- Email: [email protected]
Human AChR-α subunit production in the baculovirus expression system
Euro-Myasthenia 1.7
III
PURIFICATION AND CHARACTERIZATION THE HUMAN ACRTYLCHOLINB RECEPTOR
OP RBCOMBIN~ a-SUBUNIT.
POLYPEPTIDES
OF
G. Malcharek, A. Melms, R. Schoepfer, and J. Lindstrom. Departments of Biochemistry and Neurology, University of Tiibingen,D-7400 Mbingen, Germany. A full length cDNA coding for the complete mature a-subunit of the human nicotinic acetylcholine receptor (AChR) was isolated from a cDNA library of the human cell line TE 671 which expressed a muscle type AChR. Plasmids containing the sequences of the full length a-subunit (al-437) and fragments al-103, al-209. al-237 and a327-398 were transformed into bacteria BL 21 DE 3 p(Lys.9) which produced high amounts of recombinant protein. Polypeptides were purified from inclusion bodies by differential extraction with urea and non-ionic detergents or gel chromatography and showed a single major peak in SDS-PAGE with a purity of 85 - 95% according to gel scanning. Several mouse monoclonal antibodies (mabs) of IgM isotype were derived after immunization with the fragment al-103 which were useful to detect polypeptides containing this sequence in Western blots and solid phase ELISA. Two of these mabs were found to crossreact with native AChR expressed on TB 671 cells, apparently recognizing a conformation-independent epitope of the a-subunit. In contrast, AChR autoantibodies from the ssrum of MG patients, which in majority were directed at a conformation dependent region on the a-subunit did not bind to the recombinant polypeptides. Although recombinant polypeptides did not retain the native conformation of the AChR a-subunit, this material should be useful to study the autoimmune response to muscle AChR in human myasthenia gravis, especially on the level of autoimmune T lymphocytes.
1 8
HUMAN ACHR-a SUBUNIT PRODUCTION IN THE BACULOVIRUS EXPRESSION SYSTEM. F. A d eetta 0. Simoncini, F. Baggi, F. Crosti, F. Cornelio, and R. Mantegazza. Dept. of NeukGuscuiar Diseases, “C.Besta” National Neurological Institute, Milan, Italy. -The a subunit is the immunodominant portion of the acetylcholine receptor (AchR). Antibodies (Abs) against the a-subunit are found in the sera of myasthenic patients and are a prominent feature of animals immunized with AchR. The T cell reactivity to AchR, either in humans and animals, has been found to be predominantly against the a-subunit. Nevertheless, the fine mapping of both B and T responses is still not fully ascertained. The availability of large and purified amounts of AchR-a subunit protein is a critical step for the characterization of AchR-specific T lymphocyte immune reactivity. We have developed the expression of a recombinant AchR-a subunit in the Baculovirus “Autographa californica nuclear polyhedrosis virus (AcNPV)“- system. This is an expression system that allows the production of protein correctly folded and with posttranslational modifications typical of higher eukaryotic cells. Total RNA was obtained by the guanidinium isothiocyanate method from different cell sources: confluent myotubes in fusion medium (DMEM+P% horse serum) after 7-10 days of culture, and TE671 cells were used. A cDNA library was prepared by reverse transcriptase (MMLV) reaction and was used as a template for an AchR-specific 1.2 kb PCR amplification. The following oligos were used : a-F 5’ CGGGATCCGCCATGTCCGAACATGACACCCGTCTG 3’, and a-R 5 CGAGATCTGATTCCTTGCTGATTTAATCCAATGAG 3’. The PCR product included 2 restriction sites (BamH I and Xba I, respectively), that allowed its insertion into the polylinker region of the the plasmid pVL1393. AcNPV genomic DNA was used to cotransfect SF9 cells with the recombinant transfer vector by Ca Phosphate. After the screening for the presence of the recombinant virus (lack of polyhedrin inclusion), cell extract analysis revealed a protein of about 40 kd on western blot by staining with a polyclonal rabbit anti T AchR Ab. The recombinant protein will be used for Ab binding assays and T cell proliferation. iv
III
PURIFICATION AND CHARACTERIZATION THE HUMAN ACRTYLCHOLINB RECEPTOR
OP RBCOMBIN~ a-SUBUNIT.
