Hormone receptors in gills of smolting Atlantic salmon, Salmo salar: Expression of growth hormone, prolactin, mineralocorticoid and glucocorticoid receptors and 11β-hydroxysteroid dehydrogenase type 2

General and Comparative Endocrinology 152 (2007) 295–303 www.elsevier.com/locate/ygcen

Hormone receptors in gills of smolting Atlantic salmon, Salmo salar: Expression of growth hormone, prolactin, mineralocorticoid and glucocorticoid receptors and 11b-hydroxysteroid dehydrogenase type 2 Pia Kiilerich a, Karsten Kristiansen b, Steffen S. Madsen b

a,*

a Institute of Biology, University of Southern Denmark, Campusvej 55, DK-5230 Odense M, Denmark Department of Biochemistry and Molecular Biology, University of Southern Denmark, Campusvej 55, DK-5230 Odense M, Denmark

Received 15 September 2006; revised 29 November 2006; accepted 26 December 2006 Available online 30 December 2006

Abstract This is the first study to report concurrent dynamics in mRNA expression of growth hormone receptor (GHR), prolactin receptor (PRLR), gluco- and mineralocorticoid receptor (GR and MR) and the 11b-hydroxysteroid dehydrogenase type-2 enzyme (11bHSD2) in Atlantic salmon (Salmo salar) gill during smoltification. Transcript levels were analysed by quantitative PCR in fresh water (FW) fish and after a 24-h salt water (SW) challenge. GHR transcript levels increased concurrent with gill Na+, K+-ATPase activity in FW fish consistent with the SW-adaptive role of GH. SW-transfer induced an increased GHR expression levels in the early stages of smoltification but a decrease in expression at the peak of smoltification. PRLR transcript levels decreased steadily during smoltification in agreement with the recognized hyper-osmoregulatory role of PRL. Surprisingly, PRLR levels increased after SW transfer during the course of smoltification. GR mRNA levels were low early on during smoltification but increased at the peak of smoltification and remained high during de-smoltification, indicative of increased cortisol signalling at this point. Coherently, SW transfer increased GR levels to smolt levels prior to the smoltification peak. 11b-HSD2 levels increased at the smoltification peak and MR levels increased during de-smoltification, suggesting a need for protection of MR from cortisol signalling during smoltification. This is supported by the fact that SW-transfer results in a profound up-regulation of 11b-HSD2, whereas SW transfer down-regulates MR levels. The study concludes that GR and MR may have distinctive roles in developing hypo- and hyper-osmoregulatory mechanisms during smoltification and desmoltification, respectively.  2007 Elsevier Inc. All rights reserved. Keywords: Glucocorticoid receptor; GR; Mineralocorticoid receptor; MR; 11b-Hydroxysteroid dehydrogenase type 2; 11b-HSD2; Growth hormone receptor; GHR; Prolactin receptor; PRLR; Atlantic salmon; Gill; Smoltification

1. Introduction Smoltification and the acquisition of sea water (SW) tolerance in salmonids is a process which is regulated by interplay of several hormones. Many morphological, metabolic, biochemical and physiological changes have been carefully characterised in different species and the literature on the endocrinology of these aspects is abundant (Hoar, 1988). Plasma levels of growth hormone (GH), insulin-like growth factor-I (IGF-I) and cortisol surge during smoltification *

Corresponding author. Fax: +45 6593 0457. E-mail address: steff[email protected] (S.S. Madsen).

0016-6480/$ - see front matter  2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2006.12.018

and these hormones interact in the stimulation of hypo-osmoregulatory mechanisms (see Hoar, 1988; Bjo¨rnsson, 1997 for review). Gill chloride cell development and Na+, K+-ATPase activity are two of the functions which are stimulated by these hormones. Prolactin (PRL) on the other hand is considered a hyper-osmoregulatory hormone in many teleosts (see Manzon, 2002 for review). PRL plasma levels decrease during smoltification (Young et al., 1989; Prunet et al., 1989) and after FW–SW transfer (Prunet et al., 1985; Young et al., 1989), and PRL antagonizes the SW-adaptive effect of GH and cortisol (Madsen and Bern, 1992; Seidelin and Madsen, 1999). The receptors for GH and PRL (GHR and PRLR, respectively) have

296

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

been detected in gills of teleosts (GHR: Sakamoto and Hirano, 1991; Yao et al., 1991; Very et al., 2005; PRLR: see Manzon, 2002 for review; Lee et al., 2006), supporting an osmoregulatory role of the hormones. The PRLR has been localized in chloride cells but the expression pattern of the two receptors in the gill during smoltification has not been investigated so far. Corticosteroid signalling in fish is emerging as a complex phenomenon. Cortisol is the major corticosteroid in teleost fish and plays a fundamental role in regulating mineral balance (see Wendelaar Bonga, 1997 for review). Cortisol facilitates FW- as well as SW acclimation in euryhaline fish (Laurent and Perry, 1990; Madsen, 1990; Redding et al., 1991; Mancera et al., 2002), and stimulates differentiation and proliferation of gill chloride cells (Perry et al., 1992; Uchida et al., 1998; Dang et al., 2000). It is, however, not understood how cortisol may have opposite actions depending on the direction of salinity change. Differential cortisol signalling may be defined by receptor type (glucocorticoid (GR) or mineralocorticoid (MR)), subtype (GR1 or GR2), tissue distribution and co-localization of receptors and composition of the receptor binding element in the target gene promoter. The recent identification of two GR subtypes with different cortisol binding affinity and trans-activation activity from rainbow trout, Oncorhynchus mykiss (Bury et al., 2003) and the unusual DNA-binding ability of teleost fish GR (Lethimonier et al., 2002) exemplify the complexity of glucocorticoid signalling mechanisms. Interaction with other hormones such as PRL, GH and IGF-I may also be crucial for corticosteroid signalling (see Sakamoto et al., 2001 for review). Cortisol binds with high affinity to both GR and MR. In mammals; however, significant cortisol signalling through the MR is limited by the co-localization of MR with the 11b-hydroxysteroid dehydrogenase type 2 enzyme (11bHSD2). This enzyme converts cortisol to receptor-inactive cortisone (Funder et al., 1988). The conventional MR ligand aldosterone is absent in teleosts due to the lack of synthesizing capability (see Prunet et al., 2006 for review). Nevertheless, there is experimental evidence that the MR is indeed functional and that alternative ligand(s) are involved in MR signalling in fish (Sloman et al., 2001; Scott et al., 2005). The MR has now been cloned and characterized in fish (Colombe et al., 2000) but its role and function is largely unknown. The MR antagonist, spironolactone, decreases chloride cell density in FW rainbow trout gill (Sloman et al., 2001) and impairs chloride cell proliferation in FWtransferred killifish, Fundulus heteroclitus (Scott et al., 2005) which suggests cortisol signalling through MR in FW acclimation. In addition to binding cortisol and aldosterone, the O. mykiss MR has the ability to bind the intermediate product in mammalian mineralocorticoid synthesis 11-deoxycorticosterone, DOC, (Sturm et al., 2005). Teleosts are able to synthesize DOC and levels of DOC needed to activate MR have been measured in O. mykiss plasma. DOC may thus be a functional ligand to the MR in fish (see Prunet et al., 2006 for review). Furthermore,

