pancreas and small intestine. Signals for the two isoforms were quantified and normalized with cyclophilin mRNA level (Fig. 1C); The short isoform is predominant in brain where it represents nearly 83% of the hKv4.3 mRNA. In heart and skeletal muscle both hKv4.3 isoforms were expressed at a similar level with an expression ratio long/short isoform of 60%. Basic Properties of Short and Long hKv4.3 Isoforms When Expressed in HEK293 Cells The short (AF205856) and the long (AF205857) variants encoding a peptide of 636 amino acids and 655 amino acids, respectively, and differing by a 19 amino acids insertion (corresponding to an alternative splicing) at the C-terminal region of the hKv4.3 channel were used to transfect HEK293 cells. The cells were patch-clamped to characterize the main electrophysiological features of both channels. Results are illustrated and quantified in Fig. 2. The relative conductance versus membrane potential was evaluated by depolarizing the cells from a holding potential of ⫺80 mV to ⫹70 mV in 10 mV increments (Fig. 2A). The voltage-dependency of steady-state inactivation was evaluated using a double pulse protocol consisting in depolarizations from a holding potential of ⫺80 to ⫹30 mV in 10 mV increments followed by a depolarization to ⫹10 mV (Fig. 2B). Finally, kinetics of recovery from inactivation were assessed using a double pulse to ⫹10 mV from a holding potential of ⫺80 mV. The interpulse delay was progressively increased, from a minimum of 10 ms to a maximum of 5 s (Fig. 2C). We then evaluated the effect of four-aminopyridine (4-AP) on the short and the long isoforms of the hKv4.3 channel (Figs. 2D and 2E). Four-AP inhibited dosedependently the current flowing through hKv4.3 channels. In Fig. 2D, experimental traces show that the L-hKv4.3 current was inhibited by 60% by 3 mM 4-AP. A cross-over between the two traces could be observed, as already reported on the I to current and the rat Kv4.2 and Kv4.3 currents (19 –21). A similar phenomenon was also observed on the short isoform of the hKv4.3 channel. The concentration-dependent curve of 4-AP shows that results obtained on both hKv4.3 isoforms were very similar (Fig. 2E). Effect of Calcium Channel Antagonists on hKv4.3 Channels We evaluated the effects of different calcium channel antagonists on the current flowing through hKv4.3 channels. Experiments with calcium channel antagonists were performed on one isoform only, namely the

453

Vol. 281, No. 2, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

454

Vol. 281, No. 2, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

short hKv4.3 isoform, because no difference between short and long isoforms could be detected. We found that cadmium chloride induced a dose-dependent inhibition of the time-dependent amplitude of hKv4.3 current (Fig. 3A). Half effective concentration of cadmium chloride was 0.110 ⫾ 0.004 mM and Hill coefficient was 0.66 ⫾ 0.02. On another hand, verapamil produced a diminution of both the time-dependent amplitude and the sustained component of the hKv4.3 current. The inactivation rate of the current appeared to be accelerated. Time-dependent current was inhibited with a half effective concentration of 492.9 ⫾ 15.1 ␮M whereas the sustained amplitude of the current was half inhibited with 46.3 ⫾ 2.2 ␮M (Fig. 3B). The acceleration of the inactivation rate of the hKv4.3 current is characterized in Fig. 3C. In control conditions, inactivation rate of hKv4.3 current occurred according to a double exponential process which time constants were 173.6 ⫾ 7.5 ms (Tau 1) and 34.6 ⫾ 1.8 ms (Tau 2). Verapamil affected both time-constants and maximally reduced Tau 1 to 51.5% and Tau 2 to 22.2% of the predrug values. Half-maximal effects on Tau 1 and Tau 2 were obtained with 19.2 ⫾ 7.1 ␮M and 37.9 ⫾ 10.7 ␮M verapamil, respectively. Finally, the effect of a dihydropyridine on hKv4.3 current was evaluated. We found that neither the peak current amplitude nor the sustained current amplitude were affected by nicardipine at concentrations up to 30 ␮M (not shown). To characterize further the effect of cadmium chloride and verapamil on hKv4.3 current, subsequent experiments were performed with concentrations corresponding to the half effective concentration on hKv4.3 current identified during the dose-response experiments, i.e., 0.11 mM and 0.5 mM for cadmium chloride and verapamil, respectively. In Fig. 4 are summarized activation, inactivation and recovery from inactivation properties of hKv4.3 channels recorded in the absence and in the presence of verapamil or cadmium chloride. Cadmium affected neither the half maximal activation potential of the current nor the Boltzmann factor of the voltage-dependent activation curve (Fig. 4A). On the opposite, the voltage-dependent steady-state inactiva-

