- Email: [email protected]
HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population
Drug Metabolism and Pharmacokinetics xxx (2018) 1e4
Contents lists available at ScienceDirect
Drug Metabolism and Pharmacokinetics journal homepage: http://www.journals.elsevier.com/drug-metabolism-andpharmacokinetics
Regular Article
HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population Yaling Dou a, *, 1, Pan Peng b, 1, Congli Cai b, 1, Ali Ye a, Lingjun Kong a, Rui Zhang a a b
Department of Clinical Laboratory, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences, Beijing, 100730, China Wuhan YZY Medical Science and Technology Co Ltd., Wuhan, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 February 2018 Received in revised form 30 July 2018 Accepted 2 August 2018 Available online xxx
HLA-B*58:01 has been demonstrated to be associated with allopurinol-induced severe cutaneous adverse reactions. Since HLA-B*58:01 is too complicated to be identified, it is necessary to select an appropriate surrogate biomarker. In Japan, the rs9263726 allele was considered as a surrogate biomarker for HLA-B*58:01, but this was not the case with the Australian cohort. Due to the conflict results, in this study, we aim to demonstrate whether the rs9263726 allele is a surrogate biomarker for HLA-B*58:01 in Han Chinese population. A total of 353 samples (200 cases from the south and 153 cases from the north) were selected to detect HLA-B*58:01 and rs9263726 allele. The HLA-B*58:01 was identified by sequencing-based method, and the rs9263726 allele was identified by Taqman SNP Genotyping Assays. The results showed that the two alleles had a linkage, but not absolute linkage disequilibrium in Han Chinese population.
Keywords: HLA-B*58:01 rs9263726 Linkage disequilibrium Han Chinese Allopurinol-induced SCARs
© 2018 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction Allopurinol is a xanthine oxidase inhibitor that reduces the production of uric acid and is a first-line drug for gout and hyperuricemia [1e3]. However, allopurinol is also one of the most common causes of severe cutaneous adverse reactions (SCARs), which may lead to a high mortality rate and threat to life safety [4]. Although the reasons for allopurinol-induced SCARs are not completely clear, the human leukocyte antigen types have been reported to be associated with it. In 2005, Hung et al. first reported that the allele human leukocyte antigen (HLA)-B*58:01 was strongly associated with allopurinol-induced SCARs in a Han Chinese population [5]. This association was later confirmed in population from mainland China, Japan, Korea, Thailand, and Europe [6e10]. The sensitivity of developing an allopurinol-induced SCARs in HLA-B*58:01 carriers was 80e100% in Korean, Thai, Sardinia Italian and Han Chinese populations, but lower in the European and Japanese populations with 50e60% sensitivity [11]. At present, the Food and Drug Administration drug label has not yet given HLA-B*58:01 gene testing any recommendations.
* Corresponding author. E-mail address: [email protected] (Y. Dou). 1 These authors contributed equally to this work.
However, the Clinical Pharmacogenetics Implementation Consortium (CPIC)guidelines and the 2012 American College of Rheumatology Guidelines for management of gout recommended that patients should be tested for HLA-B*58:01 before allopurinol treatment, and, test positive patients should be prohibited from allopurinol treatment [2,3,12,13]. In 2015, a Taiwan team further confirmed that HLA-B*58:01 pre-screening could effectively reduce the risk of allopurinol-induced SCARs [14]. In the immunogenetics (IMGT)/HLA database, more than 1500 alleles of HLA-B have been reported, and HLA-B*58:01 is just one of them [15]. Exon 2 of the HLA-B locus exhibits the highest variability and is prone to generate unknown polymorphisms, which may affect the combination of primers and probes, leading to detection failures. Due to the nature of complexity and variability of HLA-B locus, testing for HLA-B*58: 01 becomes a challenge. Therefore, finding a surrogate biomarker that is less polymorphic and is in absolute linkage disequilibrium with HLA-B*58: 01 is necessary. The rs9263726 in the psoriasis susceptibility 1 candidate 1(PSORS1C1) gene was reported in absolute linkage disequilibrium (D0 ¼ 1, r2 ¼ 1) with HLA-B*58:01 in Japan [16,17]. However, another study, based on an Australian cohort, gave a contrast result that the rs9263726 allele was not linked to HLA-B*58:01 (D0 ¼ 0.059, r2 ¼ 0.001) [18]. In this study, we aim to demonstrate whether the rs9263726 allele is linked to HLA-B*58:01 in Han Chinese population.