POLYPEPTIDES
OF
G. Malcharek, A. Melms, R. Schoepfer, and J. Lindstrom. Departments of Biochemistry and Neurology, University of Tiibingen,D-7400 Mbingen, Germany. A full length cDNA coding for the complete mature a-subunit of the human nicotinic acetylcholine receptor (AChR) was isolated from a cDNA library of the human cell line TE 671 which expressed a muscle type AChR. Plasmids containing the sequences of the full length a-subunit (al-437) and fragments al-103, al-209. al-237 and a327-398 were transformed into bacteria BL 21 DE 3 p(Lys.9) which produced high amounts of recombinant protein. Polypeptides were purified from inclusion bodies by differential extraction with urea and non-ionic detergents or gel chromatography and showed a single major peak in SDS-PAGE with a purity of 85 - 95% according to gel scanning. Several mouse monoclonal antibodies (mabs) of IgM isotype were derived after immunization with the fragment al-103 which were useful to detect polypeptides containing this sequence in Western blots and solid phase ELISA. Two of these mabs were found to crossreact with native AChR expressed on TB 671 cells, apparently recognizing a conformation-independent epitope of the a-subunit. In contrast, AChR autoantibodies from the ssrum of MG patients, which in majority were directed at a conformation dependent region on the a-subunit did not bind to the recombinant polypeptides. Although recombinant polypeptides did not retain the native conformation of the AChR a-subunit, this material should be useful to study the autoimmune response to muscle AChR in human myasthenia gravis, especially on the level of autoimmune T lymphocytes.
1 8
HUMAN ACHR-a SUBUNIT PRODUCTION IN THE BACULOVIRUS EXPRESSION SYSTEM. F. A d eetta 0. Simoncini, F. Baggi, F. Crosti, F. Cornelio, and R. Mantegazza. Dept. of NeukGuscuiar Diseases, “C.Besta” National Neurological Institute, Milan, Italy. -The a subunit is the immunodominant portion of the acetylcholine receptor (AchR). Antibodies (Abs) against the a-subunit are found in the sera of myasthenic patients and are a prominent feature of animals immunized with AchR. The T cell reactivity to AchR, either in humans and animals, has been found to be predominantly against the a-subunit. Nevertheless, the fine mapping of both B and T responses is still not fully ascertained. The availability of large and purified amounts of AchR-a subunit protein is a critical step for the characterization of AchR-specific T lymphocyte immune reactivity. We have developed the expression of a recombinant AchR-a subunit in the Baculovirus “Autographa californica nuclear polyhedrosis virus (AcNPV)“- system. This is an expression system that allows the production of protein correctly folded and with posttranslational modifications typical of higher eukaryotic cells. Total RNA was obtained by the guanidinium isothiocyanate method from different cell sources: confluent myotubes in fusion medium (DMEM+P% horse serum) after 7-10 days of culture, and TE671 cells were used. A cDNA library was prepared by reverse transcriptase (MMLV) reaction and was used as a template for an AchR-specific 1.2 kb PCR amplification. The following oligos were used : a-F 5’ CGGGATCCGCCATGTCCGAACATGACACCCGTCTG 3’, and a-R 5 CGAGATCTGATTCCTTGCTGATTTAATCCAATGAG 3’. The PCR product included 2 restriction sites (BamH I and Xba I, respectively), that allowed its insertion into the polylinker region of the the plasmid pVL1393. AcNPV genomic DNA was used to cotransfect SF9 cells with the recombinant transfer vector by Ca Phosphate. After the screening for the presence of the recombinant virus (lack of polyhedrin inclusion), cell extract analysis revealed a protein of about 40 kd on western blot by staining with a polyclonal rabbit anti T AchR Ab. The recombinant protein will be used for Ab binding assays and T cell proliferation. iv