Human 3-Methyladenine-DNA Glycosylase: Effect of Sequence Context on Excision, Association with PCNA, and Stimulation by AP Endonuclease

doi:10.1016/j.jmb.2005.01.014

J. Mol. Biol. (2005) 346, 1259–1274

Human 3-Methyladenine-DNA Glycosylase: Effect of Sequence Context on Excision, Association with PCNA, and Stimulation by AP Endonuclease Liqun Xia1, Li Zheng2, Hyun-Wook Lee1, Steven E. Bates1 Laura Federico1, Binghui Shen2 and Timothy R. O’Connor1*† 1

Biology Division, Beckman Research Institute, City of Hope National Medical Center 1450 East Duarte Road, Duarte CA 91010, USA 2

Radiation Research Division Beckman Research Institute City of Hope National Medical Center, 1450 East Duarte Road Duarte, CA 91010, USA

Human 3-methyladenine-DNA glycosylase (MPG protein) is involved in the base excision repair (BER) pathway responsible mainly for the repair of small DNA base modifications. It initiates BER by recognizing DNA adducts and cleaving the glycosylic bond leaving an abasic site. Here, we explore several of the factors that could influence excision of adducts recognized by MPG, including sequence context, effect of APE1, and interaction with other proteins. To investigate sequence context, we used 13 different 25 bp oligodeoxyribonucleotides containing a unique hypoxanthine residue (Hx) and show that the steady-state specificity of Hx excision by MPG varied by 17-fold. If APE1 protein is used in the reaction for Hx removal by MPG, the steady-state kinetic parameters increase by between fivefold and 27-fold, depending on the oligodeoxyribonucleotide. Since MPG has a role in removing adducts such as 3-methyladenine that block DNA synthesis and there is a potential sequence for proliferating cell nuclear antigen (PCNA) interaction, we hypothesized that MPG protein could interact with PCNA, a protein involved in repair and replication. We demonstrate that PCNA associates with MPG using immunoprecipitation with either purified proteins or whole cell extracts. Moreover, PCNA binds to both APE1 and MPG at different sites, and loading PCNA onto a nicked, closed circular substrate with a unique Hx residue enhances MPG catalyzed excision. These data are consistent with an interaction that facilitates repair by MPG or APE1 by association with PCNA. Thus, PCNA could have a role in short-patch BER as well as in long-patch BER. Overall, the data reported here show how multiple factors contribute to the activity of MPG in cells. q 2005 Published by Elsevier Ltd.

*Corresponding author

Keywords: base excision repair; DNA glycosylase; protein–protein interaction

Introduction Cells are constantly subjected to insults from exogenous and endogenous agents.1–3 To defend against DNA damage, cells have evolved DNA

repair systems to maintain genetic stability. The base excision repair (BER) pathway is responsible mainly for the repair of structurally small DNA adducts.1,3–10 DNA glycosylases initiate the BER pathway by recognizing the DNA adducts and

† T.R.O’C. is on leave from CNRS UMR8113 Laboratoire de biotechnologie et pharmacologie ge´ne´tique applique´. Abbreviations used: 3-meAde, 3-methyladenine; 7-meGua, 7-methylguanine; Ab, antibody; AP, apurinic/ apyrimidinic, abasic; APE1, apurinic/apyrimidinic endonuclease HAP or REF-1; BER, base excision repair; 3Ade, ethenoadenine; ECL, enhanced chemilumi-nescence; FEN1, Flap endonuclease 1; Hx, hypoxanthine base; HMYH, human MutY homologue; I, hypoxanthine nucleoside; IP, immunoprecipitation; MBD1, methyl CpG binding domain protein 1; MPG, methylpurine-DNA glycosylase, AAG, APNG, ANPG; ODN, oligodeoxyribo-nucleotide; PCNA, proliferating cell nuclear antigen; POLb, DNA polymerase b; RF, replicative form; RFC, replication factor C; SCD, sequence context-dependent; UNG, uracil-DNA glycosylase. E-mail address of the corresponding author: [email protected] 0022-2836/$ - see front matter q 2005 Published by Elsevier Ltd.

1260 catalyze the scission of the glycosidic bond releasing damaged or mispaired bases.11,12 In the second step of BER, apurinic/apyrimidinic (AP) endonucleases recognize and cleave the phosphodiester backbone at abasic sites with phosphodiesterase activity. AP endonucleases will also remove fragmented sugar residues, such as phosphoglycolate, from the 3 0 terminus of strand breaks.13–17 BER is completed by polymerization, excision of dRP or a flap structure, and ligation.18–24 Human 3-methyladenine-DNA glycosylase (MPG) is a DNA glycosylase that excises a number of modified DNA bases.12,25–27 As a result of its broad substrate specificity, MPG protects mammalian cells against DNA damage by methylating agents.28 The structure of MPG, a 32 kDa protein, indicates that it flips a DNA base out of the helix during catalysis, as observed for other DNA glycosylases.29,30 The relatively slow in vitro reaction kinetics observed for MPG, raises questions about how these enzymes with poor turnover numbers efficiently locate DNA damage in vivo. The identification of a damage site by MPG protein is most probably based on several factors. One important factor is DNA sequence. Both in vitro and in vivo data using truncated MPG and human cells have shown that MPG sequence context specificity has a role in defining enzyme specificity.31 In vitro, Aag, the murine equivalent of MPG, has demonstrated SCD excision.32 Both of these investigations used only first-order rate approximations in their conclusions, so it was difficult to determine if binding or release was most responsible for sequence context specificity. One of the best ways to determine such differences would be to obtain steady-state kinetic parameters to distinguish contributions to sequence context-dependent (SCD) excision. Despite the important role of SCD excision in BER, it is not the only factor that could increase the rate of BER in vivo. Another potential factor is that subsequent steps of BER could help to drive the reaction. One example of this is found for other DNA glycosylases with the APE1 (HAP or REF-1) enzyme. APE1 catalyzes the second step of BER13–16,33–35 and some DNA glycosylase activities, including those of HOGG1, TDG, and UNG are stimulated in the presence of APE1.36–39 The enhancement of DNA glycosylase activity by APE1 has been linked to the number of available AP sites in the DNA.37 Such an enhancement of the kinetics would not necessarily change relative rates of SCD excision. The formation of complexes also assists in excision and the subsequent steps in MPG-catalyzed repair. The majority of enzymes effecting repair in the BER pathway do not require co-factors or other complexes to complete the necessary repair reactions. However, the existence of several protein complexes in BER indicates that repair via this pathway is more intricate than suggested by the fact that the enzymes maintain activity without co-factors.40–44 This, coupled with the inefficiency of

Factors Influencing MPG-catalyzed Excision

cleavage by DNA glycosylases in the first step of BER, suggests that protein complexes rather than isolated DNA glycosylases are important in the first step of the BER process. One identified complex between MPG and HHR23 is involved in recognition of DNA damage in BER.45 HHR23 also binds to XPC and TDG, another DNA glycosylase that removes T from G/T mispairs and 3C.46 In addition to an interaction with HHR23, MPG interacts with MBD1 and, in the presence of an alkylating agent, dissociates from methylated promoters.47 Reduction in the expression of the MBD1 gene using short inhibitory RNA increases the sensitivity to alkylating agents, suggesting that the interaction has biological importance. Therefore, protein–protein contacts with MPG can have significant implications for cell survival. Proliferating cell nuclear antigen (PCNA) was discovered originally in the nucleus of dividing cells and therefore was closely linked to DNA replication.48 It binds to numerous proteins and, in addition to replication, it has roles in repair and post-replicative processing, including methylation and chromatin assembly.49–59 PCNA has a homotrimeric toroidal structure that encircles the DNA, often referred to as a sliding clamp.60–63 The PCNA toroid is assembled onto DNA using the multisubunit loading factor RFC.51,64–68 Once loaded onto DNA, PCNA can scan, which allows the interaction of a number of proteins with DNA in a sequence-independent manner.49,67–75 These interactions are partly through a consensus motif, QXX(I/L/M)XX(F/H)(F/Y), found in a number of proteins. 69 Thus, PCNA could function as a molecular adaptor for recruiting factors to a DNA repair site, and it has been shown to interact with at least two DNA glycosylases, UNG and HMYH.76,77 APE1, the major AP endonuclease, also forms complexes with POLb and FEN1.78,79 This complex is proposed to play a role in switching between short-patch and long-patch BER. Thus, it is possible that PCNA serves as a platform for repair enzymes to scan DNA.72–75,80 Here, we examine the effect of sequence context and enhancement of MPG excision in the presence of APE1, and show that PCNA forms a complex with MPG both in vitro and in extracts from cells. MPG catalyzes the removal of Hx from different 25 bp oligodeoxyribonucleotides (ODNs) with a 17fold difference in steady-state specificity (kcat/Km). Removal of Hx is also more efficient by MPG and PCNA than it is by MPG alone.