https://doi.org/10.1016/j.dmpk.2018.08.001 1347-4367/© 2018 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article in press as: Dou Y, et al., HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population, Drug Metabolism and Pharmacokinetics (2018), https://doi.org/10.1016/j.dmpk.2018.08.001
2
Y. Dou et al. / Drug Metabolism and Pharmacokinetics xxx (2018) 1e4
2. Materials and Methods 2.1. Materials In this study, EDTA-anticoagulated whole-blood samples were collected randomly from the Peking Union Medical College Hospital and the Renmin Hospital of Wuhan University. Samples of non Han were excluded. A total of 353 samples were finally included in this project. Genomic DNA (gDNA) was extracted and purified using the QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany). The DNA concentration was 10 ng/mL and the OD260/280 was 1.60e2.00. All the DNA samples were only labeled with a consecutive number. And the test results only corresponded to their respective numbers. This study had passed ethical approval and ensured that the results do not infringe on the rights of the patient. 2.2. Methods 2.2.1. Genotyping of rs9263726 by Taqman assay Rs9263726 is just a G/A single nucleotide polymorphism, it was genotyped by using Taqman SNP Genotyping Assays. The PCR was performed in a total reaction volume of 25 mL, including 23 mL reaction buffer (YZYMED, Wuhan, China) and 2 mL gDNA (10 ng/mL). The PCR primers were 50 - GGACCCCAGCTCCTTAACACA -30 (forward) and 50 -TGGCAAAGTCGGTCAGGATT-30 (reverse). The PCR probes were 50 -FAM- AAACTCGTCCCCCCCAC-MGB-30 (for G) and 50 eVICAAACTCATCCCCCCCACG-MGB-3’ (for A). The PCR conditions were 37 C for 10 min and 95 C for 5 min, followed by 40 cycles of 95 C for 15s and 60 C for 1 min (fluorescence was measured). Taqman real-time PCR was performed in a LightCycler 480 II real-time PCR system (Roche, Basel, Switzerland). 2.2.2. Genotyping of HLA-B*58:01 by sequencing HLA-B types were determined by the sequencing-based method and were completed by Beijing Genomics Institute (BGI, Wuhan, China). PCR primers (forward: 50 -GAGCGAGGGGACCGCA -30 and reverse: 50 eCCGGGGTCACTCACCGG-30 ) were designed to amplify a HLA-B genomic fragment in the region of exon 2 which shows the highest variability. The PCR conditions were 95 C for 5 min, followed by 35 cycles of 95 C for 30s and 62 C for 30s and 72 C for 1 min.The final extension was done at 72 C for 5 min.This PCR step was performed in a ABI 9700 system (Applied Biosystems, California, USA). The PCR products were then sequenced by sequencing primers (50 -GGTATTTCTACACCGCCA -30 ) in a ABI 3730 system (Applied Biosystems, California, USA). 2.3. Statistical analysis HardyeWeinberg equilibrium was tested with c2 test. The statistical analysis between North and South was performed by c2 test. The above Data analysis was performed with SPSS statistical software. P < 0.05 indicated statistical significance. The analysis of linkage disequilibrium was performed with SHEsis (http://analysis.bio-x.cn) software platform. 3. Results All samples were divided into North and South populations based on the native place, including 153 cases in the northern group and 200 cases in the southern group. According to the relevant literature, the population frequency of HLA-B*58:01 in Han Chinese population was 2.9% in the north and 8.9% in the south [13]. The sample size of the North and South populations can ensure that the number of positive samples collected is greater than or equal to 5, which meets the statistical requirements.
Table 1 Rs9263726 allele test results. Rs9263726
G/G
G/A
A/A
Total
North South Total
140 182 322
13 17 30
0 1 1
153 200 353
First, we analyzed the genotyping results of rs9263726 alleles. The results were shown in Table 1. As shown in Table 1, we observed 1 cases of A/A genotype and 30 cases of G/A genotype, so we used allele frequency analysis instead of genotype frequency analysis. The frequencies of A and G alleles were 0.043 and 0.957 in the north, and 0.0475 and 0.9525 in the south. All the distribution of alleles frequencies were in Hardy-Weinberg equilibrium (north: p ¼ 0.583, south: p ¼ 0.391). At the same time, we analyzed the difference of the allele frequency in the north and South groups. The results showed that there was no significant difference in the frequency of rs9263726 allele between the two groups (p ¼ 0.751). Then, we analyzed the genotyping results of HLA-B*58:01 alleles and results were shown in Table 2. As shown in Table 2, similarly, because there were only 1 cases of HLA-B *58:01 homozygote, we use allele frequency analysis. The frequency of HLA-B*58:01 allele was 0.0229 in the north and 0.055 in the south, which distribution followed Hardy-Weinberg equilibrium (north: p ¼ 0.772, south: p ¼ 0.591). These data showed that HLA-B*58:01 allele frequency was different between north and south groups (p ¼ 0.033). At last, we analyzed the linkage disequilibrium between rs9263726 allele and HLA-B*58:01 allele. Results were shown in Table 3 for north group and Table 4 for south group. As shown in Table 3, in north group, only the partial absence of HLA-B*58: 01 allele in the rs9263726 G/A genotype was observed. The results of north group showed that HLA-B *58: 01 is linked to rs9263726, but not in absolute linkage disequilibrium (D0 ¼ 1, r2 ¼ 0.528). As shown in Table 4, in south group, the partial absence of HLA-B*58: 01 allele in the rs9263726 G/A genotype was observed. At the same time, HLA-B*58:01 was also observed in the presence of G/G genotype of rs9263726. The results of south group showed that HLA-B*58:01 is linked to rs9263726, but not in absolute linkage disequilibrium (D0 ¼ 0.887, r2 ¼ 0.675). The comparison of Tables 3 and 4 showed that HLA-B*58:01 was not observed in the presence of G/G genotype of rs9263726 in north group, which was different from the south. 4. Discussion In our study, we found that HLA-B*58:01 was linked to rs9263726 in the Han Chinese population from either north or south part of China, but this relationship was not in absolute linkage disequilibrium. Our results were different from the results of the studies from Japan [16,17]or Australia [18], which again confirmed that the linkage disequilibrium is varied between different ethnic groups [18,19]. Linkage disequilibrium presented the nonrandom association of alleles at different loci, so the genealogies of the two physically close sites were identical and tended to be co-inherited [20,21]. Historical events, such as genetic drift, multiple mutations Table 2 HLA-B*58:01 allele test results. HLA-B*58:01
*X/*X
HLA-B*58:01/*X
HLA-B*58:01/HLA-B*58:01
Total
North South Total
146 179 325
7 20 27
0 1 1
153 200 353
HLA- B genotype other than HLA- B*58:01 is indicated by *X.
