Stem Cells Remain Viable and Metabolically Active Following Needle Passage

1 2 3 4 5 PM R XXX (2016) 1-11 www.pmrjournal.org 6 7 8 9 10 11 12 13 14 15 16 17 Q4 18 19 20 21 22 23 24 25 26 Abstract 27 28 29 Objective: To assess the biological effects of passage through clinically relevant needles on the viability and metabolic activity of 30 culture-expanded, human adipose tissueederived mesenchymal stromal/stem cells (AMSCs). 31 Design: Prospective observational pilot study. 32 Setting: Academic medical center. 33 34 Participants: Patient-derived clinical-grade culture expanded AMSCs. 35 Interventions: AMSCs were passed through syringes without a needle attached (control), with an 18-gauge (25.4-mm) needle 36 attached and with a 30-gauge (19-mm) needle attached at a constant injection flow rate and constant cell concentrations. Each 37 38 injection condition was completed in triplicate. 39 Main Outcome Measures: Cell number and viability, proliferative capacity, metabolic activity, and acute gene expression as 40 measured by cell counts, mitochondrial activity, and quantitative real time reverse-transcription polymerase chain reaction on 41 day 0 (immediately), day 1, and day 4 after injection. 42 43 Results: AMSC viability was not significantly affected by injection, and cells proliferated normally regardless of study group. 44 Postinjection, AMSCs robustly expressed both proliferation markers and extracellular matrix proteins. Stress-response mRNAs 45 were markedly but transiently increased independently of needle size within the first day in culture postinjection. 46 47 Conclusions: Human, culture-expanded AMSCs maintain their viability, proliferative capacity, and metabolic function following 48 passage through needles as small as 30-gauge at constant flow rates of 4 mL/min, despite an early, nonspecific stress/cytopro49 tective response. These initial findings suggest that culture-expanded AMSCs should tolerate the injection process during most 50 51 cell-based therapeutic interventions. 52 53 54 55 56 57 group focuses on clinical applications of adiposeIntroduction 58 59 tissueederived mesenchymal stromal/stem cells 60 (AMSCs) cultured in platelet lysate for joint regeneraSince the initial characterization of mesenchymal 61 tion and repair of skeletal tissues [13-15]. stromal/stem cells (MSCs) by Friedenstein and col62 63 Osteoarthritis (OA) is the most common adult joint leagues half a century ago [1,2], these cells have been 64 disease and currently affects 27 million individuals in isolated from a variety of human tissues [3-8]. In addi65 66 the United States [27,28]. OA is characterized by cartition to their capacity for proliferation and multilineage 67 lage loss, changes in subchondral bone, synovitis, and differentiation, MSCs possess potent antiinflammatory, 68 skeletal deformity [29-33]. The economic burden of OA immunomodulatory, antiapoptotic, and trophic capa69 70 is high, with more than 185 billion dollars spent annually bilities [9-19]. Recently, MSC-based therapies have 71 to diagnose and treat OA [34]. These costs are expected demonstrated potential benefits in the treatment of a 72 73 to rise with the aging population, presenting a need to wide range of medical conditions, including myocardial 74 develop effective conservative treatments [35]. Use of infarction, kidney injury, multiple sclerosis, type I dia75 MSCs has potential therapeutic value in OA because betes, and spinal cord injury [11,12,16,20-26]. Our 76 77 78 79 1934-1482/$ - see front matter ª 2016 by the American Academy of Physical Medicine and Rehabilitation 80 http://dx.doi.org/10.1016/j.pmrj.2016.01.010

Original Research

Human Adipose-Derived Mesenchymal Stromal/Stem Cells Remain Viable and Metabolically Active Following Needle Passage

Kentaro Onishi, DO, Dakota L. Jones, BS, Scott M. Riester, MD, Eric A. Lewallen, PhD, David G. Lewallen, MD, Jacob L. Sellon, MD, Allan B. Dietz, PhD, Wenchun Qu, MD, Andre J. van Wijnen, PhD, Jay Smith, MD

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160

2 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240

Adipose Mesenchymal Stromal/Stem Cell Viability

these cells can reduce inflammation and programmed cell death (apoptosis), and in theory are capable of restoring cartilaginous tissue damaged by OA or traumatic injury [9,10,18,19]. Preliminary clinical and translational studies suggest that both culture-expanded bone marrowederived mesenchymal stromal/stem cells (BMSCs) and AMSCs may diminish OA symptoms and possibly heal tissues in some individuals. Several reports have indicated that injections of BMSCs into patients with moderate to severe knee OA may improve pain by 40%-90% within 2e6 months without serious adverse events [36-39]. In some patients, magnetic resonance imaging (MRI) also revealed evidence for meniscal or hyaline cartilage regeneration. A number of studies have reported promising results using AMSCs to treat a variety of musculoskeletal conditions, although the results have not been universally positive [40]. In a more recent study, a single variable-dose AMSC injection in patients with moderate to severe knee OA improved pain by approximately 50% without serious adverse events [41]. Moreover, patients receiving the highest cell dose (100 million cells) exhibited evidence of cartilage healing, consistent with the potential disease-modifying effects of AMSCs [41]. Although further investigation is needed to explore the relative therapeutic benefit of AMSCs versus BMSCs for OA, AMSCs do offer several advantages over BMSCs, including their relative ease of harvest, higher yield, and resistance to age-related declines in proliferative potential and cellular function [11-13,16,41-43]. For MSCs to have therapeutic effects on OA, they must be successfully delivered into the joint with minimal effects on viability and function. However, during needle expulsion, MSCs may experience levels of fluid pressure and shear stress beyond those that they naturally encounter in the body. Prior studies have documented adverse effects of shear stresses applied to red blood cells by a rotational viscometer [44]. Because the approximate diameter of MSCs can range up to 20 to 30 mm, it can be expected that MSCs will experience fluid shear stresses as they pass through needles commonly used for clinical care, and these stresses vary as a function of needle bore diameter via the HagenPoiseuille equation seen below (ie, gauge) [45]. Despite the expectation that fluid shear stress may compromise cell viability, few studies have investigated the biological effects of needle gauge on human MSCs [46-49] (Table 1). Furthermore, no previous study has investigated the biological effects of needle passage on human AMSCS. DP ¼

