- Email: [email protected]
Human β-defensin-3 alleviates the progression of atherosclerosis accelerated by Porphyromonas gingivalis lipopolysaccharide
International Immunopharmacology 38 (2016) 204–213
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Human β-defensin-3 alleviates the progression of atherosclerosis accelerated by Porphyromonas gingivalis lipopolysaccharide Lili Li a,b, Tianying Bian a,b, Jinglu Lyu a,b, Di Cui a,b, Lang Lei a,c, Fuhua Yan a,b,⁎ a b c
Department of Periodontology, Nangjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, Jiangsu, China Central Laboratory of Stomatology, Nangjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, Jiangsu, China Department of Orthodontics, Nangjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, Jiangsu, China
a r t i c l e
i n f o
Article history: Received 19 December 2015 Received in revised form 1 June 2016 Accepted 2 June 2016 Available online xxxx Keywords: Human β-defensin-3 Atherosclerosis Porphyromonas gingivalis Lipopolysaccharide Periodontitis
a b s t r a c t Background and aim: Porphyromonas gingivalis (P. gingivalis) lipopolysaccharide (LPS) is reported to be associated with the progression of atherosclerosis (AS). In this study, we explored the potential of human β-defensin-3 (hBD3), an antimicrobial peptide with immunomodulatory properties, to alleviate AS progression accelerated by P. gingivalis LPS and the mechanism underlying this effect. Materials and methods: Apolipoprotein E-deficient mice were injected intraperitoneally with hBD3, P. gingivalis LPS, or hBD3 + P. gingivalis LPS. The aorta was assessed immunohistologically and mRNA levels of inflammatory cytokines were determined by quantitative PCR. Macrophages and vascular endothelial cells were stimulated in vitro to investigate the hBD3 target cells. Inflammatory cytokines in serum and cell culture supernatants were detected using cytometric bead arrays. Signaling pathways were investigated by Western blotting. Results: In P. gingivalis LPS-treated mice, hBD3 significantly reduced serum IL-6 and TNF-α levels and aortic expression of ICAM-1, IL-6, and MCP-1 (mRNA and protein). The area and severity of atherosclerotic lesions were also diminished, with less advanced plaque formation, more continuous and distinct elastic lamina, and more normal smooth muscle cells arranged along the tunica media layer. In vitro, hBD3 decreased TNF-α, IL-1β, IL-6 secretion and downregulated TNF-α, IL-1β, IL-6, IL-8, VCAM-1, and IL-10 mRNA levels in macrophages. hBD3 did not influence TNF-α, IL-6, and IL-8 levels in HUVECs culture supernatants. Furthermore, hBD3 suppressed P. gingivalis LPS-induced activation of the NF-κB, p38 and JNK pathways. Conclusion: hBD3 alleviates AS progression accelerated by P. gingivalis LPS in apolipoprotein E-deficient mice by downregulating the cytokine expression in macrophages via the MAPK and NF-κB signaling pathways. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Porphyromonas gingivalis (P. gingivalis) is a major pathogen involved in the pathogenesis of periodontitis, which is a chronic inflammatory disease with a high incidence. P. gingivalis lipopolysaccharide (LPS) in periodontal lesion may invade into bloodstream and impact the systemic conditions negatively. Efforts have been made to understand the association between periodontal disease and systemic condition including atherosclerosis (AS), which remains a hot topic [1–5]. Evidence has been provided that elevated serum level of P. gingivalis LPS is associated with the progression of AS [6,7]. Long-term exposure to P. gingivalis LPS promotes the formation of AS plaque in Apolipoprotein E-deficient (ApoE −/−) mice [8]. P. gingivalis LPS augments the production of pro-inflammatory cytokines and facilitates monocyte adhesion to vascular endothelial cells, which are the initial events of AS [9–11]. In addition, many studies demonstrate that P. gingivalis LPS promotes ⁎ Corresponding author at: 30 Zhongyang Road, Nanjing, Jiangsu 210008, China. E-mail address: [email protected] (F. Yan).
http://dx.doi.org/10.1016/j.intimp.2016.06.003 1567-5769/© 2016 Elsevier B.V. All rights reserved.