Please cite this article in press as: Dou Y, et al., HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population, Drug Metabolism and Pharmacokinetics (2018), https://doi.org/10.1016/j.dmpk.2018.08.001
Y. Dou et al. / Drug Metabolism and Pharmacokinetics xxx (2018) 1e4
3
Table 3 Northern linkage disequilibrium analysis results. Northern
rs9263726
HLA-B*58:01
G/G G/A A/A
Total
Total
*X/*X
HLA- B*58:01 /*X
HLA-B*58:01 /HLA-B*58:01
140 6 0 146
0 7 0 7
0 0 0 0
*X/*X
HLA- B*58:01 /*X
HLA-B*58:01 /HLA-B*58:01
177 2 0 179
5 15 0 20
0 0 1 1
140 13 0 153
Table 4 Southern linkage disequilibrium analysis results. Southern
rs9263726
Total
HLA-B*58:01
G/G G/A A/A
and mixed of populations might disturb the relationship between linkage disequilibrium and inter-locus physical distance [22], which might explain the different linkage disequilibrium between HLA-B*58:01 and rs9263726 allele in different ethnic groups. In our study, we also found that HLA-B*58:01 allele showed differences between northern and southern Han Chinese population, which was consistent with previous studies [12,13]. However, the rs9263726 allele did not show any difference between the two Han Chinese ethic groups. Since the samples were randomly selected and both of the genotype distribution frequencies were followed the Hardy-Weinberg equilibrium, the difference in the north-south distribution of the two alleles indicated that HLAB*58:01 was not in absolute linkage disequilibrium with rs9263726. Another finding in our study was that although rs9263726 was not absolute linkage disequilibrium with HLA-B*58:01 in both Northern and Southern Han Chinese, all samples who have G allele of the rs9263726 still showed the different HLA-B type from the 58:01 in Northern Han Chinese. If only consider reducing the risk of allopurinol-induced SCARs, this finding indicated that the G allele of rs9263726 was the valid biomarker for the negative of HLAB*58:01 in Northern Han Chinese. However, detecting the G allele of rs9263726 also resulted in false positive results of HLA-B*58:01, which may benefit from allopurinol treatment. On the other hand, the G allele of rs9263726 was not a valid biomarker of HLA-B*58:01 negative in Southern Han population, and was not useful for the prediction of the low risk of the allopurinol-induced SCARs. Taken together, rs9263726 was not suitable as a biomarker for HLA-B*58:01 in Han Chinese population. In conclusion, we found that the HLA-B *58:01 allele was linked to rs9263726, but not in absolute linkage disequilibrium in Han Chinese population, which was different from the studies from Japan or Australia. Our study was the first study that tested the linkage disequilibrium between the two alleles in Han Chinese population and also offered a new discovery of the relationship between the two alleles. At the same time, our samples involved both the northern and southern Han Chinese population, which can better represent the Han population in China. Of course, we only analyzed the relationship between the two alleles, and did not further consider other possible factor, which may be the reason why our results were different from those in Japan. Since rs9263726 was not in absolute linkage disequilibrium with HLA-B*58: 01 in our study, we did not recommend rs9263726 as a surrogate biomarker. More research is needed to find a better surrogate biomarker for HLA-B*58: 01 in Han Chinese population.
