HPV prevalence, E6 sequence variation and physical state of HPV16 isolates from patients with cervical cancer in Sichuan, China

Gynecologic Oncology 104 (2007) 77 – 85 www.elsevier.com/locate/ygyno

HPV prevalence, E6 sequence variation and physical state of HPV16 isolates from patients with cervical cancer in Sichuan, China Ai-Dong Qiu a,1 , En-Qi Wu a,1 , Xiang-Hui Yu a , Chun-Lai Jiang a , Ying-Hua Jin a , Yong-Ge Wu a , Yue Chen a , Yan Chen a , Ya-Ming Shan a , Guo-Nan Zhang c , Ying Fan c , Xiao Zha b,⁎, Wei Kong a,⁎ a

College of Life Science, Vaccines Research Center, Jilin University, Changchun 130012, China Department of Molecular Pharmacology, Sichuan Tumor Hospital, Chengdu 610041, China c Department of Gynecol Oncology, Sichuan Tumor Hospital, Chengdu 610041, China

b

Received 22 March 2006 Available online 12 September 2006

Abstract Objectives. Infection with high-risk human papillomavirus (hr-HPV) is an important factor associated with cervical cancer. The genetic mutation of HPV16 E6 and integration of HPV16 DNA in the cervical carcinoma tissues are considered important genetic changes in cervical lesion progression. But the studies of hr-HPV epidemiology are relatively less in the area of Sichuan, China. Therefore, we investigated the prevalence of 9 high-risk subtypes and analyzed the genetic mutation characteristic of HPV16 E6 and physical state of HPV16 DNA. Methods. The fragments of L1 and E6 genes were amplified by PCR or nested PCR and then directly sequenced. Further, the multiplex PCR for HPV16 E2 and E6 genes was performed for detection of integration. Results. HPV16, 58 and 18 were prominent, accounting for 78.6%, 20.0% and 9.7%, respectively in 145 isolates. E6 variants revealed that the European (EP) prototype and East Asia (EA) strain were 26 (23.0%) and 34 (30.1%), respectively. Furthermore, there were 14 base substitutions in E6 regions of the study group, of which 12 resulted in amino acid changes and the rest was silent mutation. Significantly, the 240G substitution exactly located the P53 degradation site. Overall, 8 of 114 (7.0%) isolates only contained integrated HPV16 DNA, 43 (37.7%) only contained episomal DNA and 63 (55.3%) contained both integrated and episomal DNA. The proportion of disruption of an intact E2 gene in the patients with cervical cancer is much lower than that in the previous studies. Conclusions. HPV16, 58 and 18 were mainly prevailing subtypes in patients with cervical cancer from Sichuan areas, China and EP/EA strains were predominant in these areas. Some mutations of E6 gene, which lead to the amino acid changes, may be more potentially carcinogenic and the proportion of disruption of an intact E2 gene is much lower. © 2006 Elsevier Inc. All rights reserved. Keywords: Human papillomavirus; Prevalence; E6 variation; Physical state

Introduction Cervical cancer is the second most common cancer in women worldwide [1]. Human papillomavirus (HPV) DNA is found in the cervical carcinoma tissues of more than 93% of patients, of which HPV16 is the most prevalent subtype causing about 50% of infections [2]. The distributions of HPV genotypes in various areas and populations are different [3]. It has been reported that ⁎ Corresponding authors. W. Kong is to be contacted at fax: +86 431 5195516. E-mail addresses: [email protected] (X. Zha), [email protected] (W. Kong). 1 These two author contributed equally to this paper. 0090-8258/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.ygyno.2006.07.016

the HPV16 positive rate in the patients with cervical cancer in Southern China was about 79.6% [4]. In the Sichuan area of Southwest of China, where the morbidity of invasive cervical cancer was moderately high (approximately 22 per 100,000 women), Xiao et al. (1988) [5] identified HPV DNA in 90% of pathological sections from 29 patients with cervical cancer, and further proved HPV16 in 72% and HPV18 in 48% of the sections. In contrast, Peng et al. (1991) [6] reported a much lower HPV positive rate (35% total positive and 32% HPV16 positive) in their survey of 101 women with cervical cancer. However, up to now, in this area the studies on HPV sequence variations were less reported. But such studies were very important to reveal the potentially substantial infection of HPV DNA, the changes in

78

A.-D. Qiu et al. / Gynecologic Oncology 104 (2007) 77–85

structure and function of HPV protein and the local difference of HPV variants [7]. Infection with high-risk HPV is necessary for the development of a cervical pre-invasive or invasive lesion [8]. However, most HPV infections regress spontaneously and, for the cases that do progress to cancer (< 1%), a long period of latency is normally required. Recently independent studies have provided evidence that the specific intratype HPV genome variation, especially that of HPV16, may influence the persistence of infection and the progression from a precursor lesion to cancer [9,10]. The sequence variation of E6 gene of HPV16 is frequent, some of which are closely associated with high-risk of invasive cancer (IC) compared with others [11]. The mutation of E6 gene might lead to the amino acid change related to the induction of specific immune responses and might provide an important basis for the development of a rational vaccine strategy. Meanwhile, molecular biological studies have proved that HPV DNA is in an episomal state during a common infection or in most premalignant lesions [12], but in an integrated state or in both integrated and episomal states in most cervical carcinomas and the cell lines derived from them [13,14]. The genome integration of HPV usually disrupts the open reading frame (ORF) of E2 gene [15] and results in the lack of E2 gene which leads to the overexpression of E6 and E7 genes [16,17]. It has been known that the E6 ORFs code for a transforming oncoprotein which has been thought to function by deleting or inactivating the P53 tumor suppressor protein [18]. Therefore, the state of this viral gene may be used as an early marker of cervical lesion for the follow-up of patients with chronic infection of HPV16. In this study, we investigated the subtype distribution of HPV DNA in the cervical carcinoma specimens from 158 patients in Sichuan Province, China. In addition, we analyzed the sequence variation of HPV16 E6 gene and identified the most prevalent variants of HPV are EP (European) and EA (East- Asian) strain in the Sichuan areas. In the course of amplification of E2 fragment, we found a much lower proportion of disruption of an