macrophages transformation to foam cells. The expression of pro-inflammatory cytokines, growth factors, and adhesion molecules in macrophages is upregulated by P. gingivalis LPS [12–16]. Collectively, these findings indicate that P. gingivalis LPS from periodontal lesions may contribute to the development of AS. Essentially, AS is a chronic inflammatory disease of the arterial wall with inflammation implicated in every stage of its progression [17,18]. Currently, treatment of AS depends predominantly on lipid-lowering drugs. Despite various therapies targeting serum lipoprotein levels, AS remains to be the most significant cause of death in the industrialized world [19]. As the fundamental role of inflammation in AS has been characterized, more and more attention has been paid to anti-inflammation therapy [20–23]. Agents targeting chronic systemic inflammatory conditions have shown promise in the treatment of AS both experimentally and clinically [24]. Human β-defensins (hBDs) are small, cationic host defense peptides with immunomodulatory properties and chemoattractant activity for human monocytes, lymphocytes and DCs, suggesting that they contribute to the link between innate and adaptive immunity [25,26]. Human
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
β-defensin-3 (hBD3) exerts diverse innate immune activities and is considered to be the most promising of its class in preventing inflammatory disease [27,28]. hBD3 is widely expressed in many tissues including oral and vascular epithelium, where it participates in inflammation and the initiation of innate immune responses [29–32]. Many studies have shown that hBD3 suppresses the inflammatory effect caused by Escherichia coli lipopolysaccharide (LPS) in vitro and in vivo [33–35]. In addition, hBD3 exerts anti-inflammatory effect against Enterococcus faecalis to induce TNF-α, IL-8, and ICAM-1 expression in human monocytic cell line, THP-1 [36]. Based on the anti-inflammatory effect and antimicrobial property of hBD3, we hypothesized that hBD3 may play a role in the development of AS. However, very limited evidence regarding the effect of hBD3 on AS is currently available. In this study, we demonstrated that P. gingivalis LPS accelerates the progression of AS in ApoE −/− mice. And hBD3 alleviates these unfavorable effects by downregulating the expression of pro-inflammatory cytokine expression. Furthermore, target cells and related signaling pathways were investigated in vitro to elucidate the underlying mechanism of the anti-inflammatory effects of hBD3. Our results demonstrated that hBD3 downregulates inflammatory cytokine expression in macrophages rather than vascular endothelial cells. Both the mitogenactivated protein kinase (MAPK) and NF-κB signaling pathways participate in the anti-inflammatory effects of hBD3. Based on these observations, we speculated that hBD3 alleviates the progression of AS accelerated by P. gingivalis LPS from periodontal lesions.
205
approximately 100 μg/mouse) or hBD3 + P. gingivalis LPS. Mice were euthanized 2 h later. Based on the observation of the anti-inflammatory effect of hBD3, we conducted a long term experiment to investigate the role of hBD3 in AS. Forty randomly selected mice were divided into four groups and injected intraperitoneally with sterile phosphate-buffered saline, hBD3 solution (0.1 mg/kg, approximately 2 μg/mouse), P. gingivalis LPS (0.5 mg/kg, approximately 10 μg/mouse), or hBD3 + P. gingivalis LPS. Treatments were administered three times per week. Mice were fed a high-fat diet containing 10% lard, 4% milk powder, 2% cholesterol and 0.5% sodium cholate. Eight weeks later, the mice were euthanized and atherosclerotic plaques were observed. 2.3. Tissue harvesting and preparation Blood was collected immediately after the mice were anesthetized by overdose of isoflurane and euthanized. Then they were dissected and perfused with 10 mL PBS via the left ventricle, followed by 10 mL of 4% phosphate-buffered paraformaldehyde phosphate. The aortic trees (from the aortic valve to the iliac bifurcation) were carefully dissected. Five of them in each group were preserved in 4% buffered paraformaldehyde phosphate and processed for en face morphometric analysis [37,38]. The other five were homogenized using a TissueLyser (Shanghai JingXin) at 65 Hz for 90 s in TRIzol (Sigma, MO, USA) and stored at −80 °C until further processing for quantitative PCR. The proximal aortas together with hearts of all mice were fixed in 4% phosphatebuffered paraformaldehyde.
