- Email: [email protected]
Human chorionic gonadotropin suppresses expression of Piwis in common carp (Cyprinus carpio) ovaries
General and Comparative Endocrinology 176 (2012) 126–131
Contents lists available at SciVerse ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Short Communication
Human chorionic gonadotropin suppresses expression of Piwis in common carp (Cyprinus carpio) ovaries Yi Zhou 1, Fenghua Wang 1, Shaojun Liu ⇑, Huan Zhong, Zhen Liu, Min Tao, Chun Zhang, Yun Liu Key Laboratory of Protein Chemistry and Developmental Biology of State Education Ministry of China, College of Life Sciences, Hunan Normal University, ChangSha 410081, China
a r t i c l e
i n f o
Article history: Received 30 July 2011 Revised 22 November 2011 Accepted 24 November 2011 Available online 6 February 2012 Keywords: Common carp Piwi Gene expression hCG treatment Ovary
a b s t r a c t Piwi proteins are required for germline maintenance and gonad development. In this study, the cDNAs encoding Piwil1 and Piwil2 were cloned and sequenced from the common carp. The full-length cDNA of Piwil1 and Piwil2 were 3114 and 3421 bp, encoding 858 and 1034 amino acids including PAZ domain and PIWI domain, respectively. In addition, the Piwil1 and Piwil2 proteins shared high homology with other teleosts. Reverse transcriptase PCR revealed that the Piwi mRNAs were exclusively expressed in adult testes and ovaries. Using real-time PCR, expression study of different developmental profiles showed that Piwil1 and Piwil2 were down-regulated during pre-ovulation. Further, human chorionic gonadotropin treatment in ovaries (in vivo) and in cultured ovaries cells (in vitro) resulted in downregulation of Piwi RNAs. These results suggest that the decreased expression which was regulated by hormone plays a crucial role during ovarian differentiation and development. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Piwi belongs to Argonaute superfamily which is characterized by highly homologous PAZ and PIWI domains. Based on phylogenesis, the superfamily is divided into two subclasses – Ago subclade and Piwi subclade [3]. Ago is well studied for its function in pathway of microRNAs (miRNAs) and small interfering RNA (siRNAs) [5]. Until Piwi-interacting RNA (piRNA) has been elucidated recently, enormous progress has been made to unveil function and mechanism of Piwi proteins in piRNA pathway [1,13,23]. Piwi was initially isolated in Drosophila as a crucial factor in germline stem cells maintenance [3]. In Drosophila, Piwi mutations caused germline stem cell division failure. In mouse (Mus musculus), three Piwi-like proteins have been identified which dominated meiotic progression in testis [2,11]. Human (Homo sapiens) Piwi subfamily contains four homologous genes – Hiwi, Hiwi2, Hiwi3 and Hili. These proteins are specifically expressed in spermatocytes and round spermatids in human [19]. Ziwi (Piwi-like 1, Piwil1) and Zili (Piwi-like 2, Piwil2) were elucidated in zebrafish (Danio rerio) for the first time in fish [7,25]. Expression studies revealed that Ziwi and Zili were exclusively expressed in germline. Ziwi mutation triggered germ cell apoptosis and Zili mutation conduced to failure of germ cells differentiation [6,7]. Up to date, series of studies has reported that Piwi were identified in pig (Sus scrofa), Xenopus ⇑ Corresponding author. Fax: +86 731 88873074. 1
E-mail address: [email protected] (S. Liu). These authors contributed equally to this work.
0016-6480/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2011.11.044
tropicalis, Schmidtea mediterranea and Caenorhabditis elegans [3,20,27,32]. However, mechanism of Piwi and its regulation in gonad development and fertilization is not well deciphering. It is reasonable to believe that Piwi–piRNA complexes play a crucial role in reproductive cycles. Unlike well studied miRNA, piRNAs which interact with Piwi proteins were discovered until 2006 [1,13]. The piRNAs were located on different loci in genome, especially in transposable element. Thus, piRNAs function was determined mainly in repressing of transposable element transcripts [2,7]. Meanwhile, some piRNAs are derived from intronic or exonic regions. Recent research validated that a broad sets of piRNAs generated from 30 UTRs which suggested that 30 UTR piRNA may regulate transcripts via partially complementary sequences as miRNA in Ago-miRNA complexes [21]. Other studies showed that Piwi– piRNA complexes are essential in silencing, control of transcripts and mRNA regulation during differentiation and development of animal gonad [2,9,16,27,31]. In teleosts, gonad development and reproductive activities are controlled by the hypothalamic–pituitary–gonad (HPG) axis. Hypothalamic secretes Gonadotropin-releasing hormone (GnRH) regulates gonad development and final maturation through gonadotropins (GTH), including follicle-stimulating hormone (FSH) and luteinizing hormone (LH) [12,24]. However, almost all female fish exhibit reproductive dysfunction due to failure of LH released into bloodstream by pituitary in breeding condition [33]. Thus, exogenous hormones are employed to manipulate for spawn, including GTH, GnRH, luteinizing hormone-releasing hormone (LHRH), Human chorionic gonadotropin (hCG) and their analogs [4,18].
127
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
Meanwhile, there has been a dearth of information about non-coding RNAs and their binding proteins during these processes that would aid in understanding germline development and maturation. As a well-known food fish species, common carp (Cyprinus carpio) is also a species in studies of fish endocrinology and chemical exposure. Former studies have shown that HPG axis regulates gonad differentiation and development [14,26,29]. To address the role of Piwi proteins in common carp ovary, we cloned two Piwi homologous genes, and investigated their expression profiles in adult tissues. Piwil1 and Piwil2 expression patterns were identified during different stages of ovarian development. In addition, in vivo and in vitro studies were applied to examine the action of hCG on Piwil1 and Piwil2 expression in carp ovary. 2. Materials and methods 2.1. Experiment fish Common carp were provided by the Engineering Center of Polyploidy Fish Breeding of the National Education Ministry located at Hunan Normal University. Fish were anesthetized with 2-phenoxyethanol. All tissues were excised from the fish, frozen in liquid nitrogen, and stored at 80 °C until further use.
