Syk signaling in subarachnoid hemorrhage

Brain, Behavior, and Immunity xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Brain, Behavior, and Immunity journal homepage: www.elsevier.com/locate/ybrbi

Full-length Article

Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage Yi Xie a,1, Hongquan Guo a,1, Liumin Wang a,1, Lili Xu a, Xiaohao Zhang b, Linjie Yu c, Qian Liu a, Yunzi Li a, Nana Zhao a, Nan Zhao a, Ruidong Ye a,⇑, Xinfeng Liu a,⇑ a b c

Department of Neurology, Jinling Hospital, Medical School of Nanjing University, Nanjing, Jiangsu 210000, China Department of Neurology, The Second Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing, Jiangsu 210000, China Department of Neurology, Drum Tower Hospital, Medical School of Nanjing University, Nanjing, Jiangsu 210000, China

a r t i c l e

i n f o

Article history: Received 16 September 2016 Received in revised form 6 November 2016 Accepted 7 November 2016 Available online xxxx Keywords: Subarachnoid hemorrhage Albumin Microglia Mincle

a b s t r a c t Subarachnoid hemorrhage (SAH) is a devastating subtype of stroke. Microglial macrophage-inducible C-type lectin (Mincle) receptor launches microglial innate immunity after SAH, and thereby achieves a key step of early cerebral injury in SAH. We previously revealed albumin could improve long-term neurological outcomes after SAH. In this study, we examined the role of microglia-mediated innate immunity in the salutary effects of albumin. SAH was induced by endovascular perforation in rats. We found that albumin can significantly mitigate early neurovascular dysfunction of SAH rats. Albumin administration resulted in reduced Iba-1 and CD68 staining in cortex. Markers of microglia M1 polarization (iNOS, IL-1b, CD16, and CD32) were remarkably suppressed. Neutrophil invasion was inhibited as chemokines (MCP-1, CINC-1, and CXCL-2) mRNA levels, myeloperoxidase (MPO) and intracellular adhesion molecule-1 (ICAM-1) expressions were decreased. Mechanistically, albumin bound with microglial Mincle receptor, and retarded Mincle/Syk/IL-1b signaling in ipsilateral hemisphere subjected to SAH. In the cultured BV-2 microglial cells, we found Mincle and its ligand SAP130 mediate the cross-talk between neuronal necroptosis and microglial immunity response following SAH-related injury. Albumin could attenuate SAP130-induced Mincle upregulation and subsequent microglial inflammatory responses. The anti-inflammation effect of albumin was similar to the effect of genetic knockdown of Mincle. This effect may be attributed to a direct association between albumin and Mincle. The interaction also yielded a depression in the initiation of Mincle/Syk/IL-1b pathway. In conclusion, our results indicate that albumin can ameliorate innate immune responses after SAH. This anti-inflammatory action may be through direct restraining microglial Mincle receptor. Ó 2016 Elsevier Inc. All rights reserved.

1. Introduction Subarachnoid hemorrhage (SAH) is associated with high rates of disability and mortality (van Gijn et al., 2007). It is accompanied by a dramatic increase in intracranial pressure and a reduction of cerebral blood flow, which may cause immediate loss of consciousness and following cerebral dysfunction (Sehba et al., 2012; Suwatcharangkoon et al., 2015). Heme burden and compounds released from injured cells are the primary intermediaries in activation of resident microglia and accumulation of neutrophils (Chen et al., 2013; Friedrich et al., 2011; Hanafy, 2013). Robust inflamma⇑ Corresponding authors. 1

E-mail addresses: [email protected] (R. Ye), [email protected] (X. Liu). Equal contributors.

tory response is to improve endogenous macrophage engulfment. However, excessive immunity can induce host tissue damage. Clinical and experimental studies have illustrated the sterile inflammatory response, which contributes to injury progression following SAH, is an independent predictor of morbidity and mortality in SAH victims (Chen et al., 2013; Muroi et al., 2011). Innate immunity is initiated by immune receptors. Among these receptors, microglial macrophage-inducible C-type lectin (Mincle) receptor can sense necroptotic cell death through binding with SAP130, a subunit of the histone deacetylase (He et al., 2015; Yamasaki et al., 2008). Upon stimulation, Mincle and its downstream molecule spleen tyrosine kinase (Syk) would activate separate routes to produce inflammatory cytokines, and thereby promote neutrophils influx (Yamasaki et al., 2008; Yasukawa et al., 2014). In the central nervous system (CNS), Mincle/Syk

http://dx.doi.org/10.1016/j.bbi.2016.11.004 0889-1591/Ó 2016 Elsevier Inc. All rights reserved.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

2

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

pathway has been shown as a launching point of inflammation after ischemic stroke and traumatic brain injury (de Rivero Vaccari et al., 2015; Suzuki et al., 2013). More recently, the role of this signaling has been investigated in SAH. Mincle/Syk activation coincided with early brain injury after SAH. Inhibition of this pathway rescued inflammation-induced cerebral damage (He et al., 2015). Human serum albumin is a heart-shaped plasma protein with a single 585 amino acid polypeptide chain (Anraku et al., 2015). Albumin has multifunctional properties including maintenance of plasma colloid oncotic pressure, regulation of microvascular permeability, and interaction with circulating molecules (Doguet et al., 2012; Prajapati et al., 2011). Importantly, albumin can modulate the transcription of inflammatory genes to result in vascular hyporeactivity (Doguet et al., 2012). In the CNS, albumin may attenuate microglial and T cell activation (Ezra et al., 2015; Wang et al., 2013). We previously demonstrated a sustained neurobehavioral improvement after albumin administration in experimental SAH (Xie et al., 2015). Mild to moderate doses of albumin were able to ameliorate neurovascular injury. However, the upstream mechanism is undefined. Thus in this study we examined whether albumin exerts anti-inflammatory activity after SAH, and whether this effect is associated with Mincle receptor and microglia activation.

2. Materials and methods 2.1. SAH rat model All experimental protocols were approved by the Jinling Hospital Animal Care Committee. A total of 180 male Sprague–Dawley rats weighing 270–320 g were used in this study. The endovascular perforation model was established as described previously with slight modifications (Bederson et al., 1995). Briefly, with 1% pentobarbital anesthesia, a 4.0 monofilament nylon suture was inserted through right common carotid artery and internal carotid artery to perforate the ICA intracranial bifurcation. Sham-operated rats underwent the same procedures except that the suture was withdrawn once resistance was felt. For albumin supplementation, 20% human albumin (Biotest, Germany) was injected through tail vein 2 h after surgery under the dose of 1 g/kg. Vehicle animals received normal saline instead. Rectal temperature was maintained at 37 °C during surgery. Rats were sacrificed on post-operative day (POD) 1 for assessments of brain edema, early cerebrovascular injury and innate immune responses, on POD 1 or 7 for evaluations of neurological functions. At least 5 rats were analyzed for each data point. 2.2. Brain edema measurements Rats were decapitated and brains were divided into left and right hemisphere 24 h after surgery as described (Ye et al., 2011a). Each part was weighed immediately after removal to obtain the wet weight and again after drying in an oven at 105 °C for 24 h to acquire the dry weight. The percentage of water content was calculated as [(wet weight-dry weight)/wet weight]  100%. 2.3. Neurological assessments Neurological score was blindly evaluated using modified Garcia score (Sugawara et al., 2008). An 18-point scoring system consists of 6 sensorimotor tests including spontaneous activity, spontaneous movements of all limbs, movements of forelimbs, climbing, trunk and vibrissa touch (Ye et al., 2011b,c).