8mLQ pd 4

As experimental MSC-based therapies for the treatment of joint degeneration typically require expulsion

of cells through needles of different gauges, there is a compelling need for additional studies on the mechanosensitivity of cells during expulsion. Even though AMSCs have emerged as a viable stromal/stem-cell source for the treatment of OA and other joint disorders, it remains unclear whether passage through a needle will affect AMSC viability or function during injection procedures [41]. Therefore, the purpose of this investigation was to examine the effects of needle expulsion (ie, injection) on human AMSC viability and function using clinically applicable needle gauges as a function of time following needle passage. We hypothesized that culture-expanded human AMSCs subjected to injection stresses would exhibit changes in their biological phenotype (eg, cell viability and function). Clinically, the results of this study would provide guidance for the selection of appropriate needle sizes for regenerative medicine procedures. Methods General Design Human AMSCs were subjected to needle passage at a constant rate under 3 conditions: (a) a 6-mL plastic syringe with no needle (control); (b) a 6-mL syringe attached to an 18-gauge (G), 25.4-mm stainless steel needle; and (c) a 6-mL syringe attached to a 30-gauge, 19-mm stainless steel needle. Cells were passed through the needles into a vial and analyzed for viability and function immediately postinjection (day 0) and also at 1 day (day 1) and 4 days (day 4) following simulated injection. Cell Isolation Following informed consent and institutional review board approval at the authors’ institution, human AMSCs were isolated from lipo-aspirates obtained from a representative donor using previously described methods [13,14,50]. The donor-derived AMSCs selected in this study have previously been shown to express standard MSC markers and are capable of multilineage differentiation [13-15]. In brief, donor lipo-tissue was aspirated and then digested using Type I collagenase (Worthington Biochemicals, Lakewood, NJ) for 1.5 hours at 37 C, centrifuged at 400 g for 5 minutes, rinsed with phosphate-buffered saline solution (Life Technologies, Grand Island, NY), and strained using 7-mm cell strainers (BD Biosciences, San Jose, CA). Following this, the aspirate was treated with 154 mmol/L NH4Cl, 10 mmol/L KHCO3, and 0.1 mmol/L ethylenediaminetetraacetic acid (EDTA) for erythrocyte lysis. The remaining AMSCs were expanded in advanced Minimum Essential Medium (Life Technologies, Grand Island, NY), supplemented with 5% (vol/vol) human platelet lysate (PLTMax; MillCreekLifeSciences, Rochester, MN), 2 mmol/L Glutamax (Life Technologies, Grand Island, NY), 2 U/mL heparin,

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

Q1 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320

K. Onishi et al. / PM R XXX (2016) 1-11 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400

3

401 402 403 Flow Rate Concentration Time Point 404 405 Author (Year) Cell Source Needle Size Tested (/min) (cells/mL) Studied Outcome Results 406 7 † Agashi et al. Murine bone 22 G, 25 G, 26s G* 1 mL, 5 mL, 5  10 Immediate Viability Both 25 G and 26s G 407 408 (2009) marrow (no length 20 mL postinjection reduced viability at all 409 reported) flow rates 410 Control: uninjected 411 cells 412 6 § Walker et al. Murine and 20 G 25.4 mm 1 mL, 2 mL, 1  10 Immediate Viability For human, 25 G and 30 G 413 (2010) human 25 G 25.4 mm 4 mL, 8.3 mL postinjection, Phenotypek reduced viability 24 h 414 ‡ { 415 bone 30 G 25.4 mm 24 h post-injection at all Differentiation 416 Control: uninjected marrow flow rates vs control; no 417 cells effects on function or 418 terminal differentiation 419 ability 420 Mamidi et al. Human bone 24 G, 25 G, 26 G 2 mL 3  106 Not specified Viability# No difference in viability, 421 422 (2012) marrow (no length phenotype, and Phenotype** 423 reported) terminal differentiation Differentiation†† 424 Control: syringevs control 425 only injection 426 Garvican Equine bone 19 G 50 mm 15 mL 5  106 Immediate Viability§§ 21 G and 23 G resulted in 427 et al. marrow 21 G 50 mm postinjection, differentiationkk increased apoptosis 428 429 (2014) 23 G 50 mm 2 h, 4 h, 24 h‡‡ immediately, whereas 430 Control: uninjected 19 G resulted in 431 cells increased apoptosis at 432 2-h mark; all gauges 433 reduced metabolic 434 435 activity for first 2 h 436 postinjection; no change 437 in differentiation at any 438 time point 439 440 G ¼ gauge. 441 * 26s-gauge needles have an inner diameter of 0.127 mm, whereas standard 26-gauge needles have an inner diameter of 0.260 mm. 442 † Live/Dead Solution (Invitrogen, Paisley, UK), CellTiter AQ One Solution Cell Proliferation assay kit (Promega, Southampton, UK), and CaspACE 443 Assay System (Promega, Southampton, UK). 444 ‡ 445 Viability was tested immediately and at 24 hours. Phenotyping was tested only immediately after injections. Terminal differentiation timeline Q3 446 was not explicitly mentioned. § 447 Propidium iodide, Thiazole orange, fluorescein-isothiocyanateeconjugated Annexin V (BD Sciences, San Jose, CA). 448 k Antibodies for CD11b, CD45, CD29, CD49e, CD73, CD90, CD105, and Stro-1 (manufacturer information not reported). 449 { Alizarin red, Oil red (Chemicon, Temecula, CA), and “induction medium supplied by Invitrogen” (Invitrogen, Carlsbad, CA). 450 # 7-amino actinomycin D and Senescence b-Galactosidase Staining kit (Cell Signaling Technologies, Danvers, MA). 451 452 ** Antibodies for CD90, CD44, CD73, CD166, CD34, CD45, and HLA-DR (BD Pharmingen, San Diego, CA). †† 453 Alizarin red, Oil red, and Alcian blue (manufacture information not reported). 454 ‡‡ Viability was tested at all 4 time points. Terminal differentiation timeline was not explicitly mentioned. 455 §§ Trypan blue (Sigma-Aldrich, St. Louis, MO), Proprium iodide/Annexin V assay (Cayman Chemical, Ann Arbor, MI), alamarBlue assay (AbD 456 Serotec, Kidlington, UK). 457 kk No specific assay was mentioned but manuscript states the study tested cells’ trilineage differentiation (chondrogenic, adipogenic, and 458 459 osteogenic properties). 460 461 and counted using a hemocytometer (Thermo Fisher and 1% Penn-Strep (100 U/mL penicillin, 100 mg/mL 462 463 Scientific, Waltham, MA). A 1-mL quantity of cell streptomycin; Cellgro, Corning, NY). All AMSCs used in 464 suspension was loaded into a 6-mL plastic syringe experimentation were of passage 7. AMSCs have been 465 466 (BD Biosciences, San Jose, CA) just before each injecshown to retain differentiation capacity up to passage 467 tion. A standard syringe pump (Sage Instruments, 12 [13], and are capable of spontaneous differentiation 468 469 Freedom, CA) was used for all AMSC injections. The upon prolonged culture without passaging [14]. Our cell 470 device was precalibrated to confirm isokinetic cell culture expansion started with passage 5 cells, and the 471 expulsion at an average injection flow rate of approxicells were passaged 2 additional times to obtain suffi472 473 mately 4 mL/min (Figure 1A). This flow rate was chosen cient quantities for our experiments. 474 because it represented the highest flow rate that could 475 476 be attained by the automated syringe pump, and this Simulated Cell Injection 477 setting would maximize the opportunity to observe 478 potential effects on cell behavior. Three conditions AMSCs were detached from the culturing flask using 479 480 were tested: (a) a 6-mL plastic syringe with no needle TrypLE Express (Life Technologies, Grand Island, NY)

