- Email: [email protected]
Human B-cell lymphoma cell lines are highly sensitive to apoptosis induced by all-trans retinoic acid and interferon-γ
Leukemia Research 26 (2002) 745–755
Human B-cell lymphoma cell lines are highly sensitive to apoptosis induced by all-trans retinoic acid and interferon-␥ Nozomi Niitsu a,b,∗ , Masaaki Higashihara a , Yoshio Honma b a
Department of Hematology and Internal Medicine IV, Kitasato University School of Medicine, 1-15-1 Kitasato, Sagamihara-shi, Kanagawa 228-8555, Japan b Saitama Cancer Center and Research Institute, Saitama, Japan Received 11 September 2001; accepted 4 December 2001
Abstract When cells were incubated in the presence of both interferon-␥ (IFN-␥) and all-trans retinoic acid (ATRA), the concentration of IFN-␥ required to induce apoptosis of B-cell lymphoma cells was much lower than that required for myeloid or erythroid cell lines. The concentration of IFN-␥ that effectively inhibited the proliferation of BALM-3 cells was 1/40 of that required for BALM-1 cells. STAT-1 phosphorylation, IRF-1 mRNA and protein expression and RAR- expression were enhanced to a greater degree in BALM-3 cells treated with IFN-␥ and ATRA than in BALM-1 cells treated with IFN-␥ and ATRA, suggesting that these IFN-␥ related genes were involved in the induction of apoptosis of BALM-3 cells. © 2002 Elsevier Science Ltd. All rights reserved. Keywords: B-cell lymphoma; Interferon-␥; All-trans retinoic acid; Apoptosis
1. Introduction According to the REAL/WHO pathological classification system [1], B-cell non-Hodgkin’s lymphomas (NHL) can be roughly divided into indolent and aggressive subtypes, with the prognosis and treatment strategies for these two lymphomas differing widely. Although indolent lymphomas, and in particular follicular lymphomas, advance slowly, cure is difficult even with potent chemotherapy, and thus, new treatment strategies are needed in conjunction to chemotherapy [2,3]. The treatment strategy for aggressive B-cell lymphoma is based on the five independent prognostic factors as defined by the international prognostic index (IPI), namely, age, performance status (PS), number of extranodal lesions, Ann Arbor stage, and serum lactate dehydrogenase (LDH) level [4]. It is important to analyze the prognostic factors for NHL at the time of the initial medical examination and to apply the above classification to the treatment plan. The standard therapy [5,6], in which the cyclophosphamide, doxorubicin, vincristine, prednisolone (CHOP) regimen plays a central role, is used for patients with an index of 0 or 1 (low (L) risk group) or 2 (low–intermediate (L–I) risk group). However, high–intermediate (H–I) and high (H) risk patients do not respond well to the CHOP therapy, and thus, ∗ Corresponding author. Tel.: +81-42-778-8111; fax: +81-42-778-9847. E-mail address: [email protected] (N. Niitsu).
more potent treatments have been used on an experimental basis. Hence, more potent and toxic treatments, such as high dose chemotherapy combined with peripheral blood stem cell transplantation, are being actively utilized in recent years, but even these treatments are not very effective when chemotherapeutic agents are ineffective [7]. Therefore, it will be necessary to develop molecule-targeted therapy or to establish treatment strategies utilizing other than anti-cancer agents. Retinoids are powerful biological response modifiers, with effects on cell proliferation and differentiation [8]. Retinoids and analogues of vitamin A are important regulators of cell growth, cytokine production, and differentiation in normal B-cells [9], but their roles in neoplastic B-cells are less clear. Among these effects, the induction of differentiation and apoptosis to HL-60 cells by all-trans retinoic acid (ATRA) has been widely studied [10], and ATRA has also been clinically introduced for the treatment of acute promyelocytic leukemia (APL) and has been found to induce complete remission in most patients [11]. These agents exert their effects by binding to specific nuclear receptor isoforms (␣, , and ␥) of the RAR or RXR type, which in turn bind to DNA at specific promoter sequences (RAREs) that can affect gene expression [12]. Furthermore, interferon-␥ (IFN-␥) is a glycoprotein of monomer molecular weight 20–25 kDa which is secreted from T-cells and natural killer (NK) cells. Recently, IFN-␥
0145-2126/02/$ – see front matter © 2002 Elsevier Science Ltd. All rights reserved. PII: S 0 1 4 5 - 2 1 2 6 ( 0 1 ) 0 0 2 0 2 - 8
746
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
has been reported to inhibit apoptosis and to promote survival of B-chronic lymphocytic leukemia cells in culture via an autocrine mechanism [13]. IFN-␥ functions by inducing rapid tyrosine phosphorylation of latent signal transducer and activators of transcription (STAT-1 and/or STAT-3), cytoplasmic transcription factors, which then form homodimers or heterodimers, translocate to the nucleus, bind to well-defined DNA sequences called ␥-IFN activation site (GAS), and activate transcription of the IFN regulatory factor (IRF) family of transcription factors [14,15]. In the present study, we found that ATRA induces apoptosis in B-cell lymphoma cell lines, and that this effect was enhanced synergistically in the presence of IFN-␥. An analysis of the onset mechanism of apoptosis in these cell lines showed that the combination of ATRA and IFN-␥ significantly increased the expression of IRF-1, STAT-1 and RAR-.
2. Materials and methods 2.1. Materials Human natural IFN-␣ (Sumiferon) was kindly provided by Sumitomo Seiyaku, Tokyo, Japan. ATRA, doxorubicin, daunorubicin, fludarabin, Ara C, claduribin, and etoposide were purchased from Sigma Chemical Co. (St. Louis, MO), and IFN-␥ were from Wako Pure Chemicals (Osaka, Japan). Am80 and LE540 were gifts from Professor K. Shudo (University of Tokyo, Japan) [16] and 9-cis-RA was obtained from Biomol Research Laboratories (Plymouth Meeting, PA). Ro48-2250 was a gift from F. Hoffmann-La Roche (Basel, Switzerland). 2.2. Cells and cell culture Human B-cell lymphoma (BALM-3, SU-DHL-4, U-698-M, and SKW-4), lymphoblastiod (BALM-1), and myeloid (HL-60, NB4, U937, and K562) leukemia cells were cultures in suspension in RPMI 1640 medium supplemented with 10% fetal bovine serum and 80 g/ml gentamicin at 37 ◦ C in a humidified atmosphere of 5% CO2 in air. The B-cell lymphoma cell lines were donated by Dr. Y. Matsuo (Hayashibara Biochemical Laboratories, Okayama, Japan). The BALM-3 cell line was established from a patient with diffuse poorly differentiated lymphocytic lymphoma (according to current definitions, BALM-3 falls within the category of either diffuse large B-cell lymphoma or diffuse small-cleaved cell lymphoma) [17]. The cells were negative for Epstein-Barr virus (EBV), and expressed CD10, CD19, CD20 and CD45, but not CD3, CD4, CD8, CD34 or CD56, thus, suggesting a B-cell lymphoma. The SU-DHL-4 cell line with t(14;18)q(32;21) was established from a patient with follicular B-cell lymphoma [18]. These cells were negative for EBV, and expressed CD19, CD20
and CD22, but not CD3, CD4, CD8, CD56. In addition, the U-698-M cell was established from a patient with lymphoblastic lymphosarcoma [19]. The cells expressed CD10, CD19 and CD20, thus, suggesting a B-cell lymphoma. The SKW4 cell line was established from a patient with diffuse histiocytic lymphoma [20]. These cells were negative for acid phosphatase and ␣-NB, and expressed CD19, CD20, CD56 and HLA-DR, but not CD10, CD33 and CD34. The BALM-1 cell line was established from a patient with lymphoblastic lymphoma [21]. These cells were positive for EBV and expressed CD19 and CD20, but not CD3 or CD33. 2.3. Assay of cell growth and apoptosis Suspensions of cells were cultured with or without compounds in multidishes. Cell counts were determined using a Model Z1 Counter (Beckman–Coulter Electronics, Miami, FL). Cell viability in the above experiments was examined by the modified MTT assay [22]. Briefly, 100 l of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution (5 mg/ml in PBS) was added to each well. After incubation with MTT for 4 h, the cells were centrifuged at 1000 × g for 10 min. The precipitates were dissolved in 1 ml of DMSO and their absorptions at 560 nm were determined. 2.4. Assay for caspase-3-like activity Caspase-3-like activities were assayed with the fluorogenic substrates DEVD-MCA (Peptide Institute Inc., Osaka, Japan) [23]. Briefly, 107 cells were extracted with 1 ml of 10 mM Tris–HCl (pH 8.1) containing 9 mM 3-[(3-cholamidopropyl)-dimethylammonio]-1 - propanesulfonate, 5 mM dithiothreitol, 1 M phenylmethanesulfonyl fluoride, 100 M leupeptin, 1.5 M pepstain, 18.4 M phosphoramidon, and 5 mM EDTA at 0 ◦ C for 30 min, then centrifuged at 12,000 rpm for 2 min. Extracts were stored at −80 ◦ C unit use. For assay, the extracts were mixed with the substrate (final, 100 M) and Tris–HCl (final, 10 M; pH 7.4), and incubated at 37 ◦ C for 90 min. An equal volume of 1 M acetic acid was added and the supernatants were analyzed by a fluorescence spectrophotometer (excitation at 370 nm and emission at 460 nm). Enzyme activity was expressed in pmol aminomethylcoumarin/(min mg) protein. 2.5. Flow cytometry IFN-␥ receptor expression was determined using a specific IgG2a Mc Ab raised against the ␣ chain of the receptor. Expression of IFN-␥ receptor on the surface was determined by indirect immunofluorescent staining and flow cytometry. Cells were incubated for 30 min at 4 ◦ C in the presence of an appropriate monoclonal mouse anti-human IFN-␥ receptor
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
747
antibody (CDw119). After three washes, cells were incubated for 30 min at 4 ◦ C with goat anti-mouse Ig-labeled with fluorescein, and then analyzed in an Epics EX flow cytometer (Beckman–Coulter Electronics, Miami, FL) [24]. 2.6. Determination of mRNA level by reverse transcription-PCR RNA was extracted using a modified version of the method of Chomczynski and Sacchi [25]. Quantitative reverse transcription-PCR was performed using a GeneAmp RNA PCR kit (Takara Shuzo Co., Tokyo, Japan). The primers and profiles of the amplification reactions were as follows: IRF-1-F (forward); TTCCCTCTTCCACTCGGAGT, IRF-1-R (reverse); GATATCTGGCAGGGAGTTCA, STAT-1-F; GTGGATCCATGTCTCAGTGGTACGAACT, STAT-1-R; CAGGATCCGCTCTATACTGTGTTCATCA, RAR-␣-F; TGCTGGAGGCGCTAAAGGTC, RAR-␣-R; TCTGTCCAAGGAGTCGCTGCC, RAR--F; TGCCTTTGGAAATGGATGACAC, RAR--R; TGACTGACCCCACTGTTTTCC. Total RNA (0.2 g) from cells was converted to first-strand cDNA primed with random hexamer. A total volume of 20 l of the PCR mixture contained one-fourth of the cDNA, 200 nM of each primer, 0.11 MBq of [␣-32P] dCTP, 0.2 mM of each dNTP, 1XPCR buffer, and 2.5 U Taq DNA polymerase. Samples were amplified for 30 cycles with denaturing for 1 min at 94 ◦ C, annealing for 2 min at 55 ◦ C and extension for 3 min at 72 ◦ C. Amplification cycles were preceded by a denaturation step (95 ◦ C for 2 min) and followed by an elongation step (72 ◦ C for 10 min). After amplification, PCR products were analyzed on 1.5% agarose gels electrophoresis, and the radioactivity level was evaluated by means of autoradiography using a Fuji Bio-Image Analyzer BAS2000 (Fuji Film Co. Ltd., Tokyo). 2.7. Western immunoblot of IRF-1 and STAT-1 Cell were harvested and lysed in Laemmli buffer [60 mM Tris–HCl (pH 6.8), 10% glycerol, 2% SDS, 5% 2-mercaptoethanol, and 0.003% bromophenol blue]. The protein lysate was electrophoresed on SDS–polyacrylamide gel and transferred to an Immobilon-P transfer membrane (Millipore, Bedford, MA). The filters were blocked with 5% non-fat dried milk in 1X TBS buffer [50 mM Tris–HCl (pH 7.4), 150 mM NaCl] and then incubated overnight with 0.1 mg/ml of anti-IRF-1 or STAT-1 polyclonal antibody (Upstate Biotech, Lake Placid, NY). Alkaline phosphatase-conjugated IgG (Bio-Rad Laboratories, Hercules, CA) was used as a secondary antibody (1:1000), and the bands were developed using the Immune-Lite TM II chemiluminescent protein detection system (Bio-Rad Laboratories) according to the manufacturer’s instructions.