11b-HSD2 was recently identified and cloned in fish (Jiang et al., 2003; Kusakabe et al., 2003), which supports the possibility that MR indeed has a specific ligand in fish and a distinct signaling ability compared to GR. The absence of aldosterone, the presence of MR and DOC and the two different GR subtypes propose a sophisticated signaling interaction between these components in control of salt and water homeostasis in teleosts. Both receptor types are present in the gill, where GR is localized in chloride cells (Uchida et al., 1998; Greenwood et al., 2003). Investigations of the role and dynamics of MR and GR expression during smolting and FW–SW transitions are lacking and may contribute important information about the physiological function of these corticosteroid receptors. Cortisol has an essential role in the parr-smolt transformation, especially with regard to the development of gill chloride cells and Na+, K+-ATPase activity (McCormick, 1990; Uchida et al., 1998; Sakamoto et al., 2001). In the present study, mRNA expression of the GHR, PRLR, GR and MR and 11b-HSD2 was investigated in the gill of Atlantic salmon (Salmo salar) during smoltification and after acute challenge with SW. 2. Methods 2.1. Fish and sampling One-year old S. salar (Burishoole stock, average weight: 19.4 g) were obtained in early March from Danmarks Center for Vildlaks (Randers, Denmark), hand sorted in lower mode and upper mode populations judged by size and incipient silvering of the scales, and placed in outdoor 500 L fibreglass tanks supplied with flow through tap water on the Odense Campus (University of Southern Denmark). They were held at ambient photoperiod and temperature conditions. The fish were fed ad libitum once daily with pelleted trout feed. FW fish were sampled at 6 time points during and after smoltification from March to August. Upon each sampling, subgroups were transferred to 30 ppt artificial SW for 24 h (SW-test) at 10 C and then sampled. When sampled, fish were stunned with a blow to the head and blood collected with a heparinized syringe from the caudal vessels. Blood was held on ice until the plasma was separated by centrifugation at 8000g in 3 min, and frozen at 80 C. Hereafter the fish was killed by cutting the spinal cord and pithing of the brain. This is an approved method of euthanasia according to the Animal Health and Animal Welfare Panel of the European Food Safety Authority (European Commission). Length and weight were recorded for determination of condition factor (100 · weight · length3). For isolation of total RNA, one first gill arch was dissected, trimmed away from the cartilage and immediately frozen in liquid N2. For analysis of Na+, K+-ATPase enzymatic activity, one second gill arch was dissected and frozen in SEI-buffer (300 mM sucrose, 20 mM Na2-EDTA, 50 mM imidazole, pH 7.3) in liquid N2. All tissues were stored at 80 C until analysis. A piece of caudal musculature was carefully dissected from the skin and weighed immediately. This was used for determination of muscle water content.

2.2. Analyses Plasma osmolality was measured in a 10 ll sample in duplicates on a Wescor, 5500 vapor pressure osmometer. Muscle water content (MWC) was determined by drying for >24 h at 100 C. 2.2.1. Na+, K+-ATPase enzyme activity assay Approximately 5–7 gill filaments from each sample were homogenized and assayed for Na+, K+-ATPase activity according to McCormick (1993) at 25 C using a microplate reader (SPECTRAmax PLUS, Molecular

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303 Devices, Sunnyvale, CA, USA). Protein content in the gill homogenates was measured (Lowry et al., 1951) and enzymatic activity was normalized to protein content and expressed as lmol ADP/mg protein/h. 2.2.2. RNA purification, cDNA synthesis and real time PCR Total RNA was purified by the TRIzol procedure (Invitrogen, Carlsbad, CA, USA) using 1 ml TRIzol /100 mg gill tissue according to manufacturer’s recommendation. RNA concentration and purity was determined by measuring A260/A280. One microgram RNA was treated with 1 unit RQ1 DNase (Promega, Madison, WI, USA) for 30 min at 37 C in a total volume of 20 ll followed by 5 min at 75 C to inactivate RQ1 DNase. Reverse transcription was carried out on 1 lg DNase treated RNA with 2 lg random hexamers (GE Healthcare Bio-Sciences, Little Chalfont, UK) and 200 units MMLV reverse transcriptase (Invitrogen) for 1 h at 37 C in the presence of 40 units of RNAguard (GE Healthcare) in a total volume of 25 ll. At the end the cDNA was diluted with 50 ll milliQ H2O. Semi-quantitative real time PCR analysis using SYBR Green detection was carried out on a Mx3000p instrument (Stratagene, La Jolla, CA, USA) using standard software settings including adaptive baseline for background detection, moving average and amplification based threshold settings with the built-in FAM/ SYBR filter (excitation wavelength: 492 nm and emission wavelength: 516 nm). Reactions were carried out with 1 ll cDNA, 7.5 pmol (GR and MR) or 5 pmol (PRLR, GHR and 11b-HSD2) forward and reverse primer (DNA technology A/S, Denmark), 12.5 ll 2· Brilliant SYBR green master mix (Stratagene) in a total volume of 25 ll. Cycling conditions: 95 C for 30 s, 60 C for 60 s and 72 C for 5 s in 50 cycles (GR and MR) or 40 cycles (PRL, GHR and 11b-HSD2). Melting curve analysis was carried out routinely with 30 s for each 1 C interval from 55 C to 95 C. GR, MR and 11b-HSD2 were analyzed in duplicates, PRL and GHR in singles. 2.2.3. Amplification efficiency, normalization and calculations For each primer set, cDNA was diluted 2, 4, 8 and 16 times in duplicates and analyzed by real time PCR to determine amplification efficiency detected as the slope of the resultant linear graph of threshold cycle (Ct) versus log cDNA concentration. The amplification efficiency (Ea) for each primer set was used for calculation of relative copy numbers of the respective target gene. EF1a was used as normalization gene according to Olsvik et al. (2005). To validate the normalization, 18S rRNA was used as a second normalization gene. No appreciable differences were observed between the results obtained with the two normalization genes (not shown). Relative copy number of the target genes was calculated as 2ðCt=Ea Þ where Ct is the threshold cycle number and Ea is the amplification efficiency. Normalized units were obtained by dividing the relative copy number of the target gene with the relative copy number of the normalization gene. 2.2.4. Primers Primer sequences are listed in Table 1. All primers were designed using the NetPrimer software (Premier Biosoft International, CA, USA) with standard settings and double checked using the Primer3 software (Rozen