Table 1 Studies examining the effect of “injection” on mesenchymal stem cell (MSC) viability or function

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

4 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560

Adipose Mesenchymal Stromal/Stem Cell Viability

Figure 1. Physical properties of manually operated (open bars) and syringe-pump automated (filled bars) injections. (A) The flow rate (mL/min) during a manual injection varied based on injection condition, although the syringe pump used in the current investigation maintained an isokinetic flow rate regardless of injection condition. (B) The maximal pressure drop during injection increased as the needle gauge decreased, consistent with increased mechanical shear stresses experienced by cells injected through smaller needles. Pilot data generated by authors. e ¼ syringe only (ie, no needle); 18 ¼ 18-gauge, 25.4-mm needle; 30 ¼ 30-gauge, 19-mm needle.

(control); (b) a 6-mL syringe attached to an 18-gauge, 25.4-mm stainless steel needle (Covidien, Mansfield, MA); and (c) a 6-mL syringe attached to a 30-gauge, 19-mm stainless steel needle (Covidien, Mansfield, MA). The 2 needle sizes were chosen to represent a range of needle gauges commonly used in clinical practice. Once loaded, the syringe pump was used to inject the cells into a vessel, which was then divided for subsequent analysis (see below). To promote uniformity in experimentation, and to focus on biological variation due to mechanical stimulation, all experiments were performed with a single donor. Three injections were performed for each condition from this same cell isolate, resulting in a total of 9 trials for this investigation. Assessment of AMSC Viability, Proliferation, and Metabolic Activity To assess cell viability and proliferation potential postinjection, 2 cell counting methods were used: Trypan blue (day 0 postinjection, Sigma-Aldrich, St. Louis, MO) and DAPI (40 ,6-diamidino-2-phenylindole) staining (days 1 and 4 postinjection, Life Technologies, Grand Island, NY) paired with ImageJ analysis, an open-source National Institutes of Health (NIH)esupported image analysis program. All images were acquired using an inverted light microscope (Zeiss, Cambridge, MA). Trypan blue exclusion assays are performed with unfixed cells and permit the most rapid assessment of cell

viability immediately upon needle expulsion. This assay is based on dye exclusion of cells for Trypan blue that can be readily observed using conventional light microscopy at the point of experimentation in the laboratory. Thus, Trypan blue exclusion directly identifies the fraction of cells that have survived pressure deformation immediately following needle expulsion (t ¼ 0). As discussed in Results, virtually none of the cells that were subjected to needle passage were stained, which is indicative of membrane integrity. DAPI cell counting is performed with fixed cells. This test is based on intercalation of the dye with chromatin (DNA) in the nucleus and requires imaging of stained cells by fluorescence microscopy in a dark room. DAPI reveals the total number of cells (ie, alive and dead) regardless of viability. To assess the mitrochondrial metabolic activity of injected AMSCs, MTS (3-(4,5-dimethylthiazol2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)2H-tetrazolium) colorimetric assays (Promega, Madison, WI) were performed at days 0, 1, and 4 postinjection. MTS assays were read using a SpectraMax Plus Plate Reader (Molecular Devices, Sunnyvale, CA) at an absorbance wavelength of 490 nm. Relative Gene Expression of AMSCs in Response to Injection via mRNA Analysis Relative AMSC gene expression was used to assess the acute effect of mechanical stimulation/shear stress on

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640

K. Onishi et al. / PM R XXX (2016) 1-11 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720

cell activity and behavior. AMSCs were subjected to quantitative real time reverse-transcriptase polymerase chain reaction (qRT-PCR) to analyze mRNA expression. First, RNA was isolated using the miRNeasy Mini Kit (Qiagen, Valencia, CA) and total RNA yield was evaluated using a Nanodrop 2000 (Thermo Scientific, Inc., Waltham, MA). RT-PCR was performed to obtain cDNA using SuperScript III (Invitrogen, Carlsbad, CA). Then, cDNA was analyzed by qRT-PCR (C1000 Touch Thermal Cycler, BioRad, Hercules, CA) using SYBR Green detection with specific primers to define expression levels of mRNA biomarkers for proliferation, ECM production, stress/cytoprotective responses, stem cell surface markers, and transcription factors. Primer sequences are given in Table 2. Results were normalized to GAPDH within each sample. Statistical Analysis Descriptive statistics were used to demonstrate the effects of injection on AMSC cell counts (ie, viability), mitochondrial activity, and qRT-PCR on day 0, day 1, and day 4 postinjection. Results were analyzed by 1-way or 2-way analysis of variance, and an unpaired Student Table 2 mRNA primer sequences Primers, 50 -30 Gene

