Host-range determinants on the PB2 protein of influenza A viruses control the interaction between the viral polymerase and nucleoprotein in human cells

Virology 362 (2007) 271 – 282 www.elsevier.com/locate/yviro

Host-range determinants on the PB2 protein of influenza A viruses control the interaction between the viral polymerase and nucleoprotein in human cells Karine Labadie, Emmanuel Dos Santos Afonso, Marie-Anne Rameix-Welti, Sylvie van der Werf, Nadia Naffakh ⁎ Unité de Génétique Moléculaire des Virus Respiratoires, URA 1966 CNRS, EA302 Université Paris 7, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex 15, France Received 9 August 2006; returned to author for revision 8 September 2006; accepted 21 December 2006 Available online 31 January 2007

Abstract The transcription/replication activity of ribonucleoproteins derived from influenza A primary isolates of human (A/Paris/908/97) or avian origin (A/Mallard/Marquenterre/MZ237/83, A/Hong Kong/156/97) was compared upon reconstitution in mammalian or avian cells, using virallike reporter RNAs synthesized under the control of the human and chicken RNA polymerase I promoters, respectively. In avian cells, transcription/replication activities were in the same range with all ribonucleoproteins tested. In human cells, ribonucleoproteins derived from A/ Mallard/Marquenterre/MZ237/83 showed reduced transcription/replication activity and reduced NP binding to the PB1–PB2–PA complex (P) or to the isolated PB2 subunit, as compared to the ribonucleoproteins derived from A/Paris/908/97. Both defects were restored when PB2 residue Glu-627 was changed to a Lys. Ribonucleoproteins derived from the human A/Hong Kong/156/97 H5N1 isolate showed efficient NP–P interaction in human cells, and high levels of activity which were determined mostly by the PB2 and PA proteins. Our data suggest that PB2 might play a pivotal role in molecular interactions involving both the viral nucleoprotein and cellular proteins. © 2007 Elsevier Inc. All rights reserved. Keywords: Influenza A virus; Host-range; Transcription/replication; PB2; NP

Introduction Aquatic birds are thought to be the reservoir for genetic diversity of influenza A viruses, and the source for transmission to other animal species such as pigs, horses, or humans (Webster et al., 1992). Avian influenza A viruses usually do not replicate efficiently or cause disease in humans. Most transmissions of whole avian influenza viruses from birds to humans do not result in sustained circulation in the human population. However, adaptation to humans may occur and result in an influenza pandemic followed by the establishment of a new lineage of human viruses, as was the case in 1918 (Palese et al., 2006). Since 1997, highly pathogenic avian influenza A viruses of the H5N1 subtype that have been circulating in South-East Asia, and spread more recently to the Middle-East, Eastern ⁎ Corresponding author. Fax: +33 1 40 61 32 41. E-mail address: [email protected] (N. Naffakh). 0042-6822/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2006.12.027

Europe and Africa, were responsible for sporadic transmission from poultry to humans. Although human to human transmission of the viruses has been very inefficient so far, repeated transmission events could lead to the emergence of H5N1 viruses with increased transmissibility among humans and with the potential to initiate a new influenza pandemic (Smith et al., 2006). The molecular basis of host range restriction and adaptation of influenza A viruses to a new host species is poorly understood. Avian and human viruses differ in the receptor specificity of their surface glycoproteins, which contributes to host range restriction (Rogers and Paulson, 1983; Suzuki et al., 2000). Human viruses bind preferentially to sialic acid (SA) α2,6-galactose whereas avian viruses bind preferentially to SA α2,3-galactose. Most H5N1 viruses isolated from humans since 1997 show receptor binding properties typical of avian viruses (Gambaryan et al., 2006; Stevens et al., 2006), which probably limits their potential for human to human transmission as

272

K. Labadie et al. / Virology 362 (2007) 271–282

SAα2,3 are expressed in the lower but not the upper respiratory tract of humans (Shinya et al., 2006; van Riel et al., 2006). Yet these H5N1 viruses were able to replicate and cause disease and death in humans, indicating that receptor specificity is not the only factor that determines host range. Internal proteins also harbor determinants for host-range and virulence, as demonstrated by genetic studies on avian/human reassortant viruses (Clements et al., 1992 ; Salomon et al., 2006; Snyder et al., 1987; Tian et al., 1985). Most documented is the contribution of PB2 amino acid 627 (a Lys in human viruses, a Glu in avian viruses). A Glu to Lys substitution alone changed the host range of an avian PB2 single-gene reassortant so that it replicated in mammalian cells (Clements et al., 1992; Subbarao et al., 1993). The PB2 Glu627Lys substitution has also been associated with increased pathogenicity and replicative efficiency of Hong Kong H5N1 influenza viruses in mice (Hatta et al., 2001; Shinya et al., 2004). Remarkably, during an H7N7 virus outbreak in the Netherlands in 2003, the same PB2 Glu627Lys substitution was found in a virus isolated from a human case of fatal pneumonia, but not in viruses isolated from human cases of conjunctivitis, or from chicken (Fouchier et al., 2004). Moreover, sequence data on the virus of the 1918 pandemic indicate that PB2 amino acid 627 is a Lys (Taubenberger et al., 2005), although phylogenetic analyses suggest that all genomic segments are of avian origin and that the precursor virus was probably not circulating widely in humans until shortly before 1918 (Reid et al., 2004). Taken all together, these observations clearly point to PB2 amino acid 627 as a major determinant of host specificity and pathogenicity in mammals. However, the molecular mechanisms underlying the effects of a Glu627Lys substitution in PB2 are still unknown. Making use of a genetic system for the in vivo reconstitution of functional ribonucleoproteins (RNPs), we observed previously that PB2 amino acid 627 was a major determinant of the efficiency with which polymerase complexes ensured replication of a viral-like RNA in mammalian cells (Naffakh et al., 2000). We also found that this particular residue 627 of PB2 contributed to a significantly lower activity at 33 °C as compared to 37 °C of polymerase complexes derived from avian viruses (Massin et al., 2001). So far, our experiments related to RNPs derived from the A/Mallard/New York/6750/78 and A/FPV/Rostock/34 laboratory strains, and were performed mostly in primate cells. In the present study, our observations were extended to RNPs derived from primary isolates, including a Hong Kong H5N1 isolate responsible for a human case in 1997. Transcription/replication activities were evaluated in various cell lines of mammalian or avian origin, using virallike RNAs synthesized under the control of the human and chicken RNA polymerase I promoters, respectively. To gain insights into the mechanisms underlying the differences observed between human- and avian-derived complexes and the role of PB2 residue 627, molecular interactions between PB2 and the other components of the viral RNP were examined in co-immunoprecipitation experiments. The data suggest a pivotal role for PB2 in molecular interactions involving both the viral nucleoprotein and cellular proteins.