2.4. BV-2 microglia culture and experimental protocols BV-2 microglial cell line was obtained from China Infrastructure of Cell Line Resources (Beijing, China). The cells were cultured in RPMI 1640 medium supplemented with 5% fetal bovine serum (FBS; Invitrogen, USA), and 1% penicillin–streptomycin (Invitrogen, USA) solution in a 37 °C incubator (Thermo Scientific, USA) under an atmosphere of 5% CO2. 2.4.1. Experiment 1 Primary neuron culture was performed as previously reported (Ye et al., 2009). Briefly, embryonic day 18 mice were euthanatized. After removal of meninges, brains were transferred to Hank’s balanced salt solution (HBSS, Gibco, USA). Then they were digested in 0.125% trypsin (Gibco, USA) at 37 °C for 15 min. The trypsinization was terminated by 10% FBS/DMEM (Gibco, USA). The mixture was then filtered with a 100 lm cell strainer (Biologix) and centrifuged at 800 rpm for 5 min. Cells were resuspended in 10% FBS/DMEM (Gibco, USA) followed by seeding into 6-well plates (1  106 cells/ml). Two hours later neurons were transferred to Neurobasal medium (Gibco, USA) containing 2% B27 (Gibco, USA) and 1% L-Glutamate (Gibco, USA). Half of the medium was refreshed every three days. Neuronal necroptosis was induced by oxygen-glucose deprivation (OGD) for 2 h or co-culturing with TNF-a. Necrostatin-1 (BioVision, Milpitas, CA) of 50 lM was added and co-incubated. The medium was then subjected to immunoblotting and ELISA for SAP130 quantification. Neuronal culture medium was collected. Cells and debris were removed under 10,000g for 5 min at 4 °C. Thereafter the medium was added to BV-2 microglial culture medium without FBS for 24 h. Neutralizing antibody of SAP130 (abcam, UK) was used as a negative control. Immunoblotting and immunostaining were employed to investigate microglial Mincle activation. 2.4.2. Experiment 2 Subcultured BV-2 microglial cell line was seeded into 24-well microplates. Before treated with recombinant SAP130 (rSAP130; Abnova, Taiwan), cells were transferred into culture medium without FBS. Different doses of rSAP130 (0.1, 1.0, 10.0 lg/ml) were added. Lipopolysaccharide (LPS; Sigma, USA; 1 lg/ml) from Escherichia coli 0111:B4 was used to activate BV-2 cells as a positive control. They were all kept in a humid atmosphere at 37 °C containing 5% CO2 for 24 h. Cellular morphology and inflammatory cytokines levels were examined by histology and real-time PCR to verify the activated status. Mincle expression was tested by immunostaining and immunoblotting. Molecules in Mincle pathway were detected by immunoblotting. 2.4.3. Experiment 3 After rSAP130 dose of BV-2 microglial stimulation was determined, BV-2 cells were incubated with rSAP130, or meanwhile with albumin of different doses (0.1, 1.0, 10.0 mg/ml) in FBS-free culture medium. They were all kept in a humid atmosphere at 37 °C containing 5% CO2 for another 24 h. Mincle siRNA (Thermo, USA) was used as a negative control. BV-2 microglial initiation was evaluated by immunostaining, real-time PCR and ELISA quantification of cytokines. Immunoblotting was applied to assess the signals expression in Mincle pathway. To investigate the relations between Mincle and albumin, immunolabeling and coimmunoprecipitation were employed. 2.5. Small interfering RNA (siRNA) transfection BV-2 cells were transfected with scrambled siRNA (sc-siRNA) as a control group and Mincle siRNA (Thermo) at a final concentration

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

3

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

of 20 nM using Lipofectamine 2000 regent (Invitrogen) according to the manufacturer’s instructions. The cells were co-cultured with siRNA for 24 h before rSAP130 incubation.

2.6. Endocytosis of FITC-albumin BV-2 cells were seeded in 24-well microplates. After cells were cultured in RPMI 1640 medium without FBS for 6 h, 1% FITCalbumin was added and they were incubated at 37 °C for another 1 h. The wells were then washed with PBS three times, and the cells were fixed with 4% paraformaldehyde (4% PFA, dissolved in PBS, pH = 7.4) for 20 min at room temperature and washed in PBS for another three times. To explore the association of albumin and Mincle, immunofluorescence for Mincle was employed. The nuclei were stained by DAPI, and images were obtained with a confocal laser scanning microscope.

2.7. ELISA IL-1b, MCP-1, CINC-1, CXCL-2, IL-10 and TGF-b in the BV-2 culture supernatants were quantified by ELISA kits (SMLB00C, SMJE00, SMKC00B, SMM200, SM1000B, SMB100B; R&D Systems, USA) according to the manufacturer’s instructions.

2.10. Real-time PCR Cerebral tissues were homogenized in TRIzol reagent (Invitrogen, USA). Total RNA was extracted, and cDNA was reverse transcribed with a PrimeScript RT reagent kit (Thermo, USA) according to the manufacturer’s instructions. Quantitative PCR was performed on a Stratagene Mx3000P real-time PCR system (Agilent Technologies, USA) using SYBR Premix ExTaq kit (ComWin Biotech, China) for detection. The condition for amplification were pre-denaturation at 95 °C for 30 s, 35 cycles of denaturation at 95 °C for 5 s, and annealing/extension at 60 °C for 20 s (Xu et al., 2016). mRNA concentration was calculated using the threshold cycle method, and the levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of each sample were used for normalization. The primer pairs are listed in Table 1. 2.11. Co-immunoprecipitation Total cell lysates from right cerebral cortex or BV-2 microglia were extracted and prepared by using weak RIPA lysis buffer (Beyotime, PR China). Protein extracts of 500 lg were incubated with rabbit anti-Mincle (2 lg; sc-367006, Santa Cruz Biotechnology, USA) or control IgG from the same species overnight in a 4 °C shaker. The immune complexes were then linked to Protein A or G conjugated to microbeads (Cell Signaling Technology, USA) for 4 h. After the supernatant was removed by centrifugation, eluted proteins were used for immunoblotting analysis.

2.8. Histology 2.12. Immunoblotting analysis Rats were anesthetized on POD 1 and intracardially perfused with 200 ml 0.9% NaCl followed by 400 ml 4% PFA as previously reported (Xie et al., 2015). Brains were removed and postfixed in 4% PFA for 4–8 h, then cryoprotected in gradient sucrose solutions of 10%, 20% and 30%. Once finished dropping to the bottom of 30% sucrose solution, brains were dissected, embedded and frozen into optimal cutting temperature (OCT) compound, then cryosectioned coronally at 14 lm on a Leica CM1950 cryostat and stored frozen at 80 °C. Brain tissue sections or BV-2 microglial coverslips were fixed in 4% PFA for 10 min at room temperature before immunolabeling. As for blood-brain barrier (BBB) disruption evaluation, brain sections were incubated with biotin-conjugated donkey anti-rat IgG antibody (1:200; Jackson, USA) for 2 h at room temperature, and subsequently treated with ABC staining kit (Vector, USA). As for other measurements, after blocked in 5% BSA (Sigma, USA) for 1 h, sections or coverslips were incubated overnight with primary antibodies against NeuN (mouse; 1:100; MAB377, Millipore, USA), Iba-1 (rabbit; 1:1000; #019-19741, Wako, Japan), CD68 (mouse; 1:100; MCA341GA, AbD Serotec, UK), myeloperoxidase (MPO, rabbit; 1:100; sc-16128-R, Santa Cruz Biotechnology, USA), Mincle (goat; 1:100; sc-161489, Santa Cruz Biotechnology, USA) at 4 °C. After washing with PBS, they were then incubated in according secondary antibodies of either biotin- or Alex Fluor-488/594conjugated for 2 h. Then histological photographs were captured with microscope camera (Olympus MX51, Japan).