Fig. 1. Effect of ATRA (A) or IFN-␥ (B) on growth of several human leukemia and lymphoma cells. Cells were cultured with various concentrations of the drugs for 5 days. BALM-3 (䊏), BALM-1 (䊉), SU-DHL-4 (䉱), U-698-M (䉬), SKW-4 (); myeloid: HL-60 (), NB4 (䉫), U937 (䊐); erythroid: K562 (䊊).
3. Results 3.1. Combined effect of anti-leukemic agents and ATRA on the growth-inhibition of several human leukemia and lymphoma cell lines ATRA, a biologically active metabolite of vitamin A, is a strong cytodifferentiating agent that can induce terminal differentiation and cell cycle arrest in several hematopoietic cell lines in vitro. Firstly, we investigated the effects of ATRA on several cell lines (Fig. 1A). The growth of the following lymphoma cell lines was inhibited by ATRA in a dose-dependent manner: BALM-3, SU-DHL-4, U-698-M and SKW-4. The effects of ATRA on leukemia cell lines (NB4 and U937) were comparable to those on the lymphoma cell lines, whereas those on one lymphoblastoid cell line (BALM-1) was weaker. The inhibitory effects of ATRA combined with various anti-cancer agents and cytokines on the growth of BALM-3 were investigated. Through isobologram analysis, additive effects were defined as effects demonstrating a combination index (CI) at IC50 of about 1. Synergistic effects, therefore, possessed CI values significantly smaller than 1, and supra-additive effects possessed CI values between the two. The results showed that the combination of ATRA and daunorubicin, doxorubicin, fludarabin, Ara C, camptothecin, claduribin, etoposide (Table 1) had an additive effect on the growth of BALM-3 cells. Furthermore, the combination of ATRA and IFN-␣ (Fig. 2A), M-CSF, G-CSF or TNF-␣ had an additive effect on the growth of BALM-3 cells, whereas the combination of ATRA and IFN-␥ had a synergistic
748
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
Table 1 Effects of the combination of ATRA and various anti-cancer drugs on growth inhibition of BALM-3 cells Drugs
CIa
IC50 −ATRA
Daunorubicin (nM) Doxorubicin (nM) Mitoxantrone (M) Cytosine arabinoside (nM) Hydroxyurea (M) Methotrexate (nM) Actinomycin D (pM) Camptothecin (nM) Etoposide (nM) Fludarabin (nM) Cladribin (nM) Interferon-␥ (IU/ml)
87.5 64.1 56.2 7.82 56.2 2.12 90.2 4.82 29.4 152 2.8 742
± ± ± ± ± ± ± ± ± ± ± ±
2.1b 1.2 6.8 0.4 6.8 0.1 8.1 0.1 0.1 11 0.1 31
+ATRA 80.2 50.1 49.6 6.46 49.6 2.01 84.2 2.42 25.2 131 2.4 10.1
± ± ± ± ± ± ± ± ± ± ± ±
1.4 1.0 5.4 0.3 5.4 0.1 4.8 0.2 0.6 8 0.1 0.6
0.91 0.89 0.96 0.92 0.94 0.99 0.97 0.64 0.92 0.96 0.94 0.17
Cells were cultured with various concentrations of anti-neoplastic agents in the presence or absence of 4 nM ATRA for 5 days. a Combination index at IC . CI = 1 indicates summation (additive 50 or zero interaction), CI < 1 indicates synergism. b Mean ± S.D. for four determinations.
effect (Table 1, Fig. 2 B). We also investigated the inhibitory effects of ATRA combined with these various anti-cancer agents on the growth of U937, NB4, SU-DHL-4, SKW-4 and U-698-M. For most anti-cancer agents, the results were similar to those using BALM-3 (data not shown). 3.2. Effects of IFN-γ and ATRA on the growth of several human leukemia and lymphoma cell lines Next, we investigated the effects of IFN-␥ on several human leukemia and lymphoma cell lines. Although IFN-␥ inhibited the growth of the lymphoma cell lines in a dose-dependent manner, 300 and 900 IU/ml of IFN-␥ suppressed the growth of the lymphoma cells lines more significantly than that of the leukemia cell lines (Fig. 1 B). However, it is difficult to use such high concentrations of IFN-␥ (300 and 900 IU/ml) in clinical settings, and thus, we ascertained the effects of IFN-␥ and ATRA on these cell lines. In contrast, B-cell lymphoma cell lines (BALM-3, SU-DHL-4, SKW-4 and U-698-M cells) were much more sensitive to IFN-␥ and ATRA than other cells (Fig. 3): 24.3–122.5 IU/ml of IFN-␥ and 4 nM of ATRA inhibited the growth of B-cell lymphoma cells by 50% (IC50 ). The synergistic effect of IFN-␥ and ATRA was also clearly observed when BALM-3 cells were treated for 3 days (data not shown). Next, we investigated the inhibitory effect of IFN-␥ combined with several retinoids on the growth of BALM-3 cells. Whereas 9-cis-RA binds to RXRs and RARs, ATRA does not bind to RXRs [26–28]. Am80 is a synthetic retinoid that binds tightly to RAR [29], and Ro48-2250 is an RXR agonist [30]. The combination of IFN-␥ and ATRA or Am80 had a synergistic effect on the inhibition of cellular growth, whereas the IFN-␥ and 9-cis-RA combination had a super-additive effect and the
Fig. 2. Combined effect of various anti-cancer drugs or cytokines and IFN-␥ on the growth of BALM-3 cells in a 5-day culture. Cells were cultured with various concentrations of IFN-␣, IFN-␥, daunorubicin (DNR), or fludarabin (FLU) in the presence of 0 nM (䊏), 0.4 nM (䊉), 0.8 nM (䉱), or 4 nM (䉬) ATRA. The values are the means of three determinations.
IFN-␥ and Ro48-2250 combination had an additive effect (Fig. 4). The synergistic effect of IFN-␥ and ATRA or Am80 was abolished in the presence of an RAR antagonist, such as LE540 or Ro41-5253 (data not shown). These findings suggest that the effects of retinoids on BALM-3 cells are attributable to RAR, and not to RXR. 3.3. Combined effect of IFN-γ and ATRA on the growth-inhibition of B-cell lymphoma cells The combination of ATRA and IFN-␥ had a super-additive effect on the growth of lymphoma cell lines (SU-DHL-4, U-698-M and SKW-4), whereas it had a synergistic effect on the growth of BALM-3 cells (Fig. 5). In contrast, the combination of ATRA and IFN-␥ had an additive effect on the growth of BALM-1 cells. Furthermore, the growth of BALM-3, SU-DHL-4, and SKW-4 cells was significantly
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
749
and incubated with ATRA for 5 days. For post-treatment, cells were treated with ATRA for 2 days and then with IFN-␥ for 5 days. However, there were no significant differences in the inhibitory effect between simultaneous treatment and pre/post-treatment (data not shown). In other words, the results demonstrated that there were no significant differences in the inhibitory effect whether cells were treated with IFN-␥ and ATRA simultaneously or IFN-␥ or ATRA first. 3.4. Induction of apoptosis of BALM-3 cells treated with IFN-γ and ATRA
Fig. 3. Combined effects of IFN-␥ and ATRA on the growth of several human leukemia and lymphoma cells. Cells were cultured with various concentrations of IFN-␥ in the presence of 0.4 nM ATRA for 5 days. B-lymphoma/leukemia: BALM-3 (䊏), BALM-1 (䊉), SU-DHL-4 (䉬), U-698-M (䊓), SKW-4 ( ); myeloid: HL-60 (䊊), NB4 (), U937 (䉫); erythroid: K562 (䉱).
inhibited by ATRA alone. Next, to determine whether simultaneous treatment yields the optimal results, we examined the effects of pre- and post-treatment with IFN-␥ on ATRA induced growth inhibition by BALM-3 cells. For pre-treatment, cells were treated with various concentrations of IFN-␥ for 2 days, washed in fresh medium,
When exposed to IFN-␥ in the presence of 0.4 nM ATRA for 3 days, the number of viable BALM-3 cells decreased in a dose-dependent manner. After exposure to IFN-␥ and ATRA for 2 days, a morphological analysis showed shriveled cells, chromatin condensation, nuclear fragmentation and cytoplasmic blebbing (data not shown). An apoptotic signal requires activation of caspase-3, a member of a family of cysteine proteases that are evolutionarily conserved determinants of cell death [31]. In the present study, the caspase-3-like activity of BALM-3 and SU-DHL-4 cell extracts was measured using DEVD-MCA as a substrate. When these cells were treated with IFN-␥, there was a mild increase in the caspase-3 activity, but when these cells were treated with IFN-␥ and ATRA, there was a significant in-crease (Fig. 6 A and data not shown). However, when BALM-1 cells were treated with IFN-␥ and ATRA, the caspase-3-like activity hardly increased (Fig. 6 B). Also, there were no clear changes in the expression of mRNAs (bcl-2, bcl-XL and bax) associated with apoptosis (data not shown).
Fig. 4. Growth-inhibitory activities of various retinoids in the presence of IFN-␥. BALM-3 cells were cultured for 5 days with various concentrations of IFN-␥ in the presence of 0 nM (䊏), 0.4 nM (䊉), 4 nM (䉱) retinoids. The values are the means of four determinations.
750
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
Fig. 5. Combined effects of ATRA and IFN-␥ in several B-lymphoma/leukemia cell lines. Cells were cultured with various concentrations of IFN-␥ in combination with 0 nM (䊏), 0.4 nM (䊉), or 4 nM (䉱) ATRA for 5 days. The values are the means of four determinations.
3.5. Effects of IFN-γ and/or ATRA on the expression of IFN-γ receptors and the mRNA and protein expression of IFN-γ related genes in BALM-1 and BALM-3 cells
Fig. 6. Induction of caspase-3 activity by ATRA and IFN-␥. Cell lysates from BALM-3 and SU-DHL-4 cells treated with various concentrations of IFN-␥ in combinations with (䊏), 0.4 nM (䊉), or 4 nM (䉱) ATRA for 2 days were assayed for protease activity toward Ac-DEVD-MCA. The values are the mean ± S.D. of three determinations.