2 min with 30 cycles. For 50 RACE, the two amplification rounds conditions were: 94 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min with 30 cycles. 2.3. Sequence alignments and phylogenetic analysis Phylogenetic analysis was conducted to compare with other vertebrates. Amino acids sequences were aligned by ClustalW2 program (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Phylogenetic analysis was performed using Neighbor-Joining method with 1000 bootstrap in Mega version 4.1 [10]. 2.4. Tissue distribution Total RNA was extracted from various tissues of adult common carp. Specific primers for Piwil1 and Piwil2 were designed according to the cloned sequences with Primer Express 3.0 (Applied Biosystems). b-Actin was used as internal control. The cDNAs of different tissues synthesis was described above. The PCR condition was as follow: 94 °C for 5 min followed by 30 cycles at 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s and finally, a single elongation step at 72 °C for 10 min. 2.5. Real-time RT-PCR
2.2. Gene cloning of Piwi in common carp Total RNA from adult common carp testis was isolated by using Trizol reagent (Invitrogen, Carlsbad, CA) and then digested with DNase I (Fermentas, Vilnius, Lithuania) to eliminate residual DNA. Frist-strand cDNA was synthesized using AMV reverse transcriptase (Fermentas, Vilnius, Lithuania) with oligo (dT)12–18 primer following the manufacturer’s instruction. The degenerated primers were designed based on conserved sequences of other teleosts (Table 1). Polymerase chain reaction (PCR) was carried out by using the primers listed in Table 1. PCR were performed 94 °C for 30 s, 53 °C for 30 s, 72 °C for 3 min with 30 cycles. The PCR product was cloned and sequenced to obtain core partial cDNA of Piwil1 and Piwil2, respectively. Subsequently, RACE (Rapid Amplification of cDNA Ends) were performed using the SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) to amplify full length cDNAs. Specific nested PCR primers were designed base on the core partial sequences (Table 1). For 30 RACE, the two amplification rounds conditions were both performed 94 °C for 30 s, 58 °C for 30 s, 72 °C for
To measure different transcripts expression, Real-time RT-PCR was used. b-Actin was used as endogenous control. Each test was repeated three times to improve the accuracy of the results in a Prism 7500 Sequence Detection System (Applied Biosystems). The procedure was: 50 °C for 5 min and 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s and 60 °C for 45 s. The analysis of relative mRNA expression was performed using the 2DDCt method [15]. Finally, the dissociation curves were used to examine whether the PCR products were indeed specific. 2.6. Developmental change of Piwi Comparative expressions of Piwil1 and Piwil2 mRNAs in ovaries were examined by Real-time RT-PCR. Common carp in differential developmental periods were obtained and divided into five groups: 0+ year group [January, Body weight (BW) = 58 ± 1.95 g, gonadosomatic index (GSI) = 0.064 ± 0.011, n = 4] and four 1+ year groups (November, BW = 423 ± 21.1 g, GSI = 0.137 ± 0.010, n = 4; January, BW = 471 ± 17.6 g, GSI = 0.201 ± 0.012, n = 4; February, BW = 613 ±
Table 1 Primers sequences used in the polymerase chain reactions. Gene
Primer name
Sequence (50 –30 )
Application
Piwil1
Piwil1-F Piwil1-R Piwil1–30 out Piwil1–30 inner Piwil1–50 out Piwil1–50 inner Piwil1 RT-F Piwil1 RT-R Piwil2-F Piwil2-R Piwil2–30 out Piwil2–30 inner Piwil2–50 out Piwil2–50 inner Piwil2 RT-F Piwil2 RT-R b-Actin-F b-Actin-R
TMWGTGGGYTTTGTATCAGT CCMACWCCATCTCGRTAM ACAATCAGCAAACCTCAAGCACT GCGGTTCTCCAAGTGCGTCT TGTGCTTTGCCCAGAGTCTCCTC CGGGACTCCATAGGTGGCTTGA AGCACAGGCTGACGATTTGG CAGAATGATCAGGCCCACAA ATGGAKCCAARGCGRCC TYACAGAAARAAYAGTTTCTCTGAA GGTTCGAGACCCCTCCATCA AACTGCTGGGCTGTTTTCTATCC TGATGGTCGGCTTAGACTGGA CTCTGCCCCATGTCTTTGC AACAACTGCTGCACAACATCAAC ACAGTGCTGATGGAGGGGTCT GCCCTGCCCCATGCCATCCT AGTGCCCATCTCCTGCTCGA
Partial cDNA cloning Partial cDNA cloning 30 RACE 30 RACE 50 RACE 50 RACE RT-PCR and realtime RT-PCR and realtime Partial cDNA cloning Partial cDNA cloning 30 RACE 30 RACE 50 RACE 50 RACE RT-PCR and realtime RT-PCR and realtime RT-PCR and realtime RT-PCR and realtime
Piwil2
b-Actin
RT-PCR RT-PCR
RT-PCR RT-PCR RT-PCR RT-PCR
128
22.4 g, GSI = 0.308 ± 0.057, GSI = 0.381 ± 0.043, n = 4).
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
n = 4;
March,
BW = 763 ± 21.8 g,
2.7. In vivo hCG treatment To examine the regulation of hCG action on Piwi, eight female adult individuals were injected with hCG (Sigma, St. Louis, MO). All the fish were 2.5 years old female (December, BW = 1325 ± 130.1 g, GSI = 0.128 ± 0.007) and divided into two groups (n = 4/ group): control (saline) and hCG treatment (0.6 IU/g BW). Two injections were performed on days 1 and 5, respectively. Each group was kept in vehicle along (23 °C) until ovaries were collected on day 6. The tissues were stored at 80 °C until analysis of Piwi transcripts. 2.8. In vitro treatment of hCG Common carp ovary cell culture was performed to examine hCG effect on Piwi in vitro. Three females (2.5 years old, December, BW = 1433 ± 201.8 g, GSI = 0.135 ± 0.012) were killed and the ovaries were separated by repeated pipetting and placed in 5 ml phosphate-buffered saline (PBS) in a Petri dish. After washed three times with PBS, the organs were incubated with 0.05% (w/v) collagenase (Sigma, St. Louis, MO) in PBS for 15 min and followed three times washed with PBS. With 1 ml DMEM containing 10% fetal bovine serum (Gibco BRL), cells were cultured in 24-well culture plate (Falon) at density of 800 mg/each well. Cells were incubated in culture incubator at 24 °C with 5% CO2 for 2 days before hCG treatment. To examine the response to hCG in vitro, three different hCG concentrations of 106 M, 108 M and 1010 M were tested. For each individual carp, 12 wells were planted as follow: 3 replicates 4 different concentrations (control, 106 M, 108 M and 1010 M). After 2 h incubation, cells were harvested for transcripts analysis. 2.9. Statistical analysis
Fig. 1. (A) Piwi proteins have two characterized domains: PAZ and PIWI domains. The predicted amino acid sequence of Piwil1 and Piwil2 (B) in common carp. The PAZ domain and the PIWI domain as predicted by interProScan are underlined and boxed, respectively. The numbers refer to amino acids (N- to C-terminal).
All statistical analyses of data were performed using SPSS 13.0 package. Statistical significance between the groups was calculated by Duncan’s multiple range tests. 3. Results 3.1. Cloning and phylogenetic analysis Full length of Piwil1 (GenBank Accession No. JF505506) and Piwil2 (GenBank Accession No. JF505507) were obtained from testis of carp. Piwil1 was 3114 bp which consisted of a 64 bp 50 -UTR (untranslated region), a 2577 bp ORF (Open Reading Frame) and a 473 bp 30 -UTR. The ORF of Piwil1 encoded a peptide of 858 amino acids. While Piwil2 was 3421 bp which consisted of a 72 bp 50 -UTR, a 3105 bp ORF and a 244 bp 30 -UTR. The ORF encoded a 1034 amino acids peptide. For each Piwi, a PAZ domain and a PIWI domain were identified (Fig. 1). The phylogenetic tree demonstrated that the two homologous of Piwi were located within two main clades: Piwi1 clade and Piwi2 clade (Fig. 2). Common carp Piwil1, Ziwi, Xiwi, Miwi and Hiwi were clustered while Piwil2 was clustered with Xili, Mili and Hili. In Piwil1 clade, common carp Piwil1 shared 96.9–64% identities with Ziwi, Xiwi1, Miwi1 and Hiwi1 and only 46.7– 40.4% identities with Xiwi2, Miwi2, Hiwi2 and Hiwi3. For Piwil2 clade, the amino acid sequence of common carp Piwil2 showed 90.3% identity with Zili while shared low identities (57.5–56%) with Xili, Mili and Hili.
Fig. 2. Phylogenetic tree of Piwi proteins. The amino acids sequences used are Hiwi1, H. sapiens NP_004755; Hiwi2, H. sapiens NP_689644; Hiwi3, H. sapiens NP_001008496; Hili, H. sapiens NP_060538; Miwi1, M. musculus NP_067286; Miwi2, M. musculus NP_808573; Mili, M. musculus NP_067283; Xiwi1, Xenopus tropicalis XP_002940227; Xiwi2, Xenopus tropicalis XP_002939761; Xili, Xenopus tropicalis NP_001106470; Ziwi, D. rerio NP_899181; Zili, D. rerio ACH96370.