Results Transcription/replication activity of ribonucleoproteins derived from primary human or avian influenza A isolates, in human or in avian cells We compared the efficiency with which an NS segment-like CAT reporter RNA underwent transcription/replication in the presence of polymerase complexes derived from primary influenza A isolates of human or avian origin, in human or in avian cells. The human (Pleschka et al., 1996) and chicken (Massin et al., 2005) RNA Polymerase I promoters were used to direct the expression of the viral-like RNA in human (293T) and chicken (DF1) cells, respectively. In both cell types, the RNA template was coexpressed with the PB1, PB2, PA and NP proteins derived from the A/Paris/908/97 human isolate (P908), the A/Mallard/Marquenterre/MZ237/83 avian isolate (MZ237), or the A/Hong Kong/156/97 virus isolated from the first human case of the 1997 H5N1 outbreak (HK156). The levels of CAT protein were measured in cell extracts after 24, 48 or 72 h of incubation at 37 °C or 33 °C. The results are presented in Fig. 1. In 293T cells, the levels of CAT measured in the presence of the MZ237 polymerase complex were significantly lower as compared with the P908 complex. At 48 h post-transfection, the difference was about 1.5 log at 37 °C (Fig. 1A, closed squares vs. closed triangles), and more than 3 log at 33 °C (open squares vs. open triangles) (Student's t test, p < 0.05, n = 2 [2 independent experiments in duplicate]). Remarkably, CAT levels measured in the presence of the HK156 complex (circles) were intermediate, and not significantly different from those measured with the P908 complex (Fig. 1A). The amounts of CAT produced in the presence of the MZ237 complex were reduced by more than two orders of magnitude at 33 °C (open squares) as compared to 37 °C (closed squares) (p < 0.05, n = 2), in agreement with our previous observations on polymerase complexes derived from laboratory strains of avian origin (Massin et al., 2001). In comparison, CAT production resulting from the expression of the P908 or HK156 complexes was little sensitive to temperature reduction (Fig. 1A). In DF1 cells, unlike in 293T cells, the kinetics of accumulation of CAT were very similar with all three complexes. At 48 h post-infection, the reduction of CAT levels observed at 33 °C as compared to 37 °C was less than 1 log for the MZ237 complex as well as for the P908 and HK156 complexes (Fig. 1B). Levels of CAT were low as compared to those measured in 293T cells. This difference was most likely due to a lower efficiency of transfection of DF1 cells as the pHMG promoter was found to be equally functional in both cell types (data not shown). We asked whether these observations could be further generalized. Thus, human and chicken RNA Polymerase Ibased plasmids driving the synthesis of H1, H3, H5 or H7 virallike CAT RNAs were constructed, in addition to the plasmids producing NS viral-like RNAs used in our first set of experiments. The cloned 5′ and 3′ non-coding regions were derived from the various NS and HA genomic segments. They share common terminal regions of 12 (5′ NCR) and 13 (3′ NCR) nucleotides, respectively, but show non-conserved

K. Labadie et al. / Virology 362 (2007) 271–282

273

Fig. 1. Transcription–replication of an NS segment-like reporter RNA in the presence of P908-, HK156-, or MZ237-derived polymerase complexes in cells of human or avian origin. Four pHMG plasmids encoding the PB1, PB2, PA and NP proteins derived from the P908 (triangles), HK156 (circles) or MZ237 (squares) viruses were cotransfected together with plasmid pPR–FluA–CAT (in 293T cells, panel A) or pPRC425–FluA–CAT (in DF1 cells, panel B). Transfected cells were incubated at 37 °C (solid lines, solid symbols) or at 33 °C (dashed lines, open symbols). At 24, 48 or 72 h post-transfection, cell extracts were tested for CAT levels. Results are expressed as the mean ± mean deviation of duplicate samples from one experiment representative of two independent experiments.

regions of variable length (Table 1). The NS and H1 constructs were transfected into 293T and DF1 cells, or alternatively into COS-1 (simian) or QT6 (quail) cells, together with expression plasmids for the PB1, PB2, PA and NP core proteins derived from the P908, HK156 or MZ237 viruses. As shown in Fig. 2, when CAT levels were measured in cell extracts at 48 h posttransfection, very similar profiles were obtained with both the NS and H1 constructs (black vs. grey bars). In DF1 as well as in QT6 cells, the levels of CAT produced by all RNPs derived from all three viruses were in the same range at 37 °C, a moderate (< 1 log) decrease being observed at 33 °C as compared to 37 °C in all cases (Figs. 2C and 2D). In contrast, in COS-1 as well as in 293T cells, MZ237–RNPs produced levels of CAT reduced about 1 and 3 log as compared to P908–RNPs at 37 and 33 °C, respectively (Figs. 2A and B). Testing additional polymerase complexes derived from the human A/ Puerto Rico/8/34 (PR8) or avian A/FPV/Rostock/34 (FPV) laboratory strains with the H3, H5 or H7 viral-like CAT RNAs lead to similar observations : a lower efficiency of transcription/ replication of the viral-like RNAs with the FPV as compared to the PR8 complex in 293T cells, but not in DF1 cells (data not shown). Remarkably, in 293T and COS-1 cells at 33 °C, the

HK156 complex ensured transcription/replication of the H1 and NS viral-like RNAs with a higher efficiency as compared to the MZ237 complex (Figs. 2A and B). Plaque assays were performed on MDCK cells with the HK156, MZ237 and P908 viruses at 37 and 33 °C in parallel. When examined at 72 h post-infection that the plaques formed by MZ237 appeared smaller than those formed by P908 and HK156 at 37 °C, and were barely visible at 33 °C (Fig. 3), which was in agreement with our previous observations on three distinct influenza strains of avian origin (Massin et al., 2001). In contrast, HK156 clearly formed plaques at 33 °C although very heterogeneous in size, and P908 formed plaques at 33 °C that were as large as at 37 °C (Fig. 3). These observations, in agreement with the data from transcription/replication assays, suggest that HK156 replicates more efficiently than MZ237 at low temperature in mammalian cells. Impact of PB2 residue 627 on transcription/replication activity, in human or in avian cells Residue 627 of PB2 is a known determinant of host specificity and pathogenicity, and has been shown to affect

Table 1 Sequences of the 5′ and 3′ non-coding regions (NCR) of influenza virus NS and HA segments cloned into the pPR- and pPRC425-based reporter plasmids 5′ NCR a NS H1 H3 H5 H7 3′ NCR a NS H1 H3 H5 H7

AGTAGAAACAAGGGTGTTTTTT AGTAGAAACAAGGGTGTTTTTCCTCATATCTCTGAAATTCTAATC AGTAGAAACAAGGGTGTTTTTAATTAATGCAC AGTAGAAACAAGGGTGTTTTTAACTACAATCTGAACTCACAAAT AGTAGAAACAAGGGTGTTTTTCCAAAC TATGTCTTTGTCACCCTGCTTTTGCT TTTGGTTGTTTTTATTTTCCCCTGCTTTTGCT GGTTAATAGAATTATCCCCTGCTTTTGCT TTTGACAGATTATACCCCTGCTTTTGCT TTTGTATCCCCTGCTTTTGCT

a Derived from sequences of the NS, H1, H3, H5 and H7 segments of A/WSN/33, A/PR/8/34-NIBSC, A/Hong Kong/1143/99, A/Duck/China/E319/03 and A/ Netherlands/219/03 viruses (available in the influenza sequence database: www.flu.lanl.gov), respectively, shown in negative-sense orientation. Conserved sequences are underlined.

274

K. Labadie et al. / Virology 362 (2007) 271–282

Fig. 2. Transcription–replication of an H1 or NS segment-like reporter RNA in the presence of P908-, HK156- or MZ237-derived polymerase complexes in cells of mammalian or avian origin. Four plasmids encoding the PB1, PB2, PA and NP proteins derived from the P908, HK156 or MZ237 viruses were cotransfected together with pPR-based plasmids (in 293T or COS-1 cells, panels A and B, respectively) or pPRC425-based plasmids (in DF1 or QT6 cells, panels C and D, respectively) which directed the synthesis of viral-like CAT reporter RNAs with non coding regions derived from an NS (black bars) or H1 (grey bars) genomic segment. Following 48 h of incubation at 37 or 33 °C, cell extracts were tested for CAT levels. Results are expressed as concentration values and as the mean ± mean deviation of duplicate samples.

the replicative efficiency of influenza A viruses in mice (Hatta et al., 2001; Shinya et al., 2004). Here a significant difference was observed between transcription/replication activities of HK156and MZ237-derived complexes in mammalian cells, although both show a Glu at residue 627 of PB2. This observation prompted us to compare the effect of the PB2–Glu627Lys

substitution on the activities of HK156 and MZ237 complexes, in 293T and DF1 cells. The effect of the PB2–Lys627Glu substitution on the activity of the P908 complex was examined in parallel. To this end, plasmids encoding mutant HK156–, MZ237– or P908–PB2 proteins with a point mutation at residue 627 were used in the plasmid-based assay described above. The

Fig. 3. Plaque phenotype of the P908, HK156 and MZ237 viruses at 37 and 33 °C. The plaque phenotype of the indicated viruses was assayed on MDCK cells in a standard plaque assay as indicated in Materials and methods. Cell monolayers were stained with crystal violet after 72 h of incubation at 37 or 33 °C, as indicated.