Next, to ascertain the difference in the effects of IFN-␥ and ATRA on the growth of BALM-3 cells (synergistic effect) and BALM-1 cells (additive effect), we investigated and compared the expression of IFN-␥ receptors and the expression of IRF-1, IRF-2 and STAT-1 mRNAs and proteins. The expression of IFN-␥ receptors in BALM-1 and BALM-3 cells was analyzed by flow cytometry. Expression of these receptors was seen in these cells prior to treatment with IFN-␥ (BALM-1: 44%, and BALM-3: 40%), and there was no significant difference between the two cell types. Furthermore, after treating these cells with IFN-␥ for 24 h, expression of IFN-␥ receptors was investigated. However, there was no significant difference between the two cell types (BALM-1: 45%, and BALM-3: 42%) (data not shown). Moreover, there was no significant difference in the expression of these receptors when these cells were treated with IFN-␥ for 48 h. IFN regulatory factors 1 and 2 (IRF-1 and IRF-2) have been tightly linked to the regulation of cell proliferation [32]. IRF-1 functions as a transcriptional activator, whereas IRF-2 functions as a transcriptional repressor [33]. We treated BALM-3 or BALM-1 cells with IFN-␥ (30 IU/ml) and/or ATRA (0.4 nM), and analyzed whether any changes in IRF-1, IRF-2, STAT-1, RAR-␣, and RAR- mRNA expression occurred by quantitative
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
751
Fig. 7. Effects of ATRA and IFN-␥ on the expression of IRF-1, RAR-␣, RAR- mRNA in BALM-3 or BALM-1 cells. Cells were treated with IFN-␥ 30 IU/ml and/or ATRA 0.4 nM for 48 h. GAPDH, glyceraldehyde-3-dehydrogenase.
RT-PCR. IRF-1 mRNA was detectable in untreated cells, and when BALM-3 and BALM-1 cells were treated with IFN-␥, there was an approximately 1.5–2-fold increase in the expression of IRF-1 mRNA. Also, the expression of IRF-1 mRNA in BALM-1 cells treated with IFN-␥ and ATRA was approximately 1.8-fold greater than that in untreated BALM-1 cells, whereas that in BALM-3 cells treated with IFN-␥ and ATRA was approximately 3.5-fold greater than that in untreated BALM-3 cells (Fig. 7). The expression of IRF-1 mRNA began to increase 12 h after the treatment with IFN-␥ and ATRA, and this expression reached a peak 48 h the treatment (data not shown). IRF-2 was constitutively expressed in BALM-3 and BALM-1 cells, and the expression of IRF-2 mRNA in BALM-3 and BALM-1 cells did not change in response to the presence of IFN-␥, ATRA or IFN-␥ + ATRA (data not shown). The expression of RAR-␣ was confirmed in untreated BALM-3 and BALM-1 cells, and there was no change when these cells were treated with IFN-␥ and ATRA. On the other hand, the expression of RAR- was not seen in untreated BALM-1 and BALM-3 cells nor in those treated with IFN-␥. In contrast, when BALM-1 cells were treated with ATRA, a weak signal was observed indicating the expression of RAR-, and when these cells were treated with IFN-␥ and ATRA, it increased approximately 3-fold. Also, when BALM-3 cells were treated with ATRA, there was a weak signal indicating the expression of RAR-, and when these cells were treated with IFN-␥ and ATRA, it increased approximately 5-fold (Fig. 7). The expression of RAR- was first detectable 36 h after the treatment with IFN-␥ and ATRA, and this expression reached a peak 48 h the treatment (data not shown). These findings suggest that the expression of IRF-1 and RAR- mRNAs increase more significantly in BALM-3 cells (the combination of IFN-␥ and ATRA had
a synergistic effect) when compared to BALM-1 cells (the combination of IFN-␥ and ATRA had an additive effect). Next, we investigated the expression of IRF-1 and STAT-1 proteins by Western blotting. When compared to untreated BALM-3 cells, the expression of IRF-1 protein in BALM-3 cells treated with IFN-␥ was 4.8 times greater and that in BALM-3 cells treated with IFN-␥ and ATRA was 9.7 times greater. Also, the expression of IRF-1 protein in BALM-1 cells treated with IFN-␥ and/or ATRA was greater than that in untreated BALM-1 cells, but the degree of increase was significantly lower when compared to that for BALM-3 cells. The expression of IRF-1 protein was first detectable 24 h after the treatment with IFN-␥ and ATRA, and this expression reached a peak 48 h the treatment (data not shown). Furthermore, when compared to untreated BALM-3 cells, the expression of STAT-1 protein in BALM-3 cells treated with IFN-␥ was 5.1 greater and that in BALM-3 cells treated with IFN-␥ and IFN-␥ + ATRA was 12.9 times greater. However, when compared to untreated BALM-1 cells, the expressions of STAT-1 protein in BALM-1 cells treated with IFN-␥ and IFN-␥ + ATRA were 1.2 and 9.1 times greater, respectively, and thus, the degree of increase was smaller for BALM-1 cells (Fig. 8). In addition, the expression of IFR-1 and STAT-1 proteins in cells treated with ATRA only were comparable to expression in untreated cells (data not shown). The effects of IFN-␣ and IFN-␥ on BALM-3 cells were compared. The expression of IRF-1 mRNA induced by IFN-␣ was lower than that induced by IFN-␥. Also, the combination of IFN-␥ and ATRA significantly increased the expression of IRF-1 mRNA, whereas the combination of IFN-␣ and ATRA did not. Moreover, the combination of IFN-␥ and ATRA significantly increased the expression of RAR- mRNA, whereas the combination of IFN-␣ and ATRA did not (Fig. 9).
752
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
Fig. 8. Effects of IFN-␥ and ATRA + IFN-␥ on IRF-1 expression, STAT-1 phosphorylation and STAT-1 protein expression in BALM-1 and BALM-3 cells: Western blotting. Cells were treated with IFN-␥ 30 IU/ml and/or ATRA 0.4 nM for 48 h.
3.6. Proliferative potential of BALM-3 cells treated with IFN-γ and ATRA Continuous treatment with a clinically applicable concentration of IFN-␥ caused significant growth inhibition
for 2 days, but thereafter the growth inhibitory effect was modest. ATRA at 0.4 nM hardly affected the proliferation of BALM-3 cells, but the combined treatment with ATRA and IFN-␥ induced a complete growth arrest of the cells (Fig. 10). Thus, there is a clear synergistic interaction
Fig. 9. Effects of ATRA and IFN-␥ or IFN-␣ on the expression of IRF-1, RAR-␣, RAR- mRNA in BALM-3 cells. Cells were treated with IFN-␥ and/or ATRA 0.4 nM for 48 h. GAPDH, glyceraldehyde-3-dehydrogenase.
Fig. 10. Proliferation of BALM-3 cells in culture with ATRA in the presence or absence of IFN-␥. Cells were cultured without (䊏) or with 30 IU/ml IFN-␥ (䉱), 0.4 nM ATRA (䉬), 4 nM ATRA (䊐), 30 IU/l IFN-␥ plus 0.4 nM ATRA (䊊), or 30 IU/ml IFN-␥ plus 4 nM ATRA (). The culture medium was replaced on days 3, 6, 9, and 12. The cumulative cell number was calculated from the counts and the dilution used when feeding the culture. The values are means of three determinations.
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
between ATRA and IFN-␥ in their inhibition of proliferating activity of BALM-3 cells.
4. Discussion The therapeutic results for APL have improved significantly as a result of the introduction of induced differentiation therapy using ATRA. ATRA induces terminal differentiation in APL cells and cell cycle arrest in immature leukemic cells, but molecular mechanisms for these phenomena have not been clarified. Also, it has been reported that ATRA induces apoptosis in adult T-cell leukemia cell lines and reduces the p53 level by inducing p21Waf1/Cip1 [34], and that it is clinically effective in the treatment of T-cell lymphomas [35]. However, there has not been any clinical report on the effectiveness of ATRA on B-cell lymphomas. In the present study, the growth of B-cell lymphoma cell lines was more sensitive to ATRA (0.4 nM) than other cell lines. The results were the same using Am80, which is RAR-␣ ligand, whereas the effects of Ro48-2250, an RXR ligand, were less pronounced. Furthermore, the inhibitory effects of ATRA and Am80 on cellular growth were neutralized in the presence of RAR antagonists. These findings suggest that RAR-␣ agonists are effective in the treatment of B-cell lymphomas. Sundaresan et al. [35] treated aggressive B-cell lymphoma cell lines with liposome-encapsulated ATRA (L-ATRA), and documented that apoptosis was induced at 6–25 nM by the down-regulation of bcl-2 and up-regulation of bax. In the present study, ATRA had no effect on the expression of bcl-2, bax and bcl-XL mRNAs (data not shown). Although the activation of caspase-3 was confirmed, that of caspase-8 and caspase-9 was mild (data not shown). With a few exceptions, monotherapy with retinoids has not been satisfactory. Complete remission with ATRA alone is always transient as ATRA resistance develops in the treated patients as well as in vitro. IFN-␥ is a pleiotropic cytokine involved in the regulation of various phases of immune and inflammatory responses; it also has anti-viral and anti-proliferative activity. IFN-␥, after interacting with specific cell surface receptors, activates different signal cascades leading to the transcription of a distinct set of genes which mediate the biological effects of this cytokine [36–38]. IFN-␥ signaling requires the obligatory participation of five distinct proteins: type I integral membrane receptor proteins, IFN-␥ receptor-1 and IFN-␥ receptor-2, Jak1, Jak2 and STAT-1 [39]. Also, it has been documented that IFN-␥ is clinically useful in the treatment of B-cell chronic lymphocytic leukemia [40] and mycosis fungoides [41]. However, as is the case with ATRA, IFN-␥ monotherapy is not very effective. In one study, IFN-␥ induced apoptosis in leukemia B-cell lines by increasing the expression of IFN-␥ receptors [42], whereas the results of the present study showed that the expression of IFN-␥ receptors was confirmed in untreated cells, and it remained unchanged in the presence of IFN-␥ and/or ATRA. IFNs and ATRA have super-additive or synergistic
753