3.2. Tissue distribution of Piwi in adult carp To assess tissue distribution of Piwi transcripts in carps, RT-PCR were provided. The primers were designed according to the
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
obtained ORFs. b-Actin was used as internal control and was detected in all tissues at similar intensity. Piwil1 showed a very strong signal in testes and ovaries. No amplicon was observed in other tissues. For Piwil2, the transcripts were only observed in testes and ovaries too. In other different tissues, Piwil2 was undetectable (Fig. 3A). 3.3. Developmental changes of Piwi transcripts in ovary Among 0+ year group, 1+ year November group and 1+ year January group, no significant changes of Piwi1 transcripts were observed (P > 0.05). While Piwil1 transcripts significantly decreased in the ovaries during the spawning period (February and March) (P < 0.05) (Fig. 3B). For Piwil2, the mRNA expression levels were significantly lower in 1+ year November group and 1+ year January group compared with 0+ year group. Meanwhile, during the spawning period (February and March), another fall of Piwil2 transcripts was observed (P < 0.05) (Fig. 3C). 3.4. In vivo hCG effects on ovary Piwi transcripts The Piwil1 and Piwil2 response to hCG were estimated by in vivo study of hCG treatment. Saline and hCG (0.6 IU/g BW) were injected into female adult fish. Compared with control, hCG suppressed Piwil1 transcripts in ovaries significantly (P < 0.05) (Fig. 4A). Similarly, in ovaries, Piwil2 transcripts were depressed by hCG significantly (P < 0.05) (Fig. 4B). 3.5. In vitro hCG effects on ovary Piwi transcripts For ovarian cells, hCG depressed both Piwil1 and Piwil2 transcripts in different doses. After 2 h of hCG treatment, Piwil1 transcript levels were significantly decreased in 106 M doses of hCG treatment (P < 0.05), while 1010 M and 108 M and doses of hCG treatments were not significantly change the Piwil1
129
expression (P > 0.05) (Fig. 4C). For Piwil2, the transcripts expression was significantly decreased in all the groups of 1010 M, 108 M and 106 M doses hCG treatment (P < 0.05) (Fig. 4D). 4. Discussion In present study, two homologous Piwi genes were cloned and sequenced from gonad of common carp. Both predicted amino acid sequences of Piwil1 and Piwil2 contained PAZ domains in the centre and PIWI domains in the C-terminal which are the typical characters of Piwi genes. The common carp Piwil1 protein shared the high identity (96.9–56.5%) with Ziwi, Xiwi1, Miwi1 and Hiwi1. While it only shared 46.7–40.4% with Xiwi2, Miwi2, Hiwi2 and Hiwi3. The common carp Piwil2 protein showed the high identities with Zili, Xili, Mili and Hili but low identities with other Piwi proteins. Piwi was first depicted in Drosophila. The following studies demonstrated that two subgroup were identified in mouse, including Miwi and Mili [11]. In vertebrates, these two Piwi subgroup have been identified in Human (Hiwi and Hili), Xenopus (Xiwi and Xili) and zebrafish (Ziwi and Zili) [19,25,27]. Herein, we report for the expression of two Piwi homologs in the common carp gonad which belong to these two subgroups. Additionally, the data are consistent with the phylogenetic analysis. In the phylogenetic tree, Piwi clustered in two main branches, in agreement with Piwil1 and Piwil2 subgroup diversity. The tree also indicates that carp Piwil1 is an ortholog of Ziwi, Xiwi1, Miwi1 and Hiwi1 rather than Xiwi2, Miwi2, Hiwi2 and Hiwi3. As well as, carp Piwil2 is an ortholog of Zili, Xili, Mili and Hili. On the other hand, the topology of the tree is consistent with taxonomy, showing its presence in fish, amphibians and mammals and the bootstrap values were higher than 97%. The results confirm previous findings that only two Piwi homologs have been found in teleost instead of three or four Piwi homologs in amphibian and mammals. Either mRNA or protein, Piwis as germline specific expression genes in adults has been reported in several vertebrates, including zebrafish, Xenopus and human [6,7,25,27]. However, using
Fig. 3. Piwil1 and Piwil2 expression in carps. (A) RT-PCR analysis of Piwil1 and Piwil2 expression in different tissues of adult carps. Quantification of the transcripts expression for Piwil1 (B) and Piwil2 (C) in development stages in carp ovaries. Asterisks represent a statistically significant difference when compared with 0+ year stage (P < 0.05).
130
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
Fig. 4. Effect of hCG treatment on Piwil1 and Piwil2 expression in carp ovaries. (A and B) represent in vivo effects of the hCG on ovarian Piwil1 and Piwil2 expression, respectively. (C and D) show in vitro treatment of the hCG on Piwil1 and Piwil2 mRNA transcript levels in carp ovaries. Asterisks represent a statistically significant difference when compared with control (P < 0.05).
high-throughput small RNA sequencing, recent research showed widespread expression of piRNA molecules in somatic tissues in mouse, rhesus macaque (Macaca mulatta) and Drosophila. Western bolt analysis of Miwi protein also demonstrated expression in mouse pancreas [28]. Moreover, Piwi expression in extra-gonadal tissues in S. mediterranea, has been proved [17,20]. The present results showed that in carp, Piwi mRNAs expressed specifically in testis and ovaries, while in other tissues the expression was undetectable. This is in agreement with previous studies, fish Piwis are gonadal-specific genes which is consistent with its important role in germline development [7]. Real-time RT-PCR revealed that Piwil1 and Piwil2 mRNA expression levels decreased significant in the carp ovaries during vitellogenesis. The Piwil1 transcripts were abundant in juvenile stage, and significantly changed until February in 1+-year-old carps during prespawning. Also, the Piwil2 mRNA levels were high in juvenile stage and decreased significantly until February in 1+year-old carps during prespawning period. The data suggest that carp Piwi expression levels change with the development of ovaries. In zebrafish, by immunohistochemistry, both Ziwi and Zili were observed in all stage of oogenesis, especially during the PGC mitotic and early meitotic germ cell [6,7]. However, Ziwi and Zili expression differentiation were not assayed. By western blotting, Xiwi and Xili expression were assessed troughout the oogenesis in Xenopus. Xiwi1 protein levels decreased in stage III of oocyte. In contrast with Xiwi1, Xili were abundant in mature oocyte [27]. Our result is in agreement with Xiwi1, both two Piwi were high expressed in juvenile stage and decreased in pre-ovulation. In carps, HPG axis plays a central role in control gonad differentiation and development as other teleosts [29]. At preovulatory period, LH is highly expressed and is necessary in order for vitellogenesis and final maturation which is in coincidence with
depressed expression of Piwi. To understand whether Piwi is regulated by HPG axis, hCG treatments were preformed in vivo and in vitro in ovaries. In vivo study, two injections with 0.6 UI/g BW hCG as modified dosage of previous study were performed [18]. A significant decline of both Piwil1 and Piwil2 transcripts has been observed in ovaries. The present result indicated that hCG inhibit Piwil1 and Piwil2 expression of the transcripts in carps ovaries. Subsequently, by primary cultures of dispersed ovaries cells, in vitro hCG treatment assay were preformed. The repression of Piwil1 and Piwil2 by hCG were similar. As an analog of LH, hCG could be able to bind with LHR – a transmembrane receptor of ovarian follicle cells. As hCG is readily available and acts much faster via stimulate gonad directly, it has been wildly used in induction of fish spawning in aquaculture [30]. By stimulating the receptor, the follicles were mobilized and eventually resulted in follicle maturation and ovulation. In this process, several genes in ovaries are modulated by HPG axis, including germ cell proliferation and vitellogenesis associated genes [29]. For instance, hCG stimulates E2 synthesis in ovary and then activates G-proteins and steroidogoenic genes [8]. The present study showed that both Piwil1 and Piwil2 were down-regulated by hCG treatment in vivo and in vitro. The biological function of Piwi is germ cell maintenance and silencing of transposons by cooperating with piRNAs [2,7,23]. Moreover, it has been proved that the Piwi–piRNA complex could induce mRNA silencing which displayed a similar function of microRNA [21,22]. These researches offered a new landscape for understanding function of Piwi and piRNA in ovaries differentiation and development. In the present study, expression patterns of Piwil1 and Piwil2 have been investigated in carp ovaries. These two genes were significantly decreased during ovulation period with gonadotropin expression increased. Subsequent studies validated that Piwil1 and Piwil2 expression levels were down-regulated by hCG. Thus, the HPG axis modulate
