- Email: [email protected]
Htr2c Splice Variants and 5HT2CR-Mediated Appetite
TEM 1228 No. of Pages 2
Forum
Htr2c Splice Variants and 5HT2CRMediated Appetite Anthony R. Isles1,* Serotonin 2C receptor (5HT[81_TD$IF]2CR) exists as different isoforms as a result of alternate splicing. A truncated variant (5HT[81_TD$IF]2CR-trunc) has no canonical receptor function and yet shows robust expression levels throughout the brain. Recent work has demonstrated the biochemical role of this isoform and how altering levels of 5HT[81_TD$IF]2CR-trunc leads to changes in behaviour. The pre-RNA encoded by the 5HT2CR gene, Htr2c, is subject to two post-transcriptional modification processes, namely RNA editing and alternate splicing. Skipping of exon Vb of the Htr2c premRNA results in RNA1, whereas inclusion of exon Vb produces RNA2, which encodes the full-length version of 5HT2CR. Loss of exon Vb in RNA1 alters the amino acid reading frame and leads to the production of a truncated protein (5HT2CRtrunc). This isoform cannot act as a canonical seven-transmembrane receptor due to the lack of a complete second intracellular loop and, therefore, a functional G-protein-binding domain.
plasma membrane and decreasing the availability of a functional receptor [1]. Thus, altering the degree of Htr2c preRNA splicing may be another mechanism by which a cell titrates 5HT2CR function. Interest in the functional consequences of the 5HT2CR-trunc isoform has focussed on its possible role in the neurodevelopmental disorder, Prader-Willi syndrome (PWS). PWS is [82_TD$IF]characterised by significant neuroendocrine and metabolic impairment; after severe neonatal hypotonia and a failure to thrive in infancy, individuals with PWS subsequently develop an overeating phenotype (hyperphagia) that, unless managed carefully, leads to morbid obesity and its associated problems. PWS is a genetic disorder caused by the loss of several genes on the long arm of chromosome 15, specifically 15q11-q13. This cluster of genes is subject to genomic imprinting, whereby epigenetic marks laid down during gametogenesis distinguish the parental origin of the genomes and lead to the expression of some genes from the paternal genome only and others from the maternal genome only in the somatic cell lineages [2]. PWS is caused by the loss of paternal gene expression at the 15q11-q13
interval, including several small nucleolar (sno)-RNA molecules [3]. One of these snoRNAs, SNORD115, contains a recognition sequence for the HTR2C pre-RNA (Figure 1), suggesting that it has a role in regulating post-transcriptional modification. Subsequent in vitro work demonstrated that this is indeed the case, because SNORD115 promotes the inclusion of exon Vb and, therefore, the production of a full-length 5HT2CR [4]. Although rare [83_TD$IF]patients carrying microdeletions indicate that SNORD115 is not the major contributor to the disorder [5,6][84_TD$IF], loss of SNORD115 expression in PWS [85_TD$IF]0occurs in most cases, and would be expected to lead to increased production of the 5HT2CR-trunc isoform, increased sequestering of full-length 5HT2CR, and a reduction in 5HT2CR-mediated function. Activation of 5HT2CR has consequences for many aspects of behaviour, but most pertinent to PWS is its role in regulating appetite. Although the anorectic action of serotonin occurs via activation of multiple receptor subtypes, it is the 5-HT2CR that is the most predominant [7]. The central melanocortin system is the principle mediator of 5-HT2CR-regulated appetite [8,9]. The arcuate nucleus of the
Receptor encoded by fulllength splice variant Exon I
II
Htr2c pre-RNA
III
IV
Va Vb
VI
Receptor encoded by truncated splice variant
Why the 5HT2CR-trunc isoform should occur at relatively high levels naturally in the brain was not initially clear. However, it was recently discovered that, although 5’ -...CGGUAUGUAGCAAUACGUAAUCCUAUUGAGCAUAGCC...-3’ Htr2c this truncated variant cannot act as a GCAUUAGGAUAACUCGUACUA A...-5 GU C receptor, it has a critical role in overall ’ sno ..GA 3’ - . rd11 5 5HT2CR function. In vitro studies demonstrated that 5HT2CR-trunc was localized in the endoplasmic reticulum (ER), where it forms a heterodimer with the full-length Figure 1. Schematic Outlining the Binding of Snord115 to Htr2c and How Alternate Splicing Can Lead to Full-Length and Truncated Serotonin 2C Receptor (5HT2CR). Binding of Snord115 to a 5HT2CR. Consequently, 5HT2CR-trunc specific sequence in exon V of the Htr2c pre-RNA promotes the inclusion of exon Vb and the production of fullretains the full-length 5HT2CR in the ER, length 5HT2CR; the exon/alternative exon border in the proximal splice site (GG) is underlined. Skipping of exon preventing the latter from reaching the Vb alters the amino acid reading frame and produces a truncated 5HT2CR isoform. Loss of Snord115 expression, as is expected in most cases of PWS, leads to an increase in the levels of 5HT2CR-trunc.
