HMGA2 expression in a canine model of prostate cancer

Cancer Genetics and Cytogenetics 177 (2007) 98e102

HMGA2 expression in a canine model of prostate cancer Susanne Winklera,b, Hugo Murua Escobarb, Britta Meyera, Daniela Simonb, Nina Eberleb, Wolfgang Baumgartnerc, Siegfried Loeschkea, Ingo Nolteb, Jo¨rn Bullerdieka,* b

a Centre for Human Genetics, University of Bremen, Leobener Strasse ZHG, 28359 Bremen, Germany Small Animal Clinic, University of Veterinary Medicine, Bischofsholer Damm 15, 30173 Hannover, Germany c Department of Pathology, University of Veterinary Medicine, Bu¨nteweg 17, 30559 Hannover, Germany

Received 29 March 2007; received in revised form 14 June 2007; accepted 15 June 2007

Abstract

Prostate cancer is the most prevalent cancer in western countries, being the third leading cause of male cancer death. To check its possible significance as a prognostic marker, allowing a better prognosis of the tumor, we analyzed the high-mobility group protein-A2 gene (HMGA2) expression level because HMGA2 overexpression has been shown to correlate with the malignant potential of various neoplasias. Aside from man, the dog is the only mammalian species that shows spontaneously occurring prostate carcinoma with striking similarities to prostate cancer growth and progression in man, making it an adequate animal model for this neoplasia. We used real-time quantitative reverse-transcription polymerase chain reaction for HMGA2 expression analyses in a subset of canine prostate tissue samples. Our investigations reveal that HMGA2 expression levels in all carcinomas were higher than those of any of the nonmalignant tissues. Thus, canine prostate cancer represents a spontaneously occurring model to test therapeutic effects resulting from reduced expression of HMGA2. Ó 2007 Elsevier Inc. All rights reserved.

1. Introduction According to a recent study of the World Health Organization (WHO), prostate cancer is the most prevalent cancer in western countries and is the third leading cause of male cancer death [1]. Prostate cancer most commonly affects men over the age of 50 years. Thus, considering the worldwide trend towards an aging population, the number of prostate cancer deaths can be expected to increase. There have been 220,900 new prostate cancer cases in the United States in 2003, increasing to 234,460 new prostate cancer cases in the United States in 2006. By the year 2020, 393,000 prostate cancer-related deaths are expected worldwide [1e3]. Therefore, research into that tumor is a major challenge for future management of the disease. Of particular relevance are parameters allowing a better prediction of the course of the disease, because based on the histology of the lesions alone, it is often not possible to sufficiently recognize the malignant potential of the tumor in terms of local invasiveness and metastatic spread. Nevertheless, the latter is a prerequisite for appropriate therapy * Corresponding author. Tel.: þ49-(0)421-218-4239; fax: þ49-(0)421218-4239. E-mail address: [email protected] (J. Bullerdiek). 0165-4608/07/$ e see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2007.06.008

management. Even more challenging is the field of ‘‘theragnostics.’’ To address these questions, animal models are of valuable help. Of these, the dog will be increasingly important in the future. Besides humans, the dog is the only mammalian species that spontaneously develops prostate cancer with a considerably high frequency [4]. In addition, both species show striking similarities in the development and clinical course of the disease. The average age in which prostate carcinomas appear in dogs is 10 years, closely resembling the situation in men, where prostate carcinoma most commonly appears in older patients [1,2,5]. In both species, adenocarcinomas of the prostate represent a locally invasive disease. The tumors also tend to metastasize to the same distant regions in both species [6], and akin to their human counterparts, canine prostatic cancers vary over a broad range with respect to their clinical behavior. There currently is no widely accepted grading system for canine prostate cancer. In human prostate carcinomas, overexpression of HMGA1 has been described to correlate with more aggressive disease [7]. The similar protein HMGA2 is encoded by a separate gene mapping to 12q14~q15 [8]. All HMGA proteins show a high amino acid sequence homology, particularly among their three highly conserved AT hooks, representing the DNA-binding domains [9]. HMGA proteins

S. Winkler et al. / Cancer Genetics and Cytogenetics 177 (2007) 98e102

are abundantly expressed during embryogenesis and expressed at very low levels in most normal adult tissues [10,11]. HMGA2, however, is frequently involved in chromosomal translocations occurring in benign human tumors, such as lipomas, uterine leiomyomas, lung hamartomas, and fibroadenomas and adenolipomas of the breast [12e18]. It has been demonstrated that truncated transcripts are able to induce cell transformation [19]. The present study addresses the potential role of HMGA2 expression in canine prostate tumors and non-malignant tissues because the dog is the only animal model with spontaneously occurring prostate cancers. If overexpression of HMGA2 plays a role in these tumors, canines would constitute a suitable model to study the therapeutic effects aimed at a reduced expression of HMGA2.