intact E2 gene compared with that reported previously, and evaluated the physical status of HPV16 DNA in cervical cancer tissues by multiplex PCR for E2 and E6 genes. Materials and methods Preparation of clinical specimens Histologically confirmed cervical cancer tissues were obtained from 158 patients hospitalized in Sichuan Tumor Hospital, Chengdu, China from October 2003 to June 2004 by surgical operation and cryo-preserved at − 70°C until HPV detection was performed. The patients ranged in age of 17–71 years with a mean of 48 years. Of the 158 tumor specimens, 146 were diagnosed as squamous-cell carcinoma (SCC), 11 as adenocarcinoma (AC) and 1 as SCC\AC mixed tumor. The clinical stages of tumors were determined according to FIGO. DNA was extracted from frozen tissue specimens by DNeasy Tissue Kit (QIAGEN) according to the manufacturer's instruction and then stored at − 70°C. The quality of extracted DNA was checked by PCR amplification of βglobin gene (the primer forward 5′-CAACTTCATCCACGTTC ACC-3′ and reverse 5′-GAAGAGCCAAGGACAG GTAC-3′).

Detection and typing of HPV The presence of HPV DNA in tumor tissues was determined by PCR and direct DNA sequencing. All the specimens were firstly subjected to PCR amplification with a pair of primers GP5+ (5′-TTTGTTACTGTGGTAGATACTAC-3′)/GP6+ (5′-GAAAAATAAACTGTAAATCATATTC-3′). The HPV positive specimens were directly sequenced with the GP6+ primer. The HPV negative or sequence undetermined specimens were further tested by a second PCR with type-specific primers (Table 1) derived from the E6 ORF of HPV DNA. This method avoided false-negative results due to the disruption or deletion of L1 region. The PCR was performed on Thermalcycler (PR28A, Shenyang, China) in 25 μl of reaction mixture containing 10× PCR buffer, 2.5 mmol/l MgCl2, 250 μmol/l of each deoxynucleoside, 0.5 μmol/l of each sense and antisense primer, 20 ng of genomic DNA and 0.5 U Taq DNA polymerase (MBI, Fermentas.) by a 40-cycle protocol: denaturation at 94°C for 1 min, annealing at 45°C for 1 min and extension at 72°C for 1 min, with an initial denaturation at 94°C for 5 min and a final elongation at 72°C for 7 min. The amplification of E6 type-specific fragment was performed in 50 μl of reaction mixture containing 10× PCR buffer, 2.5 mmol/l MgCl2, 200 μmol/l of each deoxynucleoside, 0.5 μmol/l of each sense and antisense primer, 20 ng of genomic DNA and 1 U Taq DNA polymerase by a 35 cycle protocol:

Table 1 HPV E6 type-specific primers for detection and sequencing of HPV DNA in cervical cancer tissues Type

Sequence (5′ to 3′)

Site

Temperature (°C) for annealing

Length (bp) of PCR product

HPV16*

ACCGGTTAGTATAAAAG GCTCATAACAGTAGAG GCGCGCTTTGAGGATCCAACACGG TACTTGTGTTTCTCTGCGTCG GTTCAAAAATCCTGCAG CACTTGGGTTTCAGTACG CTATGTTTCAAGACACTG TTTACACGTCACAGTGCA GGACAGACATTGTAAGGTGC CAATGTAGTTATTTCTCCATGC GGCGCGCTTTGACGATCCAAAG TTGTGTTTCCCTACGTCTGC GAGGATCCAGCAACACGA CACTTGGGTCACAGGTCG GTTCCAGGACGCAGAGGAG CACTTGTGTTTGTCTACG CACGCTTTGAGGATCCTAC CACCAGTGTTTCACTACGC

56–72 640–625 108–131 578–558 110–126 554–537 107–124 556–549 87–106 585–563 104–125 572–553 108–125 545–528 112–130 556–539 59–77 534–516

56

584

58

471

48

445

45

450

52

499

60

469

56

438

58

445

55

476

HPV18 HPV31 HPV33 HPV35 HPV45 HPV52 HPV58 HPV59

Note. *—Wheeler et al. (1997) [19] designed.

A.-D. Qiu et al. / Gynecologic Oncology 104 (2007) 77–85 Table 2 Primers for PCR amplification of HPV16 E2 and E6 genes PCR HPV16 Sequence (5′–3′)

1*

E2

2

E2

3

E6

4

16p

Site

Table 4 HPV subtypes of 145 specimens from patients with cervical cancer Length (bp) of PCR product

3066–3193 147 TGCACCAACAGGATGTATAA TCAACTTGACCCTCTACCAC ACCAGATTAAGTTTGCACG 2700–3878 1179 AAAAGCACGCCAGTAATG CACCAAAAGAGAACTGCAATG 66–536 470 CAGCTGGGTTTCTCTACGTG AAAATTAAGGGCGTAACCG 20–856 837 ATGGTTTCTGGGAACAGATG

Note. *—Primers designed by Krzysztof Lukaszuk et al. (2003) [21].

denaturation at 94°C for 1 min, annealing at 45°C–60°C (Table 1) for 1 min and extension at 72°C for 1 min, with an initial denaturation at 94°C for 5 min and a final elongation at 72°C for 5 min. The HPV16 E6 negative specimens were amplified by nested PCR (PCR3, PCR4) with appropriate pair of primers (Table 2). The amplification of HPV16 was performed in 50 μl of reaction mixture containing 10× PCR buffer, 2.5 mmol/l MgCl2, 200 μmol/l of each deoxynucleoside, 50 pmol/l of each sense and antisense primer, 5 μl of template DNA and 1 U Taq DNA polymerase by a 40-cycle protocol: denaturation at 94°C for 1 min, annealing at 55°C for 1 min and extension at 72°C for 1 min, with an initial denaturation at 94°C for 5 min and a final elongation at 72°C for 10 min. Next, nested PCR was performed in 25 μl of reaction mixture containing 10× PCR buffer, 2.5 mmol/l MgCl2, 200 μmol/l of each deoxynucleoside, 50 pmol/l of each sense and antisense primer, 2 μl of PCR product and 0.5 U Taq DNA polymerase by a 35-cycle protocol: denaturation at 94°C for 1 min, annealing at 58°C for 1 min and extension at 72°C for 1 min, with an initial denaturation for 5 min at 94°C and a final elongation at 72°C for 10 min. The PCR assays were carried out in 158 specimens using appropriate viral DNA templates as positive controls and the reaction mixture containing no DNA as negative controls. The amplified DNA fragments were identified by electrophoresis in 1.5% agarose gel with ethidium bromide, then sent to Sangon Bioengineering Co. Ltd. in Shanghai for sequencing. The gene subtype was identified by the comparison of the sequence with that reported in GenBank using BLAST software.