tion of the hKv4.3 current was rightward shifted by more than 15 mV in the presence of 0.11 mM cadmium (Fig. 4B). Figure 4C illustrates that recovery from inactivation of hKv4.3 current was only slightly affected by cadmium chloride. In the presence of verapamil, voltage-dependent activation of the current was not markedly altered although a 10 mV leftward shift of the Boltzmann curve was observed. On the other hand, voltage-dependent inactivation of the current was not modified by verapamil, as illustrated in Fig. 4B. On the opposite, recovery from inactivation kinetics was tremendously slowed-down by verapamil, reactivation rate being increased from 154.1 ⫾ 5.2 ms in control conditions to 418.4 ⫾ 14.0 ms in the presence of 0.5 mM verapamil. DISCUSSION Long and Short Human Kv4.3 Channel Variants The present study shows that large differences in overall hKv4.3 gene expression have been observed among several human tissues (Fig. 1). Similar observation has been reported by Dilks and co-workers (22) as well as by Isbrandt and co-workers (23). Quantitative analysis indicate that human Kv4.3 gene is predominantly expressed in heart and brain although the relative distribution of both short and long isoforms markedly differs in both tissues (Fig. 1B). Our data suggest that the long variant represents only 17% in brain and 60% of the total hKv4.3 mRNA expression in human heart. These results are in good agreement with RT-PCR data reported by Isbrand showing that both transcripts are detected in almost equal amount in human cardiac ventricle (23). These findings differ from data published by Dilks and co-workers who detected only the long transcript in heart (22). The ratio of both short and long isoforms determined by RPA in rat (24) indicate that the long form is between 4- and 10-fold more abundant than the short form in heart. Additional data from RT-PCR made in rat provide a comparable quantification: 89% of the long form is

FIG. 1. Distribution of hKv4.3 mRNA identified by RT-PCR and RPA. (A) RT-PCR were performed in several human tissues to amplify fragments of 265 and 322 bp length for both short and long hKv4.3 isoforms, respectively. For each tissue, either no RNA (lanes 3, 7, 11, 17, 21, and 27) or 400 ng (lanes 4, 8, 12, 18, 22, and 28) total RNA were used. Experiments without reverse transcriptase were done as a negative control with 400 ng of total RNA (lanes 5, 9, 13, 19, 23, and 29) to verify the absence of contaminant arising from chromosomal DNA. A G3PDH fragment as internal positive control was amplified using 200 ng total RNA (sense primer: 5⬘GACCACAGTCCATGACATCACT 3⬘ and antisense primer: 5⬘TCCACCACCCTGTTGCTGTAG 3⬘) with experimental conditions identical to those used for hKv4.3 cDNAs in all tested tissues (lanes 2, 6, 10, 16, 20, and 26). Kv4.3 control DNAs are indicated on lanes 1, 24 and 25 for the long variant (322 bp) and on lanes 14, 15, and 30 for the short isoform (265 bp). (B) RPA was made with hKv4.3 and h-cyclophilin probes on several human tissues. The dried gel (6% denaturing polyacrylamide) was exposed on a storage phosphor screen, scanned with a Storm Imager (Molecular Dynamics) and mRNA expression levels were quantified by measuring the intensity of signals with ImageQuant software (Molecular Dynamics). hKv4.3 probe contains the 19 extra amino acids of the long isoform and is designed to protect one fragment of 322 bases for the long variant or two fragments of 177 and 88 bases for the short isoform (lanes 2, 4, 6, 8, 10, and 12). h-cyclophilin probe was made to protect a 103 bases fragment (lanes 1, 3, 5, 7, 9, and 11). (C) The expression level of the respective hKv4.3 isoforms in the different tissues is given as the relative density of the protected fragments (322 bases fragment for L-hKv4.3 and 177 ⫹ 88 bases fragments for S-hKv4.3) normalized to the density of the control cyclophilin and indicated as percentage values. 455