K. Labadie et al. / Virology 362 (2007) 271–282

results obtained at 48 h post-transfection are shown in Fig. 4. In 293T cells, CAT levels dramatically increased when the MZ237–PB1, –PA and –NP proteins were coexpressed with the mutant PB2–Glu627Lys protein (Fig. 4A, grey bars) as compared to the wt protein (black bars) (p < 0.05 at 37 °C, p < 0.001 at 33 °C, n = 2). In agreement with the data shown in Fig. 1, CAT levels measured with the wt MZ237 complex were about ten-fold lower as compared to those measured with the wt P908 or HK156 complexes at 37 °C, and showed a 2- to 3-log decrease at 33 °C (p < 0.001, n = 2). In contrast, CAT levels measured with the mutant MZ237 complex were similar when measured at 37 or 33 °C, and were in the same range as those measured with the wt P908 or HK156 complexes (Fig. 4A). Remarkably the PB2–Glu627Lys substitution had no significant effect on the levels of CAT measured with the HK156 complex in 293T cells, and the symmetrical PB2– Lys627Glu substitution also had very little effect on the levels of CAT measured with the P908 complex (Fig. 4A). Unlike in 293T cells, substitutions at PB2 residue 627 had no major effect on the amounts of CAT produced in the presence of either the MZ237, HK156 or P908 complexes in DF1 cells (Fig. 4B). For most complexes, a moderate decrease of CAT levels at 33 °C compared to 37 °C was observed in DF1 cells as in 293T cells. For the MZ237–PB2/627Glu complex, the decrease in DF1 cells was significant (p < 0.05, n = 2) but much less pronounced than in 293T cells. Our data indicated that the presence of a Glu at residue 627 of PB2 impaired the activity of MZ237- but not HK156-derived RNPs in human cells, at 37 °C and even more so at 33 °C. The molecular basis for this difference between MZ237 and HK156 was examined by testing how efficiently mixtures of the core proteins derived from both viruses ensured transcription/ replication of the NS viral-like reporter RNA in 293T cells. As shown in Fig. 5, RNPs reconstituted upon co-expression of one of the MZ237–PB1, –PA or –NP proteins with three HK156-derived proteins (rising hatched bars as indicated) produced CAT levels which were in the same range as those measured with the HK156 RNPs (black bar). When HK156derived proteins were expressed in combination with MZ237– PB2 (rising hatched bar as indicated) or both MZ237–PB2 and

275

Fig. 5. Transcription/replication of viral-like CAT reporter RNAs in the presence of heterologous MZ237/HK156 polymerase complexes at 33 or 37 °C in 293T cells. 293T cells were transfected with plasmid pPR–FluA–CAT together with the pHMG plasmids encoding the PB1, PB2, PA and NP proteins derived from HK156 (H) or MZ237 (M) viruses, as indicated. Following 48 h of incubation at 37 or 33 °C, cell extracts were tested for CAT levels. For a given polymerase complex, CAT levels were expressed as percentages of those measured at 37 °C (100%) and as the mean ± mean deviation of three independent experiments in duplicate. The range of CAT levels measured at 37 °C is indicated (++: >5 × 103 ng/ml CAT; +: <5 × 103 ng/ml CAT).

–PA (light grey bar), the relative expression of CAT at 33 °C dropped below 15% of CAT expression at 37 °C. Reciprocally, RNPs reconstituted upon co-expression of one of the HK156– PB1, –PB2, –PA or –NP proteins together with three MZ237derived proteins (declining hatched bars) produced CAT levels which were similar to those measured with the MZ237 RNPs (white bar), i.e. in the low range at 37 °C and reduced 10- to 20fold at 33 °C as compared to 37 °C. Co-expression of both HK156–PB2 and –PA with MZ237–PB1 and –NP (dark grey bar) lead to CAT levels increased as compared to the MZ237 RNPs (10- and 100-fold at 37 and 33 °C, respectively) (p < 0.05, n = 3), and close to those measured with the HK156 RNPs (black bar). Taken together, these data suggest that molecular determinants present on the PB2 and PA proteins contribute synergistically to the high level of activity of the HK156 polymerase complex in 293T cells as compared to MZ237.

Fig. 4. Effect of the Glu/Lys substitution at PB2 residue 627 on transcription/replication of an NS segment-like reporter RNA in cells of human or avian origin. 293T or DF1 cells were transfected with plasmid pPR–FluA–CAT or pPRC425–FluA–CAT, respectively, together with the pHMG plasmids encoding the PB1, PB2–E627 (black bars) or PB2–K627 (grey bars), PA and NP proteins derived from the P908, HK156 or MZ237 viruses. Following 48 h of incubation at 37 or 33 °C, cell extracts were tested for CAT levels. The results are expressed as concentration values and as the mean ± mean deviation of duplicate samples from one experiment representative of three independent experiments.

276

K. Labadie et al. / Virology 362 (2007) 271–282

Fig. 6. Effect of the Glu/Lys substitution at PB2 residue 627 on polymerase–NP interactions in 293T cells, in the presence of co-expressed viral-like RNA. 293T cells were cotransfected with plasmid pPR–FluA–CAT together with the pHMG plasmids encoding the PB1, PB2–HA (with Glu or Lys at residue 627), PA, and NP proteins derived from the P908, HK156 or MZ237 viruses, as indicated. After 48 h of incubation at 33 or 37 °C, immunoprecipitation assays were performed on total cell extracts prepared from transfected cells or mocktransfected cells (∅), using a monoclonal anti-HA antibody as described under Materials and methods. Total cell lysates and immunoprecipitates (IP) were analysed by western blotting using anti-HA, -βactin, -PB1, -PA or -NP antibodies, as indicated. The range of CAT levels measured in a fraction of the transfected cells is indicated (++: >5 × 103 ng/ml CAT; +: <5 × 103 ng/ml CAT; −: <10 ng/ml CAT). The data shown are from one experiment representative of three independent experiments.

HA, PB1, PA or NP proteins. Results are shown in Fig. 6. The amounts of immunoprecipitated PB2–HA protein, as revealed with the anti-HA antibody, appeared repeatedly higher for the PB2–HA/627Glu as compared to the PB2–HA/627Lys proteins (Fig. 6, IP, HA lane). Similar variations were observed when the steady-state levels of expression of PB2–HA/627Glu and PB2– HA/627Lys proteins were analyzed in cell extracts before immunoprecipitation (Fig. 6, total cell lysates, HA lane). A semi-quantitative analysis was performed on serial two-fold dilutions of the cell extracts using a G-Box (Stratagene). Comparison of the various signals indicated that the difference between the amounts of PB2–HA/627Lys proteins and their PB2–HA/627Glu counterparts was about 4-fold (data not shown). Single amino acid substitutions have been found to increase protein stability (Strub et al., 2004) or mRNA steadystate levels (Hansman et al., 2005) of cellular or viral proteins. However, the significance of our observation on PB2–HA remains unclear, all the more so as it was no longer observed when the experiment was repeated in the absence of vRNA (see below, and Fig. 7). The levels of co-immunoprecipitated PB1 and PA proteins essentially followed the same pattern as the levels of PB2–HA, indicating that the trimeric complex was assembled with similar efficiencies in all samples (Fig. 6, IP, PB1 and PA lanes). In contrast, striking differences were observed when the association of NP protein with the polymerase complex was examined. Co-immunoprecipitated NP could easily be detected in the P908 and HK156 samples, whereas no NP co-immunoprecipitating with the MZ237–PB2–