differentiating, anti-proliferative, anti-angiogenic and antiviral activities in various cell systems including those from human hematologic and solid tumors [43,44]. There have been many reports on the usefulness of the IFN-␣ and ATRA combination. This combination has an additive effect on the differentiation induction and growth inhibition of HL-60 and NB4 cells which have a characteristic cytogenetic abnormality, the translocation of t(15;17) [45,46]. However, it is not clear how this combination affects these cells. It has been shown that ATRA increases the expression of STAT-1 in HL-60 and U937 cells, thus, enhancing the effects of IFN-␣ and IFN-␥ [43]. Also, when NB4 cells were treated with ATRA, the expression of the IRF-1 gene increased, but synthesis of IRF-1 protein was not induced [47]. Also, there have not been many reports on the combination of IFN-␥ and ATRA. According to one report on the combination of ATRA and IFN-␣ or IFN-␥ in NB4 cells, the combination of IFN-␥ and ATRA inhibited the growth of NB4 cells more significantly than the combination of IFN-␣ and ATRA. Also, the up-regulation of p56 was not confirmed when these cells were treated with IFN-␣ or IFN-␣ + ATRA. However, the up-regulation of p56 was confirmed when these cells were treated with IFN-␥, and was further enhanced by the combination of IFN-␥ and ATRA, thus, suggesting that p56 is involved in the synergistic effect of IFN-␥ and ATRA [45]. In the present study, the expression of IFN-␥-related genes was compared between BALM-1 cells (the combination of IFN-␥ and ATRA does not have a synergistic effect) and BALM-3 cells (the combination of IFN-␥ and ATRA has a synergistic effect). The results showed that the expression of IRF-1 mRNA and protein increased significantly when BALM-3 cells were treated by IFN-␥ and ATRA than when these cells were treated by IFN-␥ or ATRA. On the other hand, the expression of IRF-1 mRNA and protein in BALM-1 cells treated with IFN-␥ and ATRA was comparable to that in BALM-1 cells treated with IFN-␥ or ATRA. Also, when compared to BALM-1 cells, the combination of IFN-␥ and ATRA induced marked phosphorylation of STAT-1 and enhanced RAR- expression in BALM-3 cells. These findings suggest that, when compared to BALM-1 cells, the expression of IRF-1 is more enhanced in BALM-3 cells due to marked STAT-1 phosphorylation, ultimately leading to apoptosis. Also, the enhanced expression of RAR- may be involved in apoptosis. The differences in the sensitivity of BALM-3 cells between the ATRA and IFN-␥ combination and ATRA and IFN-␣ combination were compared. Given that the IFN-␥ and ATRA combination enhanced the expression of IRF-1 and RAR- mRNAs more significantly than the IFN-␣ and ATRA combination, IRF-1 and RAR- signal pathways may be involved in apoptosis induced by the IFN-␥ and ATRA combination. In the future, it will be necessary to develop new treatment strategies, such as molecule-targeted therapy to treat elderly lymphoma patients who cannot tolerate conventional chemotherapeutic agents due to severe adverse reactions, and B-cell indolent lymphomas that only respond
754
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
transiently to chemotherapeutic agents. The IFN-␥ and ATRA combination could be clinically useful in the future since their effectiveness have been clinically proven. Also, in recent years, rituximab (IDEC-C2B8), a mouse–human chimeric anti-CD20 monoclonal antibody, has been introduced for the treatment of indolent B-lymphomas. When used on its own, it has a 50–70% efficacy rate and when used in combination with CHOP therapy, it shows a high efficacy of 90–100% [3,48]. However, the associated improvement in survival remains unknown due to the need for long-term observation, and this needs to be established in the future. Hence, it will also be necessary to investigate therapy-combining agents such as ATRA and IFNs and immunotherapy utilizing these antibodies. References [1] Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, et al. A revised European–American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood 1994;84:1361–92. [2] Bastion Y, Berger F, Bryon PA, Felman P, Ffrench M, Coiffier B. Follicular lymphoma: assessment of prognostic factors in 127 patients followed for 10 years. Annu Oncol 1991;2:123–34. [3] Czuczman MS, Grillo-Lopez AJ, White CA, Saleh M, Gordon L, LoBuglio AF, et al. Treatment of patients with low-grade B-cell lymphoma with the combination of chimeric anti-CD20 monoclonal antibody and CHOP chemotherapy. J Clin Oncol 1999;17:268–76. [4] Shipp MA. A predictive model for aggressive non-Hodgkin’s lymphomas: The International Non-Hodgkin’s Lymphoma Prognostic Factors Project. N Engl J Med 1993;329:987–94. [5] Fisher RI, Gaynor ER, Dahlberg S, Oken MM, Grogan TM, Mize EM, et al. Comparison of a standard regimen (CHOP) with three intensive chemotherapy regimens for advanced non-Hodgkin’s lymphoma. N Engl J Med 1993;328:1002–6. [6] Miller TP, Dana BW, Weick JK, Jones SE, Coltman CA, Dahlberg S, et al. Southwest Oncology Group clinical trials for intermediateand high-grade non-Hodgkin’s lymphomas. Semin Hematol 1998;25: 17–22. [7] Gianni AM, Bregni M, Siena S, Brambilla C, Di Nicola M, Lombardi F, et al. High-dose chemotherapy and autologous bone marrow transplantation compared with MACOP-B in aggressive B-cell lymphoma. N Engl J Med 1997;336:1290–7. [8] Warrell RP. Applications for retinoids in cancer therapy. Semin Hematol 1994;31:1–13. [9] Blomhoff HK, Smeland EB, Erikstein B, Rasmussen AM, Skrede B, Skjonsberg C, et al. Vitamin A is a key regulator for cell growth, cytokine production, and differentiation in normal B-cells. J Biol Chem 1992;267:23988–92. [10] Honma Y, Takenaga K, Kasukabe T, Hozumi M. Induction of differentiation of cultured human promyelocytic leukemia cells by retinoids. Biochem Biophys Res Commun 1980;95:507–12. [11] Huang ME, Ye YC, Chen SR, Chai JR, Lu JX, Zhoa L, et al. Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood 1988;72:567–72. [12] Chambon P. The retinoid signaling pathway: molecular and genetic analyses. Semin Cell Biol 1994;5:115–25. [13] Buschle M, Campana D, Carding SR, Richard C, Hoffbrand AV, Brenner MK. Interferon gamma inhibits apoptotic cell death in B-cell chronic lymphocytic leukemia. J Exp Med 1993;177:213–8. [14] Darnell Jr JE. STATs and gene regulation. Science 1997;277:1630–5. [15] Decker T, Kovarik P, Meinke A. GAS elements: a few nucleotides with a major impact on cytokine-induced gene expression. J Interf Cytokine Res 1997;17:121–34.
[16] Iijima T, Endo Y, Tsuji M, Kawachi E, Kagechika H, Shudo K. Dicarba-closo-dodecaboranes as a pharmacophore. Retinoidal antagonists and potential agonists. Chem Pharm Bull 1999;47: 398–404. [17] Lok MS, Koshiba H, Han T, Abe S, Minowada J, Sandberg AA. Establishment and characterization of human B lymphocytic lymphoma cell lines (BALM-3, BALM-4, and BALM-5): intraclonal variation in the B-cell differentiation stage. Int J Cancer 1979;24: 572–8. [18] Epstein AL, Herman MM, Kim H, Dorfman RF, Path MRC, Kaplan HS. Biology of the human malignant lymphomas. Part III. Intracranial heterotransplantation in the nude, athymic mouse. Cancer 1976;37:2158–76. [19] Nilsson K, Sundstrom C. Establishment and characteristics of two unique cell lines from patients with lymphosarcoma. Int J Cancer 1974;13:808–23. [20] Nilsson K, Klareskog L, Ralph P, Sundstrom C, Zech L. Phenotypic and cytogenetic characteristics of a new Epstein-Barr virus negative cell line (SKW4) derived from a B-cell lymphoma. Hematol Oncol 1983;1:277–95. [21] Minowada J, Oshimura M, Tsubota T, Higby DJ, Sandberg AA. Cytogenetic and immunoglobulin markers of human leukemic B-cell lines. Cancer Res 1977;37:3096–9. [22] Niitsu N, Yamaguchi Y, Umeda M, Honma Y. Human monocytoid leukemia cells are highly sensitive to apoptosis induced by 2 -deoxycoformycin and 2 -deoxyadenosine: association with dATP-dependent activation of caspase-3. Blood 1998;92:3368–75. [23] Thornberry NA, Bull HG, Calaycay JR, Chapman KT, Howard AD, Kostura MJ, et al. A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature 1992;356:768–74. [24] Niitsu N, Masanori U, Honma Y. Induction of differentiation of human myeloid leukemia cells by 2 -deoxycoformycin in combination with 2 -deoxyadenosine. Biochem Biophys Res Commun 1997;238:100–6. [25] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem 1987;162:156–9. [26] Petkovich M, Brand NJ, Krust A, Chambon P. A human retinoic acid receptor which belongs to the family of nuclear receptors. Nature 1987;330:444–50. [27] Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, et al. Characterization of three RXR genes that mediate the action of 9-cis-retinoic acid. Genes Dev 1992;6:329–44. [28] Heyman RA, Mangelsdorf DJ, Dyck JA, Stein RB, Eichele G, Evans RM. 9-Cis-retinoic acid is a high affinity ligand for the retinoid X receptor. Cell 1992;68:397–406. [29] Kagechika H, Kawachi E, Hashimoto Y, Himi T, Shudo K. Retinobenzoic acids. Part 1. Structure–activity relationships of aromatic amides with retinoidal activity. J Med Chem 1988;31:2182– 92. [30] Apfel CM, Kamber M, Klaus M, Mohr P, Keidel S, LeMotte PK. Enhancement of HL-60 differentiation by a new class of retinoids with selective activity on retinoid X receptor. J Biol Chem 1995;270:30765–72. [31] Fernandes-Alnemri T, Litwack G, Alnemri ES. CPP32, a novel human apoptotic protein with homologue to Caenorhabditis elegans cell death protein ced-3 and mammalian interleukin-1-converting enzyme. J Biol Chem 1994;269:30761–4. [32] Sen GC, Ransohoff RM. Interferon-induced anti-viral actions and their regulations. Adv Virus Res 1993;42:57–102. [33] Taniguchi T, Harada H, Lamphier M. Regulation of the interferon system and cell growth by the IRF transcription factors. J Cancer Res Clin Oncol 1995;121:516–20. [34] Cheng AL, Su I, Chen C, Tien H, Lay J, Chen B, et al. Use of retinoic acids in the treatment of peripheral T-cell lymphoma: a pilot study. J Clin Oncol 1994;12:1185–92.
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755 [35] Sundaresan A, Claypool K, Mehta K, Lopez-Berestein G, Cabanillas F, Ford RJ. Retinoid-mediated inhibition of cell growth with stimulation of apoptosis in aggressive B-cell lymphomas. Cell Growth Differ 1997;8:1071–82. [36] Darnell Jr J. STATs and gene regulation. Science 1997;277:1630–5. [37] Schindler C. Cytokine signal transduction. Receptor 1995;5:51–62. [38] Stark GR, Kerr IM, William BRG, Silverman RH, Schreiber RD. How cells respond to interferons. Annu Rev Biochem 1998;67:227– 64. [39] Zaki M, Douglas R, Patten N, Bachinsky M, Lamb R, Nowell P, et al. Disruption of the IFN-␥ cytokine network in chronic lymphocytic leukemia contributes to resistance of leukemic B-cells to apoptosis. Leuk Res 2000;24:611–21. [40] Horikoshi T, Onodera H, Eguchi H, Hanada N, Fukuzawa K, Takahashi M, et al. A patient with plaque-stage mycosis fungoides has successfully been treated with long-term administration of IFN-gamma and has been in complete remission for more than 6 years. Br J Dermatol 1996;134:130–3. [41] Lippman SM, Glisson BS, Kavanagh JJ, Lotan R, Hong WK, Paredes-Espinoza M, et al. Retinoic acid and interferon combination studies in human cancer. Eur J Cancer 1993;29A:9–13. [42] Lippman SM, Lotan R, Schleuniger U. Retinoid–interferon therapy of solid tumors. Int J Cancer 1997;70:481–3.
755
[43] Kumar R, Korutla L. Growth inhibition of human acute promyelocytic leukemia NB4 cells by interferons and all-trans retinoic acid: trans-modulation of inducible gene expression pathways. Anticancer Res 1995;15:353–60. [44] Bollag W. Retinoids and interferon: a new promising combination? Br J Haematol 1991;79:87–91. [45] Weihua X, Kolla V, Kalvakolanu DV. Modulation of interferon action by retinoids. Induction of murine STAT-1 gene expression by retinoic acid. J Biol Chem 1997;272:9741–8. [46] Matikainen S, Ronni T, Lehtonen A, Sareneva T, Melen K, Nordling S. Retinoic acid induces signaltransducer and activator of transcription (STAT) 1, STAT 2, and p48 expression in myeloid leukemia cells and enhances their responsiveness to interferons. Cell Growth Diff 1997;687–98. [47] Maloney DG, Grillo-Lopez AJ, White CA, Grillo-Lopez AJ, White CA, Bodkin D, et al. IDEC-C2B8 (Rituximab) antibody CD20 monoclonal antibody therapy in patients with relapsed low-grade non-Hodgkin’s lymphoma. Blood 1997;90:2188–95. [48] Czuczman MS, Grillo-Lopez AJ, White CA, Saleh M, Gordon L, LoBuglio AF, et al. Treatment of patients with low-grade B-cell lymphoma with the combination of chimeric anti-CD20 monoclocal antibody and CHOP chemotherapy. J Clin Oncol 1999;16: 268–76.