297

and Skaletsky, 2000) and BLASTed. All primers were tested for non-specific product amplification and primer-dimer formation using both melting curve analysis and agarose gel verification. In case of lack of S. salar mRNA sequence information, PCR primers based on conserved regions of O. mykiss mRNA sequences were used when necessary. As template for GHR primers the S. salar GHRI precursor (Accession Number AY462105) was used. PRLR primers were designed with O. mykiss PRLR as template (Accession Number AF229197). GR primers were designed from the O. mykiss GR1 mRNA sequence (Accession Number Z54210). The primers show 67% (forward) and 80% (reverse) identity with the O. mykiss GR2 sequence (Accession Number AY495372). However, no GR2 product was amplified as the annealing position for the forward and the reverse primer are at overlapping positions in the GR2 sequence. MR primers were designed from the O. mykiss MR mRNA sequence (Accession Number AF209873) and the amplicon covers both the MRa and MRb sequences resulting in the same product length regardless MR subtype. Primers for 11b-HSD2 were designed based on the SK1-0935 S. salar kidney cDNA clone similar to hydroxysteroid dehydrogenase sequence (Accession Number BG934620). Normalization primers EF1a and 18S rRNA were designed using S. salar sequences (Accession Numbers AF321836 and AJ427629, respectively). All primers were synthesized ˚ rhus, Denmark). by DNA Technology A/S (A

2.3. Statistics Since no samples for SW fish were obtained in late June and August, each dataset was evaluated by combining a two-way and a one-way ANOVA. Data from the sampling dates March, April, May and early June for both FW and SW fish were evaluated by a two-way ANOVA, while data from all sampling dates for FW fish were evaluated by a oneway ANOVA. The ANOVAs were followed by a Bonferroni adjusted Fisher’s Least Significant Difference (LSD) test where appropriate, taking into account the total number of pairwise comparisons. When necessary data were transformed to obtain normality and homogeneity of variances (Zar, 1999). In all cases a significance level of a = 0.05 was used. All tests were performed using SAS (Version 9.1 for Windows, by SAS Institute Inc., Cary, NC, USA).

3. Results Smoltification of the fish was established by Na+, K+ATPase activity (Fig. 1), SW tests, measurement of condition factor and determination of silvering of the scales (data not shown). Hypo-osmoregulatory performance was improved in May and early June and condition factor decreased steadily from March to early June. There was an

Table 1 Primers used for real time RT-PCR Primer name

Primer sequence (3 0 –5 0 )

Amplicon length

Template Accession Number

GHR-forward GHR-reverse PRLR-forward PRLR-reverse GR-forward GR-reverse MR-forward MR-reverse 11b-HSD2-forward 11b-HSD2-reverse EF1a-forward EF1a-reverse 18S rRNA-forward 18S rRNA-reverse

TGACTTTAAATGCCAGCACAAGGA TGGTCACCAAATACTTCCCTCTTGA CTCGAGTCCAAGAGCCAGTC CCACACTTCTCCATCAGCAA ACGACGATGGAGCCGAAC ATGGCTTTGAGCAGGGATAG AGACTCGACCCCCACCAAG AACACGCTGCAGATGGA GCTGCCTATACTCTGCCA GCCTGTGATGAAGACAGC GAGAACCATTGAGAAGTTCGAGAAG GCACCCAGGCATACTTGAAAG TATTGTGCCGCTAGAGGTGA CCTCCGACTTTCGTTCTTGA

146

AY462105

79

AF229197

106

AF209873

170

AF209873

74

BG934620

71

AF321836

101

AJ427629

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

25

FW

A 20 AB

AB

15 BC BC

10

C 5

March

April

May Early Late June June

August

Fig. 1. Changes in gill Na+, K+-ATPase activity during smoltification of FW acclimated Atlantic salmon. Values are means ± SEM (n = 6–8). Values with no letters in common are significantly different as determined by the Bonferroni adjusted Fisher’s LSD test. Overall effect of time was detected with a one-way ANOVA (P < 0.0001).

overall effect of time (P < 0.0001) on branchial Na+, K+ATPase activity during smoltification. Na+, K+-ATPase activity increased from March to a peak in early June after which the activity decreased to lower levels in late June and August (Fig. 1). GHR mRNA levels of FW fish increased from March to a peak in early June (P < 0.05; Fig. 2). Subsequently, GHR expression decreased to a level below the March level. SWchallenge increased GHR mRNA levels in April and decreased levels in early June compared to FW controls (P < 0.05). In March and May no significant effect of SW transfer was observed. Overall, an interaction between time and SW transfer on GHR mRNA levels was detected

GHR normalized to EF1α

30

FW

a

SW

25

b

20 15

bc

A AB

c

10 BC

5

BC BC C

0 March

April

May Early Late June June

August

Fig. 3. Changes in gill PRLR mRNA expression in Atlantic salmon during smoltification in FW and after 24-h SW challenge. Values are means ± SEM (n = 6–8) fish. Values with no letters in common are significantly different as determined by the Bonferroni adjusted Fisher’s LSD test (P < 0.05). Upper case letters (e.g. A) are used for FW fish and lower case letters (e.g. a) for SW fish. Stars (w) indicates a significant difference between the treatments for a specific date. FW and SW data from March to early June were analyzed by two-way ANOVA whereas FW data from March to August were analyzed with one-way ANOVA as described in Section 2.