Trends in Endocrinology & Metabolism, Month Year, Vol. xx, No. yy
1
TEM 1228 No. of Pages 2
Box 1. Therapeutic Potential? The idea that 5HT2CR-mediated feeding may be altered in PWS has raised the possibility of this being a potential route for therapeutic intervention [3,4]. This may involve the use serotonergic drugs, such as lorcaserin, a 5HT2CR-specific agonist that is already established as a major treatment for obesity generally [7], or indeed by an oligonucleotide promoting production of HTR2C RNA2 [11]. In addition to novel therapeutic pathways, these data may also highlight possible problems with existing serotonergic-based treatments. Although not necessarily the main causal factor [5,6], the loss of SNORD115 occurs in >99% of PWS cases. However, loss of SNORD115 affects the production of 5HT2CR-trunc throughout the brain and not only in the hypothalamus. We know that 5HT2CR mediates many aspects of brain function, and so it may be that, in addition to feeding, loss of SNORD115 in PWS underpins other phenotypes, such as psychiatric problems. Therefore, current 5HT2CR-specific treatments may have adverse effects or indeed exacerbate behavioural abnormalities and psychiatric problems seen in PWS [2]. A similar effect was seen in earlier work where a 5HT2CR-specific antagonist caused an enhanced effect on impulsive responding in the PWS-IC mouse model [14].
hypothalamus (ARC) contains two discrete populations of melanocortin neurons, those synthesising the anorectic melanocortin receptor (MCR) agonist, proopiomelanocortin (POMC), and those synthesising the orexigenic MCR antagonist/inverse agonist, agouti-related peptide (AgRP); 5-HT2CRs are expressed on, and modulating firing of, ARC POMC neurons [10]. Furthermore, 5HT2CR expression specifically on POMC neurons is both necessary and sufficient for the promotion of satiety and the regulation of body weight [9]. However, the extent to which altered levels of the 5HT2CR-trunc isoform impacts function had not been determined until recently. Over the past year, two studies have shown that altering the relative proportions of the 5HT2CR isoforms produces changes in feeding behaviour. The first study developed and applied an oligonucleotide that promoted the inclusion of exon 5b of Htr2c [11]. By administering this oligonucleotide directly into the hypothalamus, the authors were able to decrease the production of 5HT2CR-trunc and increase consumption of food in mice. As expected, this effect was mediated via activation of POMC neurons. Remarkably, this oligonucleotide also produced effects when administered
2
systemically, raising the possibility of its use as a potential therapy [11]. A model for PWS, the PWS-IC mouse, which displays hyperphagia [12], was recently used to explore 5HT2CR-mediated appetite. The PWS-IC mice showed, as expected, an increased preponderance of Htr2c RNA1 relative to RNA2 in the hypothalamus [13]. This would be expected to increase 5HT2CR-trunc levels and, therefore, reduce overall 5HT2CR function in the hypothalamus of these mice. In line with this, the PWS-IC mice demonstrated a blunted anorectic effect of a 5HT2CR specific agonist in a test assessing food consumption following an overnight fast. Again, this effect was mediated via POMC neurons in the ARC, because there was reduced immediate early gene activation of POMC neurons of PWS-IC mice following a normally anorectic dose of the 5HT2CR specific agonist [13]. Taken together, these two studies neatly demonstrate that a decrease [11] or an increase [13] in Htr2c RNA1 in the hypothalamus can alter feeding behaviour. This has obvious ramifications for the treatment of PWS (Box 1). Moreover, coupled with the identification of the biochemical role of 5HT2CR-trunc [1], these