Vol. 281, No. 2, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 2. Properties of the short and long isoforms of the hKv4.3 channel. (A) Voltage-dependent activation of S- and L-hKv4.3. HEK293 cells were depolarized from a holding potential of ⫺80 mV to ⫹70 mV in 10 mV increments. See text for details. The curve was well-described assuming a Boltzmann function where V 1/2 and K correspond to half-activation potential and slope factor, respectively. (B) Voltage-dependent steady-state inactivation of S- and L-hKv4.3. HEK293 cells were depolarized from a holding potential of ⫺80 mV to ⫹30 mV in 10 mV increments during the conditioning pulse and to ⫹10 mV during the test pulse. See text for details. The curve was well-described assuming a Boltzmann function where V 1/2 and K correspond to half-inactivation potential and slope factor, respectively. (C) Kinetics of recovery from inactivation of S- and L-hKv4.3. Cells were submitted to a double pulse depolarization to ⫹10 mV. Interpulse delay varied between 10 ms and 5 s. The curve was well-described assuming an exponential function where ␶ represents the time constant of exponential recovery from inactivation. (D) Current traces obtained from a HEK293 cell transfected with S-hKv4.3 cDNA before and after the application of 3 mM 4-aminopyridine. Shown traces were recorded 3 min after compound addition to the external solution. Note the cross-over of the traces obtained before and after 4-aminopyridine effect. Arrow head indicate zero current level. (D) Concentration-dependent effect of 4-aminopyridine on S-hKv4.3 and L-hKv4.3 channels. EC 50 and n H correspond to the half effective concentrations and Hill coefficient, respectively. Holding potential, ⫺80 mV; test pulse potential, ⫹10 mV.

FIG. 3. Effect of cadmium chloride and verapamil on hKv4.3 current. (A) Concentration-dependent effect of cadmium chloride on hKv4.3 current. EC 50 and n H were 0.110 ⫾ 0.004 mM and 0.66 ⫾ 0.02, respectively. Inset: Current traces recorded from a HEK293 cell transfected with S-hKv4.3 cDNA before and 3 min after the application of 0.1 mM cadmium chloride. (B) Concentration-dependent effect of verapamil on hKv4.3 peak (EC 50 ⫽ 492.9 ⫾ 15.1 ␮M and n H ⫽ 0.85 ⫾ 0.02) and steady-state (EC 50 ⫽ 46.3 ⫾ 2.2 ␮M and n H ⫽ 0.57 ⫾ 0.01) currents. Inset: Current traces recorded from a HEK293 cell transfected with S-hKv4.3 cDNA before and 3 min after the application of 0.3 mM verapamil. (C) Effect of verapamil on the slow (left panel) and the rapid (right panel) inactivation time constants of hKv4.3 current. Verapamil maximally decreased the slow and the rapid time constants to 51.5 and 22.2% of control values, respectively. See text for details. In all cases, the holding potential was ⫺80 mV and the test pulse potential was ⫹10 mV. 456

Vol. 281, No. 2, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

457

Vol. 281, No. 2, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

pression in human heart (16) might be counterbalanced by specific distribution of short and long hKv4.3 isoforms. Interestingly, the study published by Kaab and collaborators (5) has shown that human Kv4.3 mRNA is downregulated in heart failure. Regarding the overall reduction in I to in heart failure, it might be of interest to study a possible secondary regulation occurring at the mRNA maturation level leading to a change in short versus long isoform expression. In summary, we hypothesize that splicing of hKv4.3 mRNA which appears to be tissue-specific, may participate to the activity and to the diversity of I to current observed in native tissues. Electrophysiological Properties of the S-hKv4.3 in Comparison with the L-hKv4.3