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
Piwi expression during pre-ovulation in carp ovaries. Herein, we hypothesize that during pre-ovulation periods, with LH expression arised, Piwi and piRNA are suppressed. After losing suppressive effect of Piwi–piRNA complex, the silenced genes and transposons are arised and eventually induced final maturation and ovulation. In summary, full-length cDNAs of Piwil1 and Piwil2 were cloned from gonad of common carp and showed high identity with other teleosts. And we demonstrated that Piwis were suppressed by hCG. These findings extend out understanding of the hormonal regulation of Piwi and piRNA. Acknowledgments This research was supported by the National Natural Science Fund for Distinguished Young Scholars (Grant No. 30725028), the National Natural Science Foundation of China (Grant No. 30930071), the Natural Science Fund for Innovative Research Team of Hunan Province (Grant No. 10JJ7004), the National Special Fund for Scientific Research in public benefits (Grant No. 200903046), the Doctoral Fund of Ministry of Education of China (Grant No. 20104306110004), and the Construction Project of Key Discipline of Hunan Province and China. References [1] A. Aravin, D. Gaidatzis, S.M. Pfeffer, P. Landgraf, N. Iovino, P. Morris, M.J. Brownstein, S. Kuramochi-Miyagawa, T. Nakano, M. Chien, J.J. Russo, J. Ju, R. Sheridan, C. Sander, M. Zavolan, T. Tuschl, A novel class of small RNAs bind to MILI protein in mouse testes, Nature 442 (2006) 203–207. [2] M.A. Carmell, A. Girard, H.J.G. van de Kant, D. Bourc’his, T.H. Bestor, D.G. de Rooij, G.J. Hannon, MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline, Cell 12 (2007) 503–514. [3] D.N. Cox, A. Chao, J. Baker, L. Chang, D. Qiao, H. Lin, A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell selfrenewal, Gene Dev. 12 (1998) 3715–3727. [4] S. Drori, M. Ofir, B. Levavi-Sivan, Z. Yaron, Spawning induction in common carp (Cyprinus carpio) using pituitary extract or GnRH superactive analogue combined with metoclopramide: analysis of hormone profile, progress of oocyte maturation and dependence on temperature, Aquaculture 119 (1994) 393–407. [5] L. He, G.J. Hannon, MicroRNAs: small RNAs with a big role in gene regulation, Nat. Rev. Genet. 5 (2004) 522–531. [6] S. Houwing, E. Berezikov, R.F. Ketting, Zili is required for germ cell differentiation and meiosis in zebrafish, EMBO J. 27 (2008) 2702–2711. [7] S. Houwing, L.M. Kamminga, E. Berezikov, D. Cronembold, A. Girard, H. van den Elst, D.V. Filippov, H. Blaser, E. Raz, C.B. Moens, R.H.A. Plasterk, G.J. Hannon, B.W. Draper, R.F. Ketting, A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in zebrafish, Cell 129 (2007) 69–82. [8] J.S. Ings, G.J. Van Der Kraak, Characterization of the mRNA expression of StAR and steroidogenic enzymes in zebrafish ovarian follicles, Mol. Reprod. Dev. 73 (2006) 943–954. [9] A.I. Kalmykova, M.S. Klenov, V.A. Gvozdev, Argonaute protein PIWI controls mobilization of retrotransposons in the Drosophila male germline, Nucleic Acids Res. 33 (2005) 2052–2059. [10] S. Kumar, M. Nei, J. Dudley, K. Tamura, MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences, Brief Bioinform. 9 (2008) 299–306. [11] S. Kuramochi-Miyagawa, T. Kimura, K. Yomogida, A. Kuroiwa, Y. Tadokoro, Y. Fujita, M. Sato, Y. Matsuda, T. Nakano, Two mouse piwi-related genes: miwi and mili, Mech. Dev. 108 (2001) 121–133.
131
[12] H.F. Kwok, W.K. So, Y.J. Wang, W. Ge, Zebrafish gonadotropins and their receptors: I. cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone receptors – evidence for their distinct functions in follicle development, Biol. Reprod. 72 (2005) 1370–1381. [13] N.C. Lau, A.G. Seto, J. Kim, S. Kuramochi-Miyagawa, T. Nakano, D.P. Bartel, R.E. Kingston, Characterization of the piRNA complex from rat testes, Science 313 (2006) 363–367. [14] W.S. Li, H.R. Lin, A.O. Wong, Effects of gonadotropin-releasing hormone on growth hormone secretion and gene expression in common carp pituitary, Comp. Biochem. Physiol. B 132 (2002) 335–341. [15] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2-[Delta][Delta]CT method, Methods 25 (2001) 402–408. [16] T. Ohara, Y. Sakaguchi, T. Suzuki, H. Ueda, K. Miyauchi, The 30 termini of mouse Piwi-interacting RNAs are 20 -O-methylated, Nat. Struct. Mol. Biol. 14 (2007) 349–350. [17] D. Palakodeti, M. Smielewska, Y.C. Lu, G.W. Yeo, B.R. Graveley, The PIWI proteins SMEDWI-2 and SMEDWI-3 are required for stem cell function and piRNA expression in planarians, RNA 14 (2008) 1174–1186. [18] R.E. Peter, H.R. Lin, G. Van Der Kraak, Induced ovulation and spawning of cultured freshwater fish in China: advances in application of GnRH analogues and dopamine antagonists, Aquaculture 74 (1988) 1–10. [19] D. Qiao, A.M. Zeeman, W. Deng, L.H. Looijenga, H.F. Lin, Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas, Oncogene 21 (2002) 3988–3999. [20] P.W. Reddien, N.J. Oviedo, J.R. Jennings, J.C. Jenkin, A.S. Alvarado, SMEDWI-2 is a PIWI-like protein that regulates planarian stem cells, Science 310 (2005) 1327–1330. [21] N. Robine, N.C. Lau, S. Balla, Z. Jin, K. Okamura, S. Kuramochi-Miyagawa, M.D. Blower, E.C. Lai, A broadly conserved pathway generates 30 UTR-directed primary piRNAs, Curr. Biol. 19 (2009) 2066–2076. [22] K. Saito, S. Inagaki, T. Mituyama, Y. Kawamura, Y. Ono, E. Sakota, H. Kotani, K. Asai, H. Siomi, M.C. Siomi, A regulatory circuit for piwi by the large Maf gene traffic jam in Drosophila, Nature 461 (2009) 1296–1299. [23] A.G. Seto, R.E. Kingston, N.C. Lau, The coming of age for Piwi proteins, Mol. Cell 26 (2007) 603–609. [24] W.K. So, H.F. Kwok, W. Ge, Zebrafish gonadotropins and their receptors: II. cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone subunits-their spatial-temporal expression patterns and receptor specificity, Biol. Reprod. 72 (2005) 1382–1396. [25] C.H. Tan, T.C. Lee, S.D. Weeraratne, V. Korzh, T.M. Lim, Z. Gong, Ziwi, the zebrafish homologue of the Drosophila piwi: co-localization with vasa at the embryonic genital ridge and gonad-specific expression in the adults, Mech. Dev. 119 (2002) S221–S224. [26] G. Van Der Kraak, K. Suzuki, R.E. Peter, H. Itoh, H. Kawauchi, Properties of common carp gonadotropin I and gonadotropin II, Gen. Comp. Endocrinol. 85 (1992) 217–229. [27] A. Wilczynska, N. Minshall, J. Armisen, E.A. Miska, N. Standart, Two Piwi proteins, Xiwi and Xili, are expressed in the Xenopus female germline, RNA 15 (2009) 337–345. [28] Z. Yan, H.Y. Hu, X. Jiang, V. Maierhofer, E. Neb, L. He, Y. Hu, H. Hu, N. Li, W. Chen, P. Khaitovich, Widespread expression of piRNA-like molecules in somatic tissues, Nucleic Acids Res. (2011), doi:10.1093/nar/gkr298. [29] Z. Yaron, Endocrine control of gametogenesis and spawning induction in the carp, Aquaculture 129 (1995) 49–73. [30] Z. Yaron, A. Bogomolnaya, S. Drori, I. Biton, J. Aizen, Z. Kulikovsky, B. LevaviSivan, Spawning induction in the carp: past experience and future prospects – a review, Isr. J. Aquac. Bamidgeh 61 (2009) 5–26. [31] H. Yin, H.F. Lin, An epigenetic activation role of Piwi and a Piwi-associated piRNA in Drosophila melanogaster, Nature 450 (2007) 304–308. [32] X. Zhou, H. Guo, K. Chen, H. Cheng, R. Zhou, Identification, chromosomal mapping and conserved synteny of porcine Argonaute family of genes, Genetica 138 (2010) 805–812. [33] Y. Zohar, C.C. Mylonas, Endocrine manipulations of spawning in cultured fish: from hormones to genes, Aquaculture 197 (2001) 99–136.