Total
182 17 1 200
Conflicts of interest Authors declare that there are no conflicts of interest. Appendix A. Supplementary data Supplementary data related to this article can be found at https://doi.org/10.1016/j.dmpk.2018.08.001. References [1] Messerli FH, Makani H, Halpern D. Gout. N Engl J Med 2011;19:1876e7. author reply 77. [2] Khanna D, Fitzgerald JD, Khanna PP, Bae Sangmee, Singh MK, Neogi Tuhina, et al. 2012 American College of Rheumatology guidelines for management of gout. Part 1: systematic nonpharmacologic and pharmacologic therapeutic approaches to hyperuricemia. Arthritis Care Res (Hoboken) 2012;10:1431e46. [3] Khanna D, Khanna PP, Fitzgerald JD, Singh MK, Bae Sangmee, Neogi Tuhina, et al. 2012 American College of Rheumatology guidelines for management of gout. Part 2: therapy and anti-inflammatory prophylaxis of acute gouty arthritis. Arthritis Care Res (Hoboken) 2012;10:1447e61. [4] Ramasamy SN, Korb-Wells CS, Kannangara DR, Smithet MW, Wang N, Roberts DM, et al. Allopurinol hypersensitivity: a systematic review of all published cases, 1950e2012. Drug Saf 2013;10:953e80. [5] Hung SI, Chung WH, Liou LB, Chu CC, Lin Marie, Huang HP, et al. HLA-B*5801 allele as a genetic marker for severe cutaneous adverse reactions caused by allopurinol. Proc Natl Acad Sci U S A 2005;11:4134e9. [6] Cao ZH, Wei ZY, Zhu QY, Zhang JY, Yang Lun, Qin SY, et al. HLA-B*58:01 allele is associated with augmented risk for both mild and severe cutaneous adverse reactions induced by allopurinol in Han Chinese. Pharmacogenomics 2012;10: 1193e201. [7] Kaniwa N, Saito Y, Aihara M, Matsunaga K, Tohkinet M, Kurose K, et al. HLA-B locus in Japanese patients with anti-epileptics and allopurinol-related Stevens-Johnson syndrome and toxic epidermal necrolysis. Pharmacogenomics 2008;11:1617e22. [8] Kang HR, Jee YK, Kim YS, Lee CH, Jung JW, Kim SH, et al. Positive and negative associations of HLA class I alleles with allopurinol-induced SCARs in Koreans. Pharmacogenetics Genom 2011;5:303e7. [9] Tassaneeyakul W, Jantararoungtong T, Chen P, Lin PY, Tiamkao S, Khunarkornsiri U, et al. Strong association between HLA-B*5801 and allopurinol-induced Stevens-Johnson syndrome and toxic epidermal necrolysis in a Thai population. Pharmacogenetics Genom 2009;9:704e9. [10] Lonjou C, Borot N, Sekula P, Thomas L, Halevy S, Naldi L, et al. A European study of HLA-B in Stevens-Johnson syndrome and toxic epidermal necrolysis related to five high-risk drugs. Pharmacogenetics Genom 2008;2:99e107. [11] Yu KH, Yu CY, Fang YF. Diagnostic utility of HLA-B*5801 screening in severe allopurinol hypersensitivity syndrome: an updated systematic review and meta-analysis. Int J Rheum Dis 2017;9:1057e71. [12] Hershfield MS, Callaghan JT, Tassaneeyakul W, Mushiroda T, Thorn CF, Klein TE, et al. Clinical Pharmacogenetics Implementation Consortium guidelines for human leukocyte antigen-B genotype and allopurinol dosing. Clin Pharmacol Ther 2013;2:153e8. [13] Saito Y, Stamp LK, Caudle KE, Hershfield MS, McDonagh EM, Callaghan JT, et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines
Please cite this article in press as: Dou Y, et al., HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population, Drug Metabolism and Pharmacokinetics (2018), https://doi.org/10.1016/j.dmpk.2018.08.001
4
Y. Dou et al. / Drug Metabolism and Pharmacokinetics xxx (2018) 1e4
[14]
[15]
[16]
[17]
for human leukocyte antigen B (HLA-B) genotype and allopurinol dosing: 2015 update. Clin Pharmacol Ther 2016;1:36e7. Ko TM, Tsai CY, Chen SY, Chen KS, Yu KH, Chu CS, et al. Use of HLA-B*58:01 genotyping to prevent allopurinol induced severe cutaneous adverse reactions in Taiwan: national prospective cohort study. BMJ 2015:h4848. Robinson J, Soormally AR, Hayhurst JD, Marsh SG. The IPD-IMGT/HLA Database - new developments in reporting HLA variation. Hum Immunol 2016;3: 233e7. Tohkin M, Kaniwa N, Saito Y, Sugiyama E, Kurose K, Nishikawa J, et al. A wholegenome association study of major determinants for allopurinol-related Stevens-Johnson syndrome and toxic epidermal necrolysis in Japanese patients. Pharmacogenomics J 2013;1:60e9. Maekawa K, Nishikawa J, Kaniwa N, Sugiyama E, Koizumi T, Kurose K, et al. Development of a rapid and inexpensive assay for detecting a surrogate genetic polymorphism of HLA-B*58:01: a partially predictive but useful
[18]
[19]
[20]
[21] [22]
biomarker for allopurinol-related Stevens-Johnson syndrome/toxic epidermal necrolysis in Japanese. Drug Metabol Pharmacokinet 2012;4:447e50. Vidal C, Li J, Fulton R, Fernando SL. A polymorphism within the psoriasis susceptibility 1 candidate 1 (PSORS1C1) gene is not linked to HLA-B*58:01 in an Australian cohort. Drug Metabol Pharmacokinet 2016;3:252e5. de Bakker PI, McVean G, Sabeti PC, Miretti MM, Green T, Marchini J, et al. A high-resolution HLA and SNP haplotype map for disease association studies in the extended human MHC. Nat Genet 2006;10:1166e72. Maruki T, Lynch M. Genome-wide estimation of linkage disequilibrium from population-level high-throughput sequencing data. Genetics 2014;4: 1303e13. Ardlie KG, Kruglyak L, Seielstad M. Patterns of linkage disequilibrium in the human genome. Nat Rev Genet 2002;4:299e309. Jorde LB. Linkage disequilibrium and the search for complex disease genes. Genome Res 2000;10:1435e44.