70

80

a

FW

70

SW

B

60 AB

ab

AB

40 30

PRLR normalized to EF1α

35

0

50

(P < 0.0001). There was an overall effect of time on PRLR mRNA levels in FW fish (Fig. 3, P < 0.0001). PRLR mRNA levels decreased from March to May in FW fish (P < 0.05) and remained low until August. SW-challenge induced an overall increase in PRLR expression at all time-points (P < 0.0001). GR mRNA levels were stable in FW fish from March to May and then increased to higher levels in June and August (P < 0.05, Fig. 4). SW transfer

ab AB

AB

20

b

B

GR normalized to EF1α

Na+,K+-ATPase activity ( mol ADP/mg protein/hour)

298

FW 60

A

SW

50

AB

a

40

a B

30

b

20 C

b C

C

10

10 March

April

May Early Late June June

August

Fig. 2. Changes in gill GHR mRNA expression in Atlantic salmon during smoltification in FW and after 24-h SW challenge. Values are means ± SEM (n = 6–8). Values with no letters in common are significantly different as determined by the Bonferroni adjusted Fisher’s LSD test (P < 0.05). Upper case letters (e.g. A) are used for FW fish and lower case letters (e.g. a) for SW fish. Stars (w) indicates a significant difference between the treatments for a specific date. FW and SW data from March to early June were analyzed by two-way ANOVA whereas FW data from March to August were analyzed with one-way ANOVA as described in Section 2.

March

April

May Early Late June June

August

Fig. 4. Changes in gill GR mRNA expression in Atlantic salmon during smoltification in FW and after 24-h SW challenge. Values are means ± SEM (n = 6–8). Values with no letters in common are significantly different (P < 0.05) as determined by the Bonferroni adjusted Fisher’s LSD test. Upper case letters (e.g. A) are used for FW fish and lower case letters (e.g. a) for SW fish. Stars (w) indicates a significant difference between the treatments for a specific date. FW and SW data from March to early June were analyzed by two-way ANOVA whereas FW data from March to August were analyzed with one-way ANOVA as described in Section 2.

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

did not affect GR expression except for the transfer in May (P < 0.05), where a significant increase in mRNA levels was observed compared to FW-controls. There was interaction between time and SW transfer on GR mRNA levels during smoltification (P < 0.01). MR mRNA levels were stable in FW fish from March to early June after which there was a marked increase in late June and August (P < 0.05, Fig. 5). There was interaction between time and SW-transfer

MR normalized to EF1 α

80 A

FW 70

A

4. Discussion B

B

B

40 30

a B

ab b

b

March

April

20 May Early Late June June

August

11β -HSD2 normalized to EF1α

Fig. 5. Changes in gill MR mRNA expression in Atlantic salmon during smoltification in FW and after 24-h SW challenge. Values are means ± SEM (n = 6–8). Values with no letters in common are significantly different as determined by the Bonferroni adjusted Fisher’s LSD test (P < 0.05). Upper case letters (e.g. A) are used for FW fish and lower case letters (e.g. a) for SW fish. Stars (w) indicates a significant difference between the treatments for a specific date. FW and SW data from March to early June were analyzed by two-way ANOVA whereas FW data from March to August were analyzed with one-way ANOVA as described in Section 2.

250 200

(P < 0.01) as SW-transfer induced a significant decrease in MR mRNA levels from March to May (P < 0.05) but did not affect the level in early June. SW MR expression generally increased from May to early June (P < 0.05). 11b-HSD2 mRNA levels increased approximately 10-fold in FW fish from March to a peak in early June (P < 0.05, Fig. 6). There was a significant interaction between time and treatment on 11b-HSD2 mRNA levels during smoltification (P < 0.0001). SW-transfer induced a marked increase in 11b-HSD2 expression compared to FW fish from March to May (P < 0.05) but there was no effect in early June.

SW

60 50

299

FW

a a

SW

a

A

A

150

a

A

100 B 50 D

4.1. GHR expression

C

0 March

April

May Early Late June June

A frequently used index of smoltification is the spring surge in gill Na+, K+-ATPase activity, which is also seen in the present experiment. The dynamics of the activity of this enzyme reflect SW-type chloride cell development and correlate with increased SW-tolerance (see McCormick, 1995 for review). The marked drop in enzyme activity following the peak in early June indicates the onset of de-smoltification and thus loss of SW-tolerance. The increased gill enzyme activity has been causally related to increased plasma cortisol (S. salar: Langhorne and Simpson, 1986; Sundell et al., 2003) and GH levels (coho salmon (O. kisutch): Young et al., 1989; S. salar: McCormick et al., 1995) and decreased PRL levels (S. salar: Prunet et al., 1989; O. kisutch: Young et al., 1989). Whereas the dynamics of these three major osmoregulatory hormones have been analysed in several salmonids during smolting and SW-acclimation, studies of the expression of their respective receptor proteins in osmoregulatory target organs are lacking. The present study is the first to characterize changes in the gill mRNA levels of these receptors during smolting in FW and in response to a 24-h SW-challenge. However, changes in mRNA levels are only indicative of changes in protein levels and not necessarily matched by similar changes in protein levels in a given tissue. RNA stability and translation rate, post-translational modifications, cellular localization, and protein turnover are some of the additional determinants of functional protein availability.

August

Fig. 6. Changes in gill 11b-HSD2 mRNA expression in Atlantic salmon during smoltification in FW and after 24-h SW challenge. Values are means ± SEM (n = 6–8). Values with no letters in common are significantly different as determined by the Bonferroni adjusted Fisher’s LSD test (P < 0.05). Upper case letters (e.g. A) are used for FW fish and lower case letters (e.g. a) for SW fish. Stars (w) indicates a significant difference between the treatments for a specific date. FW and SW data from March to early June were analyzed by two-way ANOVA whereas FW data from March to August were analyzed with one-way ANOVA as described in Section 2.