Results Both kcat and Km contribute to SCD MPG excision MPG protein catalyzes removal of Hx and leaves an abasic site in DNA following the release of the damaged base. Reports in the literature have shown that MPG manifests SCD excision in removal,31,32

1261

Factors Influencing MPG-catalyzed Excision

Table 1. Kinetic constants for Hx excision by MPG in different sequence contexts

There is a 17-fold difference in the sequences studied for kcat/Km values. The ODN highlighted in gray is the ODN used for the DNA glycosylase assays with the APE1 enzyme.

on the basis of initial first-order rate constants. However, the use of those rate constants could mask the differences observed and does not provide intrinsic kinetic constants, i.e. kcat and Km. Since we were interested in determining factors defining the kinetics of SCD removal of a damaged Hx base, we performed steady-state kinetic analyses to determine kcat and Km for a series of ODNs. In this steady-state analysis, the pseudo second-order rate constants, kcat/Km represent the specificity for a given substrate. The higher kcat/Km values represent better substrates for an enzyme. We designed 13 ODNs based on some from a previous study32 or potential mutation hot spots in the human P53 gene for A/C transversion mutations (corresponding to Hx remaining in DNA) (Table 1). Representative steady-state data from one Hx-containing ODN manifesting the slowest kinetics and another with one of the fastest kinetics of excision by MPG are shown in Figure 1, along with the corresponding Lineweaver–Burk plots. These data show the extremes of detection of SCD excision. The accumulated steady-state kinetic data for all the ODNs are in the Table 1. The fact that steady-state kinetic data are more representative of SCD differences is found using an example of ODNs 1 and 13 in Table 1. Using first-order rate constants for ODNs 1 and 13 resulted in only a threefold difference in initial rates (data not shown), whereas that differ-

ence using steady-state parameters is almost 17fold. The data in the Table 1 show that even with a limited number of sequences, there is a large difference in the excision kinetics (17-fold difference in the range of the kcat/Km values). However, the ranges of the kcat and Km values are similar. These data are consistent with both factors contributing to SCD Hx excision by MPG, but Km has a larger influence on the steady-state kinetic parameters. Rate of MPG-catalyzed excision of Hx is enhanced in the presence of APE1 In the second step of BER, APE1 cleaves the abasic site. In some cases, the presence of APE1 has been demonstrated to accelerate the removal of damaged bases by DNA glycosylases.81–83 Therefore, we used human recombinant APE1 in the MPG-catalyzed excision reaction of Hx to determine if AP endonuclease could accelerate excision. Figure 2 demonstrates that in the presence of APE1, the rate of MPG cleavage of the Hx substrate is enhanced to over fivefold that of the reaction in the presence of only MPG. To examine the effect on the initial rate of Hx excision by MPG in the presence of APE1, the concentration of MPG was reduced to 1 nM and different molar ratios of APE1 to MPG were used at a single one minute time-point. Addition of APE1 to the

1262

Figure 1. Sequence context-dependent steady-state kinetic parameters for MPG excision of Hx. Phosphorimager scans for excision of Hx from (a) ODN 1 gcgatgtagctaaaaIcgatgatcc and (b) ODN 13 tgcatgggcgggItttaccggaggc (Table 1) from DNA glycosylase assays in two different ODNs using 2 nM MPG and different substrate concentrations (20 nM, 40 nM, 60 nM, 80 nM, and 100 nM) for five minutes. (c) Lineweaver–Burk plots for steady-state kinetic parameters for ODNs 1 (filled squares) and 11 (filled circles). Error bars represent the standard deviation of the data from three independent experiments. Further details are given in Materials and Methods and in Table 1.

DNA glycosylase reaction increased the rate of product formation over fivefold at an MPG to APE1 molar ratio of 1:20 (Figure 3). There is a significant enhancement of the reaction rate in the presence of APE1 that is correlated with the amount of APE1 in the reaction. At higher concentrations of MPG, the fold enhancement of the rate is even greater (Figure 2). Enhancement of MPG-catalyzed SCD excision by APE1 In order to determine the influence of APE1 on the intrinsic kinetic parameters (kcat and Km), we chose several ODNs containing Hx to determine the steady-state kinetic parameters in the presence of APE1 (Table 1, ODNs 1, 4, 9, and 10). An example of the difference of the steady-state parameters in the presence of APE1 is shown in Figure 4. If APE1 is added to the reaction at even a low APE1 to MPG ratio (2:1), the kcat/Km ratio is increased significantly for the reaction (by a factor of 6). This increase in the ratio is due, in part, to an increase in

Factors Influencing MPG-catalyzed Excision

Figure 2. APE1 enhances the rate of MPG-catalyzed Hx release at a fixed ratio of MPG to APE1. DNA glycosylase assays were performed as a function of time using 20 nM ODN 12 (tgcatgggcggcItgaaccggaggc) substrate (Table 1), 2 nM MPG, and either no or 1 nM APE1 protein. (a) Phosphorimager scans of MPG with or without APE1 in the reaction as a function of time. (b) Percentage cleavage of ODN 12 based on the data from the phosphorimager scans in (a).

the kcat value, which suggests that there is a faster release of the product reflected in a higher turnover number. For all the ODNs, although the kcat values increase, the range (sixfold) is maintained. Despite this increase in kcat, the major effect observed is the decrease in the range of Km. Without APE1, there is a 21-fold difference in the range. However, when APE1 is used in the reaction, the Km range is threefold. In this case, it is interesting to note that the Km value for ODN 1 is actually lower than that of ODN 10. Therefore, there is greater enhancement of the steady-state parameters in the presence of APE1 for ODN 1 (27-fold, Table 1) than for ODN 10 (fivefold, Table 1). Since the major alteration in the steady-state parameters appeared to be the change in Km, we performed electrophoretic mobility shift assays using ODNs and MPG either with or without APE1. Mobility shifts were observed in the presence of ODNs and MPG as expected.84 However, in the presence of ODNs, MPG and APE1, no mobility shift was observed (data not shown). MPG associates with PCNA in vitro MPG removes potential blocks to DNA replication, such as 3-meAde and 3-meGua. In addition, MPG has a potential binding site for PCNA that is similar to the FEN1 binding site.70 The major difference is that the orientation of the sequence is inverted (C/N terminus) compared to the normal

Factors Influencing MPG-catalyzed Excision

Figure 3. APE1 protein increases the rate of MPGcatalyzed cleavage of the Hx in ODN 10 (tgcatgggcggc Itgaaccggaggc). (a) Phosphoimager scan using different molar ratios of APE1 to MPG. The DNA glycosylase assays were performed using 20 nM Hx containing substrate, 1 nM MPG protein and different amounts of APE1 protein for five minutes. (b) Fold increase in firstorder cleavage rate of substrate as a function of the molar ratio of APE1 to MPG. The fold increase was calculated by comparison of the initial rate of removal of Hx without APE1 to that with APE1.

consensus sequence of Q1X2X3[L/I]4X5X6F7[F/Y]8. The MPG sequence in that region is YFCMNISSQ, similar to that of the consensus sequence for PCNA recognition. Previously, another member of the BER pathway, APE1, has been shown to interact with PCNA.79 Therefore, we tested the possibility that PCNA could interact with MPG and the effect of APE1 on a potential interaction using the homogeneous proteins for in vitro immunoprecipitation (Figure 5(a), lanes 1, 7, and 9). Lane 7 in Figure 5(a) uses anti-MPG antibody (Ab) for immunoprecipitation, and demonstrates that PCNA and MPG interact. If anti-MPG Ab or anti-APE1 Ab is used and APE1 is included in the immunoprecipitation, much more PCNA is immunoprecipitated (Figure 5(a), lanes 2 and 3, and lanes 6 and 7). This suggests that the interactions among the three proteins are augmented in the presence of all three proteins, which could indicate tertiary complex formation. Moreover, the interaction between MPG, APE1, and PCNA is mediated by PCNA because MPG and APE1 do not interact (Figure 5(a), lane 8). Since both APE1 and MPG interact with PCNA, we tested the possibility that increased APE1 in the immunoprecipitation could inhibit the interaction of MPG with PCNA. Figure 5(b) shows that there is no competition of MPG and APE1 for PCNA binding

1263

Figure 4. Effect of APE1 on steady-state kinetic parameters for ODN 10 (tgcatgggcggcItgaaccgg aggc). Lineweaver–Burk plots were used to determine the steady-state kinetic parameters Km and kcat for MPG protein-catalyzed excision of Hx from DNA without or with APE1 protein. V, reaction velocity in nM/s. (a) Phosphorimager scans for DNA glycosylase assays without APE1 using 2 nM MPG and different concentrations (20 nM, 40 nM, 60 nM, 80 nM, 100 nM, and 120 nM) of substrates for five minutes. (b) Phosphorimager scans for DNA glycosylase assays with APE1 using 2 nM MPG, 10 nM APE1, and different concentrations (20 nM, 40 nM, 60 nM, 80 nM, 100 nM, and 120 nM) of substrates for five minutes. (c) Lineweaver–Burk plots yielding Km and kcat from DNA glycosylase assays with or without APE1. Error bars represent the data collected from three independent experiments.

at the concentrations studied. In fact, immunoprecipitation with PCNA in the presence of all three proteins is increased (Figure 5(a), compare lanes 2 and 3, 6 and 7, and (b)). That suggests that there may be a cooperative effect of the interaction of the three proteins to form a ternary complex. Such a ternary complex could provide a basis for recognition of damage in DNA and maintain DNA repair enzymes of the same pathway in close proximity. In support of that assertion, the immunoprecipitation of PCNA, MPG, and APE1 using anti-APE1 Ab reveals that MPG is also detected (Figure 5(a), lane 10). Figure 5 shows that all three Abs against the different proteins can be used for immunoprecipitation, thus eliminating the possibility that the interactions are artifacts dependent on a single

1264

Factors Influencing MPG-catalyzed Excision

Figure 5. Western blots showing MPG, APE1, and PCNA interactions in vitro. Western blots were imaged using ECL. The immunoprecipitation antibodies were anti-MPG Ab, anti-APE1 Ab, or anti-PCNA. The input amounts for the different proteins are indicated in parentheses. The antibody used in the Western analysis is indicated below the Figure. (a) Western blots of co-immunoprecipitations of mixtures of MPG, APE1, or PCNA. Lanes 4, 5, and 11 are control lanes (Cont) using the purified proteins. Lane 1, MPG, APE1, and PCNA mixture IP of PCNA using anti-MPG AB, 2, MPG, APE1, and PCNA mixture IP of PCNA using anti-APE1 Ab, 3, APE1 and PCNA mixture IP of PCNA using anti-APE1 Ab. 4, PCNA control (2.7 pmol, 100 ng), 5, PCNA control (2.7 pmol, 100 ng), 6, MPG, APE1, and PCNA mixture IP of PCNA using anti-MPG Ab, 7, MPG and PCNA mixture IP of PCNA using anti-MPG Ab, 8, MPG and APE1 mixture IP using anti-APE1 Ab, 9, MPG, APE1, and PCNA mixture IP of MPG using anti-MPG Ab, 10, MPG, APE1, and PCNA mixture IP of MPG using anti-APE1 Ab, 11, MPG control (2.7 pmol, 100 ng). (b) Increased APE1 concentration increases the amount of co-immunoprecipitation of PCNA. The Western blot shows that there is no significant competition between APE1 and MPG for PCNA binding. The right-hand part of the Figure was constructed from a densitometric scan of the ECL image.