Please cite this article in press as: Dou Y, et al., HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population, Drug Metabolism and Pharmacokinetics (2018), https://doi.org/10.1016/j.dmpk.2018.08.001
Contents lists available at ScienceDirect
Drug Metabolism and Pharmacokinetics journal homepage: http://www.journals.elsevier.com/drug-metabolism-andpharmacokinetics
Regular Article
HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population Yaling Dou a, *, 1, Pan Peng b, 1, Congli Cai b, 1, Ali Ye a, Lingjun Kong a, Rui Zhang a a b
Department of Clinical Laboratory, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences, Beijing, 100730, China Wuhan YZY Medical Science and Technology Co Ltd., Wuhan, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 February 2018 Received in revised form 30 July 2018 Accepted 2 August 2018 Available online xxx
HLA-B*58:01 has been demonstrated to be associated with allopurinol-induced severe cutaneous adverse reactions. Since HLA-B*58:01 is too complicated to be identified, it is necessary to select an appropriate surrogate biomarker. In Japan, the rs9263726 allele was considered as a surrogate biomarker for HLA-B*58:01, but this was not the case with the Australian cohort. Due to the conflict results, in this study, we aim to demonstrate whether the rs9263726 allele is a surrogate biomarker for HLA-B*58:01 in Han Chinese population. A total of 353 samples (200 cases from the south and 153 cases from the north) were selected to detect HLA-B*58:01 and rs9263726 allele. The HLA-B*58:01 was identified by sequencing-based method, and the rs9263726 allele was identified by Taqman SNP Genotyping Assays. The results showed that the two alleles had a linkage, but not absolute linkage disequilibrium in Han Chinese population.
Keywords: HLA-B*58:01 rs9263726 Linkage disequilibrium Han Chinese Allopurinol-induced SCARs
© 2018 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction Allopurinol is a xanthine oxidase inhibitor that reduces the production of uric acid and is a first-line drug for gout and hyperuricemia [1e3]. However, allopurinol is also one of the most common causes of severe cutaneous adverse reactions (SCARs), which may lead to a high mortality rate and threat to life safety [4]. Although the reasons for allopurinol-induced SCARs are not completely clear, the human leukocyte antigen types have been reported to be associated with it. In 2005, Hung et al. first reported that the allele human leukocyte antigen (HLA)-B*58:01 was strongly associated with allopurinol-induced SCARs in a Han Chinese population [5]. This association was later confirmed in population from mainland China, Japan, Korea, Thailand, and Europe [6e10]. The sensitivity of developing an allopurinol-induced SCARs in HLA-B*58:01 carriers was 80e100% in Korean, Thai, Sardinia Italian and Han Chinese populations, but lower in the European and Japanese populations with 50e60% sensitivity [11]. At present, the Food and Drug Administration drug label has not yet given HLA-B*58:01 gene testing any recommendations.
* Corresponding author. E-mail address: [email protected] (Y. Dou). 1 These authors contributed equally to this work.
However, the Clinical Pharmacogenetics Implementation Consortium (CPIC)guidelines and the 2012 American College of Rheumatology Guidelines for management of gout recommended that patients should be tested for HLA-B*58:01 before allopurinol treatment, and, test positive patients should be prohibited from allopurinol treatment [2,3,12,13]. In 2015, a Taiwan team further confirmed that HLA-B*58:01 pre-screening could effectively reduce the risk of allopurinol-induced SCARs [14]. In the immunogenetics (IMGT)/HLA database, more than 1500 alleles of HLA-B have been reported, and HLA-B*58:01 is just one of them [15]. Exon 2 of the HLA-B locus exhibits the highest variability and is prone to generate unknown polymorphisms, which may affect the combination of primers and probes, leading to detection failures. Due to the nature of complexity and variability of HLA-B locus, testing for HLA-B*58: 01 becomes a challenge. Therefore, finding a surrogate biomarker that is less polymorphic and is in absolute linkage disequilibrium with HLA-B*58: 01 is necessary. The rs9263726 in the psoriasis susceptibility 1 candidate 1(PSORS1C1) gene was reported in absolute linkage disequilibrium (D0 ¼ 1, r2 ¼ 1) with HLA-B*58:01 in Japan [16,17]. However, another study, based on an Australian cohort, gave a contrast result that the rs9263726 allele was not linked to HLA-B*58:01 (D0 ¼ 0.059, r2 ¼ 0.001) [18]. In this study, we aim to demonstrate whether the rs9263726 allele is linked to HLA-B*58:01 in Han Chinese population.