Subtype

16 18 31 33 35 45 52 58 59 Total

Simple infection Case

Infection rate (%)

82 6 1 0 0 4 3 16 1 113

56.6 4.1 0.7 0 0 2.8 2.1 11.0 0.7 77.9

HPV types

Mixed infection

16\18 16\31 16\33 16\45 16\52 16\58 16\59 16\31\45

Case

Infection rate (%)

6 3 2 1 3 13 3 1

4.1 2.1 1.4 0.7 2.1 9.0 2.1 0.7

32

22.1

DNA sequencing. The same forward and reverse primers were used separately in cycle sequencing in order to sequence both sense and antisense strands. The sequence was analyzed and determined by NCBI Blast and sequence navigator version 2.0. In this paper, the sites of HPV16 DNA nucleotides are numbered according to the HPV16 sequence published in GenBank (AF534061). This particular genome sequence is referred to as the ‘prototype.’ HPV16 isolates with nucleotide differences from the prototype clone are referred to as ‘variants’ and a multivariant is defined as having two or more amino acid changes from the prototype. All data were confirmed twice at least by repeat PCR amplification and sequence analysis.

PCR for E2 and a mixture of E2 and E6

Number

Subtype16 (%)

Other subtypes (%)

146 11 1

110 (75.3) 3 (27.3) 1 (100)

27 (18.5) 1 (9.1) 0 (0)

For detection of integration, the E2 of the HPV16 genome between nt 2700 and nt 3878 was amplified according to the PCR conditions described by S.A. Tonon et al. [20]. Next, the HPV16 E2 positive specimens were subjected to multiplex PCR for HPV16 E2 and E6 genes (PCR2, 3), both of which were in the same reaction tube. The oligonucleotide primers were designed by using Vector NTI 3.1. software (Table 2). The multiplex PCR was performed in 25 μl of reaction mixture containing 1× PCR buffer, 4 mmol/l MgCl2, 250 μmol/l of each deoxynucleoside, 0.5 μmol/l of each sense and antisense primer, 1 μl of template DNA and 0.5 U Taq DNA polymerase (MBI, Fermentas.) by a 30cycle protocol: denaturation at 94°C for 30 s, annealing at 65°C for 1 min and extension at 74°C for 1 min, with an initial denaturation at 94°C for 5 min and a final elongation at 74°C for 10 min. The PCR products from HPV16 E2 negative specimens were re-amplified by PCR1 in 25 μl of reaction mixture containing 10× PCR buffer, 2.5 mmol/l MgCl2, 200 μmol/l of each deoxynucleoside, 50 pmol/l of each sense and antisense primer, 2 μl of PCR product of E2 negative specimen and 0.5 U Taq DNA polymerase by a 30cycle protocol: denaturation at 94°C for 30 s, annealing at 58°C for 1 min and extension at 72°C for 1 min with an initial denaturation at 94°C for 5 min and a final elongation at 72°C for 5 min. All the oligodeoxy nucleotides were synthesized in Sangon bioengineering Co. Ltd. The PCR products were identified by electrophoresis on a 2.0% agarose gel with ethidium bromide. The UV-illuminated gels were photographed and quantitatively analyzed with an image scanner (UVP, Ultra-Violet, U.S.A), then assayed with LabWorksTM software version 4.5(UVP, Inc.). The relative ratio of HPV E2 to E6 PCR products (E2/E6 ratio) was calculated. In order to verify the constancy of the E2/E6 ratio, a positive control test was performed in parallel using the T-E plasmid DNA containing HPV16 E2 and E6 genes, constructed by the authors,

Sequence analysis of HPV16 E6 ORF The PCR product of HPV16 E6 was identified by electrophoresis on 1.5% agarose gel, followed by ethidium-bromide staining, and the target bands were purified by TaKaRa Spin Columns (TaKaRa Co., Japan), then sent to Sangon for

Table 3 Histological type, clinical stage and differentiation of tumor and infection rate of HPV of various subtypes

Histological type SCC AC SCC/AC FIGO stage I II III IV Differentiation High Moderate Low Not determined

79

11 67 78 2

9 51 53 1

(81.8) (76.1) (67.9) (50)

2 (18.2) 13 (19.4) 13 (16.7) 0 (0)

Table 5 Positive rates of HPV16 DNA in 153 specimens by using GP5+/6+, E6 and E6+ nest PCR primers

6 45 76 31

4 34 50 26

(66.7) (75.6) (65.8) (83.9)

1 (16.7) 2 (4.3) 19 (25.0) 5 (16.1)

Positive Negative Positive rate (%)

GP5+/6+

E6

E6+ “nested”

79 74 49.1

80 73 52.3

114 39 74.5

80

A.-D. Qiu et al. / Gynecologic Oncology 104 (2007) 77–85 Table 7 Distribution of E6 gene variants in cervical cancer tissues at different FIGO stages

Fig. 1. Distribution of HPV subtypes in 145 patients with cervical cancer. as a template, by altering the amount of template DNA (0.5 to 20 pg) or the number of amplification cycles.