Forward

Reverse

EGR1

TGGGACTGGTAGCTGG TATTG GCTTATGCCCAGTGTGGATT CTTGGCCGATTGGTAATCCTG TTCCTTTTTCGGCACTTGGA CAGAAGGCGTGTCCCTTGAC GACGTGGCTGAGGACTTTCT

FOSB

ACCCCTCTGTCTACTATT AAGGC ATTCTGAGGCCTCGCAAGTA GCGACCTCTACTCAGAGCC AGTCCCAGGAGCGGATCAA TGGCCCAGCTCAAACAGAAG GTGAAGACCCTCAAGAG TCAGA GAGAATCCGAAGGGAAA GGAAT GCTGCAAGATCCCCTACGAAG

FOSL1 FOSL2 COL1A1 COL3A1

GCCGCCCTGTACCTTGTATCT CCTCGAACCTCGTCTTCACCTA GTAACAGCGGTGAACCTGG TTGAAGGAGGATGTTCCCATCT

DCN MKI67

ATGAAGGCCACTATCATCCTCC ACGCCTGGTTACTATCAAAAGG

EGR2 EGR3 JUN JUNB JUND FOS

HIST2H4 AGCTGTCTATCGGGCTCCAG CCNB2 CCGACGGTGTCCAGTGATTT CD44 CD90 CD105 SP1 PRRX1

CTGCCGCTTTGCAGGTGTA ATGAAGGTCCTCTACTTA TCCGC TGCACTTGGCCTACAATTCCA CAGGTGCAAACCAACAGATTA CAGGCGGATGAGAACGTGG

ATF1

CTGGAGTTTCTGCTGCTGTC

TCCGCTTGGAGTGTATCA GTCA ACGAAGAAGTGTACGAA GGGTT CAGTGCCTCAGGTTCAAGCA AGCAAGATTCGGAGGGACAT CCTCGCTTTCCTTCCTCTCC ACAGACACATATTTGGCAT GGTT GTCGCGGTCATCAGGAACTT CAGACCCATTTACTTGTG TTGGA CCTTTGCCTAAGCCTTTTCC TGTTGTTTTGGTGGGTT GAACT CATTGTGGGCAAGGTGCTATT GCACTGTGACGTTCTGGGA AGCTGCCCACTCAAGGATCT GCTGGAGTAGGTTTGGCATAG AAAAGCATCAGGATAGTG TGTCC GGCAATGGCAATGTACTGTC

5

t-test. Statistical significance was set at P < .05. Results are presented as mean and standard deviation. Results Effect of Needle Gauge on Viability, Proliferation, and Metabolic Activity There was no statistically significant difference among the 3 treatment groups with respect to cell counts immediately postinjection (day 0) as determined by light microscopy (Figure 2A, syringe only ¼ 3.70  0.79  106 cells, 18-gauge needle ¼ 3.94  0.98  106 cells, and 30-gauge needle ¼ 4.51  0.99  106 cells). Trypan blue staining of cells upon needle expulsion was mostly negative, indicating that pressure deformation did not compromise cell membrane integrity. We also performed cell counting of fixed cells on days 1 and 4 as determined by DAPI staining (Figure 3A, day 1: syringe only ¼ 11.7  3.00  106 cells, 18-gauge ¼ 7.13  2.17  106 cells, and 30-gauge ¼ 7.25  1.44  106 cells; day 4: syringe only ¼ 116.51  11.2  106 cells, 18-gauge ¼ 143.18  34.72  106 cells, and 30-gauge ¼ 128.38  13.35  106 cells). The increase in cell numbers between days 1 and 4 reflects approximately 3 to 4 cell divisions (ie, w1 cell division per day), and is consistent with previous observations showing that AMSCs exhibit exponential growth for the first 4 days of culture after seeding [14,15]. In summary, these Trypan blue and DAPI results suggest that AMSC viability was not significantly affected by injection condition and that AMSCs retained their proliferative ability during the early postinjection period (ie, up to day 4). All 3 treatment groups demonstrated similar mitochondrial metabolic activity at days 1 and 4 based on MTS assays (Figure 3B). As expected from actively proliferating cells, MTS absorbance increased between days 1 and 4. In summary, the MTS assays indicate that injection condition did not affect AMSC metabolic activity and corroborate the DAPI cell analysis reflecting normal AMSC proliferation in the early postinjection period. Effect of Needle Gauge on Relative Gene Expression Figure 4 demonstrates the relative AMSC gene expression as reflected by mRNA biomarkers for the 3 injection groups (eg, syringe only, 18-gauge needle, 30-gauge needle). The most prominent finding is that the AMSCs in all injection groups expressed very robust levels of genes normally associated with a stress response, cytoprotective mechanisms, and mechano-transduction, including the “early growth response” transcription factors EGR2 and EGR3, as well as the 7 members of the heterodimeric AP1 (FOS/

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800

6 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880

Adipose Mesenchymal Stromal/Stem Cell Viability

Figure 2. Immediate effect (day 0) of injection on adipose-tissue derived mesenchymal stromal/stem cells (AMSC) viability and function. (A) Trypan blue stain analysis immediately postinjection. No cells stained positive for Trypan blue, indicating that viability was not acutely affected in any of the 3 groups. As none of the cells exhibited positive staining with the dye, the values directly reflect the total cell population (number  106). (B) MTS assay results, indicating that mitochondrial metabolic activity immediately postinjection remained steady regardless of the injection condition. Values represent absorbance values measured at 490 nm. A and B collectively indicate that AMSC viability and metabolic activity were not significantly affected by simulated injection in the immediate postinjection period.