Human B-cell lymphoma cell lines are highly sensitive to apoptosis induced by all-trans retinoic acid and interferon-␥ Nozomi Niitsu a,b,∗ , Masaaki Higashihara a , Yoshio Honma b a
Department of Hematology and Internal Medicine IV, Kitasato University School of Medicine, 1-15-1 Kitasato, Sagamihara-shi, Kanagawa 228-8555, Japan b Saitama Cancer Center and Research Institute, Saitama, Japan Received 11 September 2001; accepted 4 December 2001
Abstract When cells were incubated in the presence of both interferon-␥ (IFN-␥) and all-trans retinoic acid (ATRA), the concentration of IFN-␥ required to induce apoptosis of B-cell lymphoma cells was much lower than that required for myeloid or erythroid cell lines. The concentration of IFN-␥ that effectively inhibited the proliferation of BALM-3 cells was 1/40 of that required for BALM-1 cells. STAT-1 phosphorylation, IRF-1 mRNA and protein expression and RAR- expression were enhanced to a greater degree in BALM-3 cells treated with IFN-␥ and ATRA than in BALM-1 cells treated with IFN-␥ and ATRA, suggesting that these IFN-␥ related genes were involved in the induction of apoptosis of BALM-3 cells. © 2002 Elsevier Science Ltd. All rights reserved. Keywords: B-cell lymphoma; Interferon-␥; All-trans retinoic acid; Apoptosis
1. Introduction According to the REAL/WHO pathological classification system [1], B-cell non-Hodgkin’s lymphomas (NHL) can be roughly divided into indolent and aggressive subtypes, with the prognosis and treatment strategies for these two lymphomas differing widely. Although indolent lymphomas, and in particular follicular lymphomas, advance slowly, cure is difficult even with potent chemotherapy, and thus, new treatment strategies are needed in conjunction to chemotherapy [2,3]. The treatment strategy for aggressive B-cell lymphoma is based on the five independent prognostic factors as defined by the international prognostic index (IPI), namely, age, performance status (PS), number of extranodal lesions, Ann Arbor stage, and serum lactate dehydrogenase (LDH) level [4]. It is important to analyze the prognostic factors for NHL at the time of the initial medical examination and to apply the above classification to the treatment plan. The standard therapy [5,6], in which the cyclophosphamide, doxorubicin, vincristine, prednisolone (CHOP) regimen plays a central role, is used for patients with an index of 0 or 1 (low (L) risk group) or 2 (low–intermediate (L–I) risk group). However, high–intermediate (H–I) and high (H) risk patients do not respond well to the CHOP therapy, and thus, ∗ Corresponding author. Tel.: +81-42-778-8111; fax: +81-42-778-9847. E-mail address: [email protected] (N. Niitsu).
more potent treatments have been used on an experimental basis. Hence, more potent and toxic treatments, such as high dose chemotherapy combined with peripheral blood stem cell transplantation, are being actively utilized in recent years, but even these treatments are not very effective when chemotherapeutic agents are ineffective [7]. Therefore, it will be necessary to develop molecule-targeted therapy or to establish treatment strategies utilizing other than anti-cancer agents. Retinoids are powerful biological response modifiers, with effects on cell proliferation and differentiation [8]. Retinoids and analogues of vitamin A are important regulators of cell growth, cytokine production, and differentiation in normal B-cells [9], but their roles in neoplastic B-cells are less clear. Among these effects, the induction of differentiation and apoptosis to HL-60 cells by all-trans retinoic acid (ATRA) has been widely studied [10], and ATRA has also been clinically introduced for the treatment of acute promyelocytic leukemia (APL) and has been found to induce complete remission in most patients [11]. These agents exert their effects by binding to specific nuclear receptor isoforms (␣, , and ␥) of the RAR or RXR type, which in turn bind to DNA at specific promoter sequences (RAREs) that can affect gene expression [12]. Furthermore, interferon-␥ (IFN-␥) is a glycoprotein of monomer molecular weight 20–25 kDa which is secreted from T-cells and natural killer (NK) cells. Recently, IFN-␥
0145-2126/02/$ – see front matter © 2002 Elsevier Science Ltd. All rights reserved. PII: S 0 1 4 5 - 2 1 2 6 ( 0 1 ) 0 0 2 0 2 - 8
746
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
has been reported to inhibit apoptosis and to promote survival of B-chronic lymphocytic leukemia cells in culture via an autocrine mechanism [13]. IFN-␥ functions by inducing rapid tyrosine phosphorylation of latent signal transducer and activators of transcription (STAT-1 and/or STAT-3), cytoplasmic transcription factors, which then form homodimers or heterodimers, translocate to the nucleus, bind to well-defined DNA sequences called ␥-IFN activation site (GAS), and activate transcription of the IFN regulatory factor (IRF) family of transcription factors [14,15]. In the present study, we found that ATRA induces apoptosis in B-cell lymphoma cell lines, and that this effect was enhanced synergistically in the presence of IFN-␥. An analysis of the onset mechanism of apoptosis in these cell lines showed that the combination of ATRA and IFN-␥ significantly increased the expression of IRF-1, STAT-1 and RAR-.
2. Materials and methods 2.1. Materials Human natural IFN-␣ (Sumiferon) was kindly provided by Sumitomo Seiyaku, Tokyo, Japan. ATRA, doxorubicin, daunorubicin, fludarabin, Ara C, claduribin, and etoposide were purchased from Sigma Chemical Co. (St. Louis, MO), and IFN-␥ were from Wako Pure Chemicals (Osaka, Japan). Am80 and LE540 were gifts from Professor K. Shudo (University of Tokyo, Japan) [16] and 9-cis-RA was obtained from Biomol Research Laboratories (Plymouth Meeting, PA). Ro48-2250 was a gift from F. Hoffmann-La Roche (Basel, Switzerland). 2.2. Cells and cell culture Human B-cell lymphoma (BALM-3, SU-DHL-4, U-698-M, and SKW-4), lymphoblastiod (BALM-1), and myeloid (HL-60, NB4, U937, and K562) leukemia cells were cultures in suspension in RPMI 1640 medium supplemented with 10% fetal bovine serum and 80 g/ml gentamicin at 37 ◦ C in a humidified atmosphere of 5% CO2 in air. The B-cell lymphoma cell lines were donated by Dr. Y. Matsuo (Hayashibara Biochemical Laboratories, Okayama, Japan). The BALM-3 cell line was established from a patient with diffuse poorly differentiated lymphocytic lymphoma (according to current definitions, BALM-3 falls within the category of either diffuse large B-cell lymphoma or diffuse small-cleaved cell lymphoma) [17]. The cells were negative for Epstein-Barr virus (EBV), and expressed CD10, CD19, CD20 and CD45, but not CD3, CD4, CD8, CD34 or CD56, thus, suggesting a B-cell lymphoma. The SU-DHL-4 cell line with t(14;18)q(32;21) was established from a patient with follicular B-cell lymphoma [18]. These cells were negative for EBV, and expressed CD19, CD20
and CD22, but not CD3, CD4, CD8, CD56. In addition, the U-698-M cell was established from a patient with lymphoblastic lymphosarcoma [19]. The cells expressed CD10, CD19 and CD20, thus, suggesting a B-cell lymphoma. The SKW4 cell line was established from a patient with diffuse histiocytic lymphoma [20]. These cells were negative for acid phosphatase and ␣-NB, and expressed CD19, CD20, CD56 and HLA-DR, but not CD10, CD33 and CD34. The BALM-1 cell line was established from a patient with lymphoblastic lymphoma [21]. These cells were positive for EBV and expressed CD19 and CD20, but not CD3 or CD33. 2.3. Assay of cell growth and apoptosis Suspensions of cells were cultured with or without compounds in multidishes. Cell counts were determined using a Model Z1 Counter (Beckman–Coulter Electronics, Miami, FL). Cell viability in the above experiments was examined by the modified MTT assay [22]. Briefly, 100 l of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution (5 mg/ml in PBS) was added to each well. After incubation with MTT for 4 h, the cells were centrifuged at 1000 × g for 10 min. The precipitates were dissolved in 1 ml of DMSO and their absorptions at 560 nm were determined. 2.4. Assay for caspase-3-like activity Caspase-3-like activities were assayed with the fluorogenic substrates DEVD-MCA (Peptide Institute Inc., Osaka, Japan) [23]. Briefly, 107 cells were extracted with 1 ml of 10 mM Tris–HCl (pH 8.1) containing 9 mM 3-[(3-cholamidopropyl)-dimethylammonio]-1 - propanesulfonate, 5 mM dithiothreitol, 1 M phenylmethanesulfonyl fluoride, 100 M leupeptin, 1.5 M pepstain, 18.4 M phosphoramidon, and 5 mM EDTA at 0 ◦ C for 30 min, then centrifuged at 12,000 rpm for 2 min. Extracts were stored at −80 ◦ C unit use. For assay, the extracts were mixed with the substrate (final, 100 M) and Tris–HCl (final, 10 M; pH 7.4), and incubated at 37 ◦ C for 90 min. An equal volume of 1 M acetic acid was added and the supernatants were analyzed by a fluorescence spectrophotometer (excitation at 370 nm and emission at 460 nm). Enzyme activity was expressed in pmol aminomethylcoumarin/(min mg) protein. 2.5. Flow cytometry IFN-␥ receptor expression was determined using a specific IgG2a Mc Ab raised against the ␣ chain of the receptor. Expression of IFN-␥ receptor on the surface was determined by indirect immunofluorescent staining and flow cytometry. Cells were incubated for 30 min at 4 ◦ C in the presence of an appropriate monoclonal mouse anti-human IFN-␥ receptor
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
747
antibody (CDw119). After three washes, cells were incubated for 30 min at 4 ◦ C with goat anti-mouse Ig-labeled with fluorescein, and then analyzed in an Epics EX flow cytometer (Beckman–Coulter Electronics, Miami, FL) [24]. 2.6. Determination of mRNA level by reverse transcription-PCR RNA was extracted using a modified version of the method of Chomczynski and Sacchi [25]. Quantitative reverse transcription-PCR was performed using a GeneAmp RNA PCR kit (Takara Shuzo Co., Tokyo, Japan). The primers and profiles of the amplification reactions were as follows: IRF-1-F (forward); TTCCCTCTTCCACTCGGAGT, IRF-1-R (reverse); GATATCTGGCAGGGAGTTCA, STAT-1-F; GTGGATCCATGTCTCAGTGGTACGAACT, STAT-1-R; CAGGATCCGCTCTATACTGTGTTCATCA, RAR-␣-F; TGCTGGAGGCGCTAAAGGTC, RAR-␣-R; TCTGTCCAAGGAGTCGCTGCC, RAR--F; TGCCTTTGGAAATGGATGACAC, RAR--R; TGACTGACCCCACTGTTTTCC. Total RNA (0.2 g) from cells was converted to first-strand cDNA primed with random hexamer. A total volume of 20 l of the PCR mixture contained one-fourth of the cDNA, 200 nM of each primer, 0.11 MBq of [␣-32P] dCTP, 0.2 mM of each dNTP, 1XPCR buffer, and 2.5 U Taq DNA polymerase. Samples were amplified for 30 cycles with denaturing for 1 min at 94 ◦ C, annealing for 2 min at 55 ◦ C and extension for 3 min at 72 ◦ C. Amplification cycles were preceded by a denaturation step (95 ◦ C for 2 min) and followed by an elongation step (72 ◦ C for 10 min). After amplification, PCR products were analyzed on 1.5% agarose gels electrophoresis, and the radioactivity level was evaluated by means of autoradiography using a Fuji Bio-Image Analyzer BAS2000 (Fuji Film Co. Ltd., Tokyo). 2.7. Western immunoblot of IRF-1 and STAT-1 Cell were harvested and lysed in Laemmli buffer [60 mM Tris–HCl (pH 6.8), 10% glycerol, 2% SDS, 5% 2-mercaptoethanol, and 0.003% bromophenol blue]. The protein lysate was electrophoresed on SDS–polyacrylamide gel and transferred to an Immobilon-P transfer membrane (Millipore, Bedford, MA). The filters were blocked with 5% non-fat dried milk in 1X TBS buffer [50 mM Tris–HCl (pH 7.4), 150 mM NaCl] and then incubated overnight with 0.1 mg/ml of anti-IRF-1 or STAT-1 polyclonal antibody (Upstate Biotech, Lake Placid, NY). Alkaline phosphatase-conjugated IgG (Bio-Rad Laboratories, Hercules, CA) was used as a secondary antibody (1:1000), and the bands were developed using the Immune-Lite TM II chemiluminescent protein detection system (Bio-Rad Laboratories) according to the manufacturer’s instructions.