Total cell lysates from right cerebral cortex or BV-2 microglia were extracted and prepared by using the RIPA lysis buffer (Cell Signaling Technology, USA) containing 1% PMSF on ice. Sample protein concentration was determined with BCA assay (Beyotime, PR China). Immunoblotting was performed as described (Kong et al., 2013; Ye et al., 2012, 2011c). We used primary antibodies to intracellular adhesion molecule-1 (ICAM-1; goat; 1:500; sc-1511, Santa Cruz Biotechnology, USA), Mincle (CLEC-4E; rabbit; Table 1 Real-time PCR primers used in this study. Primer name

Primer sequence

iNOS

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

IL-1b CD11b CD16 CD32 NLRP3 CD206 TGF-b IL-10

2.9. Fluoro-Jade C staining

Arg-1

To identify degenerated neurons, Fluoro-Jade C (FJC) was used according to the previous study (Xie et al., 2015). Briefly, after fixed in 4% PFA, sections were immersed in a basic alcohol solution (1% NaOH in 80% ethanol), followed by 70% ethanol and 0.06% potassium permanganate solution. Then 0.0001% FJC working solution was added. Slides were then cleared in xylene and coverslipped with nonfluorescent mounting media (ComWin Biotech, China).

MCP-1 CINC-1 CXCL-2 GAPDH

CAGCATCCACGCCAAGAA CAACTCGCTCCAAGATCCCT AATGCCTCGTGCTGTCTGA GGATTTTGTCGTTGCTTGTCTC TTCTGGCGACAGTCCTAACC TTTCACCAAGCTGGATCACA GCATGCTACTTACGGTTTCC TGCGAGATGAGGCTTTTGT AGCTGCTGTCGCTGGAAT GGATGCTTGAGAAGTGAATAGG AGAGGAGTGGATAGGTTTGCTG TGGGTGTAGCGTCTGTTGAG TGCGACAGTAAACGAGGCT CAGAATGCTGGCTATAAGGGA AGGCGGTGCTCGCTTTGTA ATTGCGTTGTTGCGGTCC CCAGTCAGCCAGACCCACAT GGCAACCCAAGTAACCCTTAA TGTGGGAAAAGCCAATGAAC GGTGTCAGCGGAGTGTTG TGCTGACCCCAATAAGGAA GCTTGAGGTGGTTGTGGAAAA ACCCAAACCGAAGTCATAGC GGGGACACCCTTTAGCATC ATGCCTGACGACCCTACCA GCCTTGCCTTTGTTCAGTATCT GCAAGTTCAACGGCACAG GCCAGTAGACTCCACGACAT

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

4

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

1:500; sc-367006, Santa Cruz Biotechnology, USA), Syk (rabbit; 1:1000; #13198, Cell Signaling Technology, USA), phosphorylated-Syk (p-Syk; rabbit; 1:500; ab195732, abcam, UK), caspase recruitment domain-containing protein 9 (CARD9; rabbit; 1:1000; ab124922, abcam, UK), NLRP3 (rabbit; 1:500; sc66846, Santa Cruz Biotechnology, UK), caspase-1 p10 (rabbit; 1:500; sc-514, Santa Cruz Biotechnology, USA), IL-1b (rabbit; 1:500; sc-7884, Santa Cruz Biotechnology, USA), SAP130 (goat; 1:1000; ab3608, abcam, UK), human albumin (rabbit; 1:1000; ab151742, abcam, UK) and b-actin (rabbit; 1:3000; #4970S, Cell Signaling Technology, USA). Specific signals of proteins were visualized by chemiluminescence using the ECL western blotting detection system (Millipore, USA). For quantitative analysis, the ratio for specific signals of protein (relative density of the signal) and the constitutively expressed b-actin protein were calculated to normalize for loading and transfer artifacts introduced in immunoblotting.

2.13. Statistical analysis Statistical analysis was performed using SPSS software (SPSS Inc., Chicago, IL). All results are presented as mean with SEM. Brain water content, neurological score, quantifications for real-time PCR and immunoblotting results were analyzed using one-way ANOVA, followed by Tukey HSD post hoc test. Statistical significance was established at P < 0.05. 3. Results 3.1. The effects of albumin on neurovascular dysfunction after SAH As shown in Fig. 1, SAH resulted in ipsilateral hemisphere edema, IgG leakage, and neuronal injury, which directly damage neurovascular coupling. Moreover, impaired neurological function was observed on POD 1 and was sustained until POD 7. With 1 g/kg

Fig. 1. Early assessments of neurovascular dysfunction after SAH. (A) Brain water content, (B) BBB compromise, (C) neuronal injury, including neuronal loss and degeneration, represented by NeuN and FJC staining, and (D) sensorimotor scores in sham, SAH and albumin groups. In A, B, and C, n = 5 in each group. In D, n = 10 in each group. Data are expressed as mean ± SEM. *P < 0.05, **P < 0.01 vs SAH group. Scale bar = 20 lm. Alb, albumin.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

albumin administration, early cerebral dysfunction was significantly mitigated. Brain water content of ipsilateral hemisphere was nearly normalized to 79.5%, which was substantially lower than SAH rats (Fig. 1A, P < 0.001). Immunolabeling with antibody against IgG suggested an attenuation of disrupted BBB (Fig. 1B). NeuN+ cells were markedly more frequent, while FJC+ cells were rarely present in cortical region of ipsilateral hemisphere in albumin-treated SAH rats (Fig. 1C). These albumin-induced parenchymal improvement resulted in preserved sensorimotor functions on POD 1 and 7 (Fig. 1D; F = 26.050, P < 0.001 on POD 1; F = 24.061, P < 0.001 on POD 7). 3.2. Albumin regulates microglial M1/M2 polarization after SAH To specify the response of resident microglia under SAH attack, Iba-1 and CD68 staining were used. Iba-1 is constitutively

5

expressed in both quiescent and active microglia (Zhao et al., 2015), whereas CD68 only labels activated microglia (Monje et al., 2003). Microglia cells in a resting condition were morphologically identified with rod-shaped cell bodies and ramified processes in Iba-1 staining (Fig. 2A). In comparison, more microglial cells with rounded amoeboid morphologies, large somas, and short thick processes, known as hallmarks of activation, were detected in saline-treated SAH rats. Rats receiving albumin were found to have fewer activated microglial cells, which were more inclined to be with ramified shaped, relative smaller somas with fine processes (Fig. 2A). CD68 staining further confirmed that SAH-induced microglial activation was attenuated by albumin (Fig. 2A). Next, we sought to examine the M1/M2 microglia/macrophage polarity. Using real-time PCR, we found that M1 markers, iNOS, IL1b, CD16 and CD32, were significantly increased after SAH (Fig. 2B). However, there was a substantial reduction in mRNA

Fig. 2. Microglial activation and M1 microglia/macrophage phenotype polarization. (A) ABC peroxidase immunohistochemistry and immunofluorescence staining for Iba-1 and CD68 in sham, SAH and albumin groups. Red, CD68; blue, DAPI. (B) Real-time PCR analysis for inflammatory (iNOS, IL-1b, CD11b, CD16, CD32, NLRP3), and (C) antiinflammatory cytokines (CD206, TGF-b, IL-10, Arg-1) in three different groups. n = 5 in each group. *P < 0.05, **P < 0.01 vs SAH group. Scale bar = 20 lm. Alb, albumin.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

6

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

levels of iNOS, IL-1b, CD16 and CD32 following albumin treatment (Fig. 2B, P = 0.001, 0.001, 0.004, and 0.029), indicating that SAHdriven M1 phenotype transformation can be blocked by albumin. However, no detectable differences were noted in CD11b and NLRP3 mRNAs among groups (Fig. 2B, P = 0.300 and 0.253).mRNAs encoding CD206, IL-10, and TGF-b, transcription factors characteristic of the M2 phenotype, showed corresponding increments with M1 polarization in SAH rats (Fig. 2C). This suggested an endogenous effort to retard excessive inflammation as previously reported (Hu et al., 2012). In accordance with the declined M1 polarization induced by albumin, the M2 phenotype elevation after SAH was also suppressed. There was a remarkable attenuation of CD206, IL-10, and TGF-b mRNAs increase after albumin treatment (Fig. 2C, P = 0.003, 0.004, and 0.002). No substantial difference of Arg-1 mRNA was observed among groups (Fig. 2C, P = 0.252).