Trends in Endocrinology & Metabolism, Month Year, Vol. xx, No. yy
studies demonstrate the functional relevance of RNA1 and/or 5HT2CR-trunc, which is likely to be extend beyond feeding behaviour and may be a molecular mechanism for moderating other 5HT2CR-mediated behaviours. 1
Behavioural Genetics Group, MRC Centre for
Neuropsychiatric Genetics and Genomics, Cardiff University, Cardiff, UK *Correspondence: [email protected] (A.R. Isles). http://dx.doi.org/10.1016/j.tem.2017.04.002 References 1. Martin, C.B. et al. (2013) RNA splicing and editing modulation of 5-HT(2C) receptor function: relevance to anxiety and aggression in VGV mice. Mol. Psychiatry 18, 656–665 2. Wilkinson, L.S. et al. (2007) Genomic imprinting effects on brain development and function. Nat. Rev. Neurosci. 8, 832–843 3. Cavaille, J. et al. (2000) Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc. Natl. Acad. Sci. U. S. A. 97, 14311–14316 4. Kishore, S. and Stamm, S. (2006) The snoRNA HBII-52 regulates alternative splicing of the serotonin receptor 2C. Science 311, 230–232 5. Sahoo, T. et al. (2008) Prader-Willi phenotype caused by paternal deficiency for the HBII–85C/D box small nucleolar RNA cluster. Nat. Genet. 40, 719–721 6. Duker, A.L. et al. (2010) Paternally inherited microdeletion at 15q11.2 confirms a significant role for the SNORD116C/ D box snoRNA cluster in Prader-Willi syndrome. Eur. J. Genet. 18, 1196–1201 7. Burke, L.K. and Heisler, L.K. (2015) 5-hydroxytryptamine medications for the treatment of obesity. J. Neuroendocrinol. 27, 389–398 8. Lam, D.D. et al. (2008) Serotonin 5-HT2C receptor agonist promotes hypophagia via downstream activation of melanocortin 4 receptors. Endocrinology 149, 1323–1328 9. Xu, Y. et al. (2008) 5-HT2CRs expressed by pro-opiomelanocortin neurons regulate energy homeostasis. Neuron 60, 582–589 10. Heisler, L.K. et al. (2002) Activation of central melanocortin pathways by fenfluramine. Science 297, 609–611 11. Zhang, Z. et al. (2016) Oligonucleotide-induced alternative splicing of serotonin 2C receptor reduces food intake. EMBO Mol. Med. 8, 878–894 12. Davies, J.R. et al. (2015) Calorie seeking, but not hedonic response, contributes to hyperphagia in a mouse model for Prader-Willi syndrome. Eur. J. Neurosci. 42, 2105–2113 13. Garfield, A.S. et al. (2016) Increased alternate splicing of Htr2c in a mouse model for Prader-Willi syndrome leads disruption of 5HT2C receptor mediated appetite. Mol. Brain 9, 95 14. Doe, C.M. et al. (2009) Loss of the imprinted snoRNA mbii52 leads to increased 5htr2c pre-RNA editing and altered 5HT2CR-mediated behaviour. Human Mol. Genet. 18, 2140–2148
Forum
Htr2c Splice Variants and 5HT2CRMediated Appetite Anthony R. Isles1,* Serotonin 2C receptor (5HT[81_TD$IF]2CR) exists as different isoforms as a result of alternate splicing. A truncated variant (5HT[81_TD$IF]2CR-trunc) has no canonical receptor function and yet shows robust expression levels throughout the brain. Recent work has demonstrated the biochemical role of this isoform and how altering levels of 5HT[81_TD$IF]2CR-trunc leads to changes in behaviour. The pre-RNA encoded by the 5HT2CR gene, Htr2c, is subject to two post-transcriptional modification processes, namely RNA editing and alternate splicing. Skipping of exon Vb of the Htr2c premRNA results in RNA1, whereas inclusion of exon Vb produces RNA2, which encodes the full-length version of 5HT2CR. Loss of exon Vb in RNA1 alters the amino acid reading frame and leads to the production of a truncated protein (5HT2CRtrunc). This isoform cannot act as a canonical seven-transmembrane receptor due to the lack of a complete second intracellular loop and, therefore, a functional G-protein-binding domain.