Assembly of RNPs derived from primary human or avian influenza A isolates in 293T cells We examined whether the lower activity of the RNPs derived from MZ237 as compared to P908 and HK156 in 293T cells was linked to a defect in assembly. To this end, we expressed polymerase complexes tagged with the “HA” peptide at the Cterminal end of the PB2 subunit (PB2–HA). In the transcription/ replication assay described above, MZ237, P908 and HK156 RNPs reconstituted in the presence of PB2–HA in 293T cells at 37 or 33 °C generated CAT profiles very similar to those observed with their untagged counterparts (data not shown). This indicated that the presence of the HA tag did not interfere with the transcription/replication activity of the complex as measured in our assay, and was in agreement with our previous finding that a recombinant influenza A virus expressing a PB2 protein fused at its C-terminus with a Flag peptide replicated as well as the wild-type virus (Dos Santos Afonso et al., 2005). For co-immunoprecipitation analysis, total cell lysates were prepared from transfected 293T cells as described under Materials and methods, and incubated with an antibody specific for the HA tag. Immunoprecipitated proteins were analyzed by Western blotting, using antibodies directed against the PB2–

Fig. 7. Effect of the Glu/Lys substitution at PB2 residue 627 on polymerase–NP and PB2–NP interactions in 293T cells, in the absence of co-expressed viral-like RNA. 293T cells were cotransfected with pHMG plasmids encoding the PB1, PB2, PB2–HA (with Glu or Lys at residue 627), PA, and NP proteins (A) or with pHMG plasmids encoding the PB2 or PB2–HA (with Glu or Lys at residue 627), and NP proteins (B) derived from the P908, HK156 or MZ237 viruses, as indicated. After 48 h of incubation at 37 °C, immunoprecipitation assays were performed on total cell extracts prepared from transfected cells, using a monoclonal anti-HA antibody as described under Materials and methods. Immunoprecipitates were analysed by western blotting using anti-PB2, -PB1, -PA or -NP antibodies, as indicated.

K. Labadie et al. / Virology 362 (2007) 271–282

HA/627Glu protein could be detected (Fig. 6, IP, NP lanes). Some co-immunoprecipitated NP protein was detected in the MZ237–PB2–HA/627Lys sample, although the NP/PB1 ratio seemed lower as compared with HK156 or P908 samples. In control experiments performed in the presence of untagged PB2 proteins, no signals were observed with any of the antibodies mentioned above (data not shown). The experiment was repeated in the absence of reporter vRNA. Co-immunoprecipitation of PB1 and PA with PB2 was readily observed in all samples (Fig. 7A, PB2, PB1 and PA lanes). However, co-immunoprecipitation of NP with PB2 remained undetectable until the number of transfected cells was scaled up. Indeed, for a given complex, the NP/PB2 or NP/PB1 ratios were much lower in the absence of reporter vRNA than in its presence (Fig. 7A, PB2, PB1 and NP lanes, compare samples #2 and #6). This difference suggested that the polymerase–NP interactions detected in our initial experiment (Fig. 6) were mostly RNA-mediated, although benzonase nuclease had been used in the lysis buffer. The NP signals obtained when coimmunoprecipitation was performed in the absence of reporter vRNA were low but clearly above background when the P908–, HK156– and MZ237–PB2–HA/627Lys proteins were expressed. They were lower with the 627Glu counterparts, and almost undetectable with MZ237–PB2–HA/627Glu in particular (Fig. 7A, NP lane). We then asked whether the differences in polymerase–NP interactions corresponded to differences in direct PB2–NP interactions. The various PB2– HA and NP proteins were co-expressed in 293T cells and coimmunoprecipitation followed by western blot analysis was performed as previously. When an untagged PB2 protein was expressed as a control, a low signal was observed with the antiNP antibody (Fig. 7B, lane NP, far right sample). This background due to non-specific binding of the NP protein to the anti-HA antibody–protein A/G–sepharose complex probably became more apparent in this experiment as the result of a higher efficiency of transfection when two plasmids were used instead of four or five. Whatever the tagged–PB2 protein expressed, the signal corresponding to co-immunoprecipitated NP was clearly above background (Fig. 7B, NP lane). Remarkably, the NP/PB2 ratio was the lowest with MZ237– PB2–HA/627Glu, and the NP/PB2 ratios were higher with the PB2–HA/627Lys proteins as compared to their PB2–HA/ 627Glu counterparts. Finally, we monitored the assembly of RNPs in avian cells. Despite numerous efforts, we could not achieve transfection of DF1 cells with enough efficiency. Our best results were obtained with QT6 cells, upon optimization of the transfection protocol as described in Materials and methods. When the PB2– HA, PB1, PA and NP proteins derived from the P908, HK156, and MZ237 viruses were co-expressed in QT6 cells together with a reporter vRNA, the levels of immunoprecipitated PB2 and co-immunoprecipitated PB1 and PA proteins followed the same pattern, suggesting that the trimeric complexes were assembled with similar efficiencies in all cases (Fig. 8, PB2, PB1 and PA lanes). The levels of NP protein co-immunoprecipitating with the MZ237–PB2–HA/627Glu or MZ237–PB2– HA/627Lys proteins were similar (Fig. 8, NP lane), unlike in

277

Fig. 8. Effect of the Glu/Lys substitution at PB2 residue 627 on polymerase–NP interactions in QT6 cells, in the presence of co-expressed viral-like RNA. QT6 cells were cotransfected with plasmid pPRC425–FluA–CAT together with the pHMG plasmids encoding the PB1, PB2–HA (with Glu or Lys at residue 627), PA, and NP proteins derived from the P908, HK156 or MZ237 viruses, as indicated. After 72 h of incubation at 37 °C, immunoprecipitation assays were performed on total cell extracts prepared from transfected cells, using a monoclonal anti-HA antibody as described under Materials and methods. Immunoprecipitates were analysed by Western blotting using anti-PB2, -PB1, -PA or -NP antibodies, as indicated. The range of CAT levels measured in a fraction of the transfected cells is indicated (+: 1–3 × 103 ng/ml).

293T cells (Fig. 6, NP lane). The NP signals (presumably reflecting RNA-mediated polymerase–NP interactions) were in the same range for all viruses (Fig. 8, NP lane), as were the CAT levels measured in the corresponding cell extracts. When the PB2–HA and NP proteins derived from the P908, HK156, and MZ237 viruses were co-expressed in QT6 cells in the absence of PB1 and PA, the levels of NP co-immunoprecipitating with PB2 were below the background (data not shown), most probably due to limiting transfection efficiency. Discussion Our recent identification and cloning of the chicken RNA PolI promoter (Massin et al., 2005) allowed us to generate plasmids which drive the synthesis of influenza-like reporter RNAs upon transfection in avian cells, whereas the human RNA PolI promoter-based plasmids initially described by Pleschka et al. (1996) are functional in primate cells only. The availability of both types of reporter plasmids prompted us to perform a comparative analysis, in primate (293T, COS-1) versus avian (DF1, QT6) cells, of the transcription/replication of influenza-like RNAs with different extremities, in the presence of core proteins of human or avian origin, harboring a Glu or Lys at residue 627 of PB2, and at 37 or 33 °C. In 293T as well as in COS-1 cells, we observed that the polymerase complex derived from the avian MZ237 isolate ensured transcription/replication of influenza-like RNAs with a significantly lower efficiency as compared to the complex derived from the human P908 isolate and exhibited coldsensitivity, which was determined mostly by residue 627 of PB2. These results were in agreement with and extended our previous observations made on polymerase complexes derived from laboratory viral strains, in COS-1 cells (Massin et al., 2001; Naffakh et al., 2000). In contrast, in DF1 or QT6 cells, the MZ237 and P908 complexes ensured transcription/replication of influenza-like RNAs with similar efficiencies. Low