99

adenocarcinomas (Table 1). Examples of two adenocarcinomas are given in Fig. 2. 2.2. RNA isolation Total RNA extraction of all tumor specimens was performed according to the RNeasy midi protocol for isolation of total RNA from animal tissues (Qiagen, Hilden, Germany), following the manufacturer’s instructions. 2.3. cDNA-synthesis

2. Materials and methods

We reverse-transcribed 250 ng of total RNA from each sample using M-MLV-Reverse Transcriptase and RNase Out (Invitrogen, Karlsruhe, Germany) with HMGA2dog reverse primer (50 GCCATTTCCTAGGTCTGCCTC30 ) and 10 mmol/L dNTP. Each sample was prepared in triplicate for real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR). Negative controls were prepared by adding distilled water instead of RNA.

2.1. Canine tissue samples

2.4. Standard curves

All canine tissues samples used in this study were taken from dogs of different breeds admitted to the Small Animal Clinic, University of Veterinary Medicine (Hannover, Germany) due to different medical conditions. All samples were taken during surgery or autopsy, immediately frozen in liquid nitrogen, and stored at 80 C for RNA isolation. In addition, pathohistologic examination was carried out by hematoxylin and eosin staining of paraffin-embedded specimens, which revelaed four non-neoplastic tissues, three hyperplasias, three cysts, one anaplastic carcinoma, and five

mRNA levels were measured using an ‘‘absolute’’ quantification method, which is relative to amplicon-specific standard curves. The standard curve resulted from seven dilution steps, from 102 to 108 copies, and each dilution step was measured in triplicate. The sequence for this standard was (50 e30 ): AGAGTCCCTCCAAAGCAGCTCAAAAGA AAGC AGAAGCCAATGGAGAAAAACGGCCAAGAGG CAGACCTAGGAAATGGCCA. Copy numbers were normalized relative to total RNA concentration and expressed as copy numbers per 250 ng RNA.

Table 1 Pathohistologic findings of the canine tissue samples examined Age (years)

Sample no.

Breed

1 2

Golden retriever English setter

3

Mixed breed

11

4 5 6

Mixed breed Golden retriever Hovavart

14 11 10

7 8 9 10 11 12 13 14

Munsterlander Briard Rottweiler Mixed breed Mixed breed Mixed breed Pinscher Mixed breed

10 10 8 10 11 13 7 9

15 16

Mixed breed Mixed breed

16 10

4 9

Microscopic findings Non-neoplastic Adenocarcinoma, anisokaryosis of cells, cytoplasm poorly definable Adenocarcinoma, anisokaryosis of cells, invasive growth Cystic hyperplasia Multifocal, low-grade hyperplasia Anapl. carcinoma, anisokaryosis of cells, large nuclei with multiple nucleoli Non-neoplastic Highly malignant adenocarcinoma Moderate hyperplasia Non-neoplastic Cyst Cyst Cyst Adenocarcinoma pleomorphic cells, several anaplastic cells Non-neoplastic Adenocarcinoma, large areas of connective tissue, invasive growth

Metastatic behavior Bone metastases

Mean quantity (copy number/ 250 ng/RNA) 127 85,587

Infiltration of blood vessels

1,233,000

Lymph node metastases

963 20,755 1,116,000

Mesentery metastases Not tested

213 4,239,000 7,603 1,433 4,188 10,923 9,710 56,984

Not tested

466 27,215

100

S. Winkler et al. / Cancer Genetics and Cytogenetics 177 (2007) 98e102

Fig. 1. HMGA2 expression in canine prostatic tissues. White bars, non-neoplastic tissues; spotted bars, hyperplasias; gray bars, cysts; black bars, carcinomas.