plasma membrane and decreasing the availability of a functional receptor [1]. Thus, altering the degree of Htr2c preRNA splicing may be another mechanism by which a cell titrates 5HT2CR function. Interest in the functional consequences of the 5HT2CR-trunc isoform has focussed on its possible role in the neurodevelopmental disorder, Prader-Willi syndrome (PWS). PWS is [82_TD$IF]characterised by significant neuroendocrine and metabolic impairment; after severe neonatal hypotonia and a failure to thrive in infancy, individuals with PWS subsequently develop an overeating phenotype (hyperphagia) that, unless managed carefully, leads to morbid obesity and its associated problems. PWS is a genetic disorder caused by the loss of several genes on the long arm of chromosome 15, specifically 15q11-q13. This cluster of genes is subject to genomic imprinting, whereby epigenetic marks laid down during gametogenesis distinguish the parental origin of the genomes and lead to the expression of some genes from the paternal genome only and others from the maternal genome only in the somatic cell lineages [2]. PWS is caused by the loss of paternal gene expression at the 15q11-q13
interval, including several small nucleolar (sno)-RNA molecules [3]. One of these snoRNAs, SNORD115, contains a recognition sequence for the HTR2C pre-RNA (Figure 1), suggesting that it has a role in regulating post-transcriptional modification. Subsequent in vitro work demonstrated that this is indeed the case, because SNORD115 promotes the inclusion of exon Vb and, therefore, the production of a full-length 5HT2CR [4]. Although rare [83_TD$IF]patients carrying microdeletions indicate that SNORD115 is not the major contributor to the disorder [5,6][84_TD$IF], loss of SNORD115 expression in PWS [85_TD$IF]0occurs in most cases, and would be expected to lead to increased production of the 5HT2CR-trunc isoform, increased sequestering of full-length 5HT2CR, and a reduction in 5HT2CR-mediated function. Activation of 5HT2CR has consequences for many aspects of behaviour, but most pertinent to PWS is its role in regulating appetite. Although the anorectic action of serotonin occurs via activation of multiple receptor subtypes, it is the 5-HT2CR that is the most predominant [7]. The central melanocortin system is the principle mediator of 5-HT2CR-regulated appetite [8,9]. The arcuate nucleus of the
Receptor encoded by fulllength splice variant Exon I
II
Htr2c pre-RNA
III
IV
Va Vb
VI
Receptor encoded by truncated splice variant
Why the 5HT2CR-trunc isoform should occur at relatively high levels naturally in the brain was not initially clear. However, it was recently discovered that, although 5’ -...CGGUAUGUAGCAAUACGUAAUCCUAUUGAGCAUAGCC...-3’ Htr2c this truncated variant cannot act as a GCAUUAGGAUAACUCGUACUA A...-5 GU C receptor, it has a critical role in overall ’ sno ..GA 3’ - . rd11 5 5HT2CR function. In vitro studies demonstrated that 5HT2CR-trunc was localized in the endoplasmic reticulum (ER), where it forms a heterodimer with the full-length Figure 1. Schematic Outlining the Binding of Snord115 to Htr2c and How Alternate Splicing Can Lead to Full-Length and Truncated Serotonin 2C Receptor (5HT2CR). Binding of Snord115 to a 5HT2CR. Consequently, 5HT2CR-trunc specific sequence in exon V of the Htr2c pre-RNA promotes the inclusion of exon Vb and the production of fullretains the full-length 5HT2CR in the ER, length 5HT2CR; the exon/alternative exon border in the proximal splice site (GG) is underlined. Skipping of exon preventing the latter from reaching the Vb alters the amino acid reading frame and produces a truncated 5HT2CR isoform. Loss of Snord115 expression, as is expected in most cases of PWS, leads to an increase in the levels of 5HT2CR-trunc.