FIG. 4. Effect of 0.11 mM cadmium chloride and 0.5 mM verapamil on the electrophysiological properties of hKv4.3 current. Protocols are identical as in Fig. 3. (A) Voltage-dependent activation of hKv4.3. (B) Voltage-dependent steady-state inactivation of hKv4.3. (C) Kinetics of recovery from inactivation of hKv4.3.

found in heart tissue (25). In rat, Kv4.2 is expressed in a gradient across the left ventricular wall, which correlates well with I to density (26). In human, Kv4.3 is most likely to encode all of the native cardiac I to (5). Since human Kv4.1 constituted less than 5% of the total Kv message (16), the absence of Kv4.2 gene ex-

The results of the present study show that currents recorded in HEK293 cells transfected with the short or the long isoforms of the hKv4.3 channel were very similar. Whereas the voltage-dependent activation of short and long hKv4.3 isoforms slightly differed (Fig. 2), the voltage-dependent steady-state inactivation of both isoforms were similar. Similarly, kinetics of recovery from inactivation of S-hKv4.3 and L-hKv4.3 currents were nearly identical. The similar electrophysiological features of S-hKv4.3 and L-hKv4.3 in this study are in good agreement with the results reported by Kong and co-workers (27). In addition, it is reported here that pharmacological regulation of both isoforms by 4-AP is similar. The half effective concentration of 4-AP to inhibit hKv4.3 channels in the present study (⬃2.0 mM) was not markedly different from that reported on the rat Kv4.3 channel or on the Kv4.2 (⬃1.5 mM; (19, 21)). In these studies, sensitivity of cloned channels to 4-AP is lower than that of native I to, suggesting that auxiliary protein might interfere with hKv4.3 proteins in native tissue and might affect pharmacological regulation of the channel. Recently, different ␤-subunits such as KchAP, KchIPs or mirp1 have been shown to interfere with Kv channels (28 –31). In these studies, however, the potential influence of ␤-subunits on Kv4 channels pharmacology has not been investigated in detail and remains to be further analysed. The reason why two spliced variants of the hKv4.3 channel coexist notably in cardiac tissue is not clear. In native tissue, it may result in the formation of heteromultimeric hKv4.3 channels composed of both of S-hKv4.3 and L-hKv4.3 subunits. The importance of heteromultimers of Kv4.2 and Kv4.3 ␣-subunits for the transient outward current in mice native cardiac cells has been recently reported (32). Whether heteromultimers of S-hKv4.3 and L-hKv4.3 subunits constitute functional channels and whether this heteromultimerisation influences properties of the resulting channel remains to be determined.

458

Vol. 281, No. 2, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Effects of Calcium Channel Antagonists on hKv4.3 Current Calcium channel inhibitors may thoroughly alter I to channel properties. Verapamil-induced acceleration in hKv4.3 inactivation rate agrees with the effects reported on native rat transient outward potassium current (13, 14). These effects require verapamil concentrations which are higher than concentrations used to inhibit calcium channels. On the opposite, cadmium chloride is shown to inhibit hKv4.3 current with an EC50 of 0.11 mM which is similar to cadmium chloride concentrations usually used to block I Ca-L. Several studies demonstrated that calcium current blockers were able to affect I to channel properties (33), (12, 13), eventhough some of these studies were performed in the presence of a calcium channel inhibitor to isolate and characterize I to current. For examples, Gotoh et al. reported that dihydropyridines modified I to channel properties in rabbit cardiac myocytes. This effect was described whereas the calcium current was previously inhibited by 0.3 mM cadmium chloride (12). Similarly, Jahnel et al. reported the effects of different compounds on I to current including verapamil. These experiments were however performed in the presence of 0.2 mM cadmium chloride (13). As shown in the present study, these cadmium chloride concentrations markedly alter I to current properties and may have changed sensitivity of the current to other pharmacological agents. Because recombinant cell lines such as HEK293 cells do not exhibit any endogeneous ionic currents, they represent the best and more rigorous substrate to characterize ionic channel pharmacology when transfected with the appropriate cDNA. A similar approach has been followed to study the effects of calcium channel antagonists on the delayed rectifier potassium channels, i.e., I Kr coded by the HERG gene and IKs coded by the association of KvLQT1 and IsK proteins (10). The authors expressed recombinant channels in a cell line devoid of any voltage-activated ionic channels to study rigourously the effect of calcium channel inhibitors on potassium channels. Similarly to what is shown in the present study, they reported that dihydropyridines were only poorly effective on potassium currents (10), confirming the lower sensitivity of potassium channels to dihydropyridines which was demonstrated in native cardiac tissue (9). In conclusion, the results of the present study provide a characterization of human hKv4.3 channels expressed in HEK293 cells and further confirm the role that hKv4.3 play in the generation of I to current. Our results also demonstrate that the relative expression of the two splice variants identified, L-hKv4.3 and S-hKv4.3, markedly differ in human tissues. However, the biologic as well as the physiopathologic relevance of the two variants of hKv4.3 remain to be further investigated. Finally, the effect of calcium channel antago-