Ab. Therefore, the immunoprecipitation results are consistent with the formation of a complex between MPG and PCNA. Our initial observation of a sequence similar to that observed as the interaction site between FEN1 and PCNA, led us to test the interaction between PCNA and MPG by immunoprecipitation. To observe the interaction by another means and to screen for potential interaction sites, we used a yeast two-hybrid system with the PCNA fused to the GAL4 activation domain and MPG fused to the GAL4 DNA-binding domain. In addition to the fulllength MPG cDNA, N-terminal deletions of MPG in the pAS2-1 vector were tested for interactions with PCNA. An MPG mutant with the YFCMNISSQ sequence deleted was tested for capacity to interact with PCNA. Neither the PCNA nor MPG vector alone activated transcription. However, an interaction was observed between PCNA and MPG. None of the N-terminal MPG deletion mutants abrogated the MPG-PCNA interaction completely, but the growth was reduced from that of the full-length MPG. The mutant MPG with the deletion in the YFCMNISSQ sequence also showed reduced interaction with PCNA compared to the full-length MPG. However, more experiments will

be required to define the actual MPG-PCNA interaction sites, but these data indicate that the YFCMNISSQ has at least a partial role in that interaction. PCNA increases the rate of Hx excision by MPG Since MPG interacts with PCNA and there is an enhancement of excision in the presence of APE1, we examined the effect of these proteins on the excision of Hx. If the excision of MPG is conducted in the presence of PCNA, there is no increase in the MPG-dependent cleavage rate even at a 320-fold molar excess of PCNA compared to MPG (data not shown). However, if MPG excision of Hx occurs in the presence of PCNA and APE1, an increase of w25% is observed when excess PCNA is added to the reaction (Figure 6(a)). If the concentration of PCNA is increased from 40 nM to 80 nM, further enhancement of MPG-catalyzed excision is observed but there is only a small PCNA-dependent effect on the MPG-catalyzed excision of Hx (Figure 6(b)). In addition to the excision of Hx, we examined binding of MPG to the ODN in the presence of PCNA and/or APE1. No enhancement of MPG binding to the linear fragment is observed

Factors Influencing MPG-catalyzed Excision

1265 MPG excision of Hx is enhanced by PCNA on a nicked plasmid substrate with a unique damage site Linear ODNs do not provide a substrate that will permit PCNA loading with subsequent one-dimensional tracking along the DNA to examine longrange effects on the rate of excision of Hx by MPG/PCNA. To test such effects, the experiment illustrated in Figure 7(a) was performed. A closed circular plasmid was prepared with a unique Hx residue at a defined position and a unique nick was introduced using a nicking enzyme N.BbvC IB (Figure 7(b)). The PCNA was loaded using the replication factor C (RFC) complex and then MPG was added. The reaction mixture was isolated at five and 15 minutes. Figure 7(c) shows that there is a 1.7-fold increase in the amount of product produced when PCNA is present in the reaction. Therefore, PCNA increases the MPG-catalyzed excision of Hx from DNA. Co-immunoprecipitation of MPG, PCNA, and APE1 from human cells

Figure 6. Influence of PCNA on the activity of the MPG and APE1 on the MPG-catalyzed excision of Hx from an ODN substrate. DNA glycosylase assays were performed using 20 nM of 25mer ODN 12 (Table 1) with Hx, 5 nM MPG, 1 nM APE1 and different concentrations (2 nM, 4 nM, 20 nM, 40 nM, 80 nM) of PCNA. Reaction times were for five minutes. (a) Phosphoimager scans showing excision of Hx using PCNA and MPG. DNA glycosylase assays were performed using 20 nM 25mer ODN 12 (Table 1) with Hx, 5 nM MPG, 1 nM APE1 and 80 nM PCNA. Histograms referring to the phosphorimager scans showing an effect of PCNA on excision are shown below the scan. The numbers in the histograms refer to the lanes in the phosphorimager scan from left to right. The values represent the average of three independent experiments and the error bars represent the standard deviation of the error. (b). Phosphoimager scans showing an effect of excision as a function of PCNA concentration. DNA glycosylase assays were performed using 20 nM 25mer ODN 12 (Table 1) with Hx, 5 nM MPG, 1 nM APE1 and 2–80 nM PCNA for five minutes. Histograms referring to the phosphorimager scans showing an effect of PCNA concentration on excision are shown below the scan. The numbers in the histograms refer to the lanes in the phosphorimager scan from left to right. The values represent the average of three independent experiments and the error bars represent the standard deviation of the error.

in the presence of PCNA (data not shown). Even at a concentration of APE1 that is 50-fold lower than the concentration of MPG, binding to the Hx-containing ODN is not observed. This is presumably due to the excision and subsequent cleavage of the substrate. No significant increase in excision by MPG is observed using bovine serum albumin (BSA) as a control in place of PCNA.

MPG protein interacts with PCNA during an in vitro reaction, but that does not demonstrate the interaction from complex mixtures. The MPG gene is not expressed strongly in most human cells or cell lines; therefore, a construct expressing MPG with a FLAG-tag was transiently introduced into human AD293 cells. Whole cell extracts prepared from the AD293 cells transiently expressing FLAG-tagged MPG was used for immunoprecipitation. These extracts showed that a significant amount of FLAGtagged MPG immunoprecipitates with PCNA when a Western blot is performed on the immunoprecipitated material (Figure 8(a)). An interaction is demonstrated also by immunoprecipitating MPG using an anti-PCNA Ab (Figure 8(b)). Therefore, these data are consistent with complex formation between MPG and PCNA. It is possible that the use of overexpressed MPG could influence immunoprecipitation. The amount of MPG in human cells is small; thus, it is difficult to detect MPG using anti-MPG Abs using enhanced chemiluminescence detection methods. To detect the MPG protein at low levels, we used near-infrared detection for all the proteins in AD293 cells. Antibodies against all three proteins were used to perform immunoprecipitation from AD293 cell (Figure 9). Both antiMPG and anti-APE1 immunoprecipitate PCNA (Figure 9(a)). Using PCNA for immunoprecipitation demonstrates that a weak band for MPG is detected (Figure 9(b)). This could be due to the fact that there are many proteins that interact with PCNA and with a low intracellular concentration of MPG, only a small amount of MPG is detected. Similarly for APE1, only small amounts of APE1 are detected in the AD293 cells when PCNA is used for immunoprecipitation (Figure 9(c)). Taken

1266

Factors Influencing MPG-catalyzed Excision

Figure 7. Influence of PCNA on the activity of the MPG and APE1 on the MPG-catalyzed excision of Hx from a plasmid substrate. (a) Outline of the experiment to test the effect of PCNA on MPG-catalyzed excision of Hx. The stop sign in red indicates the formation of a specific band used as a consequence of primer arrest of DNA synthesis. Note that none of the species is drawn to scale. (b) Characterization of the plasmid construct M13mp18-P53 exons 5-9. M refers to l HindIII-digested markers, RF is the covalently closed circular (ccc) DNA following synthesis and ligation, and MPG/Nth refers to removal and incision of the Hx by MPG and Nth, respectively. (c) Excision of Hx from M13mp18-P53 exons 5–9 by MPG with or without PCNA. Following the incision reaction with or without PCNA loading, the DNA was subjected to primer extension and imaged using a phosphorimager scan. The internal standard band is a band of identical intensity in all the lanes. The right-hand portion of the Figure shows the intensity changes in cleavage for the four lanes based on phosphorimager scans related to the internal standard and the five minute time-point without PCNA (lane 1).

together, these data show that there is an interaction between MPG, PCNA, and APE1.

Discussion Modified bases, including 3-meAde, Hx, and

3-Ade are excised in mammalian cells by MPG in the first step in the BER pathway.12,85–94 Here, we examine several aspects that are related to SCD repair and removal of DNA damage by MPG. Those factors include SCD excision, assistance from APE1 in enhancing the excision rate of MPG, and identify PCNA as a protein that interacts with MPG.

Factors Influencing MPG-catalyzed Excision

Figure 8. Interaction of MPG and PCNA as evidenced by co-immunoprecipitation from human cell extracts. (a) Co-immunoprecipitation of PCNA from transiently transfected AD293 cells cultured using pCMV-Tag1, pCMV-Tag-MPG or pCMV-Tag-APE1 vectors. An antiFLAG Ab was used as the primary antibody for immunoprecipitation. Primary antibodies using antiPCNA were used to perform Western blot analysis. The left panel visualizes the immunoprecipitation of the MPG-PCNA complex and the right panel the immunoprecipitation of the APE1-PCNA complex. The AD293 cells transfected with vector only are in lanes 1 and 3. (b) Co-immunoprecipitation of MPG with PCNA using AD293 cells transfected transiently using pCMV-TagMPG. Immunoprecipitation was performed using an antiPCNA Ab. Lane 1 is a control with purified MPG and lane 2 is the sample demonstrating interaction.