278

K. Labadie et al. / Virology 362 (2007) 271–282

temperature, or amino acid substitution at residue 627 of PB2 (Glu/Lys) had little effect on transcription/replication activity in avian cells. Using reporter RNAs with non-coding 3′ and 5′ extremities derived from an NS, H1, H3, H5 or H7 segment led to the same observations, which indicated that the variability in length and sequence of these non-coding regions had no effect in our assay. On the whole, our results clearly indicated that the presence of a Glu/Lys at residue 627 of PB2 could be more or less critical for transcription/replication, depending on both the viral genetic context (as an effect was observed for RNPs derived from an avian virus, but not from a human virus) and the cellular context (as an effect was observed for RNPs derived from an avian virus when reconstituted in a mammalian cell, but not in an avian cell). Our data showing an influence of the cellular context on the effects of PB2 residue 627 are in agreement with the report by Shinya et al. that Hong Kong H5N1 viruses differing in PB2 residue 627 had different growth kinetics in mouse cells, but not in avian cells (Shinya et al., 2004). Our observations also suggest that the effect of the Glu/Lys substitution is mediated through interactions of the viral RNP with host proteins that still need to be identified. The cellular RNA polymerase II, shown recently to be associated with the polymerase complex of influenza A viruses (Engelhardt et al., 2005), is an attractive candidate. However, preliminary co-immunoprecipitation experiments revealed no significant differences in the amounts of human RNA polymerase II associated with wild-type (PB2/ 627Glu) or mutant (PB2/627Lys) MZ237–RNPs upon reconstitution in 293T cells (data not shown). Influence of the viral genetic context in modulating the effects of PB2 residue 627 was underlined by our observations on RNPs derived from the HK156 virus. Indeed, changing PB2 residue 627 from a Glu to a Lys did not increase the transcription/replication activity of HK156–RNPs as it did for MZ237–RNPs when reconstituted in 293T or COS-1 cells. Unlike MZ237–RNPs and more like P908–RNPs, wild-type HK156–RNPs with a Glu at PB2 residue 627 were characterized by high levels of transcription/replication at 33 °C as well as 37 °C in the mammalian cells. During the H5N1 outbreak in Hong Kong in 1997, 16 viruses were isolated from the 18 infected humans, 15 of which were inoculated in mice and produced clear differences in pathogenicity (Katz et al., 2000). The presence of a Glu or a Lys at PB2 residue 627 did not strictly correlate with the severity of disease in humans or virulence in animal models, as a number of 1997 H5N1 viruses with a Glu at PB2 residue 627 (including the HK156 virus) were lethal for mice (Gao et al., 1999; Katz et al., 2000) or ferrets (Govorkova et al., 2005; Zitzow et al., 2002). Although the PB2 627 Glu to Lys substitution was identified as a molecular determinant of virulence in mice with the A/HK/483/97–A/HK/ 486/97 pair of viruses (Hatta et al., 2001), it was found to have only a modest effect on the virulence in mice of H5N1 viruses isolated in Vietnam in 2004 (Maines et al., 2005). This indicates that the ability of PB2 residue 627 to modulate the virulence of a given H5N1 virus was dependent on additional amino acid sequence(s). On another hand, Yao et al. found that the region encoding amino acids 362 to 581 of PB2 determined the ability

of the A/FPV/Dobson–4H/27 avian strain to replicate in mouse cells despite the presence of a Glu at residue 627 of PB2 (Yao et al., 2001), and Li et al. showed that a substitution at PB2 residue 701 had a dramatic effect on the pathogenicity of a duck H5N1 influenza virus in mice (Li et al., 2005). We observed that molecular determinants in both the PB2 and PA proteins of the reconstituted HK156–RNPs compensated for the presence of a Glu at PB2 residue 627, and contributed synergistically to the high levels of transcription/replication activity of the HK156– RNPs in 293T cells as compared to MZ237–RNPs. To our knowledge, PA has not been clearly implicated in host-range restriction so far. However, our findings are in agreement with genetic studies indicating functional cooperativity of PB2 and PA (Treanor et al., 1994) and coevolution of the three subunits of the polymerase complex (Obenauer et al., 2006). Together with classical reassortant studies (Clements et al., 1992; Snyder et al., 1987; Tian et al., 1985), our observations point to the fact that multiple combinations of genetic features involving several genomic segments can determine pathogenicity in mammals. Identification of the molecular correlates of replication efficiency and virulence in mammals, is essential in order to predict the pandemic potential of newly emerging influenza viruses. In addition to viral sequence analysis, the identification of phenotypic features predictive of an increased potential of multiplication in mammals would help achieving an effective surveillance of the zoonotic potential of avian influenza A viruses. We have shown previously that human viruses replicated equally well in MDCK cells at 33 °C (the estimated temperature of the upper respiratory tract of humans) as compared to 37 °C, whereas avian viruses replicated less efficiently at 33 °C (Massin et al., 2001). Here we show that plaque formation on MDCK cells and transcription/replication activity of the polymerase complex reconstituted in 293T cells are much more efficient at 33 °C for the HK156 virus as compared to the avian MZ237 virus. We suggest that additional studies including H5, H9, H7 and H10 viruses isolated recently in humans together with unrelated avian isolates should be undertaken, in order to determine whether reduced coldsensitivity of viral replication in cultured mammalian cells could be considered as a phenotypic signature for an increased potential of multiplication in mammals, and therefore be included in a surveillance scheme. We asked whether the lower activity of the RNPs derived from MZ237 as compared to P908 and HK156 viruses in 293T cells was related to a defect in assembly. Using co-immunoprecipitation experiments, we observed that the PB2:PB1:PA ratios were similar for all RNPs, and were not modified by a Glu/Lys substitution at PB2 amino acid 627. But strikingly, the levels of NP protein associated with the polymerase complex were lower for MZ237 than for P908 and HK156. Similarly, when direct PB2–NP interactions were assayed, they appeared lower for MZ237 than for P908 and HK156. The Glu/Lys substitution at PB2 amino acid 627 enhanced binding of NP both to the polymerase complex and to the PB2 protein when co-expressed alone. Overall, our data strongly suggested that the efficiency with which a given RNP ensured transcription/ replication of the viral-like RNA in 293T cells was related to the

K. Labadie et al. / Virology 362 (2007) 271–282

efficiency of NP binding to the PB1–PB2–PA complex. Coimmunoprecipitation experiments performed in avian cells in order to strengthen this hypothesis strongly suggested that the MZ237, HK156 and P908 PB1–PB2–PA complexes were assembled with similar efficiencies in QT6 cells, but did not allow to monitor PB2–NP interactions because of a limiting efficiency of transfection. Beyond its structural role for encapsidation of the viral RNAs, the NP protein has been assigned a major role in the switch from mRNA transcription to genome replication, based on biochemical (Shapiro and Krug, 1988) and genetic studies (Medcalf et al., 1999; Mena et al., 1999). Several modes of action have been proposed, including: 1) a “template modification” model where the interaction of soluble NP with the template RNA alters its structure and therefore the modes of transcription initiation and termination; 2) a “stabilization” model where cRNAs are degraded by nucleases early in infection and protected by the NP later in infection (Vreede et al., 2004); and 3) a “polymerase modification” model where NP alters the transcriptional function of the polymerase complex through direct protein–protein interactions. Supporting the “polymerase modification” model, there is biochemical evidence for PB2–NP and PB1–NP binding (Biswas et al., 1998; Poole et al., 2004), as well as genetic evidence for PB2–NP interaction (Mandler et al., 1991; Naffakh et al., 2000). Based on the observation of a physical and functional overlap of NPand PB1-binding sites on PB2, Poole et al. suggested that PB2– NP interactions could promote conversion of a transcriptase to a replicase complex by modifying the PB2–PB1 contacts. Noticeably, one of the domains of PB2 identified as binding PB1 and NP includes PB2 residue 627 (Poole et al., 2004). Here we show that both transcription/replication activity of the RNP and binding of the NP to the PB2 protein of an avian virus are defective in human cells, and controlled by PB2 residue 627. Documenting further the effect (or absence of effect) of a Glu to Lys substitution at PB2 residue 627 on PB2–NP interactions in avian cells, will help establishing a link between the roles of PB2 residue 627 in host-range restriction and in controlling the binding of the NP to the polymerase complex. It might be that interaction of PB2 with an as-yet unknown cellular protein (X) stabilizes the PB2–NP interaction thus promoting viral replication, and that the PB2–X interaction is impaired in human cells when PB2 is of avian origin and residue 627 is a Glu. While our data suggest that PB2 residue 627 might play a pivotal role in a complex network of molecular interactions involving both viral and cellular proteins, the exact nature of these interactions and whether or not they are related to the coldsensitivity of the replication of avian viruses remains to be determined. Materials and methods Viruses and cells 293T, COS-1 and DF1 cells were grown in DMEM supplemented with 10% fetal calf serum (FCS). QT6 cells