The variation in gill GHR mRNA levels coincided with the changes in branchial Na+, K+-ATPase activity during smolting. A peak in receptor expression in early June was followed by an abrupt decrease coincident with de-smoltification. GH stimulates growth and SW-tolerance during smolting (see Bjo¨rnsson, 1997 for review), and previous studies have demonstrated a positive correlation between plasma GH levels and gill Na+, K+-ATPase activity (McCormick et al., 1995). The present data suggest that gill GHR levels may also be up-regulated at this point. No studies have thus far reported gill GHR expression during smolting. Increased GHR mRNA expression was, however,

300

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

reported in vertebrae of S. salar post-smolts in parallel with increased GH levels during their first spring in SW (Wargelius et al., 2005). SW-transfer had a variable effect on gill GHR expression depending on the developmental stage of the fish. During the early parts of smoltification, GHR mRNA levels increased in response to SW-transfer suggesting an increased requirement for GH signalling under these circumstances. This is consistent with the SW-adaptive role established for GH. On the contrary 24-h SW-transfer induced a decrease in GHR mRNA levels at the smoltification peak in June. In O. mykiss, SW-transfer induced an initial decrease in specific GH-binding to liver membranes whereas binding in gill membranes was unaffected by salinity (Sakamoto and Hirano, 1991). This may be due to negative autoregulation by GH on its own receptor, since Schmitz et al. (1994) showed that plasma GH increases after SW-transfer at the smolt peak but not earlier during smolting. Both positive and negative autoregulation of the GHR gene by GH have been reported depending on vertebrate species, tissue type and pulsatility of plasma GH variation (Maiter et al., 1988; Mori et al., 1992; Bennett et al., 1995; Hull and Harvey, 1998; Iida et al., 2004). 4.2. PRLR expression Prolactin receptors are heavily expressed in osmoregulatory tissues in many teleosts. In the gill, chloride cells are the primary site for PRLR expression (see Manzon, 2002 for review; Lee et al., 2006) in accordance with PRL being an osmoregulatory hormone in teleosts. PRL is a FW hormone in several teleosts including salmonids (see Manzon, 2002 for review) and high circulating PRL levels are incompatible with the good SW adaptability developed during smolting (Prunet et al., 1985; Madsen and Bern, 1992). The decrease in gill PRLR mRNA levels from March to early June in the current study in concert with a decrease in plasma PRL levels during smoltification (S. salar: Prunet et al., 1989; O. kisutch: Young et al., 1989) suggests a diminishing role for PRL signalling through this period with loss of FWadaptability. PRLR expression in the gill during smoltification has not previously been reported. Curiously, PRLR expression increased consistently after 24-h SWtransfer throughout the course of smoltification. This observation contrasts the decrease or lack of effect on gill PRLR mRNA levels in BW-transferred Oreochromis niloticus (Sandra et al., 2001) and O. mykiss and the lower gill PRLR mRNA levels in SW than in FW reared O. mossambicus (see Manzon, 2002 for review). It is unknown whether the present increase in PRLR mRNA level lead into an increased de novo synthesis of PRL receptors or—more likely, is due to a decreased turnover of PRLR transcripts due to reduced translational activity. Additional information on the dynamics of gill PRL receptors has come from studies of binding capacity in membrane preparations. Specific gill PRL binding capacity decreased during SW-acclimation in O. mossambicus

(Dauder et al., 1990) but increased in O. niloticus (Auperin et al., 1995). Thus species differences in response to salinity shifts seem to occur. Estimation of hormone receptor population by binding assays may be biased by lack of/or variable stripping efficiency of endogenous hormone from its receptor prior to analysis; especially in those situations where endogenous hormone levels vary significantly (e.g. salinity shifts). 4.3. GR expression Several lines of evidence point to an important role for cortisol as a stimulator of metabolic and hypo-osmoregulatory aspects of smolting. Our current knowledge of the signaling pathway for cortisol in the gill has mostly come from many studies of corticosteroid receptor (CR) binding characteristics in cytosolic and nuclear fractions of gill tissue (see Mommsen et al., 1999 for review). These all point to the presence of a single class of receptors with the typical characteristics of a glucocorticoid receptor type. However, more detailed molecular analyses are required subsequent to the recent discovery of two different corticosteroid receptor types in the gill: a glucocorticoid and a mineralocorticoid receptor (Ducouret et al., 1995; Colombe et al., 2000; Bury et al., 2003; Sturm et al., 2005). Our data are the first to report the simultaneous expression of these two receptors in the gill during smolting in a salmonid species. The present 2-fold increase in GR transcript levels during smolting is consistent with the increased GR expression during smolting in S. salar (Mazurais et al., 1998) and masu salmon, O. masou (Mizuno et al., 2001), and may explain the increase in gill CR Bmax observed in smolting O. kisutch and S. salar (Shrimpton, 1996; Shrimpton and McCormick, 2003). Elevated GR expression suggests a need for increased cortisol signaling during smolting when SW-tolerance develops, and seems to occur prior to/or concurrent with elevated plasma cortisol levels (Shrimpton and McCormick, 2003). A convincing direct relationship has been demonstrated between gill CR Bmax and in vitro responsiveness of gill Na+, K+-ATPase activity to cortisol in O. mykiss (Shrimpton and McCormick, 1999). Our data support that increased GR signaling may be partly responsible for this mechanism. The sustained elevation of GR mRNA levels during de-smoltification may contradict other reports of a negative feedback regulation of CR by cortisol during the climax stage of smolting when plasma cortisol is elevated (Shrimpton, 1996). Still, it is important to keep in mind that a direct correlation between mRNA and protein levels not necessarily is ensured. However, circulating cortisol levels are usually low during de-smoltification and the sustained increase in GR expression observed in the present study may be due to lack of feed-back inhibition at this point. Alternatively, the high expression level suggests a dual osmoregulatory function of cortisol during loss of SW-tolerance (Dang et al., 2000; Sakamoto et al., 2001).

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

During FW–SW acclimation increased cortisol signalling occurs in several euryhaline teleosts as indicated by increased cortisol levels (see Mommsen et al., 1999 for review), increased GR mRNA levels, CR numbers and cortisol binding capacity in brook trout, Salvelinus fontinalis (Weisbart et al., 1987); O. mykiss (McLeese et al., 1994); chum salmon, O. keta (Uchida et al., 1998); F. heteroclitus (Scott et al., 2004). Our data show that the immediate response of GR expression to SW-transfer depends on the stage of smoltification. In March and April there was no effect, whereas in May there was a significant increase in GR mRNA levels after SW-transfer. This developmental change in GR responsiveness to a hyper-osmotic challenge suggests a developing functionality of the GR expression and signaling pathway which characterizes successful SWacclimation. The ability to rapidly increase GR signaling in response to SW along with the progressed development of gill Na+, K+-ATPase activity are two possible mechanisms for increased SW tolerance as the fish approach the smolt climax. At the peak of smolting, GR mRNA levels are elevated compared to March and April, and SW-transfer does not further affect GR levels. This suggests that GR levels are sufficient for successful SW-acclimation at this point.