https://doi.org/10.1016/j.dmpk.2018.08.001 1347-4367/© 2018 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article in press as: Dou Y, et al., HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population, Drug Metabolism and Pharmacokinetics (2018), https://doi.org/10.1016/j.dmpk.2018.08.001
2
Y. Dou et al. / Drug Metabolism and Pharmacokinetics xxx (2018) 1e4
2. Materials and Methods 2.1. Materials In this study, EDTA-anticoagulated whole-blood samples were collected randomly from the Peking Union Medical College Hospital and the Renmin Hospital of Wuhan University. Samples of non Han were excluded. A total of 353 samples were finally included in this project. Genomic DNA (gDNA) was extracted and purified using the QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany). The DNA concentration was 10 ng/mL and the OD260/280 was 1.60e2.00. All the DNA samples were only labeled with a consecutive number. And the test results only corresponded to their respective numbers. This study had passed ethical approval and ensured that the results do not infringe on the rights of the patient. 2.2. Methods 2.2.1. Genotyping of rs9263726 by Taqman assay Rs9263726 is just a G/A single nucleotide polymorphism, it was genotyped by using Taqman SNP Genotyping Assays. The PCR was performed in a total reaction volume of 25 mL, including 23 mL reaction buffer (YZYMED, Wuhan, China) and 2 mL gDNA (10 ng/mL). The PCR primers were 50 - GGACCCCAGCTCCTTAACACA -30 (forward) and 50 -TGGCAAAGTCGGTCAGGATT-30 (reverse). The PCR probes were 50 -FAM- AAACTCGTCCCCCCCAC-MGB-30 (for G) and 50 eVICAAACTCATCCCCCCCACG-MGB-3’ (for A). The PCR conditions were 37 C for 10 min and 95 C for 5 min, followed by 40 cycles of 95 C for 15s and 60 C for 1 min (fluorescence was measured). Taqman real-time PCR was performed in a LightCycler 480 II real-time PCR system (Roche, Basel, Switzerland). 2.2.2. Genotyping of HLA-B*58:01 by sequencing HLA-B types were determined by the sequencing-based method and were completed by Beijing Genomics Institute (BGI, Wuhan, China). PCR primers (forward: 50 -GAGCGAGGGGACCGCA -30 and reverse: 50 eCCGGGGTCACTCACCGG-30 ) were designed to amplify a HLA-B genomic fragment in the region of exon 2 which shows the highest variability. The PCR conditions were 95 C for 5 min, followed by 35 cycles of 95 C for 30s and 62 C for 30s and 72 C for 1 min.The final extension was done at 72 C for 5 min.This PCR step was performed in a ABI 9700 system (Applied Biosystems, California, USA). The PCR products were then sequenced by sequencing primers (50 -GGTATTTCTACACCGCCA -30 ) in a ABI 3730 system (Applied Biosystems, California, USA). 2.3. Statistical analysis HardyeWeinberg equilibrium was tested with c2 test. The statistical analysis between North and South was performed by c2 test. The above Data analysis was performed with SPSS statistical software. P < 0.05 indicated statistical significance. The analysis of linkage disequilibrium was performed with SHEsis (http://analysis.bio-x.cn) software platform. 3. Results All samples were divided into North and South populations based on the native place, including 153 cases in the northern group and 200 cases in the southern group. According to the relevant literature, the population frequency of HLA-B*58:01 in Han Chinese population was 2.9% in the north and 8.9% in the south [13]. The sample size of the North and South populations can ensure that the number of positive samples collected is greater than or equal to 5, which meets the statistical requirements.
Table 1 Rs9263726 allele test results. Rs9263726
G/G
G/A
A/A
Total
North South Total
140 182 322
13 17 30
0 1 1
153 200 353
First, we analyzed the genotyping results of rs9263726 alleles. The results were shown in Table 1. As shown in Table 1, we observed 1 cases of A/A genotype and 30 cases of G/A genotype, so we used allele frequency analysis instead of genotype frequency analysis. The frequencies of A and G alleles were 0.043 and 0.957 in the north, and 0.0475 and 0.9525 in the south. All the distribution of alleles frequencies were in Hardy-Weinberg equilibrium (north: p ¼ 0.583, south: p ¼ 0.391). At the same time, we analyzed the difference of the allele frequency in the north and South groups. The results showed that there was no significant difference in the frequency of rs9263726 allele between the two groups (p ¼ 0.751). Then, we analyzed the genotyping results of HLA-B*58:01 alleles and results were shown in Table 2. As shown in Table 2, similarly, because there were only 1 cases of HLA-B *58:01 homozygote, we use allele frequency analysis. The frequency of HLA-B*58:01 allele was 0.0229 in the north and 0.055 in the south, which distribution followed Hardy-Weinberg equilibrium (north: p ¼ 0.772, south: p ¼ 0.591). These data showed that HLA-B*58:01 allele frequency was different between north and south groups (p ¼ 0.033). At last, we analyzed the linkage disequilibrium between rs9263726 allele and HLA-B*58:01 allele. Results were shown in Table 3 for north group and Table 4 for south group. As shown in Table 3, in north group, only the partial absence of HLA-B*58: 01 allele in the rs9263726 G/A genotype was observed. The results of north group showed that HLA-B *58: 01 is linked to rs9263726, but not in absolute linkage disequilibrium (D0 ¼ 1, r2 ¼ 0.528). As shown in Table 4, in south group, the partial absence of HLA-B*58: 01 allele in the rs9263726 G/A genotype was observed. At the same time, HLA-B*58:01 was also observed in the presence of G/G genotype of rs9263726. The results of south group showed that HLA-B*58:01 is linked to rs9263726, but not in absolute linkage disequilibrium (D0 ¼ 0.887, r2 ¼ 0.675). The comparison of Tables 3 and 4 showed that HLA-B*58:01 was not observed in the presence of G/G genotype of rs9263726 in north group, which was different from the south. 4. Discussion In our study, we found that HLA-B*58:01 was linked to rs9263726 in the Han Chinese population from either north or south part of China, but this relationship was not in absolute linkage disequilibrium. Our results were different from the results of the studies from Japan [16,17]or Australia [18], which again confirmed that the linkage disequilibrium is varied between different ethnic groups [18,19]. Linkage disequilibrium presented the nonrandom association of alleles at different loci, so the genealogies of the two physically close sites were identical and tended to be co-inherited [20,21]. Historical events, such as genetic drift, multiple mutations Table 2 HLA-B*58:01 allele test results. HLA-B*58:01
*X/*X
HLA-B*58:01/*X
HLA-B*58:01/HLA-B*58:01
Total
North South Total
146 179 325
7 20 27
0 1 1
153 200 353
HLA- B genotype other than HLA- B*58:01 is indicated by *X.