279

were grown in HAM-F10 medium supplemented with 10% FCS, 1% chicken serum and 5% tryptose phosphate broth. MDCK cells were grown in MEM supplemented with 5% FCS. Influenza viruses A/Paris/908/97 (P908, H3N2) and A/ Mallard/Marquenterre/MZ237/83 virus (MZ237, H1N1) were isolated by the National Influenza Center (Northern France) at the Pasteur Institute in Paris (France). Influenza virus A/ Hong Kong/156/97 (HK156, H5N1) was kindly provided by Dr. Alan Hay (NIMR, London, UK). Viruses P908 and MZ237 were propagated in MDCK cells and embryonated hen eggs, respectively. The HK156 virus was grown on MDCK cells in a BSL-3+ facility approved for studies of infectious H5N1 influenza viruses. Viruses were titrated in a standard plaque assay using an agarose overlay in complete MEM containing TPCK-trypsin at a final concentration of 1 μg/ml. Plasmids for the expression of viral proteins Plasmids pHMG–PB1, –PB2, –PA, and –NP, encoding the PB1, PB2, PA and NP proteins of influenza viruses P908, HK156 and A/FPV/Rostock/34 (FPV, H7N1) have been described earlier (Crescenzo-Chaigne et al., 2002; Naffakh et al., 2000). Viral genomic RNA was prepared from virus MZ237, and the cDNAs encoding PB1, PB2, PA and NP proteins were amplified by RT–PCR and cloned into the pHMG plasmid as described previously (Naffakh et al., 2000). The corresponding sequences are available in GenBank under accession numbers DQ864506–DQ864509. Plasmids containing the PB1, PB2, PA and NP genes of the A/Puerto Rico/8/34 vaccine strain (PR8–NIBSC, H1N1) were kindly provided by Dr. R.A.M. Fouchier (Erasmus MC, Netherlands). The PB1, PB2, PA and NP coding sequences were amplified by PCR and subcloned into the pHMG plasmid. In order to insert the sequence encoding the HA tag (YPYDVPDYA) downstream of the PB2 open reading frame into pHMG–PB2 plasmids, PCR reactions were performed using pHMG–P908–PB2, –HK156–PB2 or MZ237–PB2 as templates and primers specific for the coding sequence of PB2, one of which contained additional nucleotides encoding the HA tag (sequences of the primers can be obtained upon request). The resulting amplicons were cloned between the HpaI and KpnI sites in plasmid pHMG–P908–PB2, the two KpnI sites in pHMG–MZ237–PB2, and the BstXI and KpnI sites in pHMG–HK156–PB2, respectively. The pHMG plasmid encoding P908–PB2 with a K627E mutation has been described earlier (Crescenzo-Chaigne et al., 2002). The pHMG plasmid encoding MZ237–PB2 and HK156–PB2 proteins with a E627K mutation were generated using the same PCR-based mutagenesis method. Appropriate restriction sites in the PB2 gene were used to transfer the E627K or K627E mutation into the wild type PB2–HA cloned sequences. All positive clones were sequenced using a Big Dye terminator sequencing kit and an automated sequencer (Perkin Elmer).

280

K. Labadie et al. / Virology 362 (2007) 271–282

Plasmids for the expression of viral-like RNAs Plasmids pPR–FluA–CAT and pPRC425–FluA–CAT, which direct the expression of an influenza viral-like RNA under the control of a truncated human (250 nucleotides) or chicken (425 nucleotides) RNA PolI promoter, respectively, have been described earlier (Massin et al., 2005). They contain the antisense CAT coding sequence flanked by the 5′ and 3′ extremities of the NS segment of influenza virus A/WSN/33, inserted at the BbsI sites of plasmids pPR (Crescenzo-Chaigne et al., 1999) and pPRC425 (similar to pPR except for the fact that it contains a chicken RNA PolI promoter sequence in place of the human RNA PolI promoter sequence), respectively. In order to generate pPR- or pPRC425-based plasmids for expression of influenza viral-like RNAs derived from H1, H3, H5 and H7 segments, the CAT gene was amplified by PCR using primers that allowed the reconstitution of the 5′ and 3′ non-coding regions of the HA segment on each side of the CAT sequence (sequence of the primers can be obtained upon request). The amplified products were cloned between the two BbsI sites of plasmid pPR and pPRC425, respectively. All positive clones were sequenced using a Big Dye terminator sequencing kit and an automated sequencer (Perkin Elmer).

Qiashredder columns (QIAGEN). Cell lysates were incubated on a wheel for 1 h at 4 °C and then centrifuged at 16,000×g for 20 min. A fraction was removed for western blot analysis. Meanwhile, immunomagnetic Dynabeads protein A and G (25 μL of each, Invitrogen) were mixed with 1 μg of an anti-HA rat antibody (Roche). After 2 h of incubation at 4 °C, the beads were added to the cell lysates and incubated for 2–20 additional hours on a wheel at 4 °C. The beads were washed four times in 50 mM Tris–HCl [pH 8], 150 mM NaCl, 2 mM MgCl2 and 0.3% NP40. Immunoprecipitated proteins were eluted in 50 μL of Laemmli buffer preheated at 100 °C, and analyzed by electrophoresis in SDS–polyacrylamide gels and western blotting using PVDF membranes. The membranes were incubated overnight at 4 °C with a mouse monoclonal antiHA antibody (Covance, diluted 1:1000) or with rabbit polyclonal antibodies directed against PB1, PB2, PA (kindly provided by J. Ortin, Centro Nacional de Biotecnologia, Madrid, Spain, diluted 1:5000) or against influenza A/PR/8/34 virus (Vignuzzi et al., 2001; diluted 1:10,000 for NP detection) in PBS with 1% BSA, 0.25% Tween 20, then incubated for 1 h at room temperature with peroxidase-conjugated secondary antibodies and finally incubated with the ECL+ substrate (GE Healthcare). Membranes were scanned for chemiluminescence using a G-Box (Stratagene).

Transfections and CAT assays

Acknowledgments

Subconfluent monolayers of 293T or DF1 cells in 12-well plates were transfected using the FUGENE 6 reagent (Roche) according to the manufacturer instructions. Briefly, mixes of pHMG–PB1, –PB2, –PA, –NP (0.5, 0.5, 0.5, 1 μg) and a pPRor pPRC425-derived plasmid (0. 5 μg) were resuspended in 45 μL of OPTI-MEM medium (Invitrogen) with 5 μL of FUGENE 6 and were distributed onto cells. Following 24, 48 or 72 h of incubation at 33 or 37 °C, cell extracts were prepared in 250 μL of the lysis buffer provided with the CAT ELISA kit (Roche), and tested for CAT levels. This procedure allows detection of 0.05 ng/mL CAT.