SCD excision of Hx Left unrepaired, Hx in DNA could lead to a mutation.95–97 Therefore, sequences from which Hx is removed slowly could indicate that those regions are more prone to mutation than sequences where Hx excision is rapid. If those sequences are found in regions coding for a protein with a vital role in cellular growth and control, e.g. P53, such a mutation could have a role in tumor development. In vivo, SCD repair has at least a 30-fold dependence on nucleotide position in the PGK1 gene in normal human fibroblasts that correlates with initial rate constants for excision by MPG.31 Another report has shown that there are differences up to 27-fold in first-order rate constants with respect to excision of Hx with short ODNs for the murine orthologue of MPG, Aag.32 The kinetics of excision of 7-meG at 120 different positions were evaluated in vitro and found to have initial rate constants that varied up to 180-fold.31 In this study, the range of the ratio of kcat/Km was w17-fold in 13 different 25mer ODNs, each with a unique Hx residue. Those ODNs do not demonstrate as great a range of kinetic values as that observed in one previous study,31 but not as many sequences were examined. There are several possible explanations for these differences. One is

1267

Figure 9. Immunoprecipitation of MPG, APE1, or PCNA from AD293 cells. (a) Co-immunoprecipitation of PCNA from AD293 cells using anti-MPG or anti-APE1 Abs. Anti-MPG Ab or anti-APE1 was used as the primary antibody for immunoprecipitation.An anti-PCNA primary Ab was used to perform Western blot analysis. A secondary Ab coupled to a near-infrared dye was used to reveal the PCNA band. The band on the right is a control with homogeneous PCNA. (b) Co-immunoprecipitation of MPG from AD293 cells using an anti-PCNA Ab. A secondary Ab coupled to a near-infrared dye was used to reveal the MPG band. The band on the left is a control using a homogeneous truncated MPG. Note that the intense band is from an IgG light chain that is part of the polyclonal Ab used in the immunoprecipitation. (c) Coimmunoprecipitation of APE1 from AD293 cells using anti-PCNA Ab. A secondary Ab coupled to a nearinfrared dye was used to reveal the APE1 band. The band on the left is a control using a homogeneous truncated MPG.

that a complete range of different sequences was not scanned in this study and in that reported by Wyatt & Samson.32 The initial rates investigated by us previously31 scan a wide range of sequences compared to the relatively few ODNs examined in this and other studies using ODNs.32 Another possibility is that excision is dependent also on the length of the DNA. Thus, the rate of excision could be enhanced or reduced in longer DNA compared to shorter ODNs. These potential sources for rates of SCD must eventually be examined to determine factors that influence both repair and mutagenesis. Although all the factors mentioned above may play a role in defining SCD excision, we have shown that both binding and catalysis factors define SCD for MPG-catalyzed excision of Hx from DNA, as indicated by the fact that SCD excision in these 13 examples is dependent on both the kcat and the Km values. Previously, the thermal stability of MPG has been linked to SCD excision for 3A using several ODNs.98 In another investigation, the thermal stability and the ease of removing a base from the helix has been linked to reaction rate.99 The more stable the sequence surrounding the ODN, the greater the rate of excision of 3A. The fact that both kcat and Km contribute to the SCD excision suggests

1268 that it is necessary to evaluate a large number of sequences to obtain a valid range of kinetic values for SCD excision by MPG. Despite the dependence on both factors (a sixfold difference in kcat and 21fold difference in Km), the Km factor is by far the greater driving force in the differences observed. Since the Km is linked to binding, that suggests that the differences observed are, at least in part, related to thermodynamics. It is significant that the slowest reaction observed in our study (ODN 1, Table 1) had an average value for kcat, but a very high value for Km and the fastest reaction observed (for ODN 3) had a value for kcat similar to that for Hx excision from ODN1, but a low value for Km (ODN 13, Table 1). The dominance of the Km value in the reaction is noted by the fact that the standard deviation of the kcat values in Table 1 is 2.6!10K3 sK1, whereas the standard deviation of the Km values is 54 nM. In fact, most of the Km values in this series of ODNs are clustered between 10 nM and 30 nM (nine out of 13). There are two values that are 68 nM and 212 nM that represent the slowest reactions. The other significant feature is that the Hx in both cases for the slow reaction has a CGA on the 3 0 side of the adduct. The SCD sites that have Hx removed much more slowly are potentially important for mutagenesis, since those sites would be more likely to remain in DNA and provide a template to fix a mutation during DNA synthesis. To better evaluate the upper and lower limits for the reaction parameters, more sequences must be evaluated. Enhancement of Hx excision by MPG in the presence of APE1 Another factor that enhances MPG-catalyzed excision of Hx is APE1. APE1 has been reported to enhance excision of some other DNA glycosylases, but has not been investigated for MPG.36,39,82,83,100 Here, we have shown that APE1 enhances the excision of Hx significantly with respect to both the initial rate and the steady-state kinetic parameters. Data presented by Vidal et al. suggest that the mechanism of APE1 enhancement is based on APE1 taking up available AP binding sites following removal of 8-oxoG from DNA by hOGG1.82 This is different from a model suggesting that DNA glycosylases are actively forced off the AP site by APE1.36 However, data do not support the latter hypothesis, since the dissociation rate for HOGG1 is not increased in the presence of APE1. Therefore, the increased rate for excision is based on the exclusion of HOGG1 from abasic sites by binding of APE1, and not an active removal of the DNA glycosylase from the abasic site. The increased rate of MPG excision in the presence of APE1 presumably occurs by a similar mechanism. Despite the importance of APE1-mediated acceleration of the excision reaction in vitro, no data have demonstrated that APE1 stimulates DNA glycosylasecatalyzed excision of any adduct in vivo. Nonetheless, the stimulation of MPG activity by APE1 should help to increase the rate of removal of Hx

Factors Influencing MPG-catalyzed Excision

from DNA in vivo. In addition to APE1, other proteins could serve to stimulate reaction rates in vivo through protein-protein interactions. Such interactions could have a cumulative effect on the rate of repair of damaged bases in vivo. SCD enhancement of Hx excision by MPG in the presence of APE1 We have demonstrated that there is a SCD effect for excision without APE1. The steady-state kinetic parameters for the four ODNs in Table 1 determined in the presence of APE1 maintain the same order of kcat/Km, but the range is narrower than in the absence of APE1. Again,the major driving force in determining the kcat/Km values is the Km. However, upon addition of APE1 to the Hx excision reaction, there is a greater increase in the kcat/Km parameters for the ODNs that are slower in the absence of APE1 than for those ODNs that have Hx removed more rapidly without APE1 (e.g. compare ODNs 1 and 10 in Table 1). The reactions for the faster ODNs have increased kcat/Km values, but those values are not increased by as much as for the slower ODNs. The tenfold difference observed between ODNs 1 and 10 is reduced to twofold in the presence of APE1. The SCD repair of Hx in vivo may not be as great as that observed for 7-meGua adduct repair in vivo.31 But Hx excision is accelerated up to at least 27-fold in the presence of APE1 and that could minimize the difference in SCD observed for MPG alone and MPG with APE1. Another factor that could influence repair of Hx in vivo is the role of DNA repair systems other than BER. Nucleotide excision repair and BER are proposed to excise 7-meGua and similar roles could be envisaged for repair of Hx.101 Eventually, it will be necessary to compare SCD excision of 7-meGua and Hx to determine whether similar observations are obtained for both modified bases. MPG associates with PCNA PCNA is protein that has roles in several cellular processes. In addition to replication, PCNA strongly stimulates long-patch (2-10 nt) BER.54 Our data show that MPG protein interacts with PCNA both in vitro and in vivo, suggesting that PCNA may have a role in adduct recognition in short-patch BER. In this role, PCNA could stimulate MPG-catalyzed Hx excision. On the basis of immunoprecipitation data, MPG and PCNA interact, but we do not find evidence for that interaction based on an electrophoretic mobility-shift assay (EMSA) between MPG, PCNA, and an Hx-containing ODN. This does not mean, however, that there is no interaction between PCNA and MPG, since the formation of a trimeric complex (PCNA, MPG, DNA) may be so rapid that it is impossible to observe a gel mobility-shift. Gel mobility-shifts are performed also on ODNs that are generally under 50 bp in length. To complicate gel mobility-shift assays, PCNA forms a trimer that is loaded onto

1269

Factors Influencing MPG-catalyzed Excision

genomic DNA or closed circular DNA by the RFC complex.102 The PCNA homotrimer, once formed, has a shape that allows the DNA helix to pass through the center (Figure 7(a)). The fact that loading cannot occur properly with an ODN substrate may be another reason that a supershift is not observed. Despite difficulties in the observation of the MPG-PCNA interaction on DNA, immunoprecipitation demonstrates that such a complex forms in vitro and in cell extracts. Once loaded onto DNA, the PCNA complex can provide a basis for the interaction of proteins involved in replication or repair, including MPG. There is an advantage conveyed by the formation of a complex of MPG-PCNA on a closed circular substrate with a single Hx residue at a defined position. The approximate twofold increase in the rate suggests that the PCNA could play a role in shuttling the MPG to damage, but does not greatly alter the catalysis for the removal of Hx. The formation of such a complex could facilitate recognition and repair by maintaining enzymes close to the DNA and providing them with a onedimensional diffusion apparatus (PCNA) that could deliver them to the site of damage. Association of PCNA, APE1, and MPG suggests that a tertiary complex could form in vivo. The formation of a tertiary complex would make it possible for both the MPG and APE1 to be conveyed to damage site, perhaps simultaneously. Although it may be difficult to have both APE1 and MPG bound to PCNA simultaneously in vivo, there could be factors that favor such an arrangement. More work is necessary to elucidate the sites used by MPG and APE1 to complex with PCNA as well as the biological role of the interaction, but the transport of DNA repair enzymes to damage sites one important way that cells could enhance in vivo repair rates compared to those in vitro, but it is clear that there is at least a partial role for the YFCMNISSQ sequence in MPG. The use of PCNA to deliver DNA repair proteins provides an attractive model for shuttling of proteins to damage sites, and at least one other protein has been proposed to serve as a scaffold for repair proteins. PCNA can accommodate MPG and APE1 simultaneously, suggesting that PCNA delivers the first and second enzymes in repair of Hx via BER. Another protein, XRCC1, has an important role in bringing proteins to DNA during BER.37,103,104 Both XRCC1 and PCNA interact with a number of proteins involved in repair. The wide range of interactions must be evaluated for their biological relevance, and the role of two enzymes binding to many DNA repair proteins. Both XRCC1 and PCNA have so many partners, it is inconceivable that all the complexes are formed simultaneously on a single molecule. Therefore, it is necessary in the future to define the circumstances and the signals that favor the complex formation to provide a more complete understanding of their biological function.