3.3. Albumin reduces neutrophil chemotaxis and infiltration Neutrophil accumulation has been reported to strongly contribute to neuroinflammation in cerebrovascular diseases (Suzuki et al., 2013). To assess neutrophil recruitment after SAH, ipsilateral hemisphere was subjected to real-time PCR for chemokines mRNAs measurement. SAH resulted in a striking burst in all three chemokines, MCP-1, CINC-1 and CXCL-2, among which CXCL-2 displayed the greatest elevation of 455.7-fold over baseline level (Fig. 3A). These chemokines, together with pro-inflammatory cytokines, could promote neutrophil influx by ICAM-1, which propagates leukocytes binding onto endothelial cells. Immunoblotting revealed a consistent increase in ICAM-1 protein level from SAH rats (Fig. 3B). However, in albumin-treated rats, MCP-1, CINC-1 and CXCL-2 mRNAs level appeared to be substantially

Fig. 3. Neutrophils chemotaxis, adherence and invasion. (A) The levels of chemokines, MCP-1, CINC-1 and CXCL-2, were evaluated by real-time PCR among three groups. (B) Immunoblotting analysis of MPO and ICAM-1 in sham, SAH and albumin groups. Protein b-actin served as control. (C) Immunofluorescence staining of MPO positive cells. Green, MPO; blue, DAPI. n = 5 in each group. Data are expressed as mean ± SEM. *P < 0.05 vs SAH group. Scale bar = 20 lm. Alb, albumin.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

lower than saline-treated SAH rats (Fig. 3A, P = 0.001, 0.003, and 0.007). Western blotting analysis further showed that SAHinduced ICAM-1 elevation was strikingly decreased by albumin at the protein level (Fig. 3B, P = 0.006). We then gauged MPO expression to examine whether albumin suppresses neutrophil influx into cerebral tissues. SAH increased MPO protein expression to 2.8-fold higher than control, which was significantly reversed by albumin (Fig. 3B; P = 0.015). Immunostaining results manifested increased neutrophils infiltrated into SAH-affected subcortical region, which was also retarded by albumin (Fig. 3C). 3.4. Albumin restrains IL-1b production via Mincle/Syk pathway Mincle/Syk/IL-1b pathway plays a pivotal role in the innate immune responses following SAH (He et al., 2015). We firstly tested whether IL-1b was associated with albumin-induced regulation of microglial homeostasis. IL-1b, as the key pro-inflammatory factor in innate immunity, displayed a 5.7-fold higher expression following SAH (Figs. 4A and S1A, P = 0.001), directly resulted from increased pro-IL-1b level (Figs. 4A and S1A, P = 0.001). Intravenous administration of albumin resulted in a profound reduction in both pro- and mature IL-1b (Figs. 4A and S1A, P = 0.002 and 0.005). To further characterize whether Mincle/Syk was responsible for the elevation of IL-1b after SAH, we compared Mincle/Syk expressions in ipsilateral hemisphere between albumin and saline control injection. The protein level of Mincle was statistically higher in vehicle group at 24 h after SAH (Figs. 4B and S1B, P = 0.001). A similar tendency was observed in the expression of the downstream kinase Syk, p-Syk (Figs. 4B and S1B, P = 0.008 and 0.012). With albumin supplementation, Mincle, Syk and p-Syk protein levels were significantly reduced (Figs. 4B and S1B, P = 0.024, 0.028 and 0.036). The secretion of mature IL-1b is regulated by Mincle receptor through two independent pathways, CARD9/Bcl-10 and NLRP3/ caspase-1 (Yasukawa et al., 2014). Following SAH, CARD9 and NLRP3 were strikingly augmented, with an increment of 3.4- and 4.1-fold respectively (Figs. 4C and S1C, P = 0.014 and 0.010).

7

However, intravenous albumin treatment significantly lowered the protein levels (Figs. 4C and S1C, P = 0.045 and 0.029). Downstream cleaved caspase-1 level, which promotes mature IL-1b secretion from pro-IL-1b, was also reduced by 63.6% (Figs. 4C and S1C, P = 0.023). These results demonstrated that albumin can control IL-1b production through the inhibition of Mincle/Syk pathway. 3.5. Neuronal necroptosis product SAP130 activates microglial Mincle and sequential immunity response We next sought to examine how Mincle/Syk launches innate immunity in SAH. Mincle, mainly expressed in microglia in the CNS (Suzuki et al., 2013), can promote innate immunity by ligating SAP130, a nuclear protein released from necroptotic cells (Seifert et al., 2016; Wells et al., 2008). We found high cytoplasmic SAP130 production and extracellular release of SAP130 in cultured neurons suffered from hypoxia injury, the key parenchymal pathophysiological process in SAH. Blockade of serine/threonine kinase receptor interaction protein 1 (RIP1) phosphorylation by necrostatin-1, which specifically inhibits necroptosis, could significantly decrease neuronal SAP130 release (Fig. 5A, B). Necroptosis was also induced by the activation of tumor necrosis factor-a (TNF-a) receptor, one of the death receptors with limited effects on caspase activation (He et al., 2009; Vandenabeele et al., 2010). With TNF-a stimulation, neuronal cultures also had amplified intracellular and extracellular SAP130 (Fig. 5C, D). Furthermore, the culture media from hypoxia-treated neurons could enhance microglial Mincle expression and cell activation, which was eliminated by the co-incubation with neutralizing antibody of SAP130 (Fig. 5E, F). These results suggested a cross-talk between neuronderived SAP130 and microglial Mincle receptor in the innate immunity response after SAH. We thereafter treated cultured BV-2 microglial cells with exogenous SAP130 protein. To determine the concentration of rSAP130 stimulating BV-2 cells, different doses of rSAP130 (0.1, 1.0, 10.0 lg/ml) were added. LPS, which is known for activating microglial cells, was used as a positive control. By light microscopic investigations and Iba-1 staining, BV-2 cells appeared to be significantly activated when treated with 1.0 lg/ml rSAP130 (Fig. 6A). Additionally, under the dose of 1.0 lg/ml, mRNA levels of proinflammatory cytokines (iNOS, IL-1b, CD11b, CD16, CD32 and NLRP3) and chemokines (CINC-1 and CXCL-2) were all substantially increased in BV-2 cells (Fig. 6B, C). No significant differences were detected in MCP-1, CD206, IL-10, Arg-1 and TGF-b mRNAs expression (Figs. 6B, C, and S2). These findings suggested 1.0 lg/ ml rSAP130, which was comparable to LPS, can specifically induce microglial activation towards the M1 phenotype. Using immunostaining, we further found that under the concentration of 1.0 lg/ ml, rSAP130 remarkably promoted the increment of microglial Mincle (Fig. 7A). Immunoblotting analysis confirmed that rSAP130 increased Mincle expression at the protein level (Fig. 7B, P = 0.001). 3.6. Albumin reduces SAP130-induced microglial sterile inflammation

Fig. 4. Albumin suppressed the protein levels of molecules in Mincle/Syk/IL-1b pathway. (A) Immunoblotting analysis for pro-IL-1b and IL-1b, and other signals in Mincle/Syk pathway, including (B) Mincle, Syk, p-Syk (Try 525), (C) CARD9, NLRP3, and caspase-1. n = 5 in each group. Alb, albumin.