Results We analyzed 158 cervical cancer tissue specimens from Sichuan areas. Of the 158 specimens, 5 were negative in test for β-globin and excluded from the analysis, leaving 153 specimens positive for HPV DNA. Of the 158 tumor specimens, 146 were diagnosed as squamous-cell carcinoma (SCC), 11 as adenocarcinoma (AC) and 1 as SCC\AC mixed tumor (Table 3). Subtype distribution of HPV DNA

Variant

E6 variant

I n=8

II n = 47

III–IV n = 58

Total 113

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

350T 350G 178G 173T 276G 335T 464G 442C 511C 94A + 176A 168G + 178G 176A + 350G 94A + 350G 203G + 350G 335T + 442C 168G + 350G 335T + 350G 168G + 188C + 350G 176A + 335T + 442C 94A + 176A + 350G 168G + 188C + 240G + 350G

2 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

9 [18.7] 2 [4.2] 12 [25] 0 [0] 3 [6.3] 1 [2.1] 1 [2.1] 1 [2.1] 0 [0] 0 [0] 0 [0] 1 [2.1] 3 [6.3] 1 [2.1] 2 [4.2] 3 [6.3] 6 [12.5] 2 [4.2] 0 [0] 0 [0] 0 [0]

15 [25.9] 2 [3.4] 16 [27.6] 1 [1.7] 1 [1.7] 1 [1.7] 0 [0] 2 [3.4] 1 [1.7] 1 [1.7] 1 [1.7] 0 [0] 2 [3.4] 0 [0] 1 [1.7] 4 [6.9] 2 [3.4] 5 [8.6] 1 [1.7] 1 [1.7] 1 [1.7]

26 4 34 1 4 2 1 3 1 1 1 1 5 1 3 7 8 7 1 1 1

[25] [0] [75] [0] [0] [0] [0] [0] [0] [0] [0] [0] [0] [0] [0] [0] [0] [0] [0] [0] [0]

Note. Figures in brackets are percentage values.

Of the 153 specimens positive for HPV DNA, 8 were excluded from the evaluation due to indefinite subtypes. Of the remaining 145 specimens, 113 (77.9%) were diagnosed as simple infection with a single HPV subtype, and the other 32 (22.1%) as mixed infection with multiple types (Table 4). In the study, we used the Gp5+/6+ primers, E6 type-specific primers,

as well as nested PCR, which were further performed on negative specimens to prevent the false-negative results. The result showed that the prevalence of HPV DNA in the patients was 96.8% (153/158), which was consistent with those reported by Kleter B et al. (1998) [22] and Chichareaon S et al. (1998)

Table 6 E6 gene types identified differing from the prototype (350T) Variant

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

Open reading frame nucleotides

Amino acid change

94 168 173 (Prototype)

176

178

188

203

240

276

335

350

442

464

511

G – – – – – – – – A – – A – – – – – – A –

G – – – – – – – – A – A – – – – – – A A –

T – G – – – – – – – G – – – – – – – – – –

G – – – – – – – – – – – – – – – – C – – C

A – – – – – – – – – – – – G – – – – – – –

C – – – – – – – – – – – – – – – – – – – G

A – – – G – – – – – – – – – – – – – – – –

C – – – – T – – – – – – – – T – T – T – –

T G – – – – – – – – – G G G – G G G – G G

A – – – – – – C – – – – – – C – – – C – –

A – – – – – G – – – – – – – – – – – – – –

T – – – – – – – C – – – – – – – – – – – –

C – – – – – – – – – G – – – – G – G – – G

C – – T – – – – – – – – – – – – – – – – –

L83V* D25E H24Y N58S H78Y K121E E113D NO D25N T22S + D25E D25N + L83V L83V K34E + L83V H78Y + E113D T22S + L83V H78Y + L83V T22S + E29Q + L83V D25N + H78Y + E113D D25N + L83V T22S + E29Q + A46G + L83V

Note. *—L83V represent an amino acid change from leucine to valine at site 83. The rest can be deduced by analogy.

Positive specimen

Positive rate (%)

26 4 34 1 4 2 1 3 1 1 1 1 5 1 3 7 8 7 1 1 1

23 3.5 30.1 0.9 3.5 1.8 0.9 2.7 0.9 0.9 0.9 0.9 4.4 0.9 2.7 6.2 7.1 6.2 0.9 0.9 0.9

A.-D. Qiu et al. / Gynecologic Oncology 104 (2007) 77–85

Fig. 2. PCR for HPV16 E2 gene. Specific fragments of the E2 genes (1179 bp) were successfully amplified in 58 specimens. The 56 negative specimens (lanes S5 and S9) were further tested by nested PCR for E2 gene. M: 1 kb ladder; 1–11: specimens; P: positive control; N: negative control.

[23]. Of the nine high-risk HPV subtypes (16, 18, 31, 33, 35, 45, 52, 58 and 59), HPV16, 58 and 18 were prominent, accounting for 78.6%, 20.0% and 9.7% of 145 specimens with definite subtypes, respectively, followed by HPV31 (6.2%), 33 (1.4%), 45 (4.1%), 52 (4.1%) and 59 (3.4%). The positive rates of HPV16 DNA determined using Gp5+/6+, E6 and E6+ nested PCR primers were 49.1%, 52.3% and 74.5% in 153 specimens, respectively (Table 5). However, no HPV35 was found in all the 145 specimens (Fig. 1). HPV16 E6 gene mutations The 114 HPV16-positive specimens are shown in Table 3. One of the 114 specimens was excluded from evaluation due to indefinite E6 sequence. As shown in Table 6, 21 different variants of HPV E6 gene were identified. The variants showed base substitutions at different sites of nucleotides, most of which resulted in the corresponding amino acid changes. Of the variants, variant 1 and 3 were prominent, which were found in 26 (23%) and 34 (30.1%) specimens, respectively. It is evident from the sequencing result of whole length of E6 gene that variant 1 was completely homologous to the HPV16 prototype (European strain), and the variant 3 was basically homologous to prototype, except one base substitution of G178T. To our knowledge, the base substitutions of 94A, 173T, 203G, 240G, 464G and 511C have not been reported previously. E6 variants in different stages of the cervical cancer As shown in Table 7, the variants 1 and 3 were found in the cervical cancer tissues at stages I to IV. However, the rest variants were not found in the cancer tissue at stage I.