Contents lists available at SciVerse ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Short Communication
Human chorionic gonadotropin suppresses expression of Piwis in common carp (Cyprinus carpio) ovaries Yi Zhou 1, Fenghua Wang 1, Shaojun Liu ⇑, Huan Zhong, Zhen Liu, Min Tao, Chun Zhang, Yun Liu Key Laboratory of Protein Chemistry and Developmental Biology of State Education Ministry of China, College of Life Sciences, Hunan Normal University, ChangSha 410081, China
a r t i c l e
i n f o
Article history: Received 30 July 2011 Revised 22 November 2011 Accepted 24 November 2011 Available online 6 February 2012 Keywords: Common carp Piwi Gene expression hCG treatment Ovary
a b s t r a c t Piwi proteins are required for germline maintenance and gonad development. In this study, the cDNAs encoding Piwil1 and Piwil2 were cloned and sequenced from the common carp. The full-length cDNA of Piwil1 and Piwil2 were 3114 and 3421 bp, encoding 858 and 1034 amino acids including PAZ domain and PIWI domain, respectively. In addition, the Piwil1 and Piwil2 proteins shared high homology with other teleosts. Reverse transcriptase PCR revealed that the Piwi mRNAs were exclusively expressed in adult testes and ovaries. Using real-time PCR, expression study of different developmental profiles showed that Piwil1 and Piwil2 were down-regulated during pre-ovulation. Further, human chorionic gonadotropin treatment in ovaries (in vivo) and in cultured ovaries cells (in vitro) resulted in downregulation of Piwi RNAs. These results suggest that the decreased expression which was regulated by hormone plays a crucial role during ovarian differentiation and development. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Piwi belongs to Argonaute superfamily which is characterized by highly homologous PAZ and PIWI domains. Based on phylogenesis, the superfamily is divided into two subclasses – Ago subclade and Piwi subclade [3]. Ago is well studied for its function in pathway of microRNAs (miRNAs) and small interfering RNA (siRNAs) [5]. Until Piwi-interacting RNA (piRNA) has been elucidated recently, enormous progress has been made to unveil function and mechanism of Piwi proteins in piRNA pathway [1,13,23]. Piwi was initially isolated in Drosophila as a crucial factor in germline stem cells maintenance [3]. In Drosophila, Piwi mutations caused germline stem cell division failure. In mouse (Mus musculus), three Piwi-like proteins have been identified which dominated meiotic progression in testis [2,11]. Human (Homo sapiens) Piwi subfamily contains four homologous genes – Hiwi, Hiwi2, Hiwi3 and Hili. These proteins are specifically expressed in spermatocytes and round spermatids in human [19]. Ziwi (Piwi-like 1, Piwil1) and Zili (Piwi-like 2, Piwil2) were elucidated in zebrafish (Danio rerio) for the first time in fish [7,25]. Expression studies revealed that Ziwi and Zili were exclusively expressed in germline. Ziwi mutation triggered germ cell apoptosis and Zili mutation conduced to failure of germ cells differentiation [6,7]. Up to date, series of studies has reported that Piwi were identified in pig (Sus scrofa), Xenopus ⇑ Corresponding author. Fax: +86 731 88873074. 1
E-mail address: [email protected] (S. Liu). These authors contributed equally to this work.
0016-6480/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2011.11.044
tropicalis, Schmidtea mediterranea and Caenorhabditis elegans [3,20,27,32]. However, mechanism of Piwi and its regulation in gonad development and fertilization is not well deciphering. It is reasonable to believe that Piwi–piRNA complexes play a crucial role in reproductive cycles. Unlike well studied miRNA, piRNAs which interact with Piwi proteins were discovered until 2006 [1,13]. The piRNAs were located on different loci in genome, especially in transposable element. Thus, piRNAs function was determined mainly in repressing of transposable element transcripts [2,7]. Meanwhile, some piRNAs are derived from intronic or exonic regions. Recent research validated that a broad sets of piRNAs generated from 30 UTRs which suggested that 30 UTR piRNA may regulate transcripts via partially complementary sequences as miRNA in Ago-miRNA complexes [21]. Other studies showed that Piwi– piRNA complexes are essential in silencing, control of transcripts and mRNA regulation during differentiation and development of animal gonad [2,9,16,27,31]. In teleosts, gonad development and reproductive activities are controlled by the hypothalamic–pituitary–gonad (HPG) axis. Hypothalamic secretes Gonadotropin-releasing hormone (GnRH) regulates gonad development and final maturation through gonadotropins (GTH), including follicle-stimulating hormone (FSH) and luteinizing hormone (LH) [12,24]. However, almost all female fish exhibit reproductive dysfunction due to failure of LH released into bloodstream by pituitary in breeding condition [33]. Thus, exogenous hormones are employed to manipulate for spawn, including GTH, GnRH, luteinizing hormone-releasing hormone (LHRH), Human chorionic gonadotropin (hCG) and their analogs [4,18].
127
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
Meanwhile, there has been a dearth of information about non-coding RNAs and their binding proteins during these processes that would aid in understanding germline development and maturation. As a well-known food fish species, common carp (Cyprinus carpio) is also a species in studies of fish endocrinology and chemical exposure. Former studies have shown that HPG axis regulates gonad differentiation and development [14,26,29]. To address the role of Piwi proteins in common carp ovary, we cloned two Piwi homologous genes, and investigated their expression profiles in adult tissues. Piwil1 and Piwil2 expression patterns were identified during different stages of ovarian development. In addition, in vivo and in vitro studies were applied to examine the action of hCG on Piwil1 and Piwil2 expression in carp ovary. 2. Materials and methods 2.1. Experiment fish Common carp were provided by the Engineering Center of Polyploidy Fish Breeding of the National Education Ministry located at Hunan Normal University. Fish were anesthetized with 2-phenoxyethanol. All tissues were excised from the fish, frozen in liquid nitrogen, and stored at 80 °C until further use.