2.5. Real-time quantitative RT-PCR

2.6. Statistical analysis

For quantitative analysis of canine HMGA2 expression levels 2 mL of each of the cDNA triplicates were subjected to real-time RT-PCR, using the ABI Prism 7000 Sequence Detection System (Applied Bioystems, Warrington, UK). To minimize the risk of false positives, the dilutions for the standard curve were dispensed after the samples of interest had been dispensed and sealed. An additional negative control was prepared using water with the PCR reaction mix. Nucleotide sequences for the canine primers and probe were designed according to Gross et al. [20], with slight modifications of the lower primer: HMGA2dog up (50 e30 ): AGTCCCTCCAAAGCAGCTCAAAAG, HM GA2dog lo (50 to 30 ): GCCATTTCCTAGGTCTGCCTC, HMGA2 probe (50 to 30 ): 6FAM-GAAGCCACTGG AGAA AAACGGCCA-TAMRA. PCR conditions were as follows: 50 C for 2 minutes, initial denaturation at 95 C for 10 minutes, followed by 45 cycles at 95 C for 15 seconds, and 60 C for 1 minute.

An exact chi-squared test was used to assess diagnostic efficiency.

3. Results 3.1. Real-time quantitative RT-PCR The mean quantities of all samples investigated are listed in Table 1. The expression levels of all carcinomas were significantly higher than those of any of the nonmalignant tissues. All 10 nonmalignant prostatic tissues showed quantities lower than 50,000 transcripts per 250 ng total RNA. One prostatic tissue (sample no. 16), which was designated as a carcinoma, also showed a mean quantity below this amount, but pathohistologic examination of this tissue shows that the tumor consisted of large areas of nontumorigenic connective tissue. Thus, it seems possible that the sample used for preparation of total RNA consisted mostly

Fig. 2. (A) Sample no. 8 is a poorly differentiated adenocarcinoma of the canine prostate with mucus-filled atypical glands on the left and several mitoses. (B) Sample no. 14 is a moderately to poorly differentiated adenocarcinoma of the canine prostate.

S. Winkler et al. / Cancer Genetics and Cytogenetics 177 (2007) 98e102

of this nonmalignant tissue, explaining the low expression of HMGA2. In addition, the integrity of the cDNA was tested by PCR for the housekeeping gene FUT6 (data not shown). Different from all other tissue samples investigated in this study, there was no visible band for the gene product in tissue sample 16. Thus, the actual HMGA2 transcript level of this tumor may be higher than what was revealed by our investigations. The mean quantities among the investigated tissue samples, as indicated in Fig. 1, showed a broad range from 127 transcripts per 250 ng RNA for the lowest level in non-neoplastic tissues and 4,239,000 transcripts per 250 ng RNA as the highest level observed in an adenocarcinoma. There was also some variation observed between tissues with the same pathohistologic findings: non-neoplastic tissues showed transcript levels from 127 per 250 ng RNA to 1,433 per 250 ng RNA, whereas benign lesions presented transcript levels from 963 per 250 ng RNA to 20,755 per 250 ng RNA. Adenocarcinomas exhibited a much broader span than the non-neoplastic tissues and benign lesions from 27,215 transcripts per 250 ng RNA to 4,239,000 transcripts per 250 ng RNA. Nevertheless, even when comparing the highest transcript level of non-neoplastic tissues to the lowest transcript level of adenocarcinomas, there is a nearly 19-fold increase of expression of HMGA2. 3.2. Statistical analysis The HMGA2 level may be used to separate malignant from benign cases. Assuming a logarithmic normal distribution of the HMGA2 values, the optimal limit to separate these categories is 23,086 transcripts per 250 ng RNA (smaller values indicate a benign situation). Using this limit, all cases can be classified as malign or benign, respectively, without error (i.e., with sensitivity 5 specificity 5 diagnostic efficiency 5 100%). An exact chi-squared test shows that this is not a random result (P ! 0.001).

4. Discussion Compared to the situation in humans, overexpression of genes in canine cancer compared to nonmalignant tissues has been studied rarely. Regarding the comparison between humans and dogs, Walker-Daniels et al. have described a specific tyrosine kinase, EphA2, showing overexpression in human and canine prostate cancer [21]. Herein we report that another gene, namely HMGA2, is overexpressed in canine prostatic cancer compared to nonneoplastic tissues. It has been demonstrated previously that overexpression of proteins of the HMGA family is associated with tumor progression in a variety of human tumors (e.g., colon cancer, squamous cell carcinoma of the oral cavity, breast, and lung cancer [22e26]. The expression of an embryonic protein in tumors of adults, as demonstrated in this study, suggests that HMGA2 is associated