301

but also with elevated Na+, K+-ATPase activity at the smoltification peak. This potential protection of the MR suggests that cortisol signalling during smoltification is not mediated through the MR. This is furthermore supported by the dramatic increase in 11b-HSD2 levels after SW-transfer. During de-smoltification, high 11b-HSD2 levels are sustained at the same time as MR expression is increased, supporting the presence of a specific ligand for MR signalling. Recent reports of circulating levels of DOC high enough to activate the MR in O. mykiss and S. salar (see Prunet et al., 2006 for review) strongly suggests that DOC is the functional MR ligand in these fish. However, no in vivo effect of DOC or circulating levels during smoltification or salinity shifts have yet been established. In conclusion, the present data suggest that GR and GHR are involved in development of SW-tolerance during smoltification and that MR and PRLR signalling are involved in establishing hyper-osmoregulation. The distinct regulation of 11b-HSD2 during smolting and SW-challenge suggests the presence of a specific ligand to account for MR signalling in fish. The corticosteroid signaling pathway may well be affected by interaction with other endocrine determinants of osmoregulatory modus: GH and IGF-I in SW-acclimation and PRL in FW-acclimation (Sakamoto et al., 2001).

4.4. MR and 11b-HSD2 expression Acknowledgments Cortisol signaling is not restricted to the GR; it also binds the recently identified MR with high affinity and stimulates trans-activation in vitro (Sturm et al., 2005). Little is known about general MR expression and function in fish. The present data are the first on MR expression during smolting and suggest that functionality of this receptor is coupled to hyper- rather than hypo-osmoregulation. The unchanged MR mRNA levels in FW gills during smolting, the abrupt increase at the onset of de-smoltification and the general decrease in transcript levels after SW-transfer support this theory. A role for MR in FW osmoregulation has been suggested in O. mykiss (Sloman et al., 2001) and F. heteroclitus (Scott et al., 2005). The O. mykiss MR not only binds cortisol but also the intermediate steroid in cortisol synthesis, DOC (Sturm et al., 2005), which is present in fish plasma (Prunet et al., 2006). Since the classical MR ligand, aldosterone, is absent in teleost fish, DOC seems a likely MR ligand in fish. Mutational analysis of MR suggests that DOC was in fact the ancient MR agonist prior to evolution of tetrapods (Adami, 2006). In higher vertebrates, co-localization of the 11b-HSD2 enzyme with MR governs specific aldosterone signaling through the MR by inactivating and thus reducing cortisol signaling through the MR. Recently, the 11b-HSD2 enzyme was also identified in teleost gills, O. mykiss (Kusakabe et al., 2003); Japanese eel (Anguilla japonica) and O. niloticus (Jiang et al., 2003), however, there are no reports on expression levels in the gill during smolting. The present 10-fold increase in 11b-HSD2 mRNA levels from March to early June not only coincided with increased GR mRNA levels

P.K. was supported by a grant from the School of Aquatic Sciences (SOAS, Denmark). S.M. was supported by a grant from The Danish Natural Research Council (21-02-0520). References Adami, C., 2006. Evolution. Reducible complexity. Science 312 (5770), 61–63. Auperin, B., Rentier-Delrue, F., Martial, J.A., Prunet, P., 1995. Regulation of gill prolactin receptors in tilapia (Oreochromis niloticus) after a change in salinity or hypophysectomy. J. Endocrinol. 145 (2), 213–220. Bennett, P.A., Levy, A., Sophokleous, S., Robinson, I.C., Lightman, S.L., 1995. Hypothalamic GH receptor gene expression in the rat: effects of altered GH status. J. Endocrinol. 147 (2), 225–234. Bjo¨rnsson, B.Th., 1997. The biology of salmon growth hormone: from daylight to dominance. Fish Physiol. Biochem. 17, 9–24. Bury, N.R., Sturm, A., Le Rouzic, P., Lethimonier, C., Ducouret, B., Guiguen, Y., Robinson-Rechavi, M., Laudet, V., Rafestin-Oblin, M.E., Prunet, P., 2003. Evidence for two distinct functional glucocorticoid receptors in teleost fish. J. Mol. Endocrinol. 31 (1), 141–156. Colombe, L., Fostier, A., Bury, N., Pakdel, F., Guiguen, Y., 2000. A mineralocorticoid-like receptor in the rainbow trout, Oncorhynchus mykiss: cloning and characterization of its steroid binding domain. Steroids 65 (6), 319–328. Dang, Z., Balm, P.H., Flik, G., Wendelaar Bonga, S.E., Lock, R.A., 2000. Cortisol increases Na(+)/K(+)-ATPase density in plasma membranes of gill chloride cells in the freshwater tilapia Oreochromis mossambicus. J. Exp. Biol. 203 (Pt. 15), 2349–2355. Dauder, S., Young, G., Hass, L., Bern, H.A., 1990. Prolactin receptors in liver, kidney, and gill of the tilapia (Oreochromis mossambicus): characterization and effect of salinity on specific binding of iodinated ovine prolactin. Gen. Comp. Endocrinol. 77 (3), 368–377.