Table 8 Clinical pathology and physical status of HPV16 E2 gene in cervical cancer tissues FIGO

I II III IV Total

E2/E6 gene ratio

“nested” E2 gene (concomitant)

Disrupted E2 gene (integrated)

≧ control (episomal) Cases

< control (concomitant) Cases

Cases

Cases

3 22 18 0 43

1 10 4 0 15

5 15 28 0 48

0 2 6 0 8

81

Fig. 3. Multiplex PCR for E2 and E6 genes of HPV16 DNA. Cervical cancer tissue specimens with intact E2 genes were subjected to multiplex PCR. Fragments of the E2 (1179 bp) and E6 (470 bp) were successfully co-amplified in 58 specimens. The E2/E6 ratio was obtained by densitometry. E2/E6 ratios of 15 specimens were extremely low (lane S6, S7, S8, S9) as compared to the others. M: 1 kb ladder; S1, 2, 3, 4, 5, 6, 7, 8, 9: number of the sample; P, N: positive and negative control respectively.

E2 PCR and nested PCR A total of 114 cervical cancer tissue specimens with HPV16 DNA were tested for the disruption of the E2 gene by the PCR2 in Table 2, and the result was shown in Fig 2. No E2 gene fragments were amplified in 56 specimens, which might be due to the integration of HPV DNA into host genome or partial disruption of E2 gene. By the nested PCR1 in Table 2, the HPV16 DNAs in only 8 specimens were completely integrated into the host genome, and those in the other 48 specimens might involve mixed episomal and integration forms (Table 8). In contrast, the expected fragment of 1179 bp was amplified in the rest 58 specimens (Fig. 2). In these cases, it was postulated that HPV DNA was present in pure episomal form without any disruption or partial disruption of E2 gene. It was possible, however, that HPV DNA in these cancer tissues existed in pure episomal form or in mixed episomal and integration forms. Multiplex PCR for E2 and E6 genes Multiplex PCR for HPV E2 and E6 genes was carried out in the E2 gene positive specimens. The ORFs of E2 and E6 genes were successfully co-amplified in all the specimens (Fig. 3). As expected, in a preliminary test with HPV16 plasmid DNA, E2/ E6 ratios, ranging from 1.08 to 2.46, were independent to the amount of template DNA and the number of amplification cycles. Although the E2/E6 ratios of 43 specimens exceeded the value of that of control, the multiplex PCR products from the other 15 specimens displayed extremely low E2/E6 ratio (< 0.9) (Table 8). Discussion The close association of human papillomavirus with cervical cancer is strongly suggested. Certain types of the virus are considered as high-risk types due to the great odds ratios of association with cervical cancer and their ability to integrate into the host genome [24]. Prevalence of HPV DNA ranging from 22% to 100% has been reported in case series from different settings (IARC 1995) [25]. Our findings showed a HPV infection rate of 96.8% (153/158) in the patients with cervical

82

A.-D. Qiu et al. / Gynecologic Oncology 104 (2007) 77–85

cancer, which was in accordance with that reported by Walboomers et al. (1999) [26] and slightly higher than those reported previously in China [5,6,27]. The different infection rates are most likely due to the detection method for HPV. In this study, we tried to improve the detection rate of HPV by PCR for L1 using GP5+/6+ primer, supplemented with the nested PCR for HPV E6 gene. HPV16 was found as the prominent subtype in Sichuan, with a detection rate of 78.6 (114/145) which was consistent with those reported in Europe and the U.S.A. [28–30] (60%–84%). HPV58, with a detection rate of 20% (29/145), was the second most common subtype in this study. Previous studies had shown that HPV58 type was mostly distributed in the Southeast Asia [31,32] and was the prominent subtype in Mexico [33]. HPV58 type is mainly distributed in the Southern of China, such as Guangdong, Hong Kong, etc. [34,35]. At the beginning of Qing Dynasty, a large amount of the population migrated into Sichuan from Guangdong, it may be that the migration has contributed to virus dispersion in this region. The rest of the definite subtypes included HPV18 (9.7%), HPV31 (6.2%), HPV33 (1.4%), HPV45 (4.1%), HPV52 (4.1%) and HPV59 (3.4%). Our study revealed HPV16, HPV58 and HPV18 are the major prevalence in the Sichuan areas in Sichuan Province, Southwest of China. Since data on the clinical and prognostic significance of HPV detection in cervical cancer screening are still controversial, the role of HPV intratype gene variations and HPV DNA integration into the host cell in the development of malignancy is an important subject of continuing research. High-risk HPV16 E6 and E7 are able to cause genetic instability (i.e. aneuploidy of the chromosomes) in infected cells [36]. Additionally, any change in the sequences of these genes may lead to altered biological function of the proteins encoded, which in turn may influence the natural history of the infection. The absence of cell cycle arrest, apoptosis and maintenance of telomere length caused by E6, the hyperproliferation caused by E7 and the genetic instability of the host cell caused by E6 and E7 of hr-HPV genotypes are considered a prerequisite for cells to become immortalized and obtain unrestrained growth, which may ultimately result in a malignancy [37–39]. Therefore, identification of HPV16 variants may be important for the rational design of newer diagnostic and therapeutic interventions in cervical cancer as well as for vaccine development strategies. Since the HPV E6 variants had a higher prevalence rate than E7 [40], the identification of E6 domain was a particularly good choice for

distinguishing HPV16 variants. In our study, 21 E6 variants, including a total of fourteen base substitutions in HPV16 E6 ORF, were found from 113 cervical cancer tissue specimens (Fig. 4). The European prototype was found in 26 of the 113 specimens (23%). The variants with base substitution (T → G) at nt 350 were found alone in 3.5% and in combination with other mutations in 28.1% of the specimens. Our results revealed an almost uniform distribution of HPV16 E6 prototype and variants, particularly 350G (L83V) in cervical cancer at FIGO II–IV stages, which was consistent with those reported by Ingo NINDL [40] and Yamada et al. [41]. Zebhe et al. found that the L83V was present in 88% of ICC and 44% of CIN III cases by the case–control study and regarded that the amino acid change (L83V) was strongly associated with the lesion progression in HPV16-positive cervical cancer tissue specimens [11]. However, another follow-up study [40,42] demonstrated an opposite conclusion. These discordant results may be explained in part by the different experimental designs, geographic origins of the patients analyzed and the small number of cases investigated. For the woman with cervical cancer in the Sichuan areas, compared with Stephen AL's results [7], the prevalence of the HPV16 E6 prototype showed no significant difference (23% vs. 25%), but the 350G variant was significantly higher than that of Stephen AL's (31.6% vs. 10%). Our results did not support the hypothesis from Zebhe et al. [11]. In our survey, variant 3 was found in 34 specimens (30.1%). This variant differed from the prototype by only one base substitution (T → G) at nt178 in the E6 ORF, leading to a change from aspartic acid to glutamic acid at site 25 (D25E) and having a homology of 100% to East Asia strain (EA). Our data indicated that the European standard strain (EP) and the East Asia strain are the predominant strains in cervical cancer tissue specimens collected from Sichuan areas. Some of the mutations identified in the E6 genes of HPV16 isolated in China may have considerable biological impact. All the five base substitutions identified between nt168 and nt188 might cause alterations of amino acids at N-terminus of E6 protein, and in previous vitro studies have shown that the amino acids in this region were antigenic and elicited a strong T cell response in vivo [43]. Another novel finding in this study is the occurrence of the variants 14 and 21, each of which was found in only one specimen. Besides the amino acid change L83V caused by base substitution of 350G, the two variants showed base substitutions A → G and C → G at nt 203 and 240, resulting in amino acid changes of K → E and A → G at sites 34 and 46,