Please cite this article in press as: Dou Y, et al., HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population, Drug Metabolism and Pharmacokinetics (2018), https://doi.org/10.1016/j.dmpk.2018.08.001
Y. Dou et al. / Drug Metabolism and Pharmacokinetics xxx (2018) 1e4
3
Table 3 Northern linkage disequilibrium analysis results. Northern
rs9263726
HLA-B*58:01
G/G G/A A/A
Total
Total
*X/*X
HLA- B*58:01 /*X
HLA-B*58:01 /HLA-B*58:01
140 6 0 146
0 7 0 7
0 0 0 0
*X/*X
HLA- B*58:01 /*X
HLA-B*58:01 /HLA-B*58:01
177 2 0 179
5 15 0 20
0 0 1 1
140 13 0 153
Table 4 Southern linkage disequilibrium analysis results. Southern
rs9263726
Total
HLA-B*58:01
G/G G/A A/A
and mixed of populations might disturb the relationship between linkage disequilibrium and inter-locus physical distance [22], which might explain the different linkage disequilibrium between HLA-B*58:01 and rs9263726 allele in different ethnic groups. In our study, we also found that HLA-B*58:01 allele showed differences between northern and southern Han Chinese population, which was consistent with previous studies [12,13]. However, the rs9263726 allele did not show any difference between the two Han Chinese ethic groups. Since the samples were randomly selected and both of the genotype distribution frequencies were followed the Hardy-Weinberg equilibrium, the difference in the north-south distribution of the two alleles indicated that HLAB*58:01 was not in absolute linkage disequilibrium with rs9263726. Another finding in our study was that although rs9263726 was not absolute linkage disequilibrium with HLA-B*58:01 in both Northern and Southern Han Chinese, all samples who have G allele of the rs9263726 still showed the different HLA-B type from the 58:01 in Northern Han Chinese. If only consider reducing the risk of allopurinol-induced SCARs, this finding indicated that the G allele of rs9263726 was the valid biomarker for the negative of HLAB*58:01 in Northern Han Chinese. However, detecting the G allele of rs9263726 also resulted in false positive results of HLA-B*58:01, which may benefit from allopurinol treatment. On the other hand, the G allele of rs9263726 was not a valid biomarker of HLA-B*58:01 negative in Southern Han population, and was not useful for the prediction of the low risk of the allopurinol-induced SCARs. Taken together, rs9263726 was not suitable as a biomarker for HLA-B*58:01 in Han Chinese population. In conclusion, we found that the HLA-B *58:01 allele was linked to rs9263726, but not in absolute linkage disequilibrium in Han Chinese population, which was different from the studies from Japan or Australia. Our study was the first study that tested the linkage disequilibrium between the two alleles in Han Chinese population and also offered a new discovery of the relationship between the two alleles. At the same time, our samples involved both the northern and southern Han Chinese population, which can better represent the Han population in China. Of course, we only analyzed the relationship between the two alleles, and did not further consider other possible factor, which may be the reason why our results were different from those in Japan. Since rs9263726 was not in absolute linkage disequilibrium with HLA-B*58: 01 in our study, we did not recommend rs9263726 as a surrogate biomarker. More research is needed to find a better surrogate biomarker for HLA-B*58: 01 in Han Chinese population.