We are grateful to Dr. Alan Hay for providing the influenza A/Hong Kong/156/97 isolate, to J. Ortin (Centro Nacional de Biotecnologia, Madrid, Spain) for providing polyclonal antibodies specific for PB1, PB2, and PA, to R.A.M Fouchier (Erasmus MC, Rotterdam, The Netherlands) for providing A/ PR/8/34 (NIBSC strain)-derived plasmids, and to J. Pavlovic (Institut für Medizinishe Virologie, Zurich, Switzerland) for providing the pHMG plasmid. We thank Pascale Massin for her contribution to the cloning of MZ237 cDNAs, Cyril Barbezange for his contribution to the plaque assays, and Nicolas Escriou for helpful discussions. The technical assistance of Monica Maracescu is gratefully acknowledged. This work was supported in part by the NOVAFLU 2001 (QLRT-2001-01034) program. K.L. and M.A.R.W. were supported by a fellowship from the Institut Pasteur. E.D.S. was supported by a fellowship from the Ministère de la Recherche et de la Technologie.

Immunoprecipitation assays Subconfluent monolayers of 293T (8 × 105) or QT6 (3 × 105) cells in 6-well plates were transfected with the indicated mixtures of the pPR–FluA–CAT or pPRC425–FluA–CAT (1 μg) and pHMG–PB1, –PB2 or –PB2–HA, –PA, –NP (1; 1; 1; 2 μg) plasmids, using the FUGENE 6 (Roche) and GeneJuice (Novagen) reagents, respectively. At 48 h (293T) or 72 h (QT6) post-transfection, a fraction of the cells was used when appropriate for CAT assay as described above, and the remaining cells were used for the immunoprecipitation assay. Cells were washed with PBS and then resuspended in 200 μL of lysis buffer containing 50 mM Tris–HCl [pH 8], 300 mM NaCl, 2 mM MgCl2, 0.3% NP40, 1 mM DTT, 10% glycerol, protease inhibitors (Protease Inhibitor Cocktail 1X, Sigma) and 75 U of benzonase nuclease (Novagen). When direct PB2–NP interactions were assayed, a 120 mM concentration of NaCl was used and cell extracts were centrifuged (2 min at 15,000×g) through

References Biswas, S.K., Boutz, P.L., Nayak, D.P., 1998. Influenza virus nucleoprotein interacts with influenza virus polymerase proteins. J. Virol. 72 (7), 5493–5501. Clements, M.L., Subbarao, E.K., Fries, L.F., Karron, R.A., London, W.T., Murphy, B.R., 1992. Use of single-gene reassortant viruses to study the role of avian influenza A virus genes in attenuation of wild-type human influenza A virus for squirrel monkeys and adult human volunteers. J. Clin. Microbiol. 30 (3), 655–662. Crescenzo-Chaigne, B., Naffakh, N., van der Werf, S., 1999. Comparative analysis of the ability of the polymerase complexes of influenza viruses type A, B and C to assemble into functional RNPs that allow expression and replication of heterotypic model RNA templates in vivo. Virology 265 (2), 342–353.

K. Labadie et al. / Virology 362 (2007) 271–282 Crescenzo-Chaigne, B., van der Werf, S., Naffakh, N., 2002. Differential effect of nucleotide substitutions in the 3′ arm of the influenza A virus vRNA promoter on transcription/replication by avian and human polymerase complexes is related to the nature of PB2 amino acid 627. Virology 303 (2), 240–252. Dos Santos Afonso, E., Escriou, N., Leclercq, I., van der Werf, S., Naffakh, N., 2005. The generation of recombinant influenza A viruses expressing a PB2 fusion protein requires the conservation of a packaging signal overlapping the coding and noncoding regions at the 5′ end of the PB2 segment. Virology 341 (1), 34–46. Engelhardt, O.G., Smith, M., Fodor, E., 2005. Association of the influenza A virus RNA-dependent RNA polymerase with cellular RNA polymerase II. J. Virol. 79 (9), 5812–5818. Fouchier, R.A., Schneeberger, P.M., Rozendaal, F.W., Broekman, J.M., Kemink, S.A., Munster, V., Kuiken, T., Rimmelzwaan, G.F., Schutten, M., Van Doornum, G.J., Koch, G., Bosman, A., Koopmans, M., Osterhaus, A.D., 2004. Avian influenza A virus (H7N7) associated with human conjunctivitis and a fatal case of acute respiratory distress syndrome. Proc. Natl. Acad. Sci. U. S. A. 101 (5), 1356–1361. Gambaryan, A., Tuzikov, A., Pazynina, G., Bovin, N., Balish, A., Klimov, A., 2006. Evolution of the receptor binding phenotype of influenza A (H5) viruses. Virology 344 (2), 432–438. Gao, P., Watanabe, S., Ito, T., Goto, H., Wells, K., McGregor, M., Cooley, A.J., Kawaoka, Y., 1999. Biological heterogeneity, including systemic replication in mice, of H5N1 influenza A virus isolates from humans in Hong Kong. J. Virol. 73 (4), 3184–3189. Govorkova, E.A., Rehg, J.E., Krauss, S., Yen, H.L., Guan, Y., Peiris, M., Nguyen, T.D., Hanh, T.H., Puthavathana, P., Long, H.T., Buranathai, C., Lim, W., Webster, R.G., Hoffmann, E., 2005. Lethality to ferrets of H5N1 influenza viruses isolated from humans and poultry in 2004. J. Virol. 79 (4), 2191–2198. Hansman, G.S., Katayama, K., Oka, T., Natori, K., Takeda, N., 2005. Mutational study of sapovirus expression in insect cells. Virol. J. 2, 13. Hatta, M., Gao, P., Halfmann, P., Kawaoka, Y., 2001. Molecular basis for high virulence of Hong Kong H5N1 influenza A viruses. Science 293 (5536), 1840–1842. Katz, J.M., Lu, X., Tumpey, T.M., Smith, C.B., Shaw, M.W., Subbarao, K., 2000. Molecular correlates of influenza A H5N1 virus pathogenesis in mice. J. Virol. 74 (22), 10807–10810. Li, Z., Chen, H., Jiao, P., Deng, G., Tian, G., Li, Y., Hoffmann, E., Webster, R.G., Matsuoka, Y., Yu, K., 2005. Molecular basis of replication of duck H5N1 influenza viruses in a mammalian mouse model. J. Virol. 79 (18), 12058–12064. Maines, T.R., Lu, X.H., Erb, S.M., Edwards, L., Guarner, J., Greer, P.W., Nguyen, D.C., Szretter, K.J., Chen, L.M., Thawatsupha, P., Chittaganpitch, M., Waicharoen, S., Nguyen, D.T., Nguyen, T., Nguyen, H.H., Kim, J.H., Hoang, L.T., Kang, C., Phuong, L.S., Lim, W., Zaki, S., Donis, R.O., Cox, N.J., Katz, J.M., Tumpey, T.M., 2005. Avian influenza (H5N1) viruses isolated from humans in Asia in 2004 exhibit increased virulence in mammals. J. Virol. 79 (18), 11788–117800. Mandler, J., Muller, K., Scholtissek, C., 1991. Mutants and revertants of an avian influenza A virus with temperature-sensitive defects in the nucleoprotein and PB2. Virology 181 (2), 512–519. Massin, P., van der Werf, S., Naffakh, N., 2001. Residue 627 of PB2 is a determinant of cold sensitivity in RNA replication of avian influenza viruses. J. Virol. 75 (11), 5398–5404. Massin, P., Rodrigues, P., Marasescu, M., van der Werf, S., Naffakh, N., 2005. Cloning of the chicken RNA polymerase I promoter and use for reverse genetics of influenza A viruses in avian cells. J. Virol. 79 (21), 13811–13816. Medcalf, L., Poole, E., Elton, D., Digard, P., 1999. Temperature-sensitive lesions in two influenza A viruses defective for replicative transcription disrupt RNA binding by the nucleoprotein. J. Virol. 73 (9), 7349–7356. Mena, I., Jambrina, E., Albo, C., Perales, B., Ortin, J., Arrese, M., Vallejo, D., Portela, A., 1999. Mutational analysis of influenza A virus nucleoprotein: identification of mutations that affect RNA replication. J. Virol. 73 (2), 1186–1194. Naffakh, N., Massin, P., Escriou, N., Crescenzo-Chaigne, B., van der Werf, S.,