2. Materials and methods 2.4. Atherosclerotic plaque assessment 2.1. Reagents and instruments used Ultrapure P. gingivalis LPS was purchased from Invivogen (Carlsbad, CA, USA). Recombinant human BD-3 was purchased from PEPROTECH (Rocky Hill, NJ, USA). Phosphate-buffered saline solution was purchased from Hyclone (Logan, UT, USA). BD Cytometric Bead Array Human Inflammatory Cytokines Kits and the Mouse Enhanced Sensitivity Flex Set of TNF and IL-6 were purchased from BD Biosciences. Anti-CD68 antibody and anti-MCP-1 antibody were from Wuhan Boster Biological Technology (Wuhan, China). Anti-ICAM-1 antibody, anti-IL-6 antibody, and anti-VCAM-1 antibody were from ProteinTech Group (Chicago, IL, USA). The following antibodies were purchased from Cell signaling (Cell Signaling Technology, MA, USA): anti-p44/42 MAPK (Erk1/2) antibody (catalog number 4695), anti-phosphorylated p44/42 MAPK (Erk1/ 2) antibody (catalog number 4370), anti-p38 MAPK antibody (catalog number 8690), anti-phosphorylated p38 MAPK antibody (catalog number 4511), anti-SAPK/JNK antibody (catalog number 9252), anti-phosphorylated JNK antibody (catalog number 4668), anti-phosphorylated IkappaB-alpha antibody (catalog number 2859), anti-phosphorylated NF-κB p65 antibody (catalog number 3033), and anti-NF-κB p65 antibody (catalog number 8242). The anti-GAPDH antibody was obtained from Bioworld (Nanjing, China). 2.2. ApoE−/− mice Nine-week-old male ApoE−/− mice on a C57BL/6 background were purchased from the Department of Laboratory Animal Science, Beijing University (Beijing, China). The mice were maintained in a specific pathogen-free facility on a 12 h light: 12 h dark cycle at 25 °C. Throughout the treatment period, body weight and food intake were monitored at weekly intervals. All surgery on animals was performed in accordance with the Animal Ethics Committee of Nanjing University (China). Firstly, we explored the role of hBD3 in the acute inflammatory response caused by P. gingivalis LPS. Twenty-four randomly selected mice were divided into four groups (n = 6 per group) and injected intraperitoneally with sterile phosphate-buffered saline, hBD3 (0.5 mg/ kg, approximately 10 μg/mouse), P. gingivalis LPS (5 mg/kg,
The extent of aortic atherosclerotic lesions was analyzed by en face staining with Oil red O, as previously described [39]. Briefly, the aortic tissue of each mouse (n = 5 mice per group) was harvested from the aortic valve to the iliac bifurcation. All adventitial fat and connective tissue were carefully removed. The aorta was then opened longitudinally, followed by fixation overnight in 4% paraformaldehyde. The next day, the aorta was rinsed with 5 mL of 60% isopropanol and pinned out to black wax simultaneously to reveal the entire luminal surface area. Then the aorta was stained in 5 mL of filtered 60% Oil Red O solution (Sigma, MO, USA) for 15 min at 57 °C, followed by rinsing with 60% isopropanol for 5 min. Finally, the aorta was submerged in PBS and photographed. Photographs were obtained using a digital camera (Canon EOS 650D) with a macro lens (EF 100 mm f/2.8L Macro IS USM). The lesion area was selected using Photoshop 8.0 (Adobe) software and quantified using Image-Pro Plus 6.0 (Media Cybernetics) software. 2.5. Histology and immunohistochemistry of the aortic sinus After fixation in 4% phosphate-buffered paraformaldehyde phosphate for 48 h, five samples in each group were embedded in optimal cutting temperature compound (OTC; Sakura Finetek, Beijing, China). Serial cryosections (8 mm thick) of the aortic sinus were cut and 4–6 sections from each sample were selected for Oil Red O staining to detect lipids in the plaque. The other samples in each group were embedded in paraffin. Sections (5 μm thick) were prepared and stained with hematoxylin and eosin (HE) or Masson Trichrome or used for immunostaining. Immunohistochemical staining was performed to determine the expression levels of several inflammatory markers in the aortic root. Briefly, sections were deparaffinized and rehydrated before antigen retrieval using EDTA buffer (pH 9.0). The sections were incubated with H2O2 (0.3%) for 25 min at room temperature and protected from light to block endogenous peroxidase activity. Then the sections were blocked with 3% bovine serum albumin for 30 min at room temperature to prevent non-specific binding. Subsequently, the sections were incubated
206
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
Table 1 Primers used in quantitative PCR for aortic wall of ApoE−/− mouse. Gene
Forward primer (5′–3′)
Reverse primer (5′–3′)
IL-6 MCP-1 ICAM-1 GAPDH
CTGCAAGAGACTTCCATCCAG ACTCACCTGCTGCTACTCATTC GTCCGCTGTGCTTTGAGAAC ATCACTGCCACCCAGAAG
AGTGGTATAGACAGGTCTGTTGG TGTCTGGACCCATTCCTTCTTG GTGAGGTCCTTGCCTACTTG TCCACGACGGACACATTG
dehydrated and mounted. The primary antibody was replaced with PBS in negative controls. Micrographs were obtained using an OLYMPUS BX51 microscope (Olympus Co., Tokyo, Japan) and an Olympus DP camera (magnification: 40–200 ×). Quantitative analysis was performed using the Image-Pro Plus 6.0 (Media Cybernetics).