nists on hKv4.3 currents should be thoroughly considered when characterizing the transient outward potassium current I to in native tissue where calcium current is pharmacologically inhibited. ACKNOWLEDGMENTS The authors thank Sonia Saı¨di and Agne`s Renon for the help they provided in the preparation of the manuscript.

REFERENCES 1. Coraboeuf, E., Coulombe, A., Deroubaix, E., Hatem, S., and Mercadier, J. J. (1998) Bull. Exp. Biol. Med.-Engl. Tr. 182, 325– 333. 2. Hoppe, U. C., Marban, E., and Johns, D. C. (2000) J. Clin. Invest. 105, 1077–1084. 3. Antzelevitch, C., Sicouri, S., Litovsky, S. H., Lukas, A., Krishnan, S. C., Di Diego, J. M., Gintant, G. A., and Liu, D. W. (1991) Circ. Res. 69, 1427–1449. 4. Volders, P. G. A., Sipido, K. R., Carmeliet, E., Spa¨tjens, R. L. H. M. G., Wellens, H. J. J., and Vos, M. A. (1999) Circ. 99, 206 –210. 5. Ka¨a¨b, S., Dixon, J., Duc, J., Ashen, D., Na¨bauer, M., Beuckelmann, D. J., Steinbeck, G., McKinnon, D., and Tomaselli, G. F. (1998) Circ. 98, 1383–1393. 6. Nabauer, M., and Kaab, S. (1998) Cardiovasc. Res. 37, 324 –334. 7. Crumb, W. J., Jr., Munfakh, N., Heck, H. A., and Harrison, L. H. Jr. (1999) Fatty acid block of the transient outward current in adult human atrium. Journal of Pharmacology and Experimental Therapeutics 289, 386 –391. Ref Type: Abstract 8. Zipes, D. P., and Jalife, J. (1995) Cardiac Electrophysiology— From Cell to Bedside, W. B. Saunders Company, Philadelphia. 9. Daleau, P., Khalifa, M., and Turgeon, J. (1997) Effect of cadmium and nisoldipine on the delayed rectifier potassium current in guinea pig ventricular myocytes. J. Pharmacol. Exp. Ther. 281(826), 833. Ref Type: Abstract 10. Chouabe, C., Drici, M. D., Romey, G., Barhanin, J., and Lazdunski, M. (1998) HERG and KvLQT1/IsK, the cardiac K⫹ channels involved in long QT syndromes, are targets for calcium channel blockers (abstract) Mol. Pharmacol. 54(695), 703. 11. Zhang, S., Zhou, Z., Gong, Q., Makielski, J. C., and January, C. T. (1999) Mechanism of block and identification of the verapamil binding domain to HERG potassium channels (abstract). Circ. Res. 84, 989 –998. 12. Gotoh, Y., Watanabe, M., Shibata, E. F., Clark, R. B., and Giles, W. R. (1991) Inhibition of transient outward K ⫹ current by DHP Ca 2⫹ antagonists and agonists in rabbit cardiac myocytes (abstract). Am. J. Physiol. 260, H1737–H1742. 13. Jahnel, U., Klemm, P., and Nawrath, H. (1994) NaunynSchmiedebergs Arch. Pharmacol. 349, 87–94. 14. Wegener, J. W., and Nawrath, H. (1996) Action of tertiary phenylalkylamines on cardiac transient outward current from outside the cell membrane (abstract). Naunyn-Schmiedebergs Arch. Pharmacol. 354, 746 –754. 15. Tseng, G. N. (1999) Cardiovasc. Res. 41, 16 –18. 16. Dixon, J. A., Shi, W., Wang, H. S., McDonald, C., Yu, H., Wymore, R. S., Cohen, I. S., and McKinnon, D. (1996) Circ. Res. 79, 659 – 668. 17. Wang, Z., Feng, J., Shi, H., Pond, A., Nerbonne, J. M., and Nattel, S. (1999) Circ. Res. 84, 551–561. 18. Hamill, O. P., Marty, A., Neher, E., Sakmann, B., and Sigworth, F. J. (1981) Pflugers Arch. Eur. J. Physiol. 391, 85–100.