Then we asked whether albumin can affect rSAP130-driven BV2 activation. To this end, BV-2 cells were incubated with different doses of albumin (0.1, 1.0, 10.0 mg/ml). The transformation of BV-2 cells from a highly ramified toward an amoeboid state was substantially inhibited by 10 mg/ml albumin (Fig. 8A). Consistently Iba-1+ cells were less frequent in 10 mg/ml albumin-treated microglial cells (Fig. 8A). Real-time PCR was employed to examine the mRNAs expression of inflammatory, anti-inflammatory cytokines and chemokines. After co-cultured with 10 mg/ml albumin, reduced iNOS, IL-1b, CD16, CD32, NLRP3, CINC-1 and CXCL-2 mRNAs were validated at the transcription level (Fig. 8B, C). No

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

8

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

detectable differences were observed in CD11b, MCP-1, CD206, IL10, Arg-1 and TGF-b mRNAs level following albumin treatment (Figs. 8B, C and S3). The intracellular reduction in M1 marker mRNAs was accompanied by an extracellular parallel decrement in their proteins in the albumin-treated BV-2 cells. ELISA exhibited that 10 mg/ml albumin led to decreases in IL-1b by 61.6%, MCP-1 by 34.1%, CINC-1 by 52.3% and CXCL-2 by 47.8% (Fig. 8D, P = 0.001, 0.015, 0.002 and 0.032), whereas the protein level of anti-inflammatory cytokines, IL-10 and TGF-b, were not affected (Fig. S4). Taken together, our data supported that albumin at the dose of 10 mg/ml can restrain rSAP130-induced BV-2 activation and sequential inflammatory activities. 3.7. Albumin selectively binds to microglial Mincle receptor We next examined whether a physical interaction exists between albumin and Mincle receptor. Co-immunoprecipitation

assays revealed that Mincle could be associated with exogenous human albumin in vivo (Fig. 9A). We then incubated BV-2 microglial cells with FITC-conjugated human albumin protein. Confocal microscopy displayed that human albumin was incorporated by microglial cells and co-localized with Mincle in the cytoplasm-membrane compartment (Fig. 9B). Further coimmunoprecipitation confirmed that human albumin could bind with Mincle receptor in the cultured microglial cells (Fig. 9C). 3.8. Mincle is critical for the albumin-induced attenuation of microglial sterile inflammation After incubation with rSAP130 and albumin for 24 h, BV-2 cells were immunostained for Mincle. Mincle siRNA was used as a positive control. As depicted in Fig. 10A, Mincle expression was more frequent in rSAP130-treated cells, which can be substantially abolished by albumin treatment. Concomitantly, Mincle expression was mitigated by Mincle siRNA. Sc-siRNA did not induce any

Fig. 5. The effects of neuronal necroptosis product SAP130 on microglial Mincle activation. (A) Cytoplasmic SAP130 level and (B) extracellular release of SAP130 of hypoxiatreated neurons. (C) Cytoplasmic and (D) extracellular release of SAP130 of TNF-a-treated neurons. (E) Mincle and IL-1b expression in BV-2 after co-incubated with neuronal normal medium, hypoxia medium and hypoxia medium plus SAP130 neutralizing antibody. (F) Light microscopic changes and Iba-1 staining results. Three independent experiments were conducted in triplicate. Data are expressed as mean ± SEM. #P < 0.05, *P < 0.05, **P < 0.01 vs control group. Scale bar = 20 lm.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

noticeable disturbances in cells immunoreactive for Mincle. We then compared the effects of albumin and genetic knockdown of Mincle on the downstream components in Mincle pathway. Albumin significantly reduced protein levels of Mincle/Syk/IL-1b pathway (Figs. 10B and S5). This counteraction was comparable to the function of Mincle siRNA. Twenty-four hours earlier than rSAP130 delivery, Mincle siRNA was added and successfully declined microglial Mincle expression (Fig. S6). Incubation with rSAP130 thereafter was not capable of rescuing Mincle as demonstrated by immunostaining and immunoblotting (Fig. 10). Furthermore siRNA-mediated knockdown of Mincle remarkably diminished SAP130-induced upregulation in the protein levels of Mincle/Syk/IL-1b signaling. Compared with rSAP130-activated cells, less immunoreactivity of Mincle, p-Syk, CARD9, NLRP3, cleaved caspase-1 and IL-1b were detected in Mincle siRNAtreated BV-2 cells (Figs. 10 and S5, P = 0.004, 0.018, 0.024, 0.040, 0.002 and 0.001). However, sc-siRNA did not represent an effect. We then compared the capacity of albumin and Mincle siRNA on the SAP130-driven microglial sterile inflammation. Real-time PCR documented that Mincle siRNA could suppress BV-2 activation towards the M1 phenotype. Mincle siRNA-treated BV-2 cells yielded a significant reduction in the mRNAs of iNOS, IL-1b, CD16, CD32, NLRP3, CINC-1 and CXCL-2, the extent of which was similar to those from albumin-treated counterparts (Fig. 11). These parallel data between albumin and Mincle siRNA indicated that Mincle is a critical target of albumin treatment for microglial inflammation. 4. Discussion SAH induces early neurovascular disruption which has been associated with decreased survival and long-term functional

9

deterioration (Sehba et al., 2012). The innate immune system is the primary contributor to the excessive parenchymatous inflammatory reactions and is essential for the progression of neurovascular injury. Following SAH ictus, central events conducing to robust innate immune responses are listed as follows: i) massive accumulation of blood contents burden such as hemoglobin, their metabolites and oxidized products; ii) materials released from necrotic cells such as ATP and SAP130, a component of small nuclear ribonucloprotein. Inflammation markers increase within 24 h after SAH and persist for at most 72 h (Sehba et al., 2012). Innate immunity occurs in the parenchyma of SAH brain, mainly in cortical regions (Friedrich et al., 2011; He et al., 2015). In the present study, we demonstrated a strong inflammatory response as exemplified by enhanced M1 microglia/macrophage polarization and neutrophil recruitment on POD 1, which are consistent with previous investigations (Friedrich et al., 2011; Hanafy, 2013; Kooijman et al., 2014). Microglia/macrophage mobilization is thought to be protective by removing cellular debris and promoting brain regeneration (Lalancette-Hébert et al., 2007). On the other hand, activated M1 microglia/macrophages exert proinflammatory effects through releasing detrimental proinflammatory cytokines (Hu et al., 2014). Sequential uncontrolled adhesion of neutrophils onto endothelial cells leads to vascular hyper-permeability and blood flow obstruction, which may directly exacerbate cerebral damage and result in local ischemia (Xue and Del Bigio, 2000). In this study, we found that a variety of chemokines including MCP-1, CXCL-1 and MIP-2 were pronouncedly increased following SAH, which are especially important for neutrophil recruitment. Meanwhile, ICAM-1, which promotes neutrophil adherence and invasion, was significantly higher in SAH rat brain. The number of infiltrated neutrophils, MPO positive staining cells, was increased following SAH. Thus

Fig. 6. The effects of exogenous rSAP130 on BV-2 cells activation. BV-2 cells were incubated with exogenous rSAP130 (0.1, 1.0, 10 lg/ml) and LPS (1 lg/ml), which served as positive control, for 24 h. (A) Light microscopic changes and Iba-1 staining results. (B) M1 phenotype polarization and (C) chemokines expressions were detected by real-time PCR among groups. Three independent experiments were conducted in triplicate. Data are expressed as mean ± SEM. *P < 0.05, **P < 0.01 vs control group. Scale bar = 20 lm.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