Total
182 17 1 200
Conflicts of interest Authors declare that there are no conflicts of interest. Appendix A. Supplementary data Supplementary data related to this article can be found at https://doi.org/10.1016/j.dmpk.2018.08.001. References [1] Messerli FH, Makani H, Halpern D. Gout. N Engl J Med 2011;19:1876e7. author reply 77. [2] Khanna D, Fitzgerald JD, Khanna PP, Bae Sangmee, Singh MK, Neogi Tuhina, et al. 2012 American College of Rheumatology guidelines for management of gout. Part 1: systematic nonpharmacologic and pharmacologic therapeutic approaches to hyperuricemia. Arthritis Care Res (Hoboken) 2012;10:1431e46. [3] Khanna D, Khanna PP, Fitzgerald JD, Singh MK, Bae Sangmee, Neogi Tuhina, et al. 2012 American College of Rheumatology guidelines for management of gout. Part 2: therapy and anti-inflammatory prophylaxis of acute gouty arthritis. Arthritis Care Res (Hoboken) 2012;10:1447e61. [4] Ramasamy SN, Korb-Wells CS, Kannangara DR, Smithet MW, Wang N, Roberts DM, et al. Allopurinol hypersensitivity: a systematic review of all published cases, 1950e2012. Drug Saf 2013;10:953e80. [5] Hung SI, Chung WH, Liou LB, Chu CC, Lin Marie, Huang HP, et al. HLA-B*5801 allele as a genetic marker for severe cutaneous adverse reactions caused by allopurinol. Proc Natl Acad Sci U S A 2005;11:4134e9. [6] Cao ZH, Wei ZY, Zhu QY, Zhang JY, Yang Lun, Qin SY, et al. HLA-B*58:01 allele is associated with augmented risk for both mild and severe cutaneous adverse reactions induced by allopurinol in Han Chinese. Pharmacogenomics 2012;10: 1193e201. [7] Kaniwa N, Saito Y, Aihara M, Matsunaga K, Tohkinet M, Kurose K, et al. HLA-B locus in Japanese patients with anti-epileptics and allopurinol-related Stevens-Johnson syndrome and toxic epidermal necrolysis. Pharmacogenomics 2008;11:1617e22. [8] Kang HR, Jee YK, Kim YS, Lee CH, Jung JW, Kim SH, et al. Positive and negative associations of HLA class I alleles with allopurinol-induced SCARs in Koreans. Pharmacogenetics Genom 2011;5:303e7. [9] Tassaneeyakul W, Jantararoungtong T, Chen P, Lin PY, Tiamkao S, Khunarkornsiri U, et al. Strong association between HLA-B*5801 and allopurinol-induced Stevens-Johnson syndrome and toxic epidermal necrolysis in a Thai population. Pharmacogenetics Genom 2009;9:704e9. [10] Lonjou C, Borot N, Sekula P, Thomas L, Halevy S, Naldi L, et al. A European study of HLA-B in Stevens-Johnson syndrome and toxic epidermal necrolysis related to five high-risk drugs. Pharmacogenetics Genom 2008;2:99e107. [11] Yu KH, Yu CY, Fang YF. Diagnostic utility of HLA-B*5801 screening in severe allopurinol hypersensitivity syndrome: an updated systematic review and meta-analysis. Int J Rheum Dis 2017;9:1057e71. [12] Hershfield MS, Callaghan JT, Tassaneeyakul W, Mushiroda T, Thorn CF, Klein TE, et al. Clinical Pharmacogenetics Implementation Consortium guidelines for human leukocyte antigen-B genotype and allopurinol dosing. Clin Pharmacol Ther 2013;2:153e8. [13] Saito Y, Stamp LK, Caudle KE, Hershfield MS, McDonagh EM, Callaghan JT, et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines
Please cite this article in press as: Dou Y, et al., HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population, Drug Metabolism and Pharmacokinetics (2018), https://doi.org/10.1016/j.dmpk.2018.08.001
4
Y. Dou et al. / Drug Metabolism and Pharmacokinetics xxx (2018) 1e4
[14]
[15]
[16]
[17]
for human leukocyte antigen B (HLA-B) genotype and allopurinol dosing: 2015 update. Clin Pharmacol Ther 2016;1:36e7. Ko TM, Tsai CY, Chen SY, Chen KS, Yu KH, Chu CS, et al. Use of HLA-B*58:01 genotyping to prevent allopurinol induced severe cutaneous adverse reactions in Taiwan: national prospective cohort study. BMJ 2015:h4848. Robinson J, Soormally AR, Hayhurst JD, Marsh SG. The IPD-IMGT/HLA Database - new developments in reporting HLA variation. Hum Immunol 2016;3: 233e7. Tohkin M, Kaniwa N, Saito Y, Sugiyama E, Kurose K, Nishikawa J, et al. A wholegenome association study of major determinants for allopurinol-related Stevens-Johnson syndrome and toxic epidermal necrolysis in Japanese patients. Pharmacogenomics J 2013;1:60e9. Maekawa K, Nishikawa J, Kaniwa N, Sugiyama E, Koizumi T, Kurose K, et al. Development of a rapid and inexpensive assay for detecting a surrogate genetic polymorphism of HLA-B*58:01: a partially predictive but useful
[18]
[19]
[20]
[21] [22]
biomarker for allopurinol-related Stevens-Johnson syndrome/toxic epidermal necrolysis in Japanese. Drug Metabol Pharmacokinet 2012;4:447e50. Vidal C, Li J, Fulton R, Fernando SL. A polymorphism within the psoriasis susceptibility 1 candidate 1 (PSORS1C1) gene is not linked to HLA-B*58:01 in an Australian cohort. Drug Metabol Pharmacokinet 2016;3:252e5. de Bakker PI, McVean G, Sabeti PC, Miretti MM, Green T, Marchini J, et al. A high-resolution HLA and SNP haplotype map for disease association studies in the extended human MHC. Nat Genet 2006;10:1166e72. Maruki T, Lynch M. Genome-wide estimation of linkage disequilibrium from population-level high-throughput sequencing data. Genetics 2014;4: 1303e13. Ardlie KG, Kruglyak L, Seielstad M. Patterns of linkage disequilibrium in the human genome. Nat Rev Genet 2002;4:299e309. Jorde LB. Linkage disequilibrium and the search for complex disease genes. Genome Res 2000;10:1435e44.
Please cite this article in press as: Dou Y, et al., HLA-B*58:01 and rs9263726 have a linkage, but not absolute linkage disequilibrium in Han Chinese population, Drug Metabolism and Pharmacokinetics (2018), https://doi.org/10.1016/j.dmpk.2018.08.001