Fig. 4. Sites of identified mutations in E6 regions of HPV16 isolates investigated in this survey. Solid squares represent silent E6 mutations, and stars represent the E6 mutations resulting in changes of amino acid sequence of oncoproteins.

A.-D. Qiu et al. / Gynecologic Oncology 104 (2007) 77–85

respectively. In particular, the base substitution C → G at nt240 was located in the P53 degradation site, which may be more potentially carcinogenic. Lechner et al. [44] reported that 16 E6 46Y/47Y/49H inhibited p53-mediated transcriptional repression in a transient expression assay and concluded that E6 binding to p53 was sufficient for this inhibition. Shunsuke Nakagawa et al. also confirmed that the E6 mutation of D120G could lead to direct degradation of p53 [45]. Our results revealed the base substitution A → G at nt 464, resulting in amino acid change in the C-terminal zing finger region(K121E), was just enough located in the P53 binding and degradation domains. The association of this mutation and carcinogenicity has not been described in HPV16 natural variants. Detection of HPV16 natural variants by PCR and nucleotide sequence analysis allowed the identification of subtypes and their geographical distribution pattern. However, the biological diversity of such variants, especially their oncogenic properties, will be possibly elucidated by epidemiological studies on the association between virus variants and disease progression rate and by in vitro transcription. Previous studies have implied the association of HPV16 integration with progression of cervical cancer [46]. The phenomenon of integration has been regarded as a potentially important mechanism for tumor progression in the cervix (transformation of dysplasia into invasive carcinoma) [13,47,48]. The genome integration of HPV usually disrupts E2 genes [14,15] and causes an absence of the E2 gene sequences. The lack of E2 gene could lead to the overexpression of E6 and E7 genes [16,17]. The transforming oncoprotein by the E6 ORFs code has been thought to function by deleting or inactivating the P53 tumor suppressor protein [18]. Thus, accurate detection of the integration of HPV DNA is very important for a better understanding of the mechanisms of cervical carcinogenesis and of cervical cancer progression and metastasis. Because of a small quantity of HPV16 DNA, we detected the physical status of DNA by using an optimized multiplex PCR which requires no large quantities of DNA. Firstly, we explored the presence of the E2 fragment by amplifying the E2 gene fragment at a length of 2700 to 3879 bp; however, the gene failed to be amplified in 56 of 114 specimens (49.1%), which might be due to the integration or partial disruption of HPV DNA. Secondly, we performed nested PCR1 (see Table 2) for HPV16 E2 gene at a length of 3066 to 3193 bp HPV16 E2 gene which was the most usually deleted during the integration of HPV into the host cells [49], and found that the HPV16 DNA was completely integrated into the host genome only in 8 specimens (7%) and speculated that the HPV DNA in the other 48 specimens might involve mixed episomal and integration forms. The frequency of complete virus integration was lower than that of the previous studies [20,50]. We presumed that such a difference was due to epidemiological differences among the population studied and the sensitivity of our method is higher than that of the previous studies. However, to rule out the possibility of integration outside the E2 ORF, including the E1 ORF, additional sets of primers from these regions may have to be used for further confirmation.

83

Fig. 5. Prevalence of the physical status of HPV16 DNA in cervical cancers. The segments (open, stippled and black) represent ratios of specimens harboring HPV16 DNA in pure episomal, concomitant and pure integrated forms, respectively, according to FIGO stage.

The HPV DNA in the other 58 specimens with an intact E2 gene may be in a pure episomal form or in the concomitant presence of episomal and integration forms. The copy numbers of E2 and E6 genes should be equivalent in episomal forms and the E2 gene copy number should be smaller than that of E6 gene following the preferential disruption of the E2 gene in concomitant forms. So we performed multiplex PCR for the entire E2 ORF and E6 genes to differentiate the two forms. As expected, in a preliminary experiment with HPV16 plasmid DNA, E2/E6 ratios, ranging from 1.08 to 2.46, were independent to the amount of template DNA and the number of amplification cycles. The multiplex PCR products from 15 specimens displayed extremely low ratios (< 0.9) as compared with those for the other specimens, which indicated that the HPV DNA in the 15 specimens might involve mixed episomal and integration forms. In our study, only 8 HPV16 isolates present a pure integration form of HPV DNA and were distributed in FIGO stages II or III (Fig. 5), which was a much lower proportion than that reported previously. Our results showed that the integrated sequences are rarely found in low-grade lesions and more frequent in high-grade lesions. This implied that the integration of HPV DNA is important in progression of cervical cancer. Moreover, clinical application of this technique will help researchers to understand the influences of the integration of HPV on cervical carcinogenesis and the progression of cervical cancer. In summary, the mainly prevalent HPV subtypes in Sichuan, China are HPV16, HPV58 and HPV18. The data obtained from our study on HPV16 E6 gene indicated that the EP and the EA strains were the predominant strain in cervical cancer tissues in this region. The six novel HPV16 E6 base substitutions of G94A, C173T, A203G, C240G, A464G and T511C are reported in this paper. Our findings and the results of previous studies strongly suggest that HPV16 DNA integration may play an important role in the progression of HPV16-positive cervical cancer. However, the proportion of the disruption of intact E2 gene in our study is much lower than that previously reported. Acknowledgments This work was supported in part by grants-in-aid 200504024 from the agency of science and technology of Jilin Province and by grants-in-aid 2006J 13–133 from the agency of science

84

A.-D. Qiu et al. / Gynecologic Oncology 104 (2007) 77–85

and technology of Sichuan Province, People's Republic of china.