459

Vol. 281, No. 2, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

19. Faivre, J. F., Calmels, T. P. G., Rouanel, S., Javre´, J. L., Cheval, B., and Bril, A. (1999) Cardiovasc. Res. 41, 188 –199. 20. Castle, N. A., and Slawsky, M. T. (1993) J. Pharmacol. Exp. Ther. 264, 1450 –1459. 21. Tseng, G. N., Jiang, M., and Yao, J. A. (1996) J. Pharmacol. Exp. Ther. 279, 865– 876. 22. Dilks, D., Ling, H. P., Cockett, M., Sokol, P., and Numann, R. (1999) J. Neurophysiol. 81, 1974 –1977. 23. Isbrandt, D., Leicher, T., Waldschu¨tz, R., Zhu, X., Luhmann, U., Michel, U., Sauter, K., and Pongs, O. (2000) Genomics 64, 144 – 154. 24. Takimoto, K., Li, D., Hershman, K. M., Li, P., Jackson, E. K., and Levitan, E. S. (1997) Circ. Res. 81, 533–539. 25. Ohya, S., Tanaka, M., Oku, T., Asai, Y., Watanabe, M., Giles, W. R., and Imaizumi, Y. (1997) FEBS Lett. 420, 47–53. 26. Dixon, J. E., and McKinnon, D. (1994) Circ. Res. 75, 252–260. 27. Kong, W., Po, S., Yamagishi, T., Ashen, M. D., Stetten, G., and Tomaselli, G. F. (1998) Am. J. Physiol. 275, H1963–H1970.

28. Kuryshev, Y. A., Gudz, T. I., Brown, A. M., and Wible, B. A. (2000) Am. J. Physiol. Cell Physiol. 278, C931–C941. 29. Nakamura, T. Y., Nadal, M. S., Rudy, B., Artman, M., and Coetzee, W. A. (2000) Frequenin, a Ca 2⫹-binding protein, is expressed in heart and is a novel regulator of Kv4 currents. Circulation 102(18), II–91. Ref Type: Abstract 30. An, W. F., Bowlby, M. R., Betty, M., Cao, J., Ling, H. P., Mendoza, G., Hinson, J. W., Mattsson, K. I., Strassle, B. W., Trimmer, J. S., and Rhodes, K. J. (2000) Nature 403, 553–556. 31. Tseng, G. N., Abbott, G., and Jiang, M. (2000) Hmirp1 modulates the gating kinetics and pharmacology of transient outward current. Circulation 102(18), II–285. Ref Type: Abstract 32. Guo, W., Jung, W. E., Schwartz, T. L., Johns, D. C., and Nerbonne, J. M. (2000) Role of heteromultimers in the generation of myocardial transient outward K⫹ currents (abstract). Circulation 102(18), II–286. 33. Agus, Z. S., Dukes, I. D., and Morad, M. (1991) Am. J. Physiol. 261, C310 –C318.

460