Summary Here, we have investigated several important factors that can influence DNA base excision repair. We have shown that both binding and chemistry can alter SCD excision, that APE1 enhances MPGcatalyzed excision, and that there is a complex formation of MPG with PCNA that can also accommodate APE1 binding. In the future, these data must be expanded to investigate their biological significance.

Materials and Methods Chemicals, ODNs, enzymes and plasmids Phage T4 polynucleotide kinase was from New England Biolabs. MPG, APE1, hHR23A, hHR23B, and PCNA proteins were obtained from laboratory stocks and were purified as described.105 Restriction enzymes and molecular biology grade BSA were obtained from Roche Molecular Biochemicals. ODNs containing Hx or abasic sites were provided by Integrated DNA Technologies, Inc. (Coralville, LA). The sequences are listed in the Table. The complementary strand in all cases had a T base opposite the Hx base. ODNs were gel-purified, phosphorylated at the 5 0 terminus with T4 polynucleotide kinase using [g-32P]ATP, spin column-purified, and annealed with a twofold excess of the unlabeled complementary strand. The Sequagel sequencing system (buffer, diluent, and concentrate) was from National Diagnostics (Atlanta, GA). Standard molecular biology methods followed published protocols.106,107 The pCMVTag1 vector was obtained from Stratagene. Anti-MPG antibody was prepared in the animal facility of the City of Hope using a standard protocol, and the cleared serum was used as a polyclonal antibody reagent. RFC was kind gift from Dr Jerard Hurwitz (Molecular Biology, Memorial Sloan-Kettering Cancer Center, The Rockefeller University, New York). Anti-FLAG Ab (FLAG sequence AspTyrLysAspAspAspAspLys), anti-APE1 Ab and antiPCNA Ab were obtained from Santa Cruz. The RB69 DNA polymerase was prepared using an expression vector obtained from Dr W. Konigsberg (Yale University, New Haven, CT). Phage T4 DNA ligase was prepared using an expression vector constructed in the laboratory. Both RB69 DNA polymerase and T4 DNA ligase were purified using His tags over Ni-NTA columns (Qiagen, Valencia, CA). Preparation of RF M13mp18-P53-Hx The cDNA of the human P53 gene containing exons 4–9 was inserted into the M13mp18 vector using XbaI and BamHI (prepared by C. Hong). A double-stranded, closed circular molecule with a unique Hx adduct was formed using in vitro DNA synthesis and ligation. Briefly, for DNA synthesis, 15 pmol of the kinased ODN pTGCATGGGCGGCITGAACCGGAGGC was annealed to the single-stranded M13mp18-P53 (7 mg) by heating to 80 8C and cooling to 30 8C slowly over 30 minutes. Synthesis and ligation were conducted on the annealed product using the RB69 DNA polymerase (1.4 mg), and T4 DNA ligase (400 units) in the presence of 2.5 mM ATP and 150 mM f each dNTP. The reaction mixture was incubated using the following temperatures and times: 4 8C for five

1270 minutes, 22 8C for five minutes, and 30 8C for three hours. The closed circular plasmid was purified using a CsCl gradient (1 g/ml) in 0.4 mg/ml ethidium bromide, followed by extraction with water-saturated butanol, and dialysis against 10 mM Tris–HCl (pH 7.5), 1 mM EDTA.

Cells Mammalian cell line AD293, a transformed human kidney cell line, was obtained from the ATCC (Manassas, VA) and grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal calf serum in 5% (v/v) CO2. Treatment of cells with dimethylsulfate (DMS) AD293 cells were treated with 1 mM dimethylsulfate in DMEM without serum for 15 minutes at room temperature. At 24 hours post treatment, the cells were harvested and whole cell extracts prepared for immunoprecipitation.

Immunoprecipitation in vitro and in vivo transient transfection Cultured AD293 cells transfected transiently with either pCMV-Tag1 vector or pCMV-Tag1-MPG were washed with PBS and the supernatant was disposed. The lysis buffer contained 50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1% (v/v) Nonidet P40, 0.5% (w/v) sodium deoxycholate. One Completee tablet (from Boehringer Mannheim) was added in 25 ml of lysis buffer, which was added to the cells to achieve a concentration of 106 cells/ml. The samples were sonicated using a Sonifier Cell Disruptor 350 (from Branson Sonic Power Co.) and pre-cleared with protein A/G agarose (from Roche) overnight. For in vitro immunoprecipitation, the proteins were mixed in buffer (100 mM KCl, 70 mM Hepes-KOH (pH 7.5), 5 mM b-mercaptoethanol, 5% (v/v) glycerol, 5 mM MgCl2). Anti-Flag antibody was used to pull-down the protein and precipitated again with protein A/G agarose. After a series of washes, the immunoprecipitated samples were separated by SDS-PAGE (12% (w/v) polyacrylamide) and blotted onto PVDF membrane using a standard Western blot protocol. After blocking of the non-specific binding sites, the membranes were incubated with primary antibody (anti-PCNA or antiAPE1) and the horseradish peroxidase-labeled secondary antibody added separately. Chemiluminescence was detected using ECL Plus Reagents (from Amersham Biosciences) and exposure to autoradiography film. For detection of proteins in AD293 cells without overexpression of MPG or APE1, a near-infrared imaging system was used to enhance detection of the proteins. The whole cell proteins were extracted from AD293 cells, immunoprecipitated, separated by SDS-PAGE (12% (w/v) polyacrylamide) and transferred to the PVDF membrane as described above. The membranes were blocked in Odyssey Blocking buffer. The secondary antibodies used were Alexa FluorR 700 goat anti-mouse IgG or anti-rabbit IgG (Molecular Probes, Engene, OR). The fluorescent signals on the membrane were scanned using a near-infrared Odyssey Imaging System (Infrared Imager model 9120, Li-Cor, Lincoln, NE).

Factors Influencing MPG-catalyzed Excision

DNA glycosylase activity assay Double-stranded 25 bp Hx-ODN 5 0 end-labeled with P was incubated with MPG protein to perform the activity assay as described.84 The complementary strand had a T base opposite the Hx base. The reaction buffer was 100 mM KCl, 70 mM Hepes-KOH (pH 7.5), 0.5 mM EDTA, 5 mM b-mercaptoethanol, 5% glycerol in a total volume of 20 ml, and the concentration of the ODN varied from 0 to 120 nM. Generally, the reactions were incubated for five minutes or as indicated in the individual Figures, at 37 8C after adding the diluted MPG protein (at various concentrations), and stopped by the addition of 5 ml of 1.2 M NaOH. The stopped reaction mix was incubated at 70 8C for 30 minutes to cleave at the abasic site generated by the MPG protein. At the end of the incubation, 8 ml of 1.0 M Tris–HCl (pH 7.5) was added to neutralize the mixture. The sample was mixed with 33 ml of formamide loading buffer and separated by electrophoresis on a denaturing (7 M urea) 20% polyacrylamide minigel to resolve reaction products. The dried gels were subjected to PhosphorImager analysis (Molecular Dynamics) for quantification of band intensity. 32

DNA glycosylase assays using MPG and other proteins APE1, PCNA, HHR23A and B in different concentrations were added to the reaction as described above at the same time as MPG. The reactions were stopped adding NaOH, except when APE1 was used in the reaction. All kinetics assays for the determination of apparent Km and kcat values were conducted in triplicate with less than 10% product generated to ensure conditions for steady-state approximations. The activity of MPG in this range for all the substrate concentrations was linear. For the Lineweaver-Burk plot, the x intercept is K1/Km and the y intercept is 1/Vmax. The kcat was calculated based on the total enzyme concentration ([Eo] as Vmax/[Eo]. Yeast two-hybrid assay for PCNA and MPG interaction Yeast two-hybrid analysis108–111 was performed with the hPCNA gene in pACT2 (activation domain) vector (cloned into the Xma I and Xho I sites using the following ODNs for PCR cloning: CCCGCCCGGGAATGTTCGAGGCGC GCCT and CCCGCTCGAGTTAAGATCCTTCTTCATCCTC and with hMPG gene (full-length cDNA, deletion of part of the cDNA or N-terminal cDNA truncation, see Table 2) in the pAS2-1 (DNA binding domain) vector (Clontech, Palo Alto, CA). Paired vectors were transformed into Saccharomyces cerevisiae strain AH109 by the lithium acetate method according to the manufacturer’s recommendation. Interaction in the two-hybrid system was tested by growth on histidine-deficient selective medium with 5 mM 3-aminotriazole (3-AT) and 5-bromo4-chloro-3-indolyl-a-galactopyranoside (X-a-Gal), and by b-galactosidase activity, which was determined by colony filter assay according to the manufacturer’s instructions. The interaction between murine p53 and SV40 large T antigen was used as a positive control. Negative controls included pACT2 vector with pAS2-1-MPG or pACT2PCNA with pAS2-1 vector. The negative controls showed no colony growth.