10

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

activated microglia and mobilized neutrophils together portend a higher risk of inordinate immunity after SAH. Recent studies have shown that Mincle receptor, an inducible immune receptor, selectively responded to SAP130, recruited kinase Syk family and activated innate immunity following SAH (He et al., 2015). Under normal circumstances, neither Mincle nor SAP130 is present in extracellular milieu (Yamasaki et al., 2008). After SAH, Mincle expression can be rapidly induced and becomes ready to sense SAP130. According to the study by He et al. (2015), after increment in the first 24 h, Mincle and its downstream pathway molecules recover to the basal level at 72 h post-SAH. Thus the first 24 h should be attached more importance in the evaluation of

innate immune response following SAH onset. Blocking Mincle pathway before CNS injury, brain swelling and neurological defect were significantly ameliorated (He et al., 2015; Suzuki et al., 2013), suggesting Mincle-dependent neuroinflammation may be a therapeutic target for SAH treatment. IL-1b is a central orchestrator of immunity and a key trigger of inflammation (Gross et al., 2009). The production of bioactive IL-1b is mediated by Mincle/Syk signaling with two independent signaling modules, CARD9 and NLRP3 (Gross et al., 2009; Yasukawa et al., 2014). On one hand, CARD9 is phosphorylated at Thr231 by protein kinase C-d, which is activated by Syk (Strasser et al., 2012). This phosphorylation is responsible for CARD9/BCL10 complex assembly, an essential signaling adaptor

Fig. 7. Microglial Mincle expression after co-incubation with 1.0 lg/ml rSAP130. (A) Immunofluorescence staining and (B) immunoblotting for Mincle expression in control, BV-2 receiving 1.0 lg/ml rSAP130 and BV-2 receiving LPS groups. Red, Mincle; blue, DAPI. Data are representative of at least three independent experiments. Data are expressed as mean ± SEM. *P < 0.05, **P < 0.01 vs control group. Scale bar = 20 lm.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

11

Fig. 8. The effects of different doses of albumin on rSAP130-induced BV-2 cells activation. The rSAP130 dose of 1.0 lg/ml was chosen to stimulate BV-2. In the albumintreated group, BV-2 cells were incubated with albumin of different doses (0.1, 1.0, 10 mg/ml) for another 22 h. (A) Light microscopic and Iba-1 staining for BV-2 cells. (B) Realtime PCR for M1-associated markers and (C) chemokines expression. (D) ELISA for IL-1b, CINC-1, CXCL-2 and MCP-1 levels in supernatant of BV-2 culture medium. Three independent experiments were conducted in triplicate. Data are expressed as mean ± SEM. #P < 0.05 vs control group; *P < 0.05, **P < 0.01 vs rSAP130 group. Scale bar = 20 lm.

Fig. 9. The interaction between albumin and Mincle. (A) Immunoassay of lysates of brain tissue after immunoprecipitation with Mincle, analyzed by immunoblotting with anti-SAP130, anti-albumin and anti-Mincle. Below, immunoblotting analysis of total lysates with anti-Mincle. n = 5 in each group. (B) Immunostaining for Mincle and albumin on BV-2 cells. BV-2 cells were stimulated by rSAP130 (1 lg/ml) for 24 h and then incubated with 1% FITC-albumin for another 1 h. Red, Mincle; green, FITC-albumin; blue, DAPI. (C) Immunoassay of lysates of BV-2 cells after immunoprecipitation with Mincle, analyzed by immunoblotting with anti-albumin and anti-Mincle. Below, immunoblotting analysis of total lysates with anti-Mincle. Data are representative of at least three independent experiments. Scale bar = 10 lm. Alb, albumin.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

12

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

Fig. 10. Mincle is critical for albumin-induced attenuation of Mincle/Syk activation in BV-2 cell. The rSAP130 dose of 1.0 lg/ml and the albumin dose of 10 mg/ml were chosen. Mincle and sc-siRNA were added 24 h earlier, and then BV-2 cells were treated with rSAP130 for another 24 h. (A) Immunofluorescence staining for Mincle expression. (B) Immunoblotting for signals in Mincle/Syk pathway. Three independent experiments were conducted in triplicate. Scale bar = 20 lm. sc-siRNA, scrambled siRNA.

protein for nuclear factor-jB (NF-jB) (Strasser et al., 2012; Yasukawa et al., 2014). The activation of NF-jB controls the synthesis of pro-IL-1b and therefore determines the secretion of biologically active IL-1b (Gross et al., 2009; Yasukawa et al., 2014). On the other hand, Syk regulates NLRP3 activity through reactive oxygen species production. NLRP3 then forms an inflammasome and activates caspase-1, which allows secretion of mature IL-1b (Chen et al., 2013; Yasukawa et al., 2014). In addition, Mincle may induce the emergence of CARD9-dependent chemokines, including CINC-1, and CXCL-2 (Brown, 2008). NLRP3 was also responsible for neutrophil infiltration and migration (He et al., 2015; Iyer et al., 2009; Liu et al., 2014; Satoh et al., 2013). Therefore, Mincle/Syk signaling pathway and downstream molecules may also lead to neutrophil adherence, invasion and influx. Albumin is a pleiotropic protein with high ligand binding capacity (Prajapati et al., 2011; Wang et al., 2013). We previously clarified a long-term neurological protection of mild to moderate doses of albumin in SAH rats (Xie et al., 2015). It is worthwhile to note that low dose of albumin had minimal impact on hematocrit, but it exerted noticeable neurovascular preservation, indicating other

properties of albumin may have contributed to its neuroprotective effects. Albumin is capable of modulating adhesive interactions between endothelium and neutrophils, through inhibiting vascular cell adhesion molecule-1 expression (Powers et al., 2002; Zhang and Frei, 2002). In ischemic stroke mice, systematic delivery of albumin suppresses the expressions of IL-10 and TGF-b in T lymphocytes in the brain and spleen (Wang et al., 2013). In the current study albumin also showed robust anti-inflammatory effects. Albumin inhibited microglial M1 phenotype polarization, as exemplified by the limitation of iNOS, IL-1b, CD16 and CD32 expressions. Furthermore albumin retarded neutrophil recruitment through decreasing chemokine expressions and ICAM-1 protein level, which is in accordance with the previous study (Powers et al., 2002). Another major observation in this study was that albumin directly target Mincle/Syk pathway. We found that albumin coprecipitated with microglial Mincle both in vivo and in vitro. Microglial endocytic albumin can co-localize with Mincle in the cytoplasm-membrane compartment. In addition, the interaction between SAP130 and Mincle was mitigated after albumin

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

13

Fig. 11. Mincle is critical for albumin-induced inhibition of microglial inflammation. BV-2 cells were co-cultured with 1.0 lg/ml rSAP130 and 10 mg/ml albumin. Mincle siRNA and sc-siRNA were added 24 h earlier, and then BV-2 cells were treated with rSAP130 for another 24 h. (A) Real-time PCR for M1-associated markers and (B) chemokines expression. Three independent experiments were conducted in triplicate. #P < 0.05 vs control group; *P < 0.05, **P < 0.01 vs rSAP130 group. sc-siRNA, scrambled siRNA.

supplementation. These results suggested that albumin may be able to competitively bind to Mincle, and therefore abolish SAP130-induced Mincle upregulation and mobilization under conditions of cell damage. Mincle can recognize SAP130, which does not contain any glycosylation sites, in a way independent of mannose (Yamasaki et al., 2008). Similarly albumin has no carbohydrates (Fanali et al., 2012), which may also facilitate an interaction with Mincle independently of mannose or a related sugar. Thus this may render a possibility for albumin competing with SAP130 for Mincle. Through preventing recognition of SAP130 by Mincle, albumin can further impede Mincle activation represented by decrement of p-Syk/Syk, CARD9, NLRP3, cleaved caspase-1 and IL-1b protein levels. Moreover, cysteine (Cys) in the molecular structure of albumin has great anti-inflammatory potential (Anraku et al., 2015; Hasegawa et al., 2012). It may interrupt protein tyrosine (Tyr) phosphorylation in Mincle (Secchi et al.,