Fig. 1. Effect of ATRA (A) or IFN-␥ (B) on growth of several human leukemia and lymphoma cells. Cells were cultured with various concentrations of the drugs for 5 days. BALM-3 (䊏), BALM-1 (䊉), SU-DHL-4 (䉱), U-698-M (䉬), SKW-4 (); myeloid: HL-60 (), NB4 (䉫), U937 (䊐); erythroid: K562 (䊊).
3. Results 3.1. Combined effect of anti-leukemic agents and ATRA on the growth-inhibition of several human leukemia and lymphoma cell lines ATRA, a biologically active metabolite of vitamin A, is a strong cytodifferentiating agent that can induce terminal differentiation and cell cycle arrest in several hematopoietic cell lines in vitro. Firstly, we investigated the effects of ATRA on several cell lines (Fig. 1A). The growth of the following lymphoma cell lines was inhibited by ATRA in a dose-dependent manner: BALM-3, SU-DHL-4, U-698-M and SKW-4. The effects of ATRA on leukemia cell lines (NB4 and U937) were comparable to those on the lymphoma cell lines, whereas those on one lymphoblastoid cell line (BALM-1) was weaker. The inhibitory effects of ATRA combined with various anti-cancer agents and cytokines on the growth of BALM-3 were investigated. Through isobologram analysis, additive effects were defined as effects demonstrating a combination index (CI) at IC50 of about 1. Synergistic effects, therefore, possessed CI values significantly smaller than 1, and supra-additive effects possessed CI values between the two. The results showed that the combination of ATRA and daunorubicin, doxorubicin, fludarabin, Ara C, camptothecin, claduribin, etoposide (Table 1) had an additive effect on the growth of BALM-3 cells. Furthermore, the combination of ATRA and IFN-␣ (Fig. 2A), M-CSF, G-CSF or TNF-␣ had an additive effect on the growth of BALM-3 cells, whereas the combination of ATRA and IFN-␥ had a synergistic
748
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
Table 1 Effects of the combination of ATRA and various anti-cancer drugs on growth inhibition of BALM-3 cells Drugs
CIa
IC50 −ATRA
Daunorubicin (nM) Doxorubicin (nM) Mitoxantrone (M) Cytosine arabinoside (nM) Hydroxyurea (M) Methotrexate (nM) Actinomycin D (pM) Camptothecin (nM) Etoposide (nM) Fludarabin (nM) Cladribin (nM) Interferon-␥ (IU/ml)
87.5 64.1 56.2 7.82 56.2 2.12 90.2 4.82 29.4 152 2.8 742
± ± ± ± ± ± ± ± ± ± ± ±
2.1b 1.2 6.8 0.4 6.8 0.1 8.1 0.1 0.1 11 0.1 31
+ATRA 80.2 50.1 49.6 6.46 49.6 2.01 84.2 2.42 25.2 131 2.4 10.1
± ± ± ± ± ± ± ± ± ± ± ±
1.4 1.0 5.4 0.3 5.4 0.1 4.8 0.2 0.6 8 0.1 0.6
0.91 0.89 0.96 0.92 0.94 0.99 0.97 0.64 0.92 0.96 0.94 0.17
Cells were cultured with various concentrations of anti-neoplastic agents in the presence or absence of 4 nM ATRA for 5 days. a Combination index at IC . CI = 1 indicates summation (additive 50 or zero interaction), CI < 1 indicates synergism. b Mean ± S.D. for four determinations.
effect (Table 1, Fig. 2 B). We also investigated the inhibitory effects of ATRA combined with these various anti-cancer agents on the growth of U937, NB4, SU-DHL-4, SKW-4 and U-698-M. For most anti-cancer agents, the results were similar to those using BALM-3 (data not shown). 3.2. Effects of IFN-γ and ATRA on the growth of several human leukemia and lymphoma cell lines Next, we investigated the effects of IFN-␥ on several human leukemia and lymphoma cell lines. Although IFN-␥ inhibited the growth of the lymphoma cell lines in a dose-dependent manner, 300 and 900 IU/ml of IFN-␥ suppressed the growth of the lymphoma cells lines more significantly than that of the leukemia cell lines (Fig. 1 B). However, it is difficult to use such high concentrations of IFN-␥ (300 and 900 IU/ml) in clinical settings, and thus, we ascertained the effects of IFN-␥ and ATRA on these cell lines. In contrast, B-cell lymphoma cell lines (BALM-3, SU-DHL-4, SKW-4 and U-698-M cells) were much more sensitive to IFN-␥ and ATRA than other cells (Fig. 3): 24.3–122.5 IU/ml of IFN-␥ and 4 nM of ATRA inhibited the growth of B-cell lymphoma cells by 50% (IC50 ). The synergistic effect of IFN-␥ and ATRA was also clearly observed when BALM-3 cells were treated for 3 days (data not shown). Next, we investigated the inhibitory effect of IFN-␥ combined with several retinoids on the growth of BALM-3 cells. Whereas 9-cis-RA binds to RXRs and RARs, ATRA does not bind to RXRs [26–28]. Am80 is a synthetic retinoid that binds tightly to RAR [29], and Ro48-2250 is an RXR agonist [30]. The combination of IFN-␥ and ATRA or Am80 had a synergistic effect on the inhibition of cellular growth, whereas the IFN-␥ and 9-cis-RA combination had a super-additive effect and the
Fig. 2. Combined effect of various anti-cancer drugs or cytokines and IFN-␥ on the growth of BALM-3 cells in a 5-day culture. Cells were cultured with various concentrations of IFN-␣, IFN-␥, daunorubicin (DNR), or fludarabin (FLU) in the presence of 0 nM (䊏), 0.4 nM (䊉), 0.8 nM (䉱), or 4 nM (䉬) ATRA. The values are the means of three determinations.
IFN-␥ and Ro48-2250 combination had an additive effect (Fig. 4). The synergistic effect of IFN-␥ and ATRA or Am80 was abolished in the presence of an RAR antagonist, such as LE540 or Ro41-5253 (data not shown). These findings suggest that the effects of retinoids on BALM-3 cells are attributable to RAR, and not to RXR. 3.3. Combined effect of IFN-γ and ATRA on the growth-inhibition of B-cell lymphoma cells The combination of ATRA and IFN-␥ had a super-additive effect on the growth of lymphoma cell lines (SU-DHL-4, U-698-M and SKW-4), whereas it had a synergistic effect on the growth of BALM-3 cells (Fig. 5). In contrast, the combination of ATRA and IFN-␥ had an additive effect on the growth of BALM-1 cells. Furthermore, the growth of BALM-3, SU-DHL-4, and SKW-4 cells was significantly
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
749
and incubated with ATRA for 5 days. For post-treatment, cells were treated with ATRA for 2 days and then with IFN-␥ for 5 days. However, there were no significant differences in the inhibitory effect between simultaneous treatment and pre/post-treatment (data not shown). In other words, the results demonstrated that there were no significant differences in the inhibitory effect whether cells were treated with IFN-␥ and ATRA simultaneously or IFN-␥ or ATRA first. 3.4. Induction of apoptosis of BALM-3 cells treated with IFN-γ and ATRA
Fig. 3. Combined effects of IFN-␥ and ATRA on the growth of several human leukemia and lymphoma cells. Cells were cultured with various concentrations of IFN-␥ in the presence of 0.4 nM ATRA for 5 days. B-lymphoma/leukemia: BALM-3 (䊏), BALM-1 (䊉), SU-DHL-4 (䉬), U-698-M (䊓), SKW-4 ( ); myeloid: HL-60 (䊊), NB4 (), U937 (䉫); erythroid: K562 (䉱).
inhibited by ATRA alone. Next, to determine whether simultaneous treatment yields the optimal results, we examined the effects of pre- and post-treatment with IFN-␥ on ATRA induced growth inhibition by BALM-3 cells. For pre-treatment, cells were treated with various concentrations of IFN-␥ for 2 days, washed in fresh medium,
When exposed to IFN-␥ in the presence of 0.4 nM ATRA for 3 days, the number of viable BALM-3 cells decreased in a dose-dependent manner. After exposure to IFN-␥ and ATRA for 2 days, a morphological analysis showed shriveled cells, chromatin condensation, nuclear fragmentation and cytoplasmic blebbing (data not shown). An apoptotic signal requires activation of caspase-3, a member of a family of cysteine proteases that are evolutionarily conserved determinants of cell death [31]. In the present study, the caspase-3-like activity of BALM-3 and SU-DHL-4 cell extracts was measured using DEVD-MCA as a substrate. When these cells were treated with IFN-␥, there was a mild increase in the caspase-3 activity, but when these cells were treated with IFN-␥ and ATRA, there was a significant in-crease (Fig. 6 A and data not shown). However, when BALM-1 cells were treated with IFN-␥ and ATRA, the caspase-3-like activity hardly increased (Fig. 6 B). Also, there were no clear changes in the expression of mRNAs (bcl-2, bcl-XL and bax) associated with apoptosis (data not shown).
Fig. 4. Growth-inhibitory activities of various retinoids in the presence of IFN-␥. BALM-3 cells were cultured for 5 days with various concentrations of IFN-␥ in the presence of 0 nM (䊏), 0.4 nM (䊉), 4 nM (䉱) retinoids. The values are the means of four determinations.
750
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
Fig. 5. Combined effects of ATRA and IFN-␥ in several B-lymphoma/leukemia cell lines. Cells were cultured with various concentrations of IFN-␥ in combination with 0 nM (䊏), 0.4 nM (䊉), or 4 nM (䉱) ATRA for 5 days. The values are the means of four determinations.
3.5. Effects of IFN-γ and/or ATRA on the expression of IFN-γ receptors and the mRNA and protein expression of IFN-γ related genes in BALM-1 and BALM-3 cells
Fig. 6. Induction of caspase-3 activity by ATRA and IFN-␥. Cell lysates from BALM-3 and SU-DHL-4 cells treated with various concentrations of IFN-␥ in combinations with (䊏), 0.4 nM (䊉), or 4 nM (䉱) ATRA for 2 days were assayed for protease activity toward Ac-DEVD-MCA. The values are the mean ± S.D. of three determinations.