281

2000. Genetic analysis of the compatibility between polymerase proteins from human and avian strains of influenza A viruses. J. Gen. Virol. 81 (Pt. 5), 1283–1291. Obenauer, J.C., Denson, J., Mehta, P.K., Su, X., Mukatira, S., Finkelstein, D.B., Xu, X., Wang, J., Ma, J., Fan, Y., Rakestraw, K.M., Webster, R.G., Hoffmann, E., Krauss, S., Zheng, J., Zhang, Z., Naeve, C.W., 2006. Largescale sequence analysis of avian influenza isolates. Science 311 (5767), 1576–1580. Palese, P., Tumpey, T.M., Garcia-Sastre, A., 2006. What can we learn from reconstructing the extinct 1918 pandemic influenza virus? Immunity 24 (2), 121–124. Pleschka, S., Jaskunas, R., Engelhardt, O.G., Zurcher, T., Palese, P., GarciaSastre, A., 1996. A plasmid-based reverse genetics system for influenza A virus. J. Virol. 70 (6), 4188–4192. Poole, E., Elton, D., Medcalf, L., Digard, P., 2004. Functional domains of the influenza A virus PB2 protein: identification of NP- and PB1-binding sites. Virology 321 (1), 120–133. Reid, A.H., Taubenberger, J.K., Fanning, T.G., 2004. Evidence of an absence: the genetic origins of the 1918 pandemic influenza virus. Nat. Rev., Microbiol. 2 (11), 909–914. Rogers, G.N., Paulson, J.C., 1983. Receptor determinants of human and animal influenza virus isolates: differences in receptor specificity of the H3 hemagglutinin based on species of origin. Virology 127 (2), 361–373. Salomon, R., Franks, J., Govorkova, E.A., Ilyushina, N.A., Yen, H.L., Hulse-Post, D.J., Humberd, J., Trichet, M., Rehg, J.E., Webby, R.J., Webster, R.G., Hoffmann, E., 2006. The polymerase complex genes contribute to the high virulence of the human H5N1 influenza virus isolate A/Vietnam/1203/04. J. Exp. Med. 203 (3), 689–697. Shapiro, G.I., Krug, R.M., 1988. Influenza virus RNA replication in vitro: synthesis of viral template RNAs and virion RNAs in the absence of an added primer. J. Virol. 62 (7), 2285–2290. Shinya, K., Hamm, S., Hatta, M., Ito, H., Ito, T., Kawaoka, Y., 2004. PB2 amino acid at position 627 affects replicative efficiency, but not cell tropism, of Hong Kong H5N1 influenza A viruses in mice. Virology 320 (2), 258–266. Shinya, K., Ebina, M., Yamada, S., Ono, M., Kasai, N., Kawaoka, Y., 2006. Avian flu: influenza virus receptors in the human airway. Nature 440 (7083), 435–436. Smith, G.J., Naipospos, T.S., Nguyen, T.D., de Jong, M.D., Vijaykrishna, D., Usman, T.B., Hassan, S.S., Nguyen, T.V., Dao, T.V., Bui, N.A., Leung, Y.H., Cheung, C.L., Rayner, J.M., Zhang, J.X., Zhang, L.J., Poon, L.L., Li, K.S., Nguyen, V.C., Hien, T.T., Farrar, J., Webster, R.G., Chen, H., Peiris, J.S., Guan, Y., 2006. Evolution and adaptation of H5N1 influenza virus in avian and human hosts in Indonesia and Vietnam. Virology 350 (2), 258–268. Snyder, M.H., Buckler-White, A.J., London, W.T., Tierney, E.L., Murphy, B.R., 1987. The avian influenza virus nucleoprotein gene and a specific constellation of avian and human virus polymerase genes each specify attenuation of avian–human influenza A/Pintail/79 reassortant viruses for monkeys. J. Virol. 61 (9), 2857–2863. Stevens, J., Blixt, O., Tumpey, T.M., Taubenberger, J.K., Paulson, J.C., Wilson, I.A., 2006. Structure and receptor specificity of the hemagglutinin from an H5N1 influenza virus. Science 312 (5772), 404–410. Strub, C., Alies, C., Lougarre, A., Ladurantie, C., Czaplicki, J., Fournier, D., 2004. Mutation of exposed hydrophobic amino acids to arginine to increase protein stability. BMC Biochem. 5, 9. Subbarao, E.K., London, W., Murphy, B.R., 1993. A single amino acid in the PB2 gene of influenza A virus is a determinant of host range. J. Virol. 67 (4), 1761–1764. Suzuki, Y., Ito, T., Suzuki, T., Holland Jr., R.E., Chambers, T.M., Kiso, M., Ishida, H., Kawaoka, Y., 2000. Sialic acid species as a determinant of the host range of influenza A viruses. J. Virol. 74 (24), 11825–11831. Taubenberger, J.K., Reid, A.H., Lourens, R.M., Wang, R., Jin, G., Fanning, T.G., 2005. Characterization of the 1918 influenza virus polymerase genes. Nature 437 (7060), 889–893. Tian, S.F., Buckler-White, A.J., London, W.T., Reck, L.J., Chanock, R.M., Murphy, B.R., 1985. Nucleoprotein and membrane protein genes are associated with restriction of replication of influenza A/Mallard/NY/78 virus

282

K. Labadie et al. / Virology 362 (2007) 271–282

and its reassortants in squirrel monkey respiratory tract. J. Virol. 53 (3), 771–775. Treanor, J., Perkins, M., Battaglia, R., Murphy, B.R., 1994. Evaluation of the genetic stability of the temperature-sensitive PB2 gene mutation of the influenza A/Ann Arbor/6/60 cold-adapted vaccine virus. J. Virol. 68 (12), 7684–7688. van Riel, D., Munster, V.J., de Wit, E., Rimmelzwaan, G.F., Fouchier, R.A., Osterhaus, A.D., Kuiken, T., 2006. H5N1 virus attachment to lower respiratory tract. Science 312 (5772), 399. Vignuzzi, M., Gerbaud, S., van der Werf, S., Escriou, N., 2001. Naked RNA immunization with replicons derived from poliovirus and Semliki Forest virus genomes for the generation of a cytotoxic T cell response against the influenza A virus nucleoprotein. J. Gen. Virol. 82 (Pt. 7), 1737–1747.

Vreede, F.T., Jung, T.E., Brownlee, G.G., 2004. Model suggesting that replication of influenza virus is regulated by stabilization of replicative intermediates. J. Virol. 78 (17), 9568–9572. Webster, R.G., Bean, W.J., Gorman, O.T., Chambers, T.M., Kawaoka, Y., 1992. Evolution and ecology of influenza A viruses. Microbiol. Rev. 56 (1), 152–179. Yao, Y., Mingay, L.J., McCauley, J.W., Barclay, W.S., 2001. Sequences in influenza A virus PB2 protein that determine productive infection for an avian influenza virus in mouse and human cell lines. J. Virol. 75 (11), 5410–5415. Zitzow, L.A., Rowe, T., Morken, T., Shieh, W.J., Zaki, S., Katz, J.M., 2002. Pathogenesis of avian influenza A (H5N1) viruses in ferrets. J. Virol. 76 (9), 4420–4429.