302

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

Ducouret, B., Tujague, M., Ashraf, J., Mouchel, N., Servel, N., Valotaire, Y., Thompson, E.B., 1995. Cloning of a teleost fish glucocorticoid receptor shows that it contains a deoxyribonucleic acid-binding domain different from that of mammals. Endocrinology 136 (9), 3774–3783. Funder, J.W., Pearce, P.T., Smith, R., Smith, A.I., 1988. Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242 (4878), 583–585. Greenwood, A.K., Butler, P.C., White, R.B., DeMarco, U., Pearce, D., Fernald, R.D., 2003. Multiple corticosteroid receptors in a teleost fish: distinct sequences, expression patterns, and transcriptional activities. Endocrinology 144 (10), 4226–4236. Hoar, W.S., 1988. The physiology of smolting salmonids. In: Hoar, W.S., Randall, D.J. (Eds.), Fish Physiology, vol. XIB. Academic Press, San Diego, pp. 275–343. Hull, K.L., Harvey, S., 1998. Autoregulation of central and peripheral growth hormone receptor mRNA in domestic fowl. J. Endocrinol. 156 (2), 323–329. Iida, K., del Rincon, J.P., Kim, D.S., Itoh, E., Coschigano, K.T., Kopchick, J.J., Thorner, M.O., 2004. Regulation of full-length and truncated growth hormone (GH) receptor by GH in tissues of lit/lit or bovine GH transgenic mice. Am. J. Physiol. Endocrinol. Metab. 287 (3), E566–E573. Jiang, J.Q., Wang, D.S., Senthilkumaran, B., Kobayashi, T., Kobayashi, H.K., Yamaguchi, A., Ge, W., Young, G., Nagahama, Y., 2003. Isolation, characterization and expression of 11beta-hydroxysteroid dehydrogenase type 2 cDNAs from the testes of Japanese eel (Anguilla japonica) and Nile tilapia (Oreochromis niloticus). J. Mol. Endocrinol. 31 (2), 305–315. Kusakabe, M., Nakamura, I., Young, G., 2003. 11beta-hydroxysteroid dehydrogenase complementary deoxyribonucleic acid in rainbow trout: cloning, sites of expression, and seasonal changes in gonads. Endocrinology 144 (6), 2534–2545. Langhorne, P., Simpson, T.H., 1986. The interrelationship of cortisol, gill (Na + K) ATPase, and homeostasis during the Parr-Smolt transformation of Atlantic salmon (Salmo salar L). Gen. Comp. Endocrinol. 61 (2), 203–213. Laurent, P., Perry, S.F., 1990. Effects of cortisol on gill chloride cell morphology and ionic uptake in the freshwater trout, Salmo gairdneri. Cell Tissue Res. 259 (3), 429–442. Lee, K.M., Kaneko, T., Aida, K., 2006. Prolactin and prolactin receptor expressions in a marine teleost, pufferfish Takifugu rubripes. Gen. Comp. Endocrinol. 146 (3), 318–328. Lowry, O.H., Roseborough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin reagent. J. Biol. Chem. 193, 266–275. Lethimonier, C., Tujague, M., Kern, L., Ducouret, B., 2002. Peptide insertion in the DNA-binding domain of fish glucocorticoid receptor is encoded by an additional exon and confers particular functional properties. Mol. Cell. Endocrinol. 194 (1-2), 107–116. Madsen, S.S., 1990. The role of cortisol and growth hormone in seawater adaptation and development of hypoosmoregulatory mechanisms in sea trout parr (Salmo trutta trutta). Gen. Comp. Endocrinol. 79 (1), 1– 11. Madsen, S.S., Bern, H.A., 1992. Antagonism of prolactin and growthhormone – impact on seawater adaptation in 2 salmonids, Salmo-trutta and Oncorhynchus-mykiss. Zool. Sci. 9 (4), 775–784. Maiter, D., Underwood, L.E., Maes, M., Ketelslegers, J.M., 1988. Acute down-regulation of the somatogenic receptors in rat liver by a single injection of growth hormone. Endocrinology 122, 1291–1296. Mancera, J.M., Laiz Carrion, R., del Pilar Martin del Rio, M., 2002. Osmoregulatory action of PRL, GH, and cortisol in the gilthead seabream (Sparus aurata L). Gen. Comp. Endocrinol. 129 (2), 95–103. Manzon, L.A., 2002. The role of prolactin in fish osmoregulation: A review. Gen. Comp. Endocrinol. 125, 291–310. Mazurais, D., Ducouret, B., Tujague, M., Valotaire, Y., D’Cotta, H., Gallais, C., Prunet, P., 1998. Regulation of the glucocorticoid receptor mRNA levels in the gills of Atlantic salmon (Salmo salar) during smoltification. Bull. Fr. Peˆche Piscicult. (350–351), 499–510.

McCormick, S.D., 1990. Cortisol directly stimulates differentiation of chloride cells in tilapia opercular membrane. Am. J. Physiol. 259 (4 Pt 2), R857–R863. McCormick, S.D., 1993. Methods for nonlethal gill biopsy and measurement of Na+,K+-ATPase activity. Can. J. Fish. Aquat. Sci. 50, 656– 658. McCormick, S.D., 1995. Hormonal control of gill Na+,K+-ATPase and chloride cell function. In: Wood, C.M., Shuttleworth, T.J. (Eds.), Fish Physiology, Ionoregulation: Cellular and Molecular Approaches, vol. XIV. Academic Press, New York, pp. 285–315. McCormick, S.D., Bjo¨rnsson, B.Th., Sheridan, M., Eilertson, C., Carey, J.B., Odea, M., 1995. Increased daylength stimulates plasma growthhormone and gill Na+,K+-ATPase in Atlantic salmon (Salmo salar). J. Comp. Physiol. B 165 (4), 245–254. McLeese, J.M., Johnsson, J., Huntley, F.M., Clarke, W.C., Weisbart, M., 1994. Seasonal changes in osmoregulation, cortisol, and cortisol receptor activity in the gills of parr/smolt of steelhead trout and steelhead-rainbow trout hybrids, Oncorhynchus mykiss. Gen. Comp. Endocrinol. 93 (1), 103–113. Mizuno, S., Ura, K., Onodera, Y., Fukada, H., Misaka, N., Hara, A., Adachi, S., Yamauchi, K., 2001. Changes in transcript levels of gill cortisol receptor during smoltification in wild Masu salmon, Oncorhynchus masou. Zool. Sci. 18 (6), 853–860. Mommsen, T.P., Vijayan, M.M., Moon, T.W., 1999. Cortisol in teleosts: dynamics mechanisms of action, and metabolic regulation. Rev. Fish Biol. Fish. 9 (3), 211–268. Mori, I., Sakamoto, T., Hirano, T., 1992. Growth hormone (GH)dependent hepatic GH receptors in the Japanese eel, Anguilla japonica: effects of hypophysectomy and GH injection. Gen. Comp. Endocrinol. 85 (3), 385–391. Olsvik, P.A., Lie, K.K., Jordal, A.E., Nilsen, T.O., Hordvik, I., 2005. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol. Biol. (6), 21. Perry, S.F., Goss, G.G., Laurent, P., 1992. The interrelationships between gill chloride cell morphology and ionic uptake in 4 fresh-water teleosts. Can. J. Zool. 70 (9), 1775–1786. Prunet, P., Boeuf, G., Houdebine, L.M., 1985. Plasma and pituitary prolactin levels in rainbow trout during adaptation to different salinities. J. Exp. Zool. 235 (2), 187–196. Prunet, P., Boeuf, G., Bolton, J.P., Young, G., 1989. Smoltification and seawater adaptation in Atlantic salmon (Salmo salar): plasma prolactin, growth hormone, and thyroid hormones. Gen. Comp. Endocrinol. 74 (3), 355–364. Prunet, P., Sturm, A., Milla, S., 2006. Multiple corticosteroid receptors in fish: from old ideas to new concepts. Gen. Comp. Endocrinol. 147 (1), 17–23. Redding, J.M., Patino, R., Schreck, C.B., 1991. Cortisol effects on plasma electrolytes and thyroid hormones during smoltification in coho salmon Oncorhynchus kisutch. Gen. Comp. Endocrinol. 81 (3), 373– 382. Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386. Sakamoto, T., Hirano, T., 1991. Growth hormone receptors in the liver and osmoregulatory organs of rainbow trout: characterization and dynamics during adaptation to seawater. J. Endocrinol. 130 (3), 425– 433. Sakamoto, T., Uchida, K., Yokota, S., 2001. Regulation of the iontransporting mitochondrion-rich cell during adaptation of teleost fishes to different salinities. Zool. Sci. 18 (9), 1163–1174. Sandra, O., Le Rouzic, P., Rentier-Delrue, F., Prunet, P., 2001. Transfer of tilapia (Oreochromis niloticus) to a hyperosmotic environment is associated with sustained expression of prolactin receptor in intestine, gill, and kidney. Gen. Comp. Endocrinol. 123 (3), 295–307. Schmitz, M., Berglund, I., Lundqvist, H., Bjo¨rnsson, B.Th., 1994. Growth hormone response to seawater challenge in Atlantic salmon, Salmo