JUN) gene regulatory complex (ie, JUN, JUNB, JUND, FOS, FOSB, FOSL1, and FOSL2). Cytoprotective mechanisms describe pathways that support a cellular mode that defends against adverse conditions and results in the expression of genes that promote cell survival. The robust expression of these genes observed at the time of harvest (day 0) subsided by day 1 (Figure 4A). Specifically, EGR2 (P < .05) and EGR3 (P < .001), as well as FOS (P < .001), FOSB (P < .01), FOSL1 (P < .01), FOSL2 (P < .05), JUN (P < .001), JUNB (P < .05), and JUND (P < .01) showed significant changes in expression during the first 24 hours, without significant differences between injection groups. These results suggest that the AMSCs mount a cytoprotective response to counteract stresses that emerged during the handling of cells and/or the injection simulation. Beyond the observed stress/cytoprotective gene expression response, we observed robust expression of representative extracellular matrix (ECM) markers COL1A1 and COL3A1 regardless of condition (Figure 4B), indicating that cells retain collagen anabolic activity. We note that there were modest differences in expression on Day 0 and Day 1, but

these changes are not statistically significant. We also observed a decrease in the mRNA for the ECMrelated noncollagenous proteoglycan DCN (P < .001) from day 0 to day 1. The latter result suggests that cells exhibit selective changes in the expression of ECM proteins, which reflect an altered phenotypic state. As expected, relative mRNA levels for 2 distinct proliferation markers (HIST2H4A, P < .001) and MKI67 (P < .001) increased from day 0 to day 1 (Figure 4C). The latter findings support the conclusion that AMSCs are fully capable of resuming cell cycle progression after needle expulsion. Taken together, initiation of active proliferation between day 0 and day 1 (Figures 3 and 4C) and selectively changes in expression of ECM proteins is broadly consistent with our previous work showing that AMSCs alter expression of ECM proteins when they stop proliferating [14]. Examination of relative mRNA levels for 3 representative MSC surface markers (eg, CD44, CD90, and CD105) revealed a decrease in their expression after 1 day in culture, independent of injection group. This finding is consistent with previous observations that ASMCs exhibit a general decrease in cell surface gene expression when they initiate a phase of active proliferation [14]. For comparison, expression of several transcription factors (eg, SP1, PRRX1, and ATF1) that are ubiquitously expressed in MSCs was not modulated in the same manner. In summary, the gene expression analyses indicate that AMSCs subjected to our simulated injection procedure adopted a molecular phenotype characteristic of proliferating MSCs following an initial stress/ cytoprotective response. Discussion The primary finding of the current investigation is thatculture-expanded human AMSCs maintain their viability, proliferative capacity, and cellular functions following simulated injection with clinically applicable needle gauges. For decades, needle-based delivery systems have been successfully used for therapeutic agents such as corticosteroids and viscosupplements to treat pain and inflammation associated with degenerative and inflammatory musculoskeletal conditions. Although a number of studies have investigated the emerging role of cell-based therapies to treat a variety of medical and musculoskeletal disorders, there is a paucity of experimental studies that examine the biological effects of needle-based delivery systems on the viability and cellular functions of MSCs. Importantly, to our knowledge, the current investigation is the first to examine the effect of “injection” on human, culture expanded AMSC viability or function. Our present study complements prior investigations that examined the effects of injection on human MSCs

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960

961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040

K. Onishi et al. / PM R XXX (2016) 1-11

7

Figure 3. Adipose-tissue derived mesenchymal stromal/stem cells (AMSCs) retained their proliferative capacity and metabolic function between days 1 and 4 postinjection, with no significant differences between injection groups. (A) DAPI assisted cell counts (values represent cells  106) were similar among the 3 groups on days 1 and 4, and all groups demonstrated an exponential increase cell counts between days 1 and 4, reflecting maintenance of normal proliferative capacity. (B) MTS assay for mitochondrial activity revealed similar mitochondrial activity among the 3 treatment groups on days 1 and 4, as well a commensurate increase in mitochondrial activity between days 1 and 4. This latter finding reflects cell proliferation and corroborates the DAPI stain findings in A.

[46-49]. We used AMSC suspensions of approximately 4  106 cells/mL and a flow rate of 4 mL/min. Two prior studies [48,49] used BMSCs at concentrations of 1  106/mL and 3  106/mL, flow rates of 1e8.3 mL/min, and needle gauges ranging from 20e30 (Table 1) [47,48]. A direct comparison of our work with these 2 previous studies is limited by methodological differences, including the source of MSCs, length and diameter of needles, flow-rates, our use of a “no needle” control, and/or the longer postinjection analysis period (up to 4 days) of the current investigation. Mamidi et al injected human BMSCs in suspensions of 3  106 cells/mL at a flow rate of 2 mL/min using needles ranging from 24- to 26-gauge [47]. These authors found no effect of injection on BMSC viability, morphology, surface markers, or terminal trilineage differentiation, but did not specify the time period(s) at which the postinjection assessments were performed [48]. Walker et al examined the fate of human BMSCs following injection of 1  106 cells/mL at flow rates ranging from 1-8.3 mL/min through 20- to 30-gauge needles [49]. Unlike Walker et al, Maimidi et al found reduced 24-hour BMSC viability at all flow rates following 25- and 30-gauge needle injection [49]. Significant methodological differences between the 2 studies, as well as missing “data points” (eg, no time course for postinjection assessment in the study by Mamidi et al) preclude identification of the likely explanation for the discrepant findings. Reassuringly, unlike the findings of Walker et al with respect