1271

Factors Influencing MPG-catalyzed Excision

Table 2. ODNs used for the construction of MPG fusions with the GAL4 DNA-binding domain in pAS2-1 Mutation

MPG length (amino acid residues)

5 0 ODN

3 0 ODN

N-ter N-ter N-ter N-ter N-ter N-ter Deletion

293 259 230 200 174 128 282

CGGGAATTCATGCCCGCGCGCAGC CGGGAATTCGCACCTGCAGAGCAG CGGGAATTCGGCCCATACCGCAGC CGGGAATTCGCCCGGGCATTTCTG CGGGAATTCGAGGCATACCTGGGG CGGGAATTCTCCAGCCAGGGGGAC CATCATTTACGGCATGGGGGACGGGGCT

GCGGATCCTCAGGCCTGTGTGTCC GCGGATCCTCAGGCCTGTGTGTCC GCGGATCCTCAGGCCTGTGTGTCC GCGGATCCTCAGGCCTGTGTGTCC GCGGATCCTCAGGCCTGTGTGTCC GCGGATCCTCAGGCCTGTGTGTCC

Construction of pCMV-Tag1-MPG and pCMV-Tag1APE1 and transient transfection Using PCR, the full-length human MPG cDNA and APE1 cDNA were amplified and cleaved with BglII and XhoI, and inserted into the pCMV-Tag1 vector with a Flag-Tag at the amino terminus. Plasmids were transfected transiently into AD293 cells using LipofectamineTm 2000 from Invitrogen according to the protocol recommended by the manufacturer. At six hours posttransfection, the medium was changed to normal serumcontaining medium and cultured for another 48 hours. The cells were harvested, and the proteins were extracted from whole cells. PCNA loading and MPG digestion Replicative form (RF) M13mp18-P53-Hx DNA (2 pmol) was digested with N.BbvC 1B (BioLabs) in 10 mM Tris– HCl (pH 7.5), 50 mM NaCl, 10 mM MgCl2, 1 mM DTT for one hour at 37 8C, followed by denaturation at 65 8C for 20 minutes. The samples were added in the mixture containing 2 pmol of PCNA trimer, 40 units of RFC in 20 mM Tris–HCl (pH 7.5), 0.1 M NaCl, 8 mM MgCl2, 0.5 mM ATP, 4% glycerol, 5 mM DTT, 40 ml/ml of BSA for 20 minutes at 37 8C. After loading, the MPG (400 fmol) and Nth (2 pmol) were added into the mixture and incubated at 37 8C for different lengths of time. After extraction with phenol/chloroform, a primer extension was performed by annealing [g-32P]ATP end-labeled primer (TCTGGGA CAGCCAAGTCTG) and followed by extension using Pfu DNA polymerase and the products separated by electrophoresis on a DNA-sequencing 6% gel. No acceleration of the MPG-catalyzed excision of Hx was observed using Nth.

Acknowledgements The authors thank Drs Serge Boiteux and Pablo Radicella for the human APE1 clone, and Dr Gerald Holmquist for critical reading of the manuscript. Dr Jerard Hurwitz is thanked for his kind gift of the RFC complex. This work was supported by the NIH, the Beckman Research Institute of the City of Hope National Medical Center, and the City of Hope Cancer Center Core Grant.

References 1. Lindahl, T. (2000). Suppression of spontaneous mutagenesis in human cells by DNA base excisionrepair. Mutat. Res. 462, 129–135.

2. Marnett, L. J. (2000). Oxyradicals and DNA damage. Carcinogenesis, 21, 361–370. 3. Norbury, C. J. & Hickson, I. D. (2001). Cellular responses to DNA damage. Annu. Rev. Pharmacol. Toxicol. 41, 367–401. 4. Hickson, I. D. (1997). Base excision repair of DNA damage Landes Bioscience, Chapman & Hall, Austin, New York. 5. Memisoglu, A. & Samson, L. (2000). Base excision repair in yeast and mammals. Mutat. Res. 451, 39–51. 6. Moller, P. & Wallin, H. (1998). Adduct formation, mutagenesis and nucleotide excision repair of DNA damage produced by reactive oxygen species and lipid peroxidation product. Mutat. Res. 410, 271–290. 7. Beard, W. A. & Wilson, S. H. (2000). Structural design of a eukaryotic DNA repair polymerase: DNA polymerase beta. Mutat. Res. 460, 231–244. 8. McCullough, A. K., Dodson, M. L. & Lloyd, R. S. (1999). Initiation of base excision repair: glycosylase mechanisms and structures. Annu. Rev. Biochem. 68, 255–285. 9. Cadet, J., Bourdat, A. G., D’Ham, C., Duarte, V., Gasparutto, D., Romieu, A. & Ravanat, J. L. (2000). Oxidative base damage to DNA: specificity of base excision repair enzymes. Mutat. Res. 462, 121–128. 10. Krokan, H. E., Nilsen, H., Skorpen, F., Otterlei, M. & Slupphaug, G. (2000). Base excision repair of DNA in mammalian cells. FEBS Letters, 476, 73–77. 11. Krokan, H. E., Standal, R. & Slupphaug, G. (1997). DNA glycosylases in the base excision repair of DNA. Biochem. J. 325, 1–16. 12. Singer, B. & Hang, B. (1997). What structural features determine repair enzyme specificity and mechanism in chemically modified DNA? Chem. Res. Toxicol. 10, 713–732. 13. Wilson, D. M., 3rd & Barsky, D. (2001). The major human abasic endonuclease: formation, consequences and repair of abasic lesions in DNA. Mutat. Res. 485, 283–307. 14. Wilson, D. M., 3rd, Takeshita, M., Grollman, A. P. & Demple, B. (1995). Incision activity of human apurinic endonuclease (Ape) at abasic site analogs in DNA. J. Biol. Chem. 270, 16002–16007. 15. Xu, Y. J., DeMott, M. S., Hwang, J. T., Greenberg, M. M. & Demple, B. (2003). Action of human apurinic endonuclease (Ape1) on C1 0 -oxidized deoxyribose damage in DNA. DNA Repair (Amst.), 2, 175–185. 16. Wong, D., DeMott, M. S. & Demple, B. (2003). Modulation of the 3 0 /5 0 -exonuclease activity of human apurinic endonuclease (Ape1) by its 5 0 -incised Abasic DNA product. J. Biol. Chem. 278, 36242–36249. 17. Masuda, Y., Bennett, R. A. & Demple, B. (1998). Dynamics of the interaction of human apurinic endonuclease (Ape1) with its substrate and product. J. Biol. Chem. 273, 30352–30359.

1272 18. Sobol, R. W. & Wilson, S. H. (2001). Mammalian DNA beta-polymerase in base excision repair of alkylation damage. Prog. Nucl. Acid Res. Mol. Biol. 68, 57–74. 19. Idriss, H. T., Al-Assar, O. & Wilson, S. H. (2002). DNA polymerase beta. Int. J. Biochem. Cell. Biol. 34, 321–324. 20. Wilson, S. H., Sobol, R. W., Beard, W. A., Horton, J. K., Prasad, R. & Vande Berg, B. J. (2000). DNA polymerase beta and mammalian base excision repair. Cold Spring Harbor Symp. Quant. Biol. 65, 143–155. 21. Lindahl, T. (1990). Repair of intrinsic DNA lesions. Mutat. Res. 238, 305–311. 22. Laval, J. (1996). Role of DNA repair enzymes in the cellular resistance to oxidative stress. Pathol. Biol. (Paris), 44, 14–24. 23. Tomkinson, A. E., Chen, L., Dong, Z., Leppard, J. B., Levin, D. S., Mackey, Z. B. & Motycka, T. A. (2001). Completion of base excision repair by mammalian DNA ligases. Prog. Nucl. Acid Res. Mol. Biol. 68, 151–164. 24. Tomkinson, A. E. & Mackey, Z. B. (1998). Structure and function of mammalian DNA ligases. Mutat. Res. 407, 1–9. 25. Gros, L., Saparbaev, M. K. & Laval, J. (2002). Enzymology of the repair of free radicals-induced DNA damage. Oncogene, 21, 8905–8925. 26. Wyatt, M. D., Allan, J. M., Lau, A. Y., Ellenberger, T. E. & Samson, L. D. (1999). 3-Methyladenine DNA glycosylases: structure, function, and biological importance. Bioessays, 21, 668–676. 27. Hitchcock, T. M., Dong, L., Connor, E. E., Meira, L. B., Samson, L. D., Wyatt, M. D. & Cao, W. (2004). Oxanine DNA glycosylase activity from mammalian alkyladenine glycosylase. J. Biol. Chem. 279, 38177–38183. 28. Engelward, B. P., Dreslin, A., Christensen, J., Huszar, D., Kurahara, C. & Samson, L. (1996). Repairdeficient 3-methyladenine DNA glycosylase homozygous mutant mouse cells have increased sensitivity to alkylation-induced chromosome damage and cell killing. EMBO J. 15, 945–952. 29. Lau, A. Y., Scharer, O. D., Samson, L., Verdine, G. L. & Ellenberger, T. (1998). Crystal structure of a human alkylbase-DNA repair enzyme complexed to DNA: mechanisms for nucleotide flipping and base excision. Cell, 95, 249–258. 30. Lau, A. Y., Wyatt, M. D., Glassner, B. J., Samson, L. D. & Ellenberger, T. (2000). Molecular basis for discriminating between normal and damaged bases by the human alkyladenine glycosylase, AAG. Proc. Natl Acad. Sci. USA, 97, 13573–13578. 31. Ye, N., Holmquist, G. P. & O’Connor, T. R. (1998). Heterogeneous repair of N-methylpurines at the nucleotide level in normal human cells. J. Mol. Biol. 284, 269–285. 32. Wyatt, M. D. & Samson, L. D. (2000). Influence of DNA structure on hypoxanthine and 1,N(6)ethenoadenine removal by murine 3-methyladenine DNA glycosylase. Carcinogenesis, 21, 901–908. 33. Barzilay, G. & Hickson, I. D. (1995). Structure and function of apurinic/apyrimidinic endonucleases. Bioessays, 17, 713–719. 34. Fritz, G., Grosch, S., Tomicic, M. & Kaina, B. (2003). APE/Ref-1 and the mammalian response to genotoxic stress. Toxicology, 193, 67–78. 35. Masuda, Y., Bennett, R. A. & Demple, B. (1998). Rapid dissociation of human apurinic endonuclease (Ape1) from incised DNA induced by magnesium. J. Biol. Chem. 273, 30360–30365. 36. Parikh, S. S., Mol, C. D., Slupphaug, G., Bharati, S., Krokan, H. E. & Tainer, J. A. (1998). Base excision

Factors Influencing MPG-catalyzed Excision

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48. 49. 50.