Next, to ascertain the difference in the effects of IFN-␥ and ATRA on the growth of BALM-3 cells (synergistic effect) and BALM-1 cells (additive effect), we investigated and compared the expression of IFN-␥ receptors and the expression of IRF-1, IRF-2 and STAT-1 mRNAs and proteins. The expression of IFN-␥ receptors in BALM-1 and BALM-3 cells was analyzed by flow cytometry. Expression of these receptors was seen in these cells prior to treatment with IFN-␥ (BALM-1: 44%, and BALM-3: 40%), and there was no significant difference between the two cell types. Furthermore, after treating these cells with IFN-␥ for 24 h, expression of IFN-␥ receptors was investigated. However, there was no significant difference between the two cell types (BALM-1: 45%, and BALM-3: 42%) (data not shown). Moreover, there was no significant difference in the expression of these receptors when these cells were treated with IFN-␥ for 48 h. IFN regulatory factors 1 and 2 (IRF-1 and IRF-2) have been tightly linked to the regulation of cell proliferation [32]. IRF-1 functions as a transcriptional activator, whereas IRF-2 functions as a transcriptional repressor [33]. We treated BALM-3 or BALM-1 cells with IFN-␥ (30 IU/ml) and/or ATRA (0.4 nM), and analyzed whether any changes in IRF-1, IRF-2, STAT-1, RAR-␣, and RAR- mRNA expression occurred by quantitative
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
751
Fig. 7. Effects of ATRA and IFN-␥ on the expression of IRF-1, RAR-␣, RAR- mRNA in BALM-3 or BALM-1 cells. Cells were treated with IFN-␥ 30 IU/ml and/or ATRA 0.4 nM for 48 h. GAPDH, glyceraldehyde-3-dehydrogenase.
RT-PCR. IRF-1 mRNA was detectable in untreated cells, and when BALM-3 and BALM-1 cells were treated with IFN-␥, there was an approximately 1.5–2-fold increase in the expression of IRF-1 mRNA. Also, the expression of IRF-1 mRNA in BALM-1 cells treated with IFN-␥ and ATRA was approximately 1.8-fold greater than that in untreated BALM-1 cells, whereas that in BALM-3 cells treated with IFN-␥ and ATRA was approximately 3.5-fold greater than that in untreated BALM-3 cells (Fig. 7). The expression of IRF-1 mRNA began to increase 12 h after the treatment with IFN-␥ and ATRA, and this expression reached a peak 48 h the treatment (data not shown). IRF-2 was constitutively expressed in BALM-3 and BALM-1 cells, and the expression of IRF-2 mRNA in BALM-3 and BALM-1 cells did not change in response to the presence of IFN-␥, ATRA or IFN-␥ + ATRA (data not shown). The expression of RAR-␣ was confirmed in untreated BALM-3 and BALM-1 cells, and there was no change when these cells were treated with IFN-␥ and ATRA. On the other hand, the expression of RAR- was not seen in untreated BALM-1 and BALM-3 cells nor in those treated with IFN-␥. In contrast, when BALM-1 cells were treated with ATRA, a weak signal was observed indicating the expression of RAR-, and when these cells were treated with IFN-␥ and ATRA, it increased approximately 3-fold. Also, when BALM-3 cells were treated with ATRA, there was a weak signal indicating the expression of RAR-, and when these cells were treated with IFN-␥ and ATRA, it increased approximately 5-fold (Fig. 7). The expression of RAR- was first detectable 36 h after the treatment with IFN-␥ and ATRA, and this expression reached a peak 48 h the treatment (data not shown). These findings suggest that the expression of IRF-1 and RAR- mRNAs increase more significantly in BALM-3 cells (the combination of IFN-␥ and ATRA had
a synergistic effect) when compared to BALM-1 cells (the combination of IFN-␥ and ATRA had an additive effect). Next, we investigated the expression of IRF-1 and STAT-1 proteins by Western blotting. When compared to untreated BALM-3 cells, the expression of IRF-1 protein in BALM-3 cells treated with IFN-␥ was 4.8 times greater and that in BALM-3 cells treated with IFN-␥ and ATRA was 9.7 times greater. Also, the expression of IRF-1 protein in BALM-1 cells treated with IFN-␥ and/or ATRA was greater than that in untreated BALM-1 cells, but the degree of increase was significantly lower when compared to that for BALM-3 cells. The expression of IRF-1 protein was first detectable 24 h after the treatment with IFN-␥ and ATRA, and this expression reached a peak 48 h the treatment (data not shown). Furthermore, when compared to untreated BALM-3 cells, the expression of STAT-1 protein in BALM-3 cells treated with IFN-␥ was 5.1 greater and that in BALM-3 cells treated with IFN-␥ and IFN-␥ + ATRA was 12.9 times greater. However, when compared to untreated BALM-1 cells, the expressions of STAT-1 protein in BALM-1 cells treated with IFN-␥ and IFN-␥ + ATRA were 1.2 and 9.1 times greater, respectively, and thus, the degree of increase was smaller for BALM-1 cells (Fig. 8). In addition, the expression of IFR-1 and STAT-1 proteins in cells treated with ATRA only were comparable to expression in untreated cells (data not shown). The effects of IFN-␣ and IFN-␥ on BALM-3 cells were compared. The expression of IRF-1 mRNA induced by IFN-␣ was lower than that induced by IFN-␥. Also, the combination of IFN-␥ and ATRA significantly increased the expression of IRF-1 mRNA, whereas the combination of IFN-␣ and ATRA did not. Moreover, the combination of IFN-␥ and ATRA significantly increased the expression of RAR- mRNA, whereas the combination of IFN-␣ and ATRA did not (Fig. 9).
752
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
Fig. 8. Effects of IFN-␥ and ATRA + IFN-␥ on IRF-1 expression, STAT-1 phosphorylation and STAT-1 protein expression in BALM-1 and BALM-3 cells: Western blotting. Cells were treated with IFN-␥ 30 IU/ml and/or ATRA 0.4 nM for 48 h.
3.6. Proliferative potential of BALM-3 cells treated with IFN-γ and ATRA Continuous treatment with a clinically applicable concentration of IFN-␥ caused significant growth inhibition
for 2 days, but thereafter the growth inhibitory effect was modest. ATRA at 0.4 nM hardly affected the proliferation of BALM-3 cells, but the combined treatment with ATRA and IFN-␥ induced a complete growth arrest of the cells (Fig. 10). Thus, there is a clear synergistic interaction
Fig. 9. Effects of ATRA and IFN-␥ or IFN-␣ on the expression of IRF-1, RAR-␣, RAR- mRNA in BALM-3 cells. Cells were treated with IFN-␥ and/or ATRA 0.4 nM for 48 h. GAPDH, glyceraldehyde-3-dehydrogenase.
Fig. 10. Proliferation of BALM-3 cells in culture with ATRA in the presence or absence of IFN-␥. Cells were cultured without (䊏) or with 30 IU/ml IFN-␥ (䉱), 0.4 nM ATRA (䉬), 4 nM ATRA (䊐), 30 IU/l IFN-␥ plus 0.4 nM ATRA (䊊), or 30 IU/ml IFN-␥ plus 4 nM ATRA (). The culture medium was replaced on days 3, 6, 9, and 12. The cumulative cell number was calculated from the counts and the dilution used when feeding the culture. The values are means of three determinations.
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
between ATRA and IFN-␥ in their inhibition of proliferating activity of BALM-3 cells.
4. Discussion The therapeutic results for APL have improved significantly as a result of the introduction of induced differentiation therapy using ATRA. ATRA induces terminal differentiation in APL cells and cell cycle arrest in immature leukemic cells, but molecular mechanisms for these phenomena have not been clarified. Also, it has been reported that ATRA induces apoptosis in adult T-cell leukemia cell lines and reduces the p53 level by inducing p21Waf1/Cip1 [34], and that it is clinically effective in the treatment of T-cell lymphomas [35]. However, there has not been any clinical report on the effectiveness of ATRA on B-cell lymphomas. In the present study, the growth of B-cell lymphoma cell lines was more sensitive to ATRA (0.4 nM) than other cell lines. The results were the same using Am80, which is RAR-␣ ligand, whereas the effects of Ro48-2250, an RXR ligand, were less pronounced. Furthermore, the inhibitory effects of ATRA and Am80 on cellular growth were neutralized in the presence of RAR antagonists. These findings suggest that RAR-␣ agonists are effective in the treatment of B-cell lymphomas. Sundaresan et al. [35] treated aggressive B-cell lymphoma cell lines with liposome-encapsulated ATRA (L-ATRA), and documented that apoptosis was induced at 6–25 nM by the down-regulation of bcl-2 and up-regulation of bax. In the present study, ATRA had no effect on the expression of bcl-2, bax and bcl-XL mRNAs (data not shown). Although the activation of caspase-3 was confirmed, that of caspase-8 and caspase-9 was mild (data not shown). With a few exceptions, monotherapy with retinoids has not been satisfactory. Complete remission with ATRA alone is always transient as ATRA resistance develops in the treated patients as well as in vitro. IFN-␥ is a pleiotropic cytokine involved in the regulation of various phases of immune and inflammatory responses; it also has anti-viral and anti-proliferative activity. IFN-␥, after interacting with specific cell surface receptors, activates different signal cascades leading to the transcription of a distinct set of genes which mediate the biological effects of this cytokine [36–38]. IFN-␥ signaling requires the obligatory participation of five distinct proteins: type I integral membrane receptor proteins, IFN-␥ receptor-1 and IFN-␥ receptor-2, Jak1, Jak2 and STAT-1 [39]. Also, it has been documented that IFN-␥ is clinically useful in the treatment of B-cell chronic lymphocytic leukemia [40] and mycosis fungoides [41]. However, as is the case with ATRA, IFN-␥ monotherapy is not very effective. In one study, IFN-␥ induced apoptosis in leukemia B-cell lines by increasing the expression of IFN-␥ receptors [42], whereas the results of the present study showed that the expression of IFN-␥ receptors was confirmed in untreated cells, and it remained unchanged in the presence of IFN-␥ and/or ATRA. IFNs and ATRA have super-additive or synergistic
753