Trends in Endocrinology & Metabolism, Month Year, Vol. xx, No. yy
1
TEM 1228 No. of Pages 2
Box 1. Therapeutic Potential? The idea that 5HT2CR-mediated feeding may be altered in PWS has raised the possibility of this being a potential route for therapeutic intervention [3,4]. This may involve the use serotonergic drugs, such as lorcaserin, a 5HT2CR-specific agonist that is already established as a major treatment for obesity generally [7], or indeed by an oligonucleotide promoting production of HTR2C RNA2 [11]. In addition to novel therapeutic pathways, these data may also highlight possible problems with existing serotonergic-based treatments. Although not necessarily the main causal factor [5,6], the loss of SNORD115 occurs in >99% of PWS cases. However, loss of SNORD115 affects the production of 5HT2CR-trunc throughout the brain and not only in the hypothalamus. We know that 5HT2CR mediates many aspects of brain function, and so it may be that, in addition to feeding, loss of SNORD115 in PWS underpins other phenotypes, such as psychiatric problems. Therefore, current 5HT2CR-specific treatments may have adverse effects or indeed exacerbate behavioural abnormalities and psychiatric problems seen in PWS [2]. A similar effect was seen in earlier work where a 5HT2CR-specific antagonist caused an enhanced effect on impulsive responding in the PWS-IC mouse model [14].
hypothalamus (ARC) contains two discrete populations of melanocortin neurons, those synthesising the anorectic melanocortin receptor (MCR) agonist, proopiomelanocortin (POMC), and those synthesising the orexigenic MCR antagonist/inverse agonist, agouti-related peptide (AgRP); 5-HT2CRs are expressed on, and modulating firing of, ARC POMC neurons [10]. Furthermore, 5HT2CR expression specifically on POMC neurons is both necessary and sufficient for the promotion of satiety and the regulation of body weight [9]. However, the extent to which altered levels of the 5HT2CR-trunc isoform impacts function had not been determined until recently. Over the past year, two studies have shown that altering the relative proportions of the 5HT2CR isoforms produces changes in feeding behaviour. The first study developed and applied an oligonucleotide that promoted the inclusion of exon 5b of Htr2c [11]. By administering this oligonucleotide directly into the hypothalamus, the authors were able to decrease the production of 5HT2CR-trunc and increase consumption of food in mice. As expected, this effect was mediated via activation of POMC neurons. Remarkably, this oligonucleotide also produced effects when administered
2
systemically, raising the possibility of its use as a potential therapy [11]. A model for PWS, the PWS-IC mouse, which displays hyperphagia [12], was recently used to explore 5HT2CR-mediated appetite. The PWS-IC mice showed, as expected, an increased preponderance of Htr2c RNA1 relative to RNA2 in the hypothalamus [13]. This would be expected to increase 5HT2CR-trunc levels and, therefore, reduce overall 5HT2CR function in the hypothalamus of these mice. In line with this, the PWS-IC mice demonstrated a blunted anorectic effect of a 5HT2CR specific agonist in a test assessing food consumption