51. 52.

repair initiation revealed by crystal structures and binding kinetics of human uracil-DNA glycosylase with DNA. EMBO J. 17, 5214–5226. Vidal, A. E., Boiteux, S., Hickson, I. D. & Radicella, J. P. (2001). XRCC1 coordinates the initial and late stages of DNA abasic site repair through protein– protein interactions. EMBO J. 20, 6530–6539. Cappelli, E., Hazra, T., Hill, J. W., Slupphaug, G., Bogliolo, M. & Frosina, G. (2001). Rates of base excision repair are not solely dependent on levels of initiating enzymes. Carcinogenesis, 22, 387–393. Waters, T. R., Gallinari, P., Jiricny, J. & Swann, P. F. (1999). Human thymine DNA glycosylase binds to apurinic sites in DNA but is displaced by human apurinic endonuclease 1. J. Biol. Chem. 274, 67–74. Cooper, P. K., Nouspikel, T., Clarkson, S. G. & Leadon, S. A. (1997). Defective transcription-coupled repair of oxidative base damage in Cockayne syndrome patients from XP group G. Science, 275, 990–993. Le Page, F., Kwoh, E. E., Avrutskaya, A., Gentil, A., Leadon, S. A., Sarasin, A. & Cooper, P. K. (2000). Transcription-coupled repair of 8-oxoguanine: requirement for XPG, TFIIH, and CSB and implications for Cockayne syndrome. Cell, 101, 159–171. Klungland, A., Hoss, M., Gunz, D., Constantinou, A., Clarkson, S. G., Doetsch, P. W. et al. (1999). Base excision repair of oxidative DNA damage activated by XPG protein. Mol. Cell, 3, 33–42. Bessho, T. (1999). Nucleotide excision repair 3 0 endonuclease XPG stimulates the activity of base excision repair enzyme thymine glycol DNA glycosylase. Nucl. Acids Res. 27, 979–983. Wu, P., Qiu, C., Sohail, A., Zhang, X., Bhagwat, A. S. & Cheng, X. (2003). Mismatch repair in methylated DNA. Structure and activity of the mismatch-specific thymine glycosylase domain of methyl-CpG-binding protein MBD4. J. Biol. Chem. 278, 5285–5291. Miao, F., Bouziane, M., Dammann, R., Masutani, C., Hanaoka, F., Pfeifer, G. & O’Connor, T. R. (2000). 3-Methyladenine-DNA glycosylase (MPG protein) interacts with human RAD23 proteins. J. Biol. Chem. 275, 28433–28438. Shimizu, Y., Iwai, S., Hanaoka, F. & Sugasawa, K. (2003). Xeroderma pigmentosum group C protein interacts physically and functionally with thymine DNA glycosylase. EMBO J. 22, 164–173. Watanabe, S., Ichimura, T., Fujita, N., Tsuruzoe, S., Ohki, I., Shirakawa, M. et al. (2003). Methylated DNA-binding domain 1 and methylpurine-DNA glycosylase link transcriptional repression and DNA repair in chromatin. Proc. Natl Acad. Sci. USA, 100, 12859–12864. Takasaki, Y., Deng, J. S. & Tan, E. M. (1981). A nuclear antigen associated with cell proliferation and blast transformation. J. Expt. Med. 154, 1899–1909. Warbrick, E. (2000). The puzzle of PCNA’s many partners. Bioessays, 22, 997–1006. Tomasevic, G., Kamme, F. & Wieloch, T. (1998). Changes in proliferating cell nuclear antigen, a protein involved in DNA repair, in vulnerable hippocampal neurons following global cerebral ischemia. Brain Res. Mol. Brain Res. 60, 168–176. Matsumoto, Y. (2001). Molecular mechanism of PCNA-dependent base excision repair. Prog. Nucl. Acid Res. Mol. Biol. 68, 129–138. Biade, S., Sobol, R. W., Wilson, S. H. & Matsumoto, Y. (1998). Impairment of proliferating cell nuclear antigen-dependent apurinic/apyrimidinic site repair on linear DNA. J. Biol. Chem. 273, 898–902.

Factors Influencing MPG-catalyzed Excision

53. Dianov, G. L., Jensen, B. R., Kenny, M. K. & Bohr, V. A. (1999). Replication protein A stimulates proliferating cell nuclear antigen-dependent repair of abasic sites in DNA by human cell extracts. Biochemistry, 38, 11021–11025. 54. Dogliotti, E., Fortini, P., Pascucci, B. & Parlanti, E. (2001). The mechanism of switching among multiple BER pathways. Prog. Nucl. Acid Res. Mol. Biol. 68, 3–27. 55. Kim, K., Biade, S. & Matsumoto, Y. (1998). Involvement of flap endonuclease 1 in base excision DNA repair. J. Biol. Chem. 273, 8842–8848. 56. Klungland, A. & Lindahl, T. (1997). Second pathway for completion of human DNA base excision-repair: reconstitution with purified proteins and requirement for DNase IV (FEN1). EMBO J. 16, 3341–3348. 57. Matsumoto, Y., Kim, K. & Bogenhagen, D. F. (1994). Proliferating cell nuclear antigen-dependent abasic site repair in Xenopus laevis oocytes: an alternative pathway of base excision DNA repair. Mol. Cell. Biol. 14, 6187–6197. 58. Krokan, H. E., Otterlei, M., Nilsen, H., Kavli, B., Skorpen, F., Andersen, S. et al. (2001). Properties and functions of human uracil-DNA glycosylase from the UNG gene. Prog. Nucl. Acid Res. Mol. Biol. 68, 365–386. 59. Pascucci, B., Maga, G., Hubscher, U., Bjoras, M., Seeberg, E., Hickson, I. D. et al. (2002). Reconstitution of the base excision repair pathway for 7,8-dihydro8-oxoguanine with purified human proteins. Nucl. Acids Res. 30, 2124–2130. 60. Hosfield, D. J., Mol, C. D., Shen, B. & Tainer, J. A. (1998). Structure of the DNA repair and replication endonuclease and exonuclease FEN-1: coupling DNA and PCNA binding to FEN-1 activity. Cell, 95, 135–146. 61. Krishna, T. S., Kong, X. P., Gary, S., Burgers, P. M. & Kuriyan, J. (1994). Crystal structure of the eukaryotic DNA polymerase processivity factor PCNA. Cell, 79, 1233–1243. 62. Lieber, M. R. (1997). The FEN-1 family of structurespecific nucleases in eukaryotic DNA replication, recombination and repair. Bioessays, 19, 233–240. 63. Schurtenberger, P., Egelhaaf, S. U., Hindges, R., Maga, G., Jonsson, Z. O., May, R. P. et al. (1998). The solution structure of functionally active human proliferating cell nuclear antigen determined by small-angle neutron scattering. J. Mol. Biol. 275, 123–132. 64. Kim, J. & MacNeill, S. A. (2003). Genome stability: a new member of the RFC family. Curr. Biol. 13, R873–R875. 65. Yao, N., Coryell, L., Zhang, D., Georgescu, R. E., Finkelstein, J., Coman, M. M. et al. (2003). Replication factor C clamp loader subunit arrangement within the circular pentamer and its attachment points to proliferating cell nuclear antigen. J. Biol. Chem. 278, 50744–50753. 66. Anderson, L. A. & Perkins, N. D. (2002). The large subunit of replication factor C interacts with the histone deacetylase, HDAC1. J. Biol. Chem. 277, 29550–29554. 67. Cai, J., Uhlmann, F., Gibbs, E., Flores-Rozas, H., Lee, C. G., Phillips, B. et al. (1996). Reconstitution of human replication factor C from its five subunits in baculovirus-infected insect cells. Proc. Natl Acad. Sci. USA, 93, 12896–12901. 68. Yao, N., Turner, J., Kelman, Z., Stukenberg, P. T., Dean, F., Shechter, D. et al. (1996). Clamp loading, unloading and intrinsic stability of the PCNA, beta and gp45 sliding clamps of human, E. coli and T4 replicases. Genes Cells, 1, 101–113.