differentiating, anti-proliferative, anti-angiogenic and antiviral activities in various cell systems including those from human hematologic and solid tumors [43,44]. There have been many reports on the usefulness of the IFN-␣ and ATRA combination. This combination has an additive effect on the differentiation induction and growth inhibition of HL-60 and NB4 cells which have a characteristic cytogenetic abnormality, the translocation of t(15;17) [45,46]. However, it is not clear how this combination affects these cells. It has been shown that ATRA increases the expression of STAT-1 in HL-60 and U937 cells, thus, enhancing the effects of IFN-␣ and IFN-␥ [43]. Also, when NB4 cells were treated with ATRA, the expression of the IRF-1 gene increased, but synthesis of IRF-1 protein was not induced [47]. Also, there have not been many reports on the combination of IFN-␥ and ATRA. According to one report on the combination of ATRA and IFN-␣ or IFN-␥ in NB4 cells, the combination of IFN-␥ and ATRA inhibited the growth of NB4 cells more significantly than the combination of IFN-␣ and ATRA. Also, the up-regulation of p56 was not confirmed when these cells were treated with IFN-␣ or IFN-␣ + ATRA. However, the up-regulation of p56 was confirmed when these cells were treated with IFN-␥, and was further enhanced by the combination of IFN-␥ and ATRA, thus, suggesting that p56 is involved in the synergistic effect of IFN-␥ and ATRA [45]. In the present study, the expression of IFN-␥-related genes was compared between BALM-1 cells (the combination of IFN-␥ and ATRA does not have a synergistic effect) and BALM-3 cells (the combination of IFN-␥ and ATRA has a synergistic effect). The results showed that the expression of IRF-1 mRNA and protein increased significantly when BALM-3 cells were treated by IFN-␥ and ATRA than when these cells were treated by IFN-␥ or ATRA. On the other hand, the expression of IRF-1 mRNA and protein in BALM-1 cells treated with IFN-␥ and ATRA was comparable to that in BALM-1 cells treated with IFN-␥ or ATRA. Also, when compared to BALM-1 cells, the combination of IFN-␥ and ATRA induced marked phosphorylation of STAT-1 and enhanced RAR- expression in BALM-3 cells. These findings suggest that, when compared to BALM-1 cells, the expression of IRF-1 is more enhanced in BALM-3 cells due to marked STAT-1 phosphorylation, ultimately leading to apoptosis. Also, the enhanced expression of RAR- may be involved in apoptosis. The differences in the sensitivity of BALM-3 cells between the ATRA and IFN-␥ combination and ATRA and IFN-␣ combination were compared. Given that the IFN-␥ and ATRA combination enhanced the expression of IRF-1 and RAR- mRNAs more significantly than the IFN-␣ and ATRA combination, IRF-1 and RAR- signal pathways may be involved in apoptosis induced by the IFN-␥ and ATRA combination. In the future, it will be necessary to develop new treatment strategies, such as molecule-targeted therapy to treat elderly lymphoma patients who cannot tolerate conventional chemotherapeutic agents due to severe adverse reactions, and B-cell indolent lymphomas that only respond
754
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755
transiently to chemotherapeutic agents. The IFN-␥ and ATRA combination could be clinically useful in the future since their effectiveness have been clinically proven. Also, in recent years, rituximab (IDEC-C2B8), a mouse–human chimeric anti-CD20 monoclonal antibody, has been introduced for the treatment of indolent B-lymphomas. When used on its own, it has a 50–70% efficacy rate and when used in combination with CHOP therapy, it shows a high efficacy of 90–100% [3,48]. However, the associated improvement in survival remains unknown due to the need for long-term observation, and this needs to be established in the future. Hence, it will also be necessary to investigate therapy-combining agents such as ATRA and IFNs and immunotherapy utilizing these antibodies. References [1] Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, et al. A revised European–American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood 1994;84:1361–92. [2] Bastion Y, Berger F, Bryon PA, Felman P, Ffrench M, Coiffier B. Follicular lymphoma: assessment of prognostic factors in 127 patients followed for 10 years. Annu Oncol 1991;2:123–34. [3] Czuczman MS, Grillo-Lopez AJ, White CA, Saleh M, Gordon L, LoBuglio AF, et al. Treatment of patients with low-grade B-cell lymphoma with the combination of chimeric anti-CD20 monoclonal antibody and CHOP chemotherapy. J Clin Oncol 1999;17:268–76. [4] Shipp MA. A predictive model for aggressive non-Hodgkin’s lymphomas: The International Non-Hodgkin’s Lymphoma Prognostic Factors Project. N Engl J Med 1993;329:987–94. [5] Fisher RI, Gaynor ER, Dahlberg S, Oken MM, Grogan TM, Mize EM, et al. Comparison of a standard regimen (CHOP) with three intensive chemotherapy regimens for advanced non-Hodgkin’s lymphoma. N Engl J Med 1993;328:1002–6. [6] Miller TP, Dana BW, Weick JK, Jones SE, Coltman CA, Dahlberg S, et al. Southwest Oncology Group clinical trials for intermediateand high-grade non-Hodgkin’s lymphomas. Semin Hematol 1998;25: 17–22. [7] Gianni AM, Bregni M, Siena S, Brambilla C, Di Nicola M, Lombardi F, et al. High-dose chemotherapy and autologous bone marrow transplantation compared with MACOP-B in aggressive B-cell lymphoma. N Engl J Med 1997;336:1290–7. [8] Warrell RP. Applications for retinoids in cancer therapy. Semin Hematol 1994;31:1–13. [9] Blomhoff HK, Smeland EB, Erikstein B, Rasmussen AM, Skrede B, Skjonsberg C, et al. Vitamin A is a key regulator for cell growth, cytokine production, and differentiation in normal B-cells. J Biol Chem 1992;267:23988–92. [10] Honma Y, Takenaga K, Kasukabe T, Hozumi M. Induction of differentiation of cultured human promyelocytic leukemia cells by retinoids. Biochem Biophys Res Commun 1980;95:507–12. [11] Huang ME, Ye YC, Chen SR, Chai JR, Lu JX, Zhoa L, et al. Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood 1988;72:567–72. [12] Chambon P. The retinoid signaling pathway: molecular and genetic analyses. Semin Cell Biol 1994;5:115–25. [13] Buschle M, Campana D, Carding SR, Richard C, Hoffbrand AV, Brenner MK. Interferon gamma inhibits apoptotic cell death in B-cell chronic lymphocytic leukemia. J Exp Med 1993;177:213–8. [14] Darnell Jr JE. STATs and gene regulation. Science 1997;277:1630–5. [15] Decker T, Kovarik P, Meinke A. GAS elements: a few nucleotides with a major impact on cytokine-induced gene expression. J Interf Cytokine Res 1997;17:121–34.
[16] Iijima T, Endo Y, Tsuji M, Kawachi E, Kagechika H, Shudo K. Dicarba-closo-dodecaboranes as a pharmacophore. Retinoidal antagonists and potential agonists. Chem Pharm Bull 1999;47: 398–404. [17] Lok MS, Koshiba H, Han T, Abe S, Minowada J, Sandberg AA. Establishment and characterization of human B lymphocytic lymphoma cell lines (BALM-3, BALM-4, and BALM-5): intraclonal variation in the B-cell differentiation stage. Int J Cancer 1979;24: 572–8. [18] Epstein AL, Herman MM, Kim H, Dorfman RF, Path MRC, Kaplan HS. Biology of the human malignant lymphomas. Part III. Intracranial heterotransplantation in the nude, athymic mouse. Cancer 1976;37:2158–76. [19] Nilsson K, Sundstrom C. Establishment and characteristics of two unique cell lines from patients with lymphosarcoma. Int J Cancer 1974;13:808–23. [20] Nilsson K, Klareskog L, Ralph P, Sundstrom C, Zech L. Phenotypic and cytogenetic characteristics of a new Epstein-Barr virus negative cell line (SKW4) derived from a B-cell lymphoma. Hematol Oncol 1983;1:277–95. [21] Minowada J, Oshimura M, Tsubota T, Higby DJ, Sandberg AA. Cytogenetic and immunoglobulin markers of human leukemic B-cell lines. Cancer Res 1977;37:3096–9. [22] Niitsu N, Yamaguchi Y, Umeda M, Honma Y. Human monocytoid leukemia cells are highly sensitive to apoptosis induced by 2 -deoxycoformycin and 2 -deoxyadenosine: association with dATP-dependent activation of caspase-3. Blood 1998;92:3368–75. [23] Thornberry NA, Bull HG, Calaycay JR, Chapman KT, Howard AD, Kostura MJ, et al. A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature 1992;356:768–74. [24] Niitsu N, Masanori U, Honma Y. Induction of differentiation of human myeloid leukemia cells by 2 -deoxycoformycin in combination with 2 -deoxyadenosine. Biochem Biophys Res Commun 1997;238:100–6. [25] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem 1987;162:156–9. [26] Petkovich M, Brand NJ, Krust A, Chambon P. A human retinoic acid receptor which belongs to the family of nuclear receptors. Nature 1987;330:444–50. [27] Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, et al. Characterization of three RXR genes that mediate the action of 9-cis-retinoic acid. Genes Dev 1992;6:329–44. [28] Heyman RA, Mangelsdorf DJ, Dyck JA, Stein RB, Eichele G, Evans RM. 9-Cis-retinoic acid is a high affinity ligand for the retinoid X receptor. Cell 1992;68:397–406. [29] Kagechika H, Kawachi E, Hashimoto Y, Himi T, Shudo K. Retinobenzoic acids. Part 1. Structure–activity relationships of aromatic amides with retinoidal activity. J Med Chem 1988;31:2182– 92. [30] Apfel CM, Kamber M, Klaus M, Mohr P, Keidel S, LeMotte PK. Enhancement of HL-60 differentiation by a new class of retinoids with selective activity on retinoid X receptor. J Biol Chem 1995;270:30765–72. [31] Fernandes-Alnemri T, Litwack G, Alnemri ES. CPP32, a novel human apoptotic protein with homologue to Caenorhabditis elegans cell death protein ced-3 and mammalian interleukin-1-converting enzyme. J Biol Chem 1994;269:30761–4. [32] Sen GC, Ransohoff RM. Interferon-induced anti-viral actions and their regulations. Adv Virus Res 1993;42:57–102. [33] Taniguchi T, Harada H, Lamphier M. Regulation of the interferon system and cell growth by the IRF transcription factors. J Cancer Res Clin Oncol 1995;121:516–20. [34] Cheng AL, Su I, Chen C, Tien H, Lay J, Chen B, et al. Use of retinoic acids in the treatment of peripheral T-cell lymphoma: a pilot study. J Clin Oncol 1994;12:1185–92.
N. Niitsu et al. / Leukemia Research 26 (2002) 745–755 [35] Sundaresan A, Claypool K, Mehta K, Lopez-Berestein G, Cabanillas F, Ford RJ. Retinoid-mediated inhibition of cell growth with stimulation of apoptosis in aggressive B-cell lymphomas. Cell Growth Differ 1997;8:1071–82. [36] Darnell Jr J. STATs and gene regulation. Science 1997;277:1630–5. [37] Schindler C. Cytokine signal transduction. Receptor 1995;5:51–62. [38] Stark GR, Kerr IM, William BRG, Silverman RH, Schreiber RD. How cells respond to interferons. Annu Rev Biochem 1998;67:227– 64. [39] Zaki M, Douglas R, Patten N, Bachinsky M, Lamb R, Nowell P, et al. Disruption of the IFN-␥ cytokine network in chronic lymphocytic leukemia contributes to resistance of leukemic B-cells to apoptosis. Leuk Res 2000;24:611–21. [40] Horikoshi T, Onodera H, Eguchi H, Hanada N, Fukuzawa K, Takahashi M, et al. A patient with plaque-stage mycosis fungoides has successfully been treated with long-term administration of IFN-gamma and has been in complete remission for more than 6 years. Br J Dermatol 1996;134:130–3. [41] Lippman SM, Glisson BS, Kavanagh JJ, Lotan R, Hong WK, Paredes-Espinoza M, et al. Retinoic acid and interferon combination studies in human cancer. Eur J Cancer 1993;29A:9–13. [42] Lippman SM, Lotan R, Schleuniger U. Retinoid–interferon therapy of solid tumors. Int J Cancer 1997;70:481–3.
755
[43] Kumar R, Korutla L. Growth inhibition of human acute promyelocytic leukemia NB4 cells by interferons and all-trans retinoic acid: trans-modulation of inducible gene expression pathways. Anticancer Res 1995;15:353–60. [44] Bollag W. Retinoids and interferon: a new promising combination? Br J Haematol 1991;79:87–91. [45] Weihua X, Kolla V, Kalvakolanu DV. Modulation of interferon action by retinoids. Induction of murine STAT-1 gene expression by retinoic acid. J Biol Chem 1997;272:9741–8. [46] Matikainen S, Ronni T, Lehtonen A, Sareneva T, Melen K, Nordling S. Retinoic acid induces signaltransducer and activator of transcription (STAT) 1, STAT 2, and p48 expression in myeloid leukemia cells and enhances their responsiveness to interferons. Cell Growth Diff 1997;687–98. [47] Maloney DG, Grillo-Lopez AJ, White CA, Grillo-Lopez AJ, White CA, Bodkin D, et al. IDEC-C2B8 (Rituximab) antibody CD20 monoclonal antibody therapy in patients with relapsed low-grade non-Hodgkin’s lymphoma. Blood 1997;90:2188–95. [48] Czuczman MS, Grillo-Lopez AJ, White CA, Saleh M, Gordon L, LoBuglio AF, et al. Treatment of patients with low-grade B-cell lymphoma with the combination of chimeric anti-CD20 monoclocal antibody and CHOP chemotherapy. J Clin Oncol 1999;16: 268–76.