2 min with 30 cycles. For 50 RACE, the two amplification rounds conditions were: 94 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min with 30 cycles. 2.3. Sequence alignments and phylogenetic analysis Phylogenetic analysis was conducted to compare with other vertebrates. Amino acids sequences were aligned by ClustalW2 program (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Phylogenetic analysis was performed using Neighbor-Joining method with 1000 bootstrap in Mega version 4.1 [10]. 2.4. Tissue distribution Total RNA was extracted from various tissues of adult common carp. Specific primers for Piwil1 and Piwil2 were designed according to the cloned sequences with Primer Express 3.0 (Applied Biosystems). b-Actin was used as internal control. The cDNAs of different tissues synthesis was described above. The PCR condition was as follow: 94 °C for 5 min followed by 30 cycles at 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s and finally, a single elongation step at 72 °C for 10 min. 2.5. Real-time RT-PCR
2.2. Gene cloning of Piwi in common carp Total RNA from adult common carp testis was isolated by using Trizol reagent (Invitrogen, Carlsbad, CA) and then digested with DNase I (Fermentas, Vilnius, Lithuania) to eliminate residual DNA. Frist-strand cDNA was synthesized using AMV reverse transcriptase (Fermentas, Vilnius, Lithuania) with oligo (dT)12–18 primer following the manufacturer’s instruction. The degenerated primers were designed based on conserved sequences of other teleosts (Table 1). Polymerase chain reaction (PCR) was carried out by using the primers listed in Table 1. PCR were performed 94 °C for 30 s, 53 °C for 30 s, 72 °C for 3 min with 30 cycles. The PCR product was cloned and sequenced to obtain core partial cDNA of Piwil1 and Piwil2, respectively. Subsequently, RACE (Rapid Amplification of cDNA Ends) were performed using the SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) to amplify full length cDNAs. Specific nested PCR primers were designed base on the core partial sequences (Table 1). For 30 RACE, the two amplification rounds conditions were both performed 94 °C for 30 s, 58 °C for 30 s, 72 °C for
To measure different transcripts expression, Real-time RT-PCR was used. b-Actin was used as endogenous control. Each test was repeated three times to improve the accuracy of the results in a Prism 7500 Sequence Detection System (Applied Biosystems). The procedure was: 50 °C for 5 min and 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s and 60 °C for 45 s. The analysis of relative mRNA expression was performed using the 2DDCt method [15]. Finally, the dissociation curves were used to examine whether the PCR products were indeed specific. 2.6. Developmental change of Piwi Comparative expressions of Piwil1 and Piwil2 mRNAs in ovaries were examined by Real-time RT-PCR. Common carp in differential developmental periods were obtained and divided into five groups: 0+ year group [January, Body weight (BW) = 58 ± 1.95 g, gonadosomatic index (GSI) = 0.064 ± 0.011, n = 4] and four 1+ year groups (November, BW = 423 ± 21.1 g, GSI = 0.137 ± 0.010, n = 4; January, BW = 471 ± 17.6 g, GSI = 0.201 ± 0.012, n = 4; February, BW = 613 ±
Table 1 Primers sequences used in the polymerase chain reactions. Gene
Primer name
Sequence (50 –30 )
Application
Piwil1
Piwil1-F Piwil1-R Piwil1–30 out Piwil1–30 inner Piwil1–50 out Piwil1–50 inner Piwil1 RT-F Piwil1 RT-R Piwil2-F Piwil2-R Piwil2–30 out Piwil2–30 inner Piwil2–50 out Piwil2–50 inner Piwil2 RT-F Piwil2 RT-R b-Actin-F b-Actin-R
TMWGTGGGYTTTGTATCAGT CCMACWCCATCTCGRTAM ACAATCAGCAAACCTCAAGCACT GCGGTTCTCCAAGTGCGTCT TGTGCTTTGCCCAGAGTCTCCTC CGGGACTCCATAGGTGGCTTGA AGCACAGGCTGACGATTTGG CAGAATGATCAGGCCCACAA ATGGAKCCAARGCGRCC TYACAGAAARAAYAGTTTCTCTGAA GGTTCGAGACCCCTCCATCA AACTGCTGGGCTGTTTTCTATCC TGATGGTCGGCTTAGACTGGA CTCTGCCCCATGTCTTTGC AACAACTGCTGCACAACATCAAC ACAGTGCTGATGGAGGGGTCT GCCCTGCCCCATGCCATCCT AGTGCCCATCTCCTGCTCGA
Partial cDNA cloning Partial cDNA cloning 30 RACE 30 RACE 50 RACE 50 RACE RT-PCR and realtime RT-PCR and realtime Partial cDNA cloning Partial cDNA cloning 30 RACE 30 RACE 50 RACE 50 RACE RT-PCR and realtime RT-PCR and realtime RT-PCR and realtime RT-PCR and realtime
Piwil2
b-Actin
RT-PCR RT-PCR
RT-PCR RT-PCR RT-PCR RT-PCR
128
22.4 g, GSI = 0.308 ± 0.057, GSI = 0.381 ± 0.043, n = 4).
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
n = 4;
March,
BW = 763 ± 21.8 g,
2.7. In vivo hCG treatment To examine the regulation of hCG action on Piwi, eight female adult individuals were injected with hCG (Sigma, St. Louis, MO). All the fish were 2.5 years old female (December, BW = 1325 ± 130.1 g, GSI = 0.128 ± 0.007) and divided into two groups (n = 4/ group): control (saline) and hCG treatment (0.6 IU/g BW). Two injections were performed on days 1 and 5, respectively. Each group was kept in vehicle along (23 °C) until ovaries were collected on day 6. The tissues were stored at 80 °C until analysis of Piwi transcripts. 2.8. In vitro treatment of hCG Common carp ovary cell culture was performed to examine hCG effect on Piwi in vitro. Three females (2.5 years old, December, BW = 1433 ± 201.8 g, GSI = 0.135 ± 0.012) were killed and the ovaries were separated by repeated pipetting and placed in 5 ml phosphate-buffered saline (PBS) in a Petri dish. After washed three times with PBS, the organs were incubated with 0.05% (w/v) collagenase (Sigma, St. Louis, MO) in PBS for 15 min and followed three times washed with PBS. With 1 ml DMEM containing 10% fetal bovine serum (Gibco BRL), cells were cultured in 24-well culture plate (Falon) at density of 800 mg/each well. Cells were incubated in culture incubator at 24 °C with 5% CO2 for 2 days before hCG treatment. To examine the response to hCG in vitro, three different hCG concentrations of 106 M, 108 M and 1010 M were tested. For each individual carp, 12 wells were planted as follow: 3 replicates 4 different concentrations (control, 106 M, 108 M and 1010 M). After 2 h incubation, cells were harvested for transcripts analysis. 2.9. Statistical analysis
Fig. 1. (A) Piwi proteins have two characterized domains: PAZ and PIWI domains. The predicted amino acid sequence of Piwil1 and Piwil2 (B) in common carp. The PAZ domain and the PIWI domain as predicted by interProScan are underlined and boxed, respectively. The numbers refer to amino acids (N- to C-terminal).
All statistical analyses of data were performed using SPSS 13.0 package. Statistical significance between the groups was calculated by Duncan’s multiple range tests. 3. Results 3.1. Cloning and phylogenetic analysis Full length of Piwil1 (GenBank Accession No. JF505506) and Piwil2 (GenBank Accession No. JF505507) were obtained from testis of carp. Piwil1 was 3114 bp which consisted of a 64 bp 50 -UTR (untranslated region), a 2577 bp ORF (Open Reading Frame) and a 473 bp 30 -UTR. The ORF of Piwil1 encoded a peptide of 858 amino acids. While Piwil2 was 3421 bp which consisted of a 72 bp 50 -UTR, a 3105 bp ORF and a 244 bp 30 -UTR. The ORF encoded a 1034 amino acids peptide. For each Piwi, a PAZ domain and a PIWI domain were identified (Fig. 1). The phylogenetic tree demonstrated that the two homologous of Piwi were located within two main clades: Piwi1 clade and Piwi2 clade (Fig. 2). Common carp Piwil1, Ziwi, Xiwi, Miwi and Hiwi were clustered while Piwil2 was clustered with Xili, Mili and Hili. In Piwil1 clade, common carp Piwil1 shared 96.9–64% identities with Ziwi, Xiwi1, Miwi1 and Hiwi1 and only 46.7– 40.4% identities with Xiwi2, Miwi2, Hiwi2 and Hiwi3. For Piwil2 clade, the amino acid sequence of common carp Piwil2 showed 90.3% identity with Zili while shared low identities (57.5–56%) with Xili, Mili and Hili.
Fig. 2. Phylogenetic tree of Piwi proteins. The amino acids sequences used are Hiwi1, H. sapiens NP_004755; Hiwi2, H. sapiens NP_689644; Hiwi3, H. sapiens NP_001008496; Hili, H. sapiens NP_060538; Miwi1, M. musculus NP_067286; Miwi2, M. musculus NP_808573; Mili, M. musculus NP_067283; Xiwi1, Xenopus tropicalis XP_002940227; Xiwi2, Xenopus tropicalis XP_002939761; Xili, Xenopus tropicalis NP_001106470; Ziwi, D. rerio NP_899181; Zili, D. rerio ACH96370.