101

with the malignant potential in the oncogenic process [27]. It is presumed that the neoplastic transformation of cells expressing high levels of HMGA proteins takes part in a multistep process that results in the aberrant expression of factors that are able to induce the continuous expression of HMGA proteins. These elevated levels of HMGA proteins then contribute to neoplastic transformation of the cells [28]. Because of the correlation between elevated levels of HMGA and the malignant and metastatic potential of tumors, the overexpression of HMGA proteins can be used as a diagnostic and prognostic marker [23,29]. Thus, some efforts have been made to establish HMGA2 expression as a tool to classify subsets of malignant tumors with poor prognosis [30]. Herein we report on HMGA2 expression in canine prostate cancer, a disease in a companion animal that closely resembles the situation in humans. Our data clearly show that expression of HMGA2 is low in non-neoplastic tissues, rises in benign lesions, with intermediate values for cysts and hyperplasia, and increases at least 19-fold in carcinomas (Fig. 1). In our study, all malignant neoplasias showed expression levels beyond a quantity of 23,086 transcripts per 250 ng total RNA, whereas none of the nonmalignant tissues showed expression levels exceeding that value. Most likely, the broad intertumoral range of transcript levels reflects the differences of the aggressive behavior of the tumors. In summary, our investigations show that HMGA2 expression seems to play an important role in canine prostate cancer. Therefore, canine prostate cancer not only represents a valuable animal model for that frequent type of human cancer, but is also an interesting model with respect to therapeutic intervention aimed at reducing HMGA2 expression.

References [1] Brundtland GH, World Health Organization, Geneva, 2001. [2] Mettlin CJ, Murphy GP, Rosenthal DS, Menck HR. The National Cancer Data Base report on prostate carcinoma after the peak in incidence rates in the U.S. The American College of Surgeons Commission on Cancer and the American Cancer Society. Cancer 1998;83:1679e84. [3] Online publication, American Cancer Society. Statistics. Available at http://www.cancer.org/docroot/stt/stt_0.asp. Accessed 2007. [4] Boutemmine D, Bouchard N, Boerboom D, Jones HE, Goff AK, Dore M, Sirois J. Molecular characterization of canine prostaglandin G/H synthase-2 and regulation in prostatic adenocarcinoma cells in vitro. Endocrinology 2002;143:1134e43. [5] Nolte I, Nolte M. Praxis der Onkologie bei Hund und Katze. Stuttgart: Enke, 2000. [6] MacEwen EG. Spontaneous tumors in dogs and cats: models for the study of cancer biology and treatment. Cancer Metastasis Rev 1990;9:125e36. [7] Tamimi Y, van der Poel HG, Denyn MM, Umbas R, Karthaus HF, Debruyne FM, Schalken JA. Increased expression of high mobility group protein I(Y) in high grade prostatic cancer determined by in situ hybridization. Cancer Res 1993;53:5512e6. [8] Wanschura S, Kazmierczak B, Schoenmakers E, Meyen E, Bartnitzke S, Van de Ven W, Bullerdiek J, Schloot W. Regional fine mapping of the multiple-aberration region involved in uterine

102

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

S. Winkler et al. / Cancer Genetics and Cytogenetics 177 (2007) 98e102 leiomyoma, lipoma, and pleomorphic adenoma of the salivary gland to 12q15. Genes Chromosomes Cancer 1995;14:68e70. Wisniewski JR, Schwanbeck R. High mobility group I/Y: multifunctional chromosomal proteins causally involved in tumor progression and malignant transformation (review). Int J Mol Med 2000;6:409e19. Pentimalli F, Dentice M, Fedele M, Pierantoni GM, Cito L, Pallante P, Santoro M, Viglietto G, Dal Cin P, Fusco A. Suppression of HMGA2 protein synthesis could be a tool for the therapy of well differentiated liposarcomas overexpressing HMGA2. Cancer Res 2003;63:7423e7. Rogalla P, Drechsler K, Frey G, Hennig Y, Helmke B, Bonk U, Bullerdiek J. HMGI-C expression patterns in human tissues Implications for the genesis of frequent mesenchymal tumors. Am J Pathol 1996;149:775e9. Ashar HR, Fejzo MS, Tkachenko A, Zhou X, Fletcher JA, Weremowicz S, Morton CC, Chada K. Disruption of the architectural factor HMGI-C: DNA-binding AT hook motifs fused in lipomas to distinct transcriptional regulatory domains. Cell 1995;82:57e65. Bullerdiek J, Wobst G, Meyer-Bolte K, Chilla R, Haubrich J, Thode B, Bartnitzke S. Cytogenetic subtyping of 220 salivary gland pleomorphic adenomas: correlation to occurrence, histological subtype, and in vitro cellular behavior. Cancer Genet Cytogenet 1993;65:27e31. Hennig Y, Deichert U, Bonk U, Thode B, Bartnitzke S, Bullerdiek J. Chromosomal translocations affecting 12q14-15 but not deletions of the long arm of chromosome 7 associated with a growth advantage of uterine smooth muscle cells. Mol Hum Reprod 1999;5:1150e4. Hennig Y, Wanschura S, Deichert U, Bartnitzke S, Bullerdiek J. Rearrangements of the high mobility group protein family genes and the molecular genetic origin of uterine leiomyomas and endometrial polyps. Mol Hum Reprod 1996;2:277e83. Kazmierczak B, Hennig Y, Wanschura S, Rogalla P, Bartnitzke S, Van de Ven W, Bullerdiek J. Description of a novel fusion transcript between HMGI-C, a gene encoding for a member of the high mobility group proteins, and the mitochondrial aldehyde dehydrogenase gene. Cancer Res 1995;55:6038e9. Kazmierczak B, Wanschura S, Rosigkeit J, Meyer-Bolte K, Uschinsky K, Haupt R, Schoenmakers EF, Bartnitzke S, Van de Ven WJ, Bullerdiek J. Molecular characterization of 12q14~q15 rearrangements in three pulmonary chondroid hamartomas. Cancer Res 1995;55:2497e9. Schoenmakers EF, Wanschura S, Mols R, Bullerdiek J, Van den Berghe H, Van de Ven WJ. Recurrent rearrangements in the high