2.6. Cell culture
Table 2 Primers used in quantitative PCR for human cells. Gene
Forward primer (5′–3′)
Reverse primer (5′–3′)
TNF-α IL-1β IL-6 IL-8 VCAM-1 IL-10 GAPDH
GGAGGGGTCTTCCAGCTGGAGA TTCCTGTTGTCTACACCAATGC AACAACCTGAACCTTCCAAAGA AGACATACTCCAAACCTTTCCACC GCAAGGTTCCTAGCGTGTAC TCCTTGCTGGAGGACTTTAAGGGT AGAACATCATCCCTGCCTCTACT
CAATGATCCCAAAGTAGACCTGC CGGGCTTTAAGTGAGTAGGAGA TCAAACTCCAAAAGACCAGTGA ACAACCCTCTGCACCCAGTT GGCTCAAGCTGTCATATTCAC TGTCTGGGTCTTGGTTCTCAGCTT GATGTCATCATATTTGGCAGGTT
overnight at 4 °C with different primary antibodies specific for intercellular adhesion molecule-1 (ICAM-1), monocyte chemoattractant protein-1 (MCP-1), IL-6, and vascular cell adhesion molecule-1 (VCAM-1) at dilutions recommended by the manufacturers. The sections were then washed and incubated with appropriate horseradish peroxidaseconjugated secondary antibodies for 1 h at room temperature. Immunoreactivity was evaluated using DAB (3,3′-diaminobenzidine) as a chromogenic substrate, which was monitored under an optical microscope. The sections were then counterstained with hematoxylin,
The human acute monocytic leukemia cell line, THP-1, was purchased from the Cell Bank of the Chinese Academic of Sciences (Shanghai, China) and cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (HyClone) and 1% antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin, HyClone). The human umbilical vein endothelial cell line, HUVEC, obtained from ScienCell (San Diego, CA, USA) were cultured in endothelial cell medium (ECM, ScienCell, USA) supplemented with 5% fetal bovine serum (FBS, 0025, ScienCell, USA), 1% endothelial cell growth supplement (ECGS, 1052, ScienCell, USA) and 1% antibiotics (0503, ScienCell, USA). All cells were maintained in a standard atmosphere containing humidified 5% CO2 at 37 ° C. The medium was changed every 2 to 3 days. Macrophages were stimulated with 5 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 3 h or 6 h. HUVECs were treated with 50 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 8 h. The concentrations of inflammatory cytokines in culture supernatants were measured using cytometric bead arrays and the mRNA levels of inflammatory cytokines in cells were measured by quantitative PCR.
Fig. 1. hBD3 decreased serum inflammatory markers in acute and chronic inflammatory responses to P. gingivalis LPS. Serum was collected 2 h after one dose of P. gingivalis LPS (A) or after 3 doses per week for consecutive 8 weeks (B) administered to ApoE−/− mice. Serum TNF-α and IL-6 were detected by cytometric bead arrays. Results are expressed as means ± SD (10 mice/group). *P b 0.05.
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
207
Fig. 2. hBD3 suppressed pro-inflammatory cytokine expression in the aorta of P. gingivalis LPS-treated ApoE−/− mice. Mice were treated with PBS, P. gingivalis LPS, hBD3 or hBD3 + P. gingivalis LPS for 2 h. (A) The mRNA levels of ICAM-1, MCP-1 and IL-6 were quantified by quantitative PCR. Relative quantities of mRNAs were calculated using the ΔΔCt method and were normalized against GAPDH. (B) Representative photographs of ICAM-1, MCP-1 and IL-6 immunostaining (200×). Results are expressed as means ± SD (n = 4–5 mice/group). *P b 0.05.