3.2. Tissue distribution of Piwi in adult carp To assess tissue distribution of Piwi transcripts in carps, RT-PCR were provided. The primers were designed according to the
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
obtained ORFs. b-Actin was used as internal control and was detected in all tissues at similar intensity. Piwil1 showed a very strong signal in testes and ovaries. No amplicon was observed in other tissues. For Piwil2, the transcripts were only observed in testes and ovaries too. In other different tissues, Piwil2 was undetectable (Fig. 3A). 3.3. Developmental changes of Piwi transcripts in ovary Among 0+ year group, 1+ year November group and 1+ year January group, no significant changes of Piwi1 transcripts were observed (P > 0.05). While Piwil1 transcripts significantly decreased in the ovaries during the spawning period (February and March) (P < 0.05) (Fig. 3B). For Piwil2, the mRNA expression levels were significantly lower in 1+ year November group and 1+ year January group compared with 0+ year group. Meanwhile, during the spawning period (February and March), another fall of Piwil2 transcripts was observed (P < 0.05) (Fig. 3C). 3.4. In vivo hCG effects on ovary Piwi transcripts The Piwil1 and Piwil2 response to hCG were estimated by in vivo study of hCG treatment. Saline and hCG (0.6 IU/g BW) were injected into female adult fish. Compared with control, hCG suppressed Piwil1 transcripts in ovaries significantly (P < 0.05) (Fig. 4A). Similarly, in ovaries, Piwil2 transcripts were depressed by hCG significantly (P < 0.05) (Fig. 4B). 3.5. In vitro hCG effects on ovary Piwi transcripts For ovarian cells, hCG depressed both Piwil1 and Piwil2 transcripts in different doses. After 2 h of hCG treatment, Piwil1 transcript levels were significantly decreased in 106 M doses of hCG treatment (P < 0.05), while 1010 M and 108 M and doses of hCG treatments were not significantly change the Piwil1
129
expression (P > 0.05) (Fig. 4C). For Piwil2, the transcripts expression was significantly decreased in all the groups of 1010 M, 108 M and 106 M doses hCG treatment (P < 0.05) (Fig. 4D). 4. Discussion In present study, two homologous Piwi genes were cloned and sequenced from gonad of common carp. Both predicted amino acid sequences of Piwil1 and Piwil2 contained PAZ domains in the centre and PIWI domains in the C-terminal which are the typical characters of Piwi genes. The common carp Piwil1 protein shared the high identity (96.9–56.5%) with Ziwi, Xiwi1, Miwi1 and Hiwi1. While it only shared 46.7–40.4% with Xiwi2, Miwi2, Hiwi2 and Hiwi3. The common carp Piwil2 protein showed the high identities with Zili, Xili, Mili and Hili but low identities with other Piwi proteins. Piwi was first depicted in Drosophila. The following studies demonstrated that two subgroup were identified in mouse, including Miwi and Mili [11]. In vertebrates, these two Piwi subgroup have been identified in Human (Hiwi and Hili), Xenopus (Xiwi and Xili) and zebrafish (Ziwi and Zili) [19,25,27]. Herein, we report for the expression of two Piwi homologs in the common carp gonad which belong to these two subgroups. Additionally, the data are consistent with the phylogenetic analysis. In the phylogenetic tree, Piwi clustered in two main branches, in agreement with Piwil1 and Piwil2 subgroup diversity. The tree also indicates that carp Piwil1 is an ortholog of Ziwi, Xiwi1, Miwi1 and Hiwi1 rather than Xiwi2, Miwi2, Hiwi2 and Hiwi3. As well as, carp Piwil2 is an ortholog of Zili, Xili, Mili and Hili. On the other hand, the topology of the tree is consistent with taxonomy, showing its presence in fish, amphibians and mammals and the bootstrap values were higher than 97%. The results confirm previous findings that only two Piwi homologs have been found in teleost instead of three or four Piwi homologs in amphibian and mammals. Either mRNA or protein, Piwis as germline specific expression genes in adults has been reported in several vertebrates, including zebrafish, Xenopus and human [6,7,25,27]. However, using
Fig. 3. Piwil1 and Piwil2 expression in carps. (A) RT-PCR analysis of Piwil1 and Piwil2 expression in different tissues of adult carps. Quantification of the transcripts expression for Piwil1 (B) and Piwil2 (C) in development stages in carp ovaries. Asterisks represent a statistically significant difference when compared with 0+ year stage (P < 0.05).
130
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
Fig. 4. Effect of hCG treatment on Piwil1 and Piwil2 expression in carp ovaries. (A and B) represent in vivo effects of the hCG on ovarian Piwil1 and Piwil2 expression, respectively. (C and D) show in vitro treatment of the hCG on Piwil1 and Piwil2 mRNA transcript levels in carp ovaries. Asterisks represent a statistically significant difference when compared with control (P < 0.05).
high-throughput small RNA sequencing, recent research showed widespread expression of piRNA molecules in somatic tissues in mouse, rhesus macaque (Macaca mulatta) and Drosophila. Western bolt analysis of Miwi protein also demonstrated expression in mouse pancreas [28]. Moreover, Piwi expression in extra-gonadal tissues in S. mediterranea, has been proved [17,20]. The present results showed that in carp, Piwi mRNAs expressed specifically in testis and ovaries, while in other tissues the expression was undetectable. This is in agreement with previous studies, fish Piwis are gonadal-specific genes which is consistent with its important role in germline development [7]. Real-time RT-PCR revealed that Piwil1 and Piwil2 mRNA expression levels decreased significant in the carp ovaries during vitellogenesis. The Piwil1 transcripts were abundant in juvenile stage, and significantly changed until February in 1+-year-old carps during prespawning. Also, the Piwil2 mRNA levels were high in juvenile stage and decreased significantly until February in 1+year-old carps during prespawning period. The data suggest that carp Piwi expression levels change with the development of ovaries. In zebrafish, by immunohistochemistry, both Ziwi and Zili were observed in all stage of oogenesis, especially during the PGC mitotic and early meitotic germ cell [6,7]. However, Ziwi and Zili expression differentiation were not assayed. By western blotting, Xiwi and Xili expression were assessed troughout the oogenesis in Xenopus. Xiwi1 protein levels decreased in stage III of oocyte. In contrast with Xiwi1, Xili were abundant in mature oocyte [27]. Our result is in agreement with Xiwi1, both two Piwi were high expressed in juvenile stage and decreased in pre-ovulation. In carps, HPG axis plays a central role in control gonad differentiation and development as other teleosts [29]. At preovulatory period, LH is highly expressed and is necessary in order for vitellogenesis and final maturation which is in coincidence with
depressed expression of Piwi. To understand whether Piwi is regulated by HPG axis, hCG treatments were preformed in vivo and in vitro in ovaries. In vivo study, two injections with 0.6 UI/g BW hCG as modified dosage of previous study were performed [18]. A significant decline of both Piwil1 and Piwil2 transcripts has been observed in ovaries. The present result indicated that hCG inhibit Piwil1 and Piwil2 expression of the transcripts in carps ovaries. Subsequently, by primary cultures of dispersed ovaries cells, in vitro hCG treatment assay were preformed. The repression of Piwil1 and Piwil2 by hCG were similar. As an analog of LH, hCG could be able to bind with LHR – a transmembrane receptor of ovarian follicle cells. As hCG is readily available and acts much faster via stimulate gonad directly, it has been wildly used in induction of fish spawning in aquaculture [30]. By stimulating the receptor, the follicles were mobilized and eventually resulted in follicle maturation and ovulation. In this process, several genes in ovaries are modulated by HPG axis, including germ cell proliferation and vitellogenesis associated genes [29]. For instance, hCG stimulates E2 synthesis in ovary and then activates G-proteins and steroidogoenic genes [8]. The present study showed that both Piwil1 and Piwil2 were down-regulated by hCG treatment in vivo and in vitro. The biological function of Piwi is germ cell maintenance and silencing of transposons by cooperating with piRNAs [2,7,23]. Moreover, it has been proved that the Piwi–piRNA complex could induce mRNA silencing which displayed a similar function of microRNA [21,22]. These researches offered a new landscape for understanding function of Piwi and piRNA in ovaries differentiation and development. In the present study, expression patterns of Piwil1 and Piwil2 have been investigated in carp ovaries. These two genes were significantly decreased during ovulation period with gonadotropin expression increased. Subsequent studies validated that Piwil1 and Piwil2 expression levels were down-regulated by hCG. Thus, the HPG axis modulate