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27] [28] [29]

[30]

mobility group protein gene, HMGI-C, in benign mesenchymal tumours. Nat Genet 1995;10:436e44. Battista S, Fidanza V, Fedele M, Klein-Szanto AJ, Outwater E, Brunner H, Santoro M, Croce CM, Fusco A. The expression of a truncated HMGI-C gene induces gigantism associated with lipomatosis. Cancer Res 1999;59:4793e7. Gross KL, Neskey DM, Manchanda N, Weremowicz S, Kleinman MS, Nowak RA, Ligon AH, Rogalla P, Drechsler K, Bullerdiek J, Morton CC. HMGA2 expression in uterine leiomyomata and myometrium: quantitative analysis and tissue culture studies. Genes Chromosomes Cancer 2003;38:68e79. Walker-Daniels J, Coffman K, Azimi M, Rhim JS, Bostwick DG, Snyder P, Kerns BJ, Waters DJ, Kinch MS. Overexpression of the EphA2 tyrosine kinase in prostate cancer. Prostate 1999;41: 275e80. Miyazawa J, Mitoro A, Kawashiri S, Chada KK, Imai K. Expression of mesenchyme-specific gene HMGA2 in squamous cell carcinomas of the oral cavity. Cancer Res 2004;64:2024e9. Rogalla P, Drechsler K, Kazmierczak B, Rippe V, Bonk U, Bullerdiek J. Expression of HMGI-C, a member of the high mobility group protein family, in a subset of breast cancers: relationship to histologic grade. Mol Carcinogen 1997;19:153e6. Meyer B, Loeschke S, Schultze A, Weigel T, Sandkamp M, Goldmann T, Vollmer E, Bullerdiek J. HMGA2 Overexpression in non-small cell lung Cancer. Mol Carcinogen 2007;46:503e11. Abe N, Watanabe T, Sugiyama M, Uchimura H, Chiappetta G, Fusco A, Atomi Y. Determination of high mobility group I(Y) expression level in colorectal neoplasias: a potential diagnostic marker. Cancer Res 1999;59:1169e74. Sarhadi V, Wikman H, Salmenkivi K, Kuosma E, Sioris T, Salo J, Karjalainen A, Knuutila S, Anttila S. Increased expression of high mobility group A proteins in lung cancer. J Pathol 2006;209: 206e12. Goodwin G. The high mobility group protein, HMGI-C. Int J Biochem Cell Biol 1998;30:761e6. Reeves R. Molecular biology of HMGA proteins: hubs of nuclear function. Gene 2001;277:63e81. Reeves R. Structure and function of the HMGI(Y) family of architectural transcription factors. Environ Health Perspect 2000;108(Suppl. 5):803e9. Rogalla P, Drechsler K, Schroder-Babo W, Eberhardt K, Bullerdiek J. HMGIC expression patterns in non-small lung cancer and surrounding tissue. Anticancer Res 1998;18:3327e30.