to human BMSCs, we found that human AMSC viability was unaffected by simulated injection under similar conditions. Furthermore, we observed that our passed AMSCs retained both their proliferative potential and mitochondrial metabolic activity, despite an early stress/cytoprotective response. It is possible that BMSC and AMSC preparations may differ in their inherent vulnerability to experimental handling and/or fluid shear stress during injection. Alternatively or additionally, differing methods of AMSC versus BMSC culture expansion (eg, culture media) may select for cells with different responses to handling- and/or injectionrelated stresses. Clearly, further investigation is necessary to clarify the potential differential responses between “injected” BMSC and AMSCs. Reduced cell viability upon expulsion from syringes is consistent with our observation that MSCs mount a cellular stress/cytoprotective response based on transiently induced expression of specific early response factors (ie, EGR and AP1/Fos-Jun related proteins). Transit of AMSCs through syringes invokes major pressure changes that are quantitatively linked to the applied flow rate, the viscosity of the cell suspension, as well as the dimensions of needles included in our injection simulation (see equation above). For the current investigation, we selected needles with sizes near the upper and lower boundaries of clinical relevance and therefore examined the effects of both a wide (18-gauge) and narrow (30-gauge) needle.

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120

1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200

8

Adipose Mesenchymal Stromal/Stem Cell Viability

Figure 4. Effect of needle gauge on relative adipose-tissue derived mesenchymal stromal/stem cells (AMSC) gene expression (as determined by mRNA analysis) following injection. Bar graphs in the panels show expression data after needle expulsion for “early response” genes (A-C), extracellular matrix (ECM) proteins (D), proliferation markers (E), cell surface markers (F), and representative transcription factors that are ubiquitous in mesenchymal cells (G). Values represent the mean (with standard deviation) of 3 different AMSC injections that were sampled as biological triplicates (n ¼ 9 total samples).

Although we maintained cell suspensions and flow rates at constant and clinically realistic values, a possible limitation of our approach is that flow rates may not always be constant in clinical settings where manual administrations are typical. Cell suspensions may

experience variable pressure changes during injection due to human factors (eg, interactions between the needle gauge and forces exerted by human operator, or even manual fatigue of the operator). Alternatively, changes in resistance to flow may be imparted by the

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 Q21265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280

1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360

K. Onishi et al. / PM R XXX (2016) 1-11

injected region. For example, injected cells suspensions may reach the volumetric limits of a closed space or encounter tissues of variable density (eg, synovial cavity in the joint or the nucleus pulposus of a spine disk). Future studies may account for the effects of variable pressure on cell viability by performing needle expulsion trials with various levels of resistance that mimic in vivo conditions of AMSC injection. There are several additional study limitations that warrant consideration when interpreting the results of the current investigation. First, we examined only a single concentration of culture-expanded human AMSCs. Although our chosen concentration of 4  106 cells/mL is within the range of clinical relevance, we recognize the interaction between cell concentration, viscosity, and mechanical fluid shear stress. Consequently, future studies will examine the effects of injection on more highly concentrated AMSC suspensions. Second, we used a cell isolate from a single donor and therefore cannot assess the full range of biological differences in cellular responses of AMSCs to needle passage. However, the choice of a single donor in this initial investigation was intentional to eliminate donor-to-donor variation that might confound the results, as well as to control study costs. Third, our longest needle was 25.4 mm. In clinical practice, longer needles are commonly used for shoulder, hip, and spine injections (up to 3-4 cm). Although the effect of needle length on fluid shear stress is relatively minor when compared to the effect of needle diameter, future investigations should use longer needles to determine whether needle length affects AMSC viability or function following injection. Fourth, although our flow rate of 4 mL/min was commensurate with previously reported studies, it is necessary to evaluate more clinically relevant scenarios, including effects of higher flow rates on AMSC viability and behavior. These considerations will be addressed in future studies that examine the effects on AMSC viability and function of very high flow rate injections that can be achieved by manual expulsion, as is the case in routine clinical care.

Conclusion Culture-expanded human AMSCs maintained their viability, proliferative capacity, and metabolic function following passage through needles as small as 30-gauge at constant flow rates of 4 mL/min, despite an early, nonspecific stress/cytoprotective response. These initial findings suggest that culture-expanded AMSCs should tolerate the injection process during most cellbased therapeutic interventions. Future research should examine higher AMSC concentrations, faster injection flow rates, and longer needles, as well as identify and characterize any differences between the postinjection responses of AMSCs and BMSCs.

9

Acknowledgments We thank the members of the orthopedic research laboratories and especially Matt Getzlaf and Liselotte Bulstra, for stimulating discussions and/or assistance with procedures. We appreciate the generous philanthropic support of William H. and Karen J. Eby, and the charitable foundation in their names. We also thank the Center for Regenerative Medicine of Mayo Clinic for support through career development awards (to J.S. and S.M.R.) and the National Institute of Arthritis and Musculoskeletal and Skin Diseases (R01 AR049069 to AvW; T32 AR56950 to E.A.L.).