Y. Zhou et al. / General and Comparative Endocrinology 176 (2012) 126–131
Piwi expression during pre-ovulation in carp ovaries. Herein, we hypothesize that during pre-ovulation periods, with LH expression arised, Piwi and piRNA are suppressed. After losing suppressive effect of Piwi–piRNA complex, the silenced genes and transposons are arised and eventually induced final maturation and ovulation. In summary, full-length cDNAs of Piwil1 and Piwil2 were cloned from gonad of common carp and showed high identity with other teleosts. And we demonstrated that Piwis were suppressed by hCG. These findings extend out understanding of the hormonal regulation of Piwi and piRNA. Acknowledgments This research was supported by the National Natural Science Fund for Distinguished Young Scholars (Grant No. 30725028), the National Natural Science Foundation of China (Grant No. 30930071), the Natural Science Fund for Innovative Research Team of Hunan Province (Grant No. 10JJ7004), the National Special Fund for Scientific Research in public benefits (Grant No. 200903046), the Doctoral Fund of Ministry of Education of China (Grant No. 20104306110004), and the Construction Project of Key Discipline of Hunan Province and China. References [1] A. Aravin, D. Gaidatzis, S.M. Pfeffer, P. Landgraf, N. Iovino, P. Morris, M.J. Brownstein, S. Kuramochi-Miyagawa, T. Nakano, M. Chien, J.J. Russo, J. Ju, R. Sheridan, C. Sander, M. Zavolan, T. Tuschl, A novel class of small RNAs bind to MILI protein in mouse testes, Nature 442 (2006) 203–207. [2] M.A. Carmell, A. Girard, H.J.G. van de Kant, D. Bourc’his, T.H. Bestor, D.G. de Rooij, G.J. Hannon, MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline, Cell 12 (2007) 503–514. [3] D.N. Cox, A. Chao, J. Baker, L. Chang, D. Qiao, H. Lin, A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell selfrenewal, Gene Dev. 12 (1998) 3715–3727. [4] S. Drori, M. Ofir, B. Levavi-Sivan, Z. Yaron, Spawning induction in common carp (Cyprinus carpio) using pituitary extract or GnRH superactive analogue combined with metoclopramide: analysis of hormone profile, progress of oocyte maturation and dependence on temperature, Aquaculture 119 (1994) 393–407. [5] L. He, G.J. Hannon, MicroRNAs: small RNAs with a big role in gene regulation, Nat. Rev. Genet. 5 (2004) 522–531. [6] S. Houwing, E. Berezikov, R.F. Ketting, Zili is required for germ cell differentiation and meiosis in zebrafish, EMBO J. 27 (2008) 2702–2711. [7] S. Houwing, L.M. Kamminga, E. Berezikov, D. Cronembold, A. Girard, H. van den Elst, D.V. Filippov, H. Blaser, E. Raz, C.B. Moens, R.H.A. Plasterk, G.J. Hannon, B.W. Draper, R.F. Ketting, A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in zebrafish, Cell 129 (2007) 69–82. [8] J.S. Ings, G.J. Van Der Kraak, Characterization of the mRNA expression of StAR and steroidogenic enzymes in zebrafish ovarian follicles, Mol. Reprod. Dev. 73 (2006) 943–954. [9] A.I. Kalmykova, M.S. Klenov, V.A. Gvozdev, Argonaute protein PIWI controls mobilization of retrotransposons in the Drosophila male germline, Nucleic Acids Res. 33 (2005) 2052–2059. [10] S. Kumar, M. Nei, J. Dudley, K. Tamura, MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences, Brief Bioinform. 9 (2008) 299–306. [11] S. Kuramochi-Miyagawa, T. Kimura, K. Yomogida, A. Kuroiwa, Y. Tadokoro, Y. Fujita, M. Sato, Y. Matsuda, T. Nakano, Two mouse piwi-related genes: miwi and mili, Mech. Dev. 108 (2001) 121–133.
131
[12] H.F. Kwok, W.K. So, Y.J. Wang, W. Ge, Zebrafish gonadotropins and their receptors: I. cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone receptors – evidence for their distinct functions in follicle development, Biol. Reprod. 72 (2005) 1370–1381. [13] N.C. Lau, A.G. Seto, J. Kim, S. Kuramochi-Miyagawa, T. Nakano, D.P. Bartel, R.E. Kingston, Characterization of the piRNA complex from rat testes, Science 313 (2006) 363–367. [14] W.S. Li, H.R. Lin, A.O. Wong, Effects of gonadotropin-releasing hormone on growth hormone secretion and gene expression in common carp pituitary, Comp. Biochem. Physiol. B 132 (2002) 335–341. [15] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2-[Delta][Delta]CT method, Methods 25 (2001) 402–408. [16] T. Ohara, Y. Sakaguchi, T. Suzuki, H. Ueda, K. Miyauchi, The 30 termini of mouse Piwi-interacting RNAs are 20 -O-methylated, Nat. Struct. Mol. Biol. 14 (2007) 349–350. [17] D. Palakodeti, M. Smielewska, Y.C. Lu, G.W. Yeo, B.R. Graveley, The PIWI proteins SMEDWI-2 and SMEDWI-3 are required for stem cell function and piRNA expression in planarians, RNA 14 (2008) 1174–1186. [18] R.E. Peter, H.R. Lin, G. Van Der Kraak, Induced ovulation and spawning of cultured freshwater fish in China: advances in application of GnRH analogues and dopamine antagonists, Aquaculture 74 (1988) 1–10. [19] D. Qiao, A.M. Zeeman, W. Deng, L.H. Looijenga, H.F. Lin, Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas, Oncogene 21 (2002) 3988–3999. [20] P.W. Reddien, N.J. Oviedo, J.R. Jennings, J.C. Jenkin, A.S. Alvarado, SMEDWI-2 is a PIWI-like protein that regulates planarian stem cells, Science 310 (2005) 1327–1330. [21] N. Robine, N.C. Lau, S. Balla, Z. Jin, K. Okamura, S. Kuramochi-Miyagawa, M.D. Blower, E.C. Lai, A broadly conserved pathway generates 30 UTR-directed primary piRNAs, Curr. Biol. 19 (2009) 2066–2076. [22] K. Saito, S. Inagaki, T. Mituyama, Y. Kawamura, Y. Ono, E. Sakota, H. Kotani, K. Asai, H. Siomi, M.C. Siomi, A regulatory circuit for piwi by the large Maf gene traffic jam in Drosophila, Nature 461 (2009) 1296–1299. [23] A.G. Seto, R.E. Kingston, N.C. Lau, The coming of age for Piwi proteins, Mol. Cell 26 (2007) 603–609. [24] W.K. So, H.F. Kwok, W. Ge, Zebrafish gonadotropins and their receptors: II. cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone subunits-their spatial-temporal expression patterns and receptor specificity, Biol. Reprod. 72 (2005) 1382–1396. [25] C.H. Tan, T.C. Lee, S.D. Weeraratne, V. Korzh, T.M. Lim, Z. Gong, Ziwi, the zebrafish homologue of the Drosophila piwi: co-localization with vasa at the embryonic genital ridge and gonad-specific expression in the adults, Mech. Dev. 119 (2002) S221–S224. [26] G. Van Der Kraak, K. Suzuki, R.E. Peter, H. Itoh, H. Kawauchi, Properties of common carp gonadotropin I and gonadotropin II, Gen. Comp. Endocrinol. 85 (1992) 217–229. [27] A. Wilczynska, N. Minshall, J. Armisen, E.A. Miska, N. Standart, Two Piwi proteins, Xiwi and Xili, are expressed in the Xenopus female germline, RNA 15 (2009) 337–345. [28] Z. Yan, H.Y. Hu, X. Jiang, V. Maierhofer, E. Neb, L. He, Y. Hu, H. Hu, N. Li, W. Chen, P. Khaitovich, Widespread expression of piRNA-like molecules in somatic tissues, Nucleic Acids Res. (2011), doi:10.1093/nar/gkr298. [29] Z. Yaron, Endocrine control of gametogenesis and spawning induction in the carp, Aquaculture 129 (1995) 49–73. [30] Z. Yaron, A. Bogomolnaya, S. Drori, I. Biton, J. Aizen, Z. Kulikovsky, B. LevaviSivan, Spawning induction in the carp: past experience and future prospects – a review, Isr. J. Aquac. Bamidgeh 61 (2009) 5–26. [31] H. Yin, H.F. Lin, An epigenetic activation role of Piwi and a Piwi-associated piRNA in Drosophila melanogaster, Nature 450 (2007) 304–308. [32] X. Zhou, H. Guo, K. Chen, H. Cheng, R. Zhou, Identification, chromosomal mapping and conserved synteny of porcine Argonaute family of genes, Genetica 138 (2010) 805–812. [33] Y. Zohar, C.C. Mylonas, Endocrine manipulations of spawning in cultured fish: from hormones to genes, Aquaculture 197 (2001) 99–136.