following an overnight fast. Again, this effect was mediated via POMC neurons in the ARC, because there was reduced immediate early gene activation of POMC neurons of PWS-IC mice following a normally anorectic dose of the 5HT2CR specific agonist [13]. Taken together, these two studies neatly demonstrate that a decrease [11] or an increase [13] in Htr2c RNA1 in the hypothalamus can alter feeding behaviour. This has obvious ramifications for the treatment of PWS (Box 1). Moreover, coupled with the identification of the biochemical role of 5HT2CR-trunc [1], these
Trends in Endocrinology & Metabolism, Month Year, Vol. xx, No. yy
studies demonstrate the functional relevance of RNA1 and/or 5HT2CR-trunc, which is likely to be extend beyond feeding behaviour and may be a molecular mechanism for moderating other 5HT2CR-mediated behaviours. 1
Behavioural Genetics Group, MRC Centre for
Neuropsychiatric Genetics and Genomics, Cardiff University, Cardiff, UK *Correspondence: [email protected] (A.R. Isles). http://dx.doi.org/10.1016/j.tem.2017.04.002 References 1. Martin, C.B. et al. (2013) RNA splicing and editing modulation of 5-HT(2C) receptor function: relevance to anxiety and aggression in VGV mice. Mol. Psychiatry 18, 656–665 2. Wilkinson, L.S. et al. (2007) Genomic imprinting effects on brain development and function. Nat. Rev. Neurosci. 8, 832–843 3. Cavaille, J. et al. (2000) Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc. Natl. Acad. Sci. U. S. A. 97, 14311–14316 4. Kishore, S. and Stamm, S. (2006) The snoRNA HBII-52 regulates alternative splicing of the serotonin receptor 2C. Science 311, 230–232 5. Sahoo, T. et al. (2008) Prader-Willi phenotype caused by paternal deficiency for the HBII–85C/D box small nucleolar RNA cluster. Nat. Genet. 40, 719–721 6. Duker, A.L. et al. (2010) Paternally inherited microdeletion at 15q11.2 confirms a significant role for the SNORD116C/ D box snoRNA cluster in Prader-Willi syndrome. Eur. J. Genet. 18, 1196–1201 7. Burke, L.K. and Heisler, L.K. (2015) 5-hydroxytryptamine medications for the treatment of obesity. J. Neuroendocrinol. 27, 389–398 8. Lam, D.D. et al. (2008) Serotonin 5-HT2C receptor agonist promotes hypophagia via downstream activation of melanocortin 4 receptors. Endocrinology 149, 1323–1328 9. Xu, Y. et al. (2008) 5-HT2CRs expressed by pro-opiomelanocortin neurons regulate energy homeostasis. Neuron 60, 582–589 10. Heisler, L.K. et al. (2002) Activation of central melanocortin pathways by fenfluramine. Science 297, 609–611 11. Zhang, Z. et al. (2016) Oligonucleotide-induced alternative splicing of serotonin 2C receptor reduces food intake. EMBO Mol. Med. 8, 878–894 12. Davies, J.R. et al. (2015) Calorie seeking, but not hedonic response, contributes to hyperphagia in a mouse model for Prader-Willi syndrome. Eur. J. Neurosci. 42, 2105–2113 13. Garfield, A.S. et al. (2016) Increased alternate splicing of Htr2c in a mouse model for Prader-Willi syndrome leads disruption of 5HT2C receptor mediated appetite. Mol. Brain 9, 95 14. Doe, C.M. et al. (2009) Loss of the imprinted snoRNA mbii52 leads to increased 5htr2c pre-RNA editing and altered 5HT2CR-mediated behaviour. Human Mol. Genet. 18, 2140–2148