References 1. Friedenstein AJ, Chailakhyan RK, Latsinik NV, Panasyuk AF, KeilissBorok IV. Stromal cells responsible for transferring the microenvironment of the hemopoietic tissues. Cloning in vitro and retransplantation in vivo. Transplantation 1974;17:331-340. 2. Friedenstein AJ, Petrakova KV, Kurolesova AI, Frolova GP. Heterotopic of bone marrow. Analysis of precursor cells for osteogenic and hematopoietic tissues. Transplantation 1968;6: 230-247. 3. Caplan AI. Mesenchymal stem cells. J Orthop Res 1991;9:641-650. 4. da Silva Meirelles L, Chagastelles PC, Nardi NB. Mesenchymal stem cells reside in virtually all post-natal organs and tissues. J Cell Sci 2006;119:2204-2213. 5. Kassis I, Zangi L, Rivkin R, et al. Isolation of mesenchymal stem cells from G-CSF-mobilized human peripheral blood using fibrin microbeads. Bone Marrow Transplant 2006;37:967-976. 6. Zou Z, Zhang Y, Hao L, et al. More insight into mesenchymal stem cells and their effects inside the body. Expert Opin Biol Ther 2010; 10:215-230. 7. Poznanski WJ, Waheed I, Van R. Human fat cell precursors. Morphologic and metabolic differentiation in culture. Lab Invest 1973;29:570-576. 8. Van RL, Bayliss CE, Roncari DA. Cytological and enzymological characterization of adult human adipocyte precursors in culture. J Clin Invest 1976;58:699-704. 9. Awad HA, Butler DL, Boivin GP, et al. Autologous mesenchymal stem cell-mediated repair of tendon. Tissue Eng 1999;5:267-277. 10. Bai L, Caplan A, Lennon D, Miller RH. Human mesenchymal stem cells signals regulate neural stem cell fate. Neurochem Res 2007; 32:353-362. 11. Bao J, Fisher JE, Lillegard JB, et al. Serum-free medium and mesenchymal stromal cells enhance functionality and stabilize integrity of rat hepatocyte spheroids. Cell Transplant 2013;22:299-308. 12. Chen BK, Staff NP, Knight AM, et al. A safety study on intrathecal delivery of autologous mesenchymal stromal cells in rabbits directly supporting phase I human trials. Transfusion 2015;55:1013-1020. 13. Crespo-Diaz R, Behfar A, Butler GW, et al. Platelet lysate consisting of a natural repair proteome supports human mesenchymal stem cell proliferation and chromosomal stability. Cell Transplant 2011;20:797-811. 14. Dudakovic A, Camilleri E, Riester SM, et al. High-resolution molecular validation of self-renewal and spontaneous differentiation in clinical-grade adipose-tissue derived human mesenchymal stem cells. J Cell Biochem 2014;115:1816-1828. 15. Dudakovic A, Camilleri ET, Lewallen EA, et al. Histone deacetylase inhibition destabilizes the multi-potent state of uncommitted adiposederived mesenchymal stromal cells. J Cell Physiol 2015;230:52-62. 16. Eirin A, Zhu XY, Ferguson CM, et al. Intra-renal delivery of mesenchymal stem cells attenuates myocardial injury after

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440

1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520

10

17.

18.

19.

20.

21. 22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

Adipose Mesenchymal Stromal/Stem Cell Viability reversal of hypertension in porcine renovascular disease. Stem Cell Res Ther 2015;6:7. Murphy MB, Moncivais K, Caplan AI. Mesenchymal stem cells: Environmentally responsive therapeutics for regenerative medicine. Exp Mol Med 2013;45:e54. Park H, Temenoff JS, Tabata Y, Caplan AI, Mikos AG. Injectable biodegradable hydrogel composites for rabbit marrow mesenchymal stem cell and growth factor delivery for cartilage tissue engineering. Biomaterials 2007;28:3217-3227. Wagner J, Kean T, Young R, Dennis JE, Caplan AI. Optimizing mesenchymal stem cell-based therapeutics. Curr Opin Biotechnol 2009;20:531-536. Britten MB, Abolmaali ND, Assmus B, et al. Infarct remodeling after intracoronary progenitor cell treatment in patients with acute myocardial infarction (TOPCARE-AMI): Mechanistic insights from serial contrast-enhanced magnetic resonance imaging. Circulation 2003;108:2212-2218. Bussolati B, Hauser PV, Carvalhosa R, Camussi G. Contribution of stem cells to kidney repair. Curr Stem Cell Res Ther 2009;4:2-8. Fellous TG, Guppy NJ, Brittan M, Alison MR. Cellular pathways to beta-cell replacement. Diabetes Metab Res Rev 2007;23: 87-99. Fiorina P, Jurewicz M, Augello A, et al. Immunomodulatory function of bone marrow-derived mesenchymal stem cells in experimental autoimmune type 1 diabetes. J Immunol 2009;183:993-1004. Karussis D, Karageorgiou C, Vaknin-Dembinsky A, et al. Safety and immunological effects of mesenchymal stem cell transplantation in patients with multiple sclerosis and amyotrophic lateral sclerosis. Arch Neurol 2010;67:1187-1194. Kumar AA, Kumar SR, Narayanan R, Arul K, Baskaran M. Autologous bone marrow derived mononuclear cell therapy for spinal cord injury: A phase I/II clinical safety and primary efficacy data. Exp Clin Transplant 2009;7:241-248. Vassalli G, Moccetti T. Cardiac repair with allogeneic mesenchymal stem cells after myocardial infarction. Swiss Med Wkly 2011;141: w13209. Helmick CG, Felson DT, Lawrence RC, et al. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. Part I. Arthritis Rheum 2008;58:15-25. Lawrence RC, Felson DT, Helmick CG, et al. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. Part II. Arthritis Rheum 2008;58:26-35. Bollet AJ, Nance JL. Biochemical findings in normal and osteoarthritic articular cartilage. II. Chondroitin sulfate concentration and chain length, water, and ash content. J Clin Invest 1966;45: 1170-1177. Brocklehurst R, Bayliss MT, Maroudas A, et al. The composition of normal and osteoarthritic articular cartilage from human knee joints. With special reference to unicompartmental replacement and osteotomy of the knee. J Bone Joint Surg Am 1984;66:95-106. Venn M, Maroudas A. Chemical composition and swelling of normal and osteoarthrotic femoral head cartilage. I. Chemical composition. Ann Rheum Dis 1977;36:121-129. Wenham CY, Conaghan PG. The role of synovitis in osteoarthritis. Ther Adv Musculoskelet Dis 2010;2:349-359.