1273 69. Warbrick, E. (1998). PCNA binding through a conserved motif. Bioessays, 20, 195–199. 70. Frank, G., Qiu, J., Zheng, L. & Shen, B. (2001). Stimulation of eukaryotic flap endonuclease-1 activities by proliferating cell nuclear antigen (PCNA) is independent of its in vitro interaction via a consensus PCNA binding region. J. Biol. Chem. 276, 36295–36302. 71. Zhang, G., Gibbs, E., Kelman, Z., O’Donnell, M. & Hurwitz, J. (1999). Studies on the interactions between human replication factor C and human proliferating cell nuclear antigen. Proc. Natl Acad. Sci. USA, 96, 1869–1874. 72. Haracska, L., Unk, I., Johnson, R. E., Phillips, B. B., Hurwitz, J., Prakash, L. & Prakash, S. (2002). Stimulation of DNA synthesis activity of human DNA polymerase kappa by PCNA. Mol. Cell. Biol. 22, 784–791. 73. Haracska, L., Johnson, R. E., Unk, I., Phillips, B. B., Hurwitz, J., Prakash, L. & Prakash, S. (2001). Targeting of human DNA polymerase iota to the replication machinery via interaction with PCNA. Proc. Natl Acad. Sci. USA, 98, 14256–14261. 74. Haracska, L., Johnson, R. E., Unk, I., Phillips, B., Hurwitz, J., Prakash, L. & Prakash, S. (2001). Physical and functional interactions of human DNA polymerase eta with PCNA. Mol. Cell. Biol. 21, 7199–7206. 75. Matsumoto, Y., Kim, K., Hurwitz, J., Gary, R., Levin, D. S., Tomkinson, A. E. & Park, M. S. (1999). Reconstitution of proliferating cell nuclear antigen-dependent repair of apurinic/apyrimidinic sites with purified human proteins. J. Biol. Chem. 274, 33703–33708. 76. Otterlei, M., Warbrick, E., Nagelhus, T. A., Haug, T., Slupphaug, G., Akbari, M. et al. (1999). Postreplicative base excision repair in replication foci. EMBO J. 18, 3834–3844. 77. Boldogh, I., Milligan, D., Lee, M. S., Bassett, H., Lloyd, R. S. & McCullough, A. K. (2001). hMYH cell cycle-dependent expression, subcellular localization and association with replication foci: evidence suggesting replication-coupled repair of adenine:8-oxoguanine mispairs. Nucl. Acids Res. 29, 2802–2809. 78. Bennett, R. A., Wilson, D. M., 3rd, Wong, D. & Demple, B. (1997). Interaction of human apurinic endonuclease and DNA polymerase beta in the base excision repair pathway. Proc. Natl Acad. Sci. USA, 94, 7166–7169. 79. Dianova, I. I., Bohr, V. A. & Dianov, G. L. (2001). Interaction of human AP endonuclease 1 with flap endonuclease 1 and proliferating cell nuclear antigen involved in long-patch base excision repair. Biochemistry, 40, 12639–12644. 80. Kelman, Z. & Hurwitz, J. (1998). Protein-PCNA interactions: a DNA-scanning mechanism? Trends Biochem. Sci. 23, 236–238. 81. Waters, T. R. & Swann, P. F. (1998). Kinetics of the action of thymine DNA glycosylase. J. Biol. Chem. 273, 20007–20014. 82. Vidal, A. E., Hickson, I. D., Boiteux, S. & Radicella, J. P. (2001). Mechanism of stimulation of the DNA glycosylase activity of hOGG1 by the major human AP endonuclease: bypass of the AP lyase activity step. Nucl. Acids Res. 29, 1285–1292. 83. Hill, J. W., Hazra, T. K., Izumi, T. & Mitra, S. (2001). Stimulation of human 8-oxoguanine-DNA glycosylase by AP-endonuclease: potential coordination of the initial steps in base excision repair. Nucl. Acids Res. 29, 430–438. 84. Miao, F., Bouziane, M. & O’Connor, T. R. (1998). Interaction of the recombinant human

1274

85.

86.

87.

88. 89.

90.

91.

92.

93.

94.

95. 96.

Factors Influencing MPG-catalyzed Excision

methylpurine-DNA glycosylase (MPG protein) with oligodeoxyribonucleotides containing either hypoxanthine or abasic sites. Nucl. Acids Res. 26, 4034–4041. Chakravarti, D., Ibeanu, G. C., Tano, K. & Mitra, S. (1991). Cloning and expression in Escherichia coli of a human cDNA encoding the DNA repair protein N-methylpurine-DNA glycosylase. J. Biol. Chem. 266, 15710–15715. Samson, L., Derfler, B., Boosalis, M. & Call, K. (1991). Cloning and characterization of a 3-methyladenine DNA glycosylase cDNA from human cells whose gene maps to chromosome 16. Proc. Natl Acad. Sci. USA, 88, 9127–9131. O’Connor, T. R. & Laval, J. (1991). Human cDNA expressing a functional DNA glycosylase excising 3-methyladenine and 7-methylguanine. Biochem. Biophys. Res. Commun. 176, 1170–1177. O’Connor, T. R. & Laval, F. (1990). Isolation and structure of a cDNA expressing a mammalian 3-methyladenine-DNA glycosylase. EMBO J. 9, 3337–3342. Saparbaev, M. & Laval, J. (1994). Excision of hypoxanthine from DNA containing dIMP residues by the Escherichia coli, yeast, rat, and human alkylpurine DNA glycosylases. Proc. Natl Acad. Sci. USA, 91, 5873–5877. Saparbaev, M., Kleibl, K. & Laval, J. (1995). Escherichia coli, Saccharomyces cerevisiae, rat and human 3-methyladenine DNA glycosylases repair 1,N6-ethenoadenine when present in DNA. Nucl. Acids Res. 23, 3750–3755. Saparbaev, M., Langouet, S., Privezentzev, C. V., Guengerich, F. P., Cai, H., Elder, R. H. & Laval, J. (2002). 1,N(2)-ethenoguanine, a mutagenic DNA adduct, is a primary substrate of Escherichia coli mismatch-specific uracil-DNA glycosylase and human alkylpurine-DNA-N-glycosylase. J. Biol. Chem. 277, 26987–26993. Singer, B., Antoccia, A., Basu, A. K., Dosanjh, M. K., Fraenkel-Conrat, H., Gallagher, P. E. et al. (1992). Both purified human 1,N6-ethenoadenine-binding protein and purified human 3-methyladenine-DNA glycosylase act on 1,N6-ethenoadenine and 3-methyladenine. Proc. Natl Acad. Sci. USA, 89, 9386–9390. Hang, B., Chenna, A., Rao, S. & Singer, B. (1996). 1,N6-ethenoadenine and 3,N4-ethenocytosine are excised by separate human DNA glycosylases. Carcinogenesis, 17, 155–157. Hang, B., Singer, B., Margison, G. P. & Elder, R. H. (1997). Targeted deletion of alkylpurine-DNA-Nglycosylase in mice eliminates repair of 1,N6ethenoadenine and hypoxanthine but not of 3,N4ethenocytosine or 8-oxoguanine. Proc. Natl Acad. Sci. USA, 94, 12869–12874. Nordmann, P. L., Makris, J. C. & Reznikoff, W. S. (1988). Inosine induced mutations. Mol. Gen. Genet. 214, 62–67. Kamiya, H., Miura, H., Kato, H., Nishimura, S. & Ohtsuka, E. (1992). Induction of mutation of a synthetic c-Ha-ras gene containing hypoxanthine. Cancer Res. 52, 1836–1839.

97. Kow, Y. W. (2002). Repair of deaminated bases in DNA. Free Radic. Biol. Med. 33, 886–893. 98. Hang, B., Sagi, J. & Singer, B. (1998). Correlation between sequence-dependent glycosylase repair and the thermal stability of oligonucleotide duplexes containing 1, N6-ethenoadenine. J. Biol. Chem. 273, 33406–33413. 99. Biswas, T., Clos, L. J., 2nd, SantaLucia, J., Jr, Mitra, S. & Roy, R. (2002). Binding of specific DNA base-pair mismatches by N-methylpurine-DNA glycosylase and its implication in initial damage recognition. J. Mol. Biol. 320, 503–513. 100. Yoon, J. H., Iwai, S., O’Connor, T. R. & Pfeifer, G. P. (2003). Human thymine DNA glycosylase (TDG) and methyl-CpG-binding protein 4 (MBD4) excise thymine glycol (Tg) from a Tg:G mispair. Nucl. Acids Res. 31, 5399–5404. 101. Plosky, B., Samson, L., Engelward, B. P., Gold, B., Schlaen, B., Millas, T. et al. (2002). Base excision repair and nucleotide excision repair contribute to the removal of N-methylpurines from active genes. DNA Repair (Amst.), 1, 683–696. 102. Ellison, V. & Stillman, B. (1998). Reconstitution of recombinant human replication factor C (RFC) and identification of an RFC subcomplex possessing DNA-dependent ATPase activity. J. Biol. Chem. 273, 5979–5987. 103. Thompson, L. H., Brookman, K. W., Jones, N. J., Allen, S. A. & Carrano, A. V. (1990). Molecular cloning of the human XRCC1 gene, which corrects defective DNA strand break repair and sister chromatid exchange. Mol. Cell. Biol. 10, 6160–6171. 104. Caldecott, K. W. (2003). XRCC1 and DNA strand break repair. DNA Repair (Amst), 2, 955–969. 105. Xia, L. & O’Connor, T. R. (2001). DNA glycosylase activity assay based on streptavidin paramagnetic bead substrate capture. Anal. Biochem. 298, 322–326. 106. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1992). Short Protocols in Molecular Biology (2nd edit.), Wiley, New York. 107. Sambrook, J., Russell, D. W., Irwin, N. & Janssen, K. A. (2001). Molecular Cloning: a Laboratory Manual (3rd edit.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 108. Fields, S. & Song, O. (1989). A novel genetic system to detect protein–protein interactions. Nature, 340, 245–246. 109. Fields, S. & Sternglanz, R. (1994). The two-hybrid system: an assay for protein–protein interactions. Trends Genet. 10, 286–292. 110. Bartel, P., Chien, C. T., Sternglanz, R. & Fields, S. (1993). Elimination of false positives that arise in using the two-hybrid system. Biotechniques, 14, 920–924. 111. Chien, C. T., Bartel, P. L., Sternglanz, R. & Fields, S. (1991). The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl Acad. Sci. USA, 88, 9578–9582.

Edited by J. Karn (Received 20 October 2004; received in revised form 29 December 2004; accepted 5 January 2005)