[21]

References [22] [1] Parkin DM. Global cancer statistics in the year 2000. Lancet Oncol 2001 (Sep);2(9):533–43. [2] Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM, Peto J, et al. Prevalence of human papillomavirus DNA in cervical cancer: a worldwide perspective. International Biological Study on Cervical Cancer (IBSCC) Study Group. J Natl Cancer Inst 1995 (Jun 7);87(11):796–802. [3] Stewart AC, Eriksson AM, Manos MM, Munoz N, Bosch FX, Peto J, et al. Intratype variation in 12 human papillomavirus types: a worldwide perspective. J Virol 1996 (May);70(5):3127–36. [4] Lo KW, Wong YF, Chan MK, Li JC, Poon JS, Wang VW, et al. Prevalence of human papillomavirus in cervical cancer: a multicenter study in China. Int J Cancer 2002 (Jul 20);100(3):327–31. [5] Xiao X, Cao M, Miller TR, Cao ZY, Yen TS. Papillomavirus DNA in cervical carcinoma specimens from central China. Lancet 1988 (Oct 15);2 (8616):902. [6] Peng HQ, Liu SL, Mann V, Rohan T, Rawls W. Human papillomavirus types 16 and 33, herpes simplex virus type 2 and other risk factors for cervical cancer in Sichuan province China. Int J Cancer 1991 (Mar 12);47 (5):711–6. [7] Stephen AL, Thompson CH, Tattersall MH, Cossart YE, Rose BR. Analysis of mutations in the URR and E6/E7 oncogenes of HPV 16 cervical cancer isolates from central China. Int J Cancer 2000 (Jun 1);86(5):695–701. [8] Zur Hausen H. Human papillomaviruses in the pathogenesis of anogenital cancer. Virology 1991 (Sep);184(1):9–13. [9] Xi LF, Demers GW, Koutsky LA, Kiviat NB, Kuypers J, Watts DH, et al. Analysis of human papillomavirus type 16 variants indicates establishment of persistent infection. J Infect Dis 1995 (Sep);172(3):747–55. [10] Alvarez-Salas LM, Wilczynski P, Burger RA, Monk BJ, Dipaolo JA. Polymorphism of the HPV-16 E6 gene of cervical carcinoma. Int J Oncol 1995 (May);7(3):261–6. [11] Zehbe I, Wilander E, Delius H, Tommasino M. Human papillomavirus 16 E6 variants are more prevalent in invasive cervical carcinoma than the prototype. Cancer Res 1998 (Feb 15);58(4):829–33. [12] Daniel B, Rangarajan A, Mukherjee G, Vallikad E, Krishna S. The link between integration and expression of human papillomavirus type 16 genomes and cellular changes in the evolution of cervical intraepithelial neoplastic lesions. J Gen Virol 1997 (May);78(5):1095–101. [13] Cullen AP, Reid R, Campion M, Lorincz AT. Analysis of the physical state of different human papillomavirus DNAs in intraepithelial and invasive cervical neoplasm. J Virol 1991 (Feb);65(2):606–12. [14] Durst M, Kleinheinz A, Hotz M, Gissmann L. The physical state of human papillomavirus type 16 DNA in benign and malignant genital tumors. J Gen Virol 1985 (Jul);66(7):1515–22. [15] Jeon S, Lambert PF. Integration of HPV-16 DNA into the human genome leads to increased stability of E6/E7 mRNAs: implications for cervical carcinogenesis. Proc Natl Acad Sci U S A 1995 (Feb 28);92(5): 1654–8. [16] Bernard BA, Bailly C, Lenoir MC, Darmon M, Thierry F, Yaniv M. The human papillomavirus type 18 (HPV18) E2 gene product is a repressor of the HPV18 regulatory region in human keratinocytes. J Virol 1989 (Oct);63(10):4317–24. [17] Romanczuk H, Thierry F, Howley PM. Mutational analysis of cis elements involved in E2 modulation of human papillomavirus type 16 P97 and type 18 P105 promoters. J Virol 1990 (Jun);64(6):2849–59. [18] Scheffner M, Huibregtse JM, Viestra RD, Howley PM. The HPV16 E6 and E6-AP complex functions as a ubiquitin protein ligase in the ubiquitination of p53. J Cell 1993 (Nov 5);75(3):495–505. [19] Wheeler CM, Yamada T, Hildesheim A, Janison SA. Human papillomavirus type 16 sequence variants: identification by E6 and L1 lineagespecific hybridization. J Clin Microbiol 1997 (Jan);35(1):11–9. [20] Tonon SA, Picconi MA, Bos PD, Zinovich JB, Galuppo J, Alonio LV, et al. Physical status of the E2 human papillomavirus 16 viral gene in cervical

[23]

[24] [25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37] [38]

[39]

[40]