33. Hunter DJ, Zhang W, Conaghan PG, et al. Systematic review of the concurrent and predictive validity of MRI biomarkers in OA. Osteoarthritis Cartilage 2011;19:557-588. 34. Kotlarz H, Gunnarsson CL, Fang H, Rizzo JA. Insurer and out-ofpocket costs of osteoarthritis in the US: Evidence from national survey data. Arthritis Rheum 2009;60:3546-3553. 35. Hootman JM, Helmick CG. Projections of US prevalence of arthritis and associated activity limitations. Arthritis Rheum 2006;54: 226-229. 36. Davatchi F, Abdollahi BS, Mohyeddin M, Shahram F, Nikbin B. Mesenchymal stem cell therapy for knee osteoarthritis. Preliminary report of four patients. Int J Rheum Dis 2011;14:211-215. 37. Emadedin M, Aghdami N, Taghiyar L, et al. Intra-articular injection of autologous mesenchymal stem cells in six patients with knee osteoarthritis. Arch Iran Med 2012;15:422-428. 38. Orozco L, Munar A, Soler R, et al. Treatment of knee osteoarthritis with autologous mesenchymal stem cells: A pilot study. Transplantation 2013;95:1535-1541. 39. Centeno CJ, Busse D, Kisiday J, Keohan C, Freeman M, Karli D. Increased knee cartilage volume in degenerative joint disease using percutaneously implanted, autologous mesenchymal stem cells. Pain Physician 2008;11:343-353. 40. Vilar JM, Batista M, Morales M, et al. Assessment of the effect of intraarticular injection of autologous adipose-derived mesenchymal stem cells in osteoarthritic dogs using a double blinded force platform analysis. BMC Vet Res 2014;10:143. 41. Jo CH, Lee YG, Shin WH, et al. Intra-articular injection of mesenchymal stem cells for the treatment of osteoarthritis of the knee: A proof-of-concept clinical trial. Stem Cells 2014;32: 1254-1266. 42. Zuk PA, Zhu M, Ashjian P, et al. Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell 2002;13:4279-4295. 43. Zuk PA, Zhu M, Mizuno H, et al. Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng 2001;7:211-228. 44. Leverett LB, Hellums JD, Alfrey CP, Lynch EC. Red blood cell damage by shear stress. Biophys J 1972;12:257-273. 45. Ge J, Guo L, Wang S, et al. The size of mesenchymal stem cells is a significant cause of vascular obstructions and stroke. Stem Cell Rev 2014;10:295-303. 46. Agashi K, Chau DY, Shakesheff KM. The effect of delivery via narrowbore needles on mesenchymal cells. Regen Med 2009;4:49-64. 47. Garvican ER, Cree S, Bull L, Smith RK, Dudhia J. Viability of equine mesenchymal stem cells during transport and implantation. Stem Cell Res Ther 2014;5:94. 48. Mamidi MK, Singh G, Husin JM, et al. Impact of passing mesenchymal stem cells through smaller bore size needles for subsequent use in patients for clinical or cosmetic indications. J Transl Med 2012;10:229. 49. Walker PA, Jimenez F, Gerber MH, et al. Effect of needle diameter and flow rate on rat and human mesenchymal stromal cell characterization and viability. Tissue Eng Part C Methods 2010;16:989-997. 50. Mader EK, Butler G, Dowdy SC, et al. Optimizing patient derived mesenchymal stem cells as virus carriers for a phase I clinical trial in ovarian cancer. J Transl Med 2013;11:20.

Disclosure K.O. Department of Physical Medicine & Rehabilitation, Mayo Clinic Sports Medicine Center, Mayo Clinic, Rochester, MN Disclosure: nothing to disclose D.L.J. Department of Biomedical Engineering and Physiology, Mayo Graduate School, Mayo Clinic, Rochester, MN; Department of Orthopedic Surgery, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN Disclosure: nothing to disclose

S.M.R. Department of Orthopedic Surgery, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN Disclosures related to this publication: grant, Center of Regenerative Medicine at Mayo Clinic (money to author and institution) E.A.L. Department of Orthopedic Surgery, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN Disclosures related to this publication: grant, National Institute of Arthritis and Musculoskeletal and Skin Diseases T32 AR56950

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600

1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680

K. Onishi et al. / PM R XXX (2016) 1-11 D.G.L. Department of Orthopedic Surgery, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN Disclosures outside this publication: consultancy, Zimmer (money to author and institution), Link (money to author), Mako/Stryker (money to author and institution); patents, Zimmer (money to author and institution); royalties, Zimmer, Mako/Stryker (money to author and institution); stock/stock options, Ketai Medical Devices, Mako (money to author); travel/accommodations/meeting expenses unrelated to activities, listed, Zimmer (money to author and institution) J.L.S. Department of Physical Medicine & Rehabilitation, Mayo Clinic Sports Medicine Center, Mayo Clinic, Rochester, MN Disclosure: nothing to disclose A.B.D. Department of Biochemistry & Molecular Biology, Mayo Graduate School, Mayo Clinic, Rochester, MN; Department of Laboratory Medicine & Pathology, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN Disclosures related to this publication: other, Mill Creek Life Sciences Commerical Interest (money to author) W.Q. Department of Physical Medicine & Rehabilitation, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN; Department of Anesthesiology Division of Pain Medicine, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN Disclosure: nothing to disclose

11

A.J.v.W. Department of Orthopedic Surgery, Medical Sciences Building, Rm S369, Mayo Clinic, 200 1st St, SW, Rochester, MN 55905; Department of Biomedical Engineering and Physiology, Mayo Graduate School, Mayo Clinic, Rochester, MN; Department of Biochemistry & Molecular Biology, Mayo Graduate School, Mayo Clinic, Rochester, MN. Address correspondence to: A.J.v.W.; e-mail: [email protected] Disclosures related to this publication: grant, William H. and Karen J. Eby Award (money to author and institution), National Institute of Arthritis and Musculoskeletal and Skin Disease; R01 AR049069 (money to author and institution) J.S. Department of Physical Medicine & Rehabilitation, W14, Mayo Building, Mayo Clinic, 200 1st St, SW, Rochester, MN 55905; Department of Radiology, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN; Department of Anatomy, Mayo Clinic College of Medicine, Mayo Clinic, Rochester, MN. Address correspondence to: J.S.; e-mail: [email protected] Disclosures related to this publication: grant, Center for Regenerative Medicine of Mayo Clinic career development award (money to author and institution) K.O. and D.L.J. contributed equally Submitted for publication September 29, 2015; accepted January 20, 2016.

FLA 5.4.0 DTD
PMRJ1655_proof
6 February 2016
6:13 pm
ce

1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760