2015), which is critical for Mincle mobilization and its transduction to intracellular signals (Yamasaki et al., 2008). However, possibility exists that albumin can be associated with SAP130 or other proteins in SAH-induced cerebral immune responses. Further studies are required to reach more details in other possible interactions mediated by albumin in SAH injury. In summary, this study identifies the anti-inflammatory activity of albumin in the experimental SAH. Albumin directly bound to microglial Mincle receptor, deactivated the downstream CARD9/ Bcl-10 and NLPR3/caspase-1 pathways, and reduced sequential IL-1b production. This action competitively prevented the crosstalk from neuronal necroptosis production SAP130 to launch microglial innate immunity in SAH (Fig. 12). These findings may encourage further studies on the albumin and other therapeutic agents targeting Mincle-dependent innate immunity in the cerebrovascular diseases.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

14

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx

Fig. 12. Schematic depicting anti-inflammatory implications of albumin towards SAP130-driven microglial Mincle activation. Mincle is mainly expressed on microglial cells. Following SAH ictus, SAP130 is induced by neuron necroptosis. SAP130-Mincle association initiates Syk recruitment and stimulation, delivering an activation signal. Then downstream CARD9 and NLRP3 are both mobilized by Syk to generate inflammatory factors and chemokines. However, with albumin supplementation, SAP130 binding to Mincle can be blocked. As a result, Syk phosphorylation is inhibited, so was downstream cascade. This identifies a novel mechanism underlying neuroprotective function of albumin.

Conflict of interest The authors declare no financial or otherwise conflicts of interest. Acknowledgments This project was supported by National Natural Science Foundation of China (No. 81200892, 31300900, 81471182, and 81400332), Natural Science Foundation of Jiangsu Province, China (BK 20150555). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.bbi.2016.11.004. References Anraku, M., Shintomo, R., Taguchi, K., Kragh-Hansen, U., Kai, T., Maruyama, T., Otagiri, M., 2015. Amino acids of importance for the antioxidant activity of human serum albumin as revealed by recombinant mutants and genetic variants. Life Sci. 134, 36–41. Bederson, J.B., Germano, I.M., Guarino, L., 1995. Cortical blood flow and cerebral perfusion pressure in a new noncraniotomy model of subarachnoid hemorrhage in the rat. Stroke 26, 1086–1092. Brown, G.D., 2008. Sensing necrosis with Mincle. Nat. Immunol. 9, 1099–1100. Chen, S., Ma, Q., Krafft, P.R., Hu, Q., Rolland 2nd, W., Sherchan, P., Zhang, J., Tang, J., Zhang, J.H., 2013. P2X7R/cryopyrin inflammasome axis inhibition reduces neuroinflammation after SAH. Neurobiol. Dis. 58, 296–307. de Rivero Vaccari, J.C., Brand III, F.J., Berti, A.F., Alonso, O.F., Bullock, M.R., de Rivero Vaccari, J.P., 2015. Mincle signaling in the innate immune response after traumatic brain injury. J. Neurotraum. 32, 228–236.

Doguet, F., Tamion, F., Le Guillou, V., Bubenheim, M., Thuillez, C., Richard, V., Bessou, J.P., 2012. Albumin limits mesenteric endothelial dysfunction and inflammatory response in cardiopulmonary bypass. Artif. Organs 36, 962–971. Ezra, A., Rabinovich-Nikitin, I., Rabinovich-Toidman, P., Solomon, B., 2015. Multifunctional effect of human serum albumin reduces Alzheimer’s disease related pathologies in the 3xTg mouse model. J. Alzheimers Dis. 50, 175–188. Fanali, G., di Masi, A., Trezza, V., Marino, M., Fasano, M., Ascenzi, P., 2012. Human serum albumin: from bench to bedside. Mol. Aspects Med. 33, 209–290. Friedrich, V., Flores, R., Muller, A., Bi, W., Peerschke, E.I., Sehba, F.A., 2011. Reduction of neutrophil activity decreases early microvascular injury after subarachnoid haemorrhage. J. Neuroinflamm. 8, 103. Gross, O., Poeck, H., Bscheider, M., Dostert, C., Hannesschlager, N., Endres, S., Hartmann, G., Tardivel, A., Schweighoffer, E., Tybulewicz, V., et al., 2009. Syk kinase signalling couples to the Nlrp3 inflammasome for anti-fungal host defence. Nature 459, 433–436. Hanafy, K.A., 2013. The role of microglia and the TLR4 pathway in neuronal apoptosis and vasospasm after subarachnoid hemorrhage. J. Neuroinflamm. 10, 83. Hasegawa, S., Ichiyama, T., Sonaka, I., Ohsaki, A., Okada, S., Wakiguchi, H., Kudo, K., Kittaka, S., Hara, M., Furukawa, S., 2012. Cysteine, histidine and glycine exhibit anti-inflammatory effects in human coronary arterial endothelial cells. Clin. Exp. Immunol. 167, 269–274. He, S., Wang, L., Miao, L., Wang, T., Du, F., Zhao, L., Wang, X., 2009. Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-a. Cell 137, 1100–1111. He, Y., Xu, L., Li, B., Guo, Z.N., Hu, Q., Guo, Z., Tang, J., Chen, Y., Zhang, Y., Zhang, J.H., 2015. Macrophage-inducible C-type lectin/spleen tyrosine kinase signaling pathway contributes to neuroinflammation after subarachnoid hemorrhage in rats. Stroke 46, 2277–2286. Hu, X., Li, P., Guo, Y., Wang, H., Leak, R.K., Chen, S., Gao, Y., Chen, J., 2012. Microglia/macrophage polarization dynamics reveal novel mechanism of injury expansion after focal cerebral ischemia. Stroke 43, 3063–3070. Hu, X., Liou, A.K., Leak, R.K., Xu, M., An, C., Suenaga, J., Shi, Y., Gao, Y., Zheng, P., Chen, J., 2014. Neurobiology of microglial action in CNS injuries: receptor-mediated signaling mechanisms and functional roles. Prog. Neurobiol. 119–120, 60–84. Iyer, S.S., Pulskens, W.P., Sadler, J.J., Butter, L.M., Teske, G.J., Ulland, T.K., Eisenbarth, S.C., Florquin, S., Flavell, R.A., Leemans, J.C., et al., 2009. Necrotic cells trigger a sterile inflammatory response through the Nlrp3 inflammasome. Proc. Natl. Acad. Sci. U S A 106, 20388–20393.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004