preneoplastic and neoplastic lesions. J Clin Virol 2001 (May);21 (2):129–34. Lukaszuk K, Liss J, Wozniak I, Emerich J, Wojcikowski C. Human papillomavirus type 16 status in cervical carcinoma cell DNA assayed by multiplex PCR. J Clin Microbiol 2003 (Feb);41(2):608–12. Kleter B, van Doorn LJ, ter Schegget J, Schrauwen L, Van Krimpen K, Burger M, et al. Novel short-fragment PCR assay for highly sensitive broad-spectrum detection of anogenital human papillomaviruses. Am J Pathol 1998 (Dec);153(6):1731–9. Chichareaon S, Herrero R, Munoz N, Bosch FX, Jacobs MV, Deacon J, et al. Risk factors for cervical cancer in Thailand: a case–control study. J Natl Cancer Inst 1998 (Jan 7);90(1):50–7. Ferenczy A, Franco E. Cervical-cancer screening beyond the year 2000. Lancet Oncol 2001 (Jan);2(1):27–32. IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans, vol. 64, Human Papillomaviruses, pp. 47–52. Lyon: International Agency for Research on Cancer, World Health Organization. IARC (1995). Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 1999 (Sep);189(1):12–9. Huano S, Afonina I, Miller BA, Beckmann AM. Human papillomavirus types 52 and 58 are prevalent in cervical cancers from Chinese women. Int J Cancer 1997 (Feb);70(4):408–11. Durst M, Gissman L, Ikenberg H, Zur HauSen H. A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proc Natl Acad Sci U S A 1983 (Jun);80 (12):3812–5. Meanwell CA, Cox MF, Blackledge G, Maitland NJ. Hpv16 in normal and malignant cervical epithelium: implications for the aetiology and behavior of cervical neoplasia. Lancet 1987 (Mar 28);1(8535):703–7. Crook T, Wrede D, Tidy JA, Mason WP, Evans DJ, Vousdan KH. Clonal P53 mutation in primary cervical cancer: association with human papillomavirus-negative tumors. Lancet 1992 (May 2);339(8801): 1070–3. Clifford GM, Smith JS, Plummer M, Munoz N, Franceschi S. Human papillomavirus types in invasive cervical cancer worldwide: a metaanalysis. Br J Cancer 2003 (Jan 13);88(1):63–73. Pham TH, Nguyen TH, Herrero R, Vaccarella S, Smith JS, Nguyen Thuy TT, et al. Human papillomavirus infection among women in South and North Vietnam. Int J Cancer 2003 (Mar 20);104(2):213–20. Gonzalez-Losa Mdel R, Rosado-Lopez I, Valdez-Gonzalez N, Puerto-Solis M. High prevalence of human papillomavirus type 58 in Mexican colposcopy patients. J Clin Virol 2004 (Mar);29(3):202–5. Chan PK, Li WH, Chan MY, Ma WL, Cheng JL, Cheng AF. High prevalence of human papillomavirus type 58 in Chinese women with cervical cancer and precancerous lesions. J Med Virol 1999 (Oct);59 (2):232–8. Jie L, Bao-yin L, Hausen Z. Investigation of the infection and geographical distribution of HPV in cervical carcinoma tissues from Chinese women. Chinese Journal of Experimental and Clinical Virology 1996;10(1):50–5. Duensing S, Munger K. The human papillomavirus type 16 E6 and E7 oncoproteins independently induce numerical and structural chromosome instability. Cancer Res 2002 (Dec 1);62(23):7075–82. Hubbard RA. Human papillomavirus testing methods. Arch Pathol Lab Med 2003 (Aug);127(8):940–5. Ewen ME, Sluss HK, Sherr CJ, Matsushime H, Kato J, Livingston DM. Functional interactions of the retinoblastoma protein with mammalian Dtype cyclins. Cell 1993 (May 7);73(3):487–97. Kiyono T, Foster SA, Koop JI, McDougall JK, Galloway DA, Klingelhutz AJ. Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature 1998 (Nov 5); 396(6706):84–8. Nindl I, Rindfleisch K, Lotz B, Schneider A, Durst M. Uniform distribution of Hpv 16 E6 and E7 variants in patients with normal histology, cervical intra-epithelial neoplasia and cervical cancer. Int J Cancer 1999 (Jul 19);82(2):203–7.

A.-D. Qiu et al. / Gynecologic Oncology 104 (2007) 77–85 [41] Yamada T, Manos M, Peto J, Greer CE, Munoz N, Bosch FX, et al. Human papillomavirus type 16 sequence variation in cervical cancers: a worldwide perspective. J Virol 1997 (Mar);71(3):2463–72. [42] Hu X, Guo Z, Tianyun P, Ponten F, Wilander E, Andersson S, et al. Hpv typing and hpv16 E6-sequence variations in synchronous lesions of cervical squamous-cell carcinoma from Swedish patients. Int J Cancer 1999 (Sep 24);83(1):34–7. [43] Kast WM, Brandt RM, Sidney J, Drijfhout JW, Kubo RT, Grey HM, et al. Role of HLA-A motifs in identification of potential CTL epitopes in human papillomavirus type 16 E6 and E7 proteins. J Immunol 1994 (Apr 15);152(8):3904–12. [44] Lechner MS, Mack DH, Finicle AB, Crook T, Vousden KH, Laimins LA. Human papillomavirus E6 proteins bind p53 in vivo and abrogate p53mediated repression of transcription. EMBO J 1992 (Aug);11(8): 3045–52. [45] Nakagawa S, Watanabe S, Yoshikawa H, Taketani Y, Yoshiike K, Kanda T. Mutation analysis of human papllomavirus type 16 E6 protein: transforming function for human cells and degradation of p53 in vitro. Virology 1995;212:535–42.

85

[46] Klaes R, Woerner SM, Ridder R, Wentzensen N, Duerst M, Schneider A, et al. Detection of high-risk cervical intraepithelial neoplasia and cervical cancer by amplification of transcripts derived from integrated papillomavirus oncogenes. Cancer Res 1999 (Dec 15);59(24):6132–6. [47] Daniel B, Mukherjee G, Seshadri L, Vallikad E, Krishna S. Changes in the physical state and expression of human papillomavirus type 16 in the progression of cervical intraepithelial neoplasia lesions analysed by PCR. J Gen Virol 1995 (Oct);76(10):2589–93. [48] Pirami L, Giache V, Becciolini A. Analysis of HPV 16, 18, 31 and 35 DNA in pre-invasive and invasive lesions of the uterine cervix. J Clin Pathol 1997 (Jul);50(7):600–6004. [49] Chen CM, Shyu MP, Au LC, Chu HW, Cheng WT, Choo KB. Analysis of deletion of the integrated human papillomavirus 16 sequence in cervical cancer: a rapid multiplex polymerase chain reaction approach. J Med Virol 1994 (Oct);44(2):206–11. [50] Yoshinouchi M, Hongo A, Nakamura K, Kodama J, Itoh S, Sakai H, et al. Analysis by multiplex PCR of the physical status of human papillomavirus type 16 DNA in cervical cancers. J Clin Microbiol 1999 (Nov);37(11): 3514–7.