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303 salar, during parr-smolt transformation. Aquaculture 121 (1-3), 209– 221. Scott, G.R., Richards, J.G., Forbush, B., Isenring, P., Schulte, P.M., 2004. Changes in gene expression in gills of the euryhaline killifish Fundulus heteroclitus after abrupt salinity transfer. Am. J. Physiol. Cell Physiol. 287 (2), C300–C309. Scott, G.R., Keir, K.R., Schulte, P.M., 2005. Effects of spironolactone and RU486 on gene expression and cell proliferation after freshwater transfer in the euryhaline killifish. J. Comp. Physiol. [B] 175 (7), 499– 510. Seidelin, M., Madsen, S.S., 1999. Endocrine control of Na+,K+-ATPase and chloride cell development in brown trout (Salmo trutta): interaction of insulin-like growth factor-I with prolactin and growth hormone. J. Endocrinol. 162 (1), 127–135. Shrimpton, J.M., 1996. Relationship between size, gill corticosteroid receptors, Na+-K+ ATPase activity and smolting in juvenile coho salmon (Oncorhynchus kisutch) in autumn and spring. Aquaculture 147 (1–2), 127–140. Shrimpton, J.M., McCormick, S.D., 1999. Responsiveness of gill Na+/ K+-ATPase to cortisol is related to gill corticosteroid receptor concentration in juvenile rainbow trout. J. Exp. Biol. 202 (Pt 8), 987–995. Shrimpton, J.M., McCormick, S.D., 2003. Environmental and endocrine control of gill corticosteroid receptor number and affinity in Atlantic salmon (Salmo salar) during smolting. Aquaculture 222 (1-4), 83–99. Sloman, K.A., Desforges, P.R., Gilmour, KM., 2001. Evidence for a mineralocorticoid-like receptor linked to branchial chloride cell proliferation in freshwater rainbow trout. J. Exp. Biol. 204 (Pt 22), 3953–3961. Sturm, A., Bury, N., Dengreville, L., Fagart, J., Flouriot, G., RafestinOblin, M.E., Prunet, P., 2005. 11-deoxycorticosterone is a potent agonist of the rainbow trout (Oncorhynchus mykiss) mineralocorticoid receptor. Endocrinology 146 (1), 47–55.

303

Sundell, K., Jutfelt, F., Agustsson, T., Olsen, R.E., Sandblom, E., Hansen, T., Bjo¨rnsson, B.Th., 2003. Intestinal transport mechanisms and plasma cortisol levels during normal and out-of-season parr-smolt transformation of Atlantic salmon, Salmo salar. Aquaculture 222 (1– 4), 265–285. Uchida, K., Kaneko, T., Tagawa, M., Hirano, T., 1998. Localization of cortisol receptor in branchial chloride cells in chum salmon fry. Gen. Comp. Endocrinol. 109 (2), 175–185. Very, N.M., Kittilson, J.D., Norbeck, L.A., Sheridan, M.A., 2005. Isolation, characterization, and distribution of two cDNAs encoding for growth hormone receptor in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 140 (4), 615–628. Wargelius, A., Fjelldal, P.G., Benedet, S., Hansen, T., Bjo¨rnsson, B.T., Nordgarden, U., 2005. A peak in gh-receptor expression is associated with growth activation in Atlantic salmon vertebrae, while upregulation of igf-I receptor expression is related to increased bone density. Gen. Comp. Endocrinol. 142 (1-2), 163–168. Weisbart, M., Chakraborti, P.K., Gallivan, G., Eales, J.G., 1987. Dynamics of cortisol receptor activity in the gills of the brook trout, Salvelinus fontinalis, during seawater adaptation. Gen. Comp. Endocrinol. 68 (3), 440–448. Wendelaar Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77 (3), 591–625 (Review). Yao, K., Niu, P.D., Le Gac, F., Le Bail, P.Y., 1991. Presence of specific growth hormone binding sites in rainbow trout (Oncorhynchus mykiss) tissues: characterization of the hepatic receptor. Gen. Comp. Endocrinol. 81 (1), 72–82. Young, G., Bjo¨rnsson, B.T., Prunet, P., Lin, R.J., Bern, H.A., 1989. Smoltification and seawater adaptation in coho salmon (Oncorhynchus kisutch): plasma prolactin, growth hormone, thyroid hormones, and cortisol. Gen. Comp. Endocrinol. 74 (3), 335–345. Zar, J.H., 1999. Biostatistical Analysis, fourth ed. Prentice-Hall, Upper Saddle River, NJ, USA.