Y. Xie et al. / Brain, Behavior, and Immunity xxx (2016) xxx–xxx Kong, X., Liu, Y., Ye, R., Zhu, B., Zhu, Y., Liu, X., Hu, C., Luo, H., Zhang, Y., Ding, Y., et al., 2013. GSK3b is a checkpoint for TNF-a-mediated impaired osteogenic differentiation of mesenchymal stem cells in inflammatory microenvironments. Biochim. Biophys. Acta 1830, 5119–5129. Kooijman, E., Nijboer, C.H., van Velthoven, C.T., Mol, W., Dijkhuizen, R.M., Kesecioglu, J., Heijnen, C.J., 2014. Long-term functional consequences and ongoing cerebral inflammation after subarachnoid hemorrhage in the rat. PLoS ONE 9, e90584. Lalancette-Hébert, M., Gowing, G., Simard, A., Weng, Y.C., Kriz, J., 2007. Selective ablation of proliferating microglial cells exacerbates ischemic injury in the brain. J. Neurosci. 27, 2596–2605. Liu, Y., Lian, K., Zhang, L., Wang, R., Yi, F., Gao, C., Xin, C., Zhu, D., Li, Y., Yan, W., et al., 2014. TXNIP mediates NLRP3 inflammasome activation in cardiac microvascular endothelial cells as a novel mechanism in myocardial ischemia/reperfusion injury. Basic Res. Cardiol. 109, 415. Monje, M.L., Toda, H., Palmer, T.D., 2003. Inflammatory blockade restores adult hippocampal neurogenesis. Science 302, 1760–1765. Muroi, C., Mink, S., Seule, M., Bellut, D., Fandino, J., Keller, E., 2011. Monitoring of the inflammatory response after aneurysmal subarachnoid haemorrhage in the clinical setting: review of literature and report of preliminary clinical experience. Acta Neurochir. Suppl. 110 (Pt 1), 191–196. Powers, K.A., Kapus, A., Khadaroo, R.G., Papia, G., Rotstein, O.D., 2002. 25% albumin modulates adhesive interactions between neutrophils and the endothelium following shock/resuscitation. Surgery 132, 391–398. Prajapati, K.D., Sharma, S.S., Roy, N., 2011. Current perspectives on potential role of albumin in neuroprotection. Rev. Neurosci. 22, 355–363. Satoh, T., Kambe, N., Matsue, H., 2013. NLRP3 activation induces ASC-dependent programmed necrotic cell death, which leads to neutrophilic inflammation. Cell Death Dis. 4, e644. Secchi, C., Carta, M., Crescio, C., Spano, A., Arras, M., Caocci, G., Galimi, F., La Nasa, G., Pippia, P., Turrini, F., et al., 2015. T cell tyrosine phosphorylation response to transient redox stress. Cell Signal. 27, 777–788. Sehba, F.A., Hou, J., Pluta, R.M., Zhang, J.H., 2012. The importance of early brain injury after subarachnoid hemorrhage. Prog. Neurobiol. 97, 14–37. Seifert, L., Werba, G., Tiwari, S., Giao Ly, N.N., Alothman, S., Alqunaibit, D., Avanzi, A., Barilla, R., Daley, D., Greco, S.H., et al., 2016. The necrosome promotes pancreatic oncogenesis via CXCL1 and Mincle-induced immune suppression. Nature 532, 245–249. Strasser, D., Neumann, K., Bergmann, H., Marakalala, M.J., Guler, R., Rojowska, A., Hopfner, K.P., Brombacher, F., Urlaub, H., Baier, G., et al., 2012. Syk kinasecoupled C-type lectin receptors engage protein kinase C-sigma to elicit Card9 adaptor-mediated innate immunity. Immunity 36, 32–42. Sugawara, T., Ayer, R., Jadhav, V., Zhang, J.H., 2008. A new grading system evaluating bleeding scale in filament perforation subarachnoid hemorrhage rat model. J. Neurosci. Methods 167, 327–334. Suwatcharangkoon, S., Meyers, E., Falo, C., Schmidt, J.M., Agarwal, S., Claassen, J., Mayer, S.A., 2015. Loss of consciousness at onset of subarachnoid hemorrhage as an important marker of early brain injury. JAMA Neurol., 1–8. Suzuki, Y., Nakano, Y., Mishiro, K., Takagi, T., Tsuruma, K., Nakamura, M., Yoshimura, S., Shimazawa, M., Hara, H., 2013. Involvement of Mincle and Syk in the changes to innate immunity after ischemic stroke. Sci. Rep. 3, 3177.

15

van Gijn, J., Kerr, R., Rinkel, G., 2007. Subarachnoid haemorrhage. Lancet 369, 306– 318. Vandenabeele, P., Galluzzi, L., Berghe, T., Kroemer, G., 2010. Molecular mechanisms of necroptosis: an ordered cellular explosion. Nat. Rev. Mol. Cell Biol. 11, 700– 714. Wang, M., Wang, Y., He, J., Wei, S., Zhang, N., Liu, F., Liu, X., Kang, Y., Yao, X., 2013. Albumin induces neuroprotection against ischemic stroke by altering Toll-like receptor 4 and regulatory T cells in mice. CNS Neurol. Disord-Dr 12, 220–227. Wells, C., Salvage-Jones, J., Li, X., Hitchens, K., Butcher, S., Murray, R., Beckhouse, A., Manzanero, S., Cobbold, C., Schroder, K., et al., 2008. The macrophage-inducible C-type lectin, mincle, is an essential component of the innate immune response to Candida albicans. J. Immunol. 180, 7404–7413. Xie, Y., Liu, W., Zhang, X., Wang, L., Xu, L., Xiong, Y., Yang, L., Sang, H., Ye, R., Liu, X., 2015. Human albumin improves long-term behavioral sequelae after subarachnoid hemorrhage through neurovascular remodeling. Crit. Care Med. 43, e440–e449. Xu, L., Wang, L., Wen, Z., Wu, L., Jiang, Y., Yang, L., Xiao, L., Xie, Y., Ma, M., Zhu, W., 2016. Caveolin-1 is a checkpoint regulator in hypoxia-induced astrocyte apoptosis via Ras/Raf/ERK pathway. Am. J. Physiol. Cell Physiol. 310, C903– C910. Xue, M., Del Bigio, M.R., 2000. Intracortical hemorrhage injury in rats relationship between blood fractions and brain cell death. Stroke 31, 1721–1727. Yamasaki, S., Ishikawa, E., Sakuma, M., Hara, H., Ogata, K., Saito, T., 2008. Mincle is an ITAM-coupled activating receptor that senses damaged cells. Nat. Immunol. 9, 1179–1188. Yasukawa, S., Miyazaki, Y., Yoshii, C., Nakaya, M., Ozaki, N., Toda, S., Kuroda, E., Ishibashi, K., Yasuda, T., Natsuaki, Y., et al., 2014. An ITAM-Syk-CARD9 signalling axis triggers contact hypersensitivity by stimulating IL-1 production in dendritic cells. Nat. Commun. 5, 3755. Ye, R., Li, N., Han, J., Kong, X., Cao, R., Rao, Z., Zhao, G., 2009. Neuroprotective effects of ginsenoside Rd against oxygen-glucose deprivation in cultured hippocampal neurons. Neurosci. Res. 64, 306–310. Ye, R., Kong, X., Yang, Q., Zhang, Y., Han, J., Li, P., Xiong, L., Zhao, G., 2011a. Ginsenoside Rd in experimental stroke: superior neuroprotective efficacy with a wide therapeutic window. Neurotherapeutics 8, 515–525. Ye, R., Kong, X., Yang, Q., Zhang, Y., Han, J., Zhao, G., 2011b. Ginsenoside Rd attenuates redox imbalance and improves stroke outcome after focal cerebral ischemia in aged mice. Neuropharmacology 61, 815–824. Ye, R., Zhang, X., Kong, X., Han, J., Yang, Q., Zhang, Y., Chen, Y., Li, P., Liu, J., Shi, M., et al., 2011c. Ginsenoside Rd attenuates mitochondrial dysfunction and sequential apoptosis after transient focal ischemia. Neuroscience 178, 169–180. Ye, R., Yang, Q., Kong, X., Li, N., Zhang, Y., Han, J., Xiong, L., Liu, X., Zhao, G., 2012. Sevoflurane preconditioning improves mitochondrial function and long-term neurologic sequelae after transient cerebral ischemia: role of mitochondrial permeability transition. Crit. Care Med. 40, 2685–2693. Zhang, W.J., Frei, B., 2002. Albumin selectively inhibits TNFa-induced expression of vascular cell adhesion molecule-1 in human aortic endothelial cells. Cardiovasc. Res. 55, 820–829. Zhao, Q., Xie, X., Fan, Y., Zhang, J., Jiang, W., Wu, X., Yan, S., Chen, Y., Peng, C., You, Z., 2015. Phenotypic dysregulation of microglial activation in young offspring rats with maternal sleep deprivation-induced cognitive impairment. Sci. Rep. 5, 9513.

Please cite this article in press as: Xie, Y., et al. Human albumin attenuates excessive innate immunity via inhibition of microglial Mincle/Syk signaling in subarachnoid hemorrhage. Brain Behav. Immun. (2016), http://dx.doi.org/10.1016/j.bbi.2016.11.004