2.7. Cytokine measurement in serum and cell culture supernatant Cytometric bead arrays (CBA, BD Biosciences) were used according to the manufacturer to measure serum levels of IL-6 and TNF-α, as well as IL-8, IL-1β, IL-6, IL-10, TNF, and IL-12p70 in cell supernatant. Samples (50 μL) were assayed against a 10-point standard curve (0.274–200 pg/mL for serum and 20–5000 pg/mL for culture supernatant) for each cytokine measured using a BD FACSCalibur (BD Bioscience). FCAP Array software (BD version 3.1) was used to create the standard curves for each cytokine and convert the mean fluorescence intensity (MFI) values into cytokine concentrations. 2.8. Quantitative PCR Total RNA was isolated from cell lines and aortic tissue using TRIzol reagent (Invitrogen). The concentration and quality of RNA was assessed using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Middlesex, MA, USA). Reverse transcription was performed using the SuperScript VILO cDNA Synthesis Kit (Invitrogen) according to the manufacturer's instructions. Quantitative PCR of mRNA was performed with gene specific primer pairs using the SYBR® Select Master Mix (Applied Biosystems) according to the manufacturer's instructions.
Quantitative PCR was performed on the ViiA™ 7 Real-Time PCR System. Primer sequences are shown in Table 1 and Table 2. The relative expression of mRNA was obtained using the ΔΔCt method and was normalized to GAPDH.
2.9. Western blot Macrophages were stimulated with 50 μg/mL P. gingivalis LPS in the presence or absence of hBD3 (2 μg/mL or 10 μg/mL) for 30 min. Cells were washed twice with ice-cold PBS, and then lysed using cell lysis buffer (catalog number P0013K, Beyotime, China) containing protease inhibitor cocktail set III (1:200, Calbiochem, USA) and phosphatase inhibitor cocktail set II (1:100, Calbiochem, USA) to extract total protein in cells. The lysate was collected and then centrifuged at 12,000 × g for 5 min at 4 °C. The remaining cell lysate was prepared in 5 × SDS loading buffer. Cytoplasmic protein was extracted using the Nuclear and Cytoplasmic Protein Extraction Kit (Keygetec, China) according to the manual instruction. Briefly, 5 × 106 cells were collected with a cell scraper and washed twice with ice-cold PBS (4 °C, 500 × g, 3 min). Then the supernatant was removed carefully and 75 μL ice-cold Buffer A was added to the sediment. After a 15 second vortex, the lysis system was placed on ice.
208
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
Fig. 3. hBD3 suppressed the expression of pro-inflammatory markers in the aorta of ApoE−/− mice stimulated with P. gingivalis LPS. Mice were treated with PBS, P. gingivalis LPS, hBD3 or P. gingivalis LPS + hBD3 for eight consecutive weeks. (A) The mRNA levels of ICAM-1, MCP-1 and IL-6 were quantified by quantitative PCR. Relative quantities of mRNAs were calculated using the ΔΔCt method and were normalized against GAPDH. (B) Representative photographs of ICAM-1, MCP-1 and IL-6 immunostaining (200 ×). Results are expressed as means ± SD (n = 4–5 mice/group). *P b 0.05.
Ten minutes later, 11 μL ice-cold Buffer B was added to the lysis system, followed by a 5 second vortex. Then the lysis system was put on ice for 1 min. After a 5 second vortex, centrifugation was done at 16,000 × g for 5 min at 4 °C. The supernatant, which contain cytoplasmic protein, was carefully pipetted to a new Eppendorf tube. Then the cytoplasmic protein was prepared in 5 × SDS loading buffer. Equal amounts of protein were separated by SDS-PAGE (4%–12% gel; GenScript, Jiangsu, China) and then transferred to the PVDF membrane. After blocking in 5% BSA, the membrane was incubated with the following antibodies: anti-ERK1/2 antibody, anti-phosphorylated ERK1/2 antibody, anti-p38 MAPK antibody, anti-phosphorylated p38 MAPK antibody, anti-SAPK/JNK antibody, anti-phosphorylated JNK antibody, anti-phosphorylated IκB-α antibody, anti-phosphorylated NF-κB p65 antibody, and anti-NF-κB p65 antibody (all 1:1000) or anti-GAPDH antibody (1:5000) overnight at 4 °C. The blots were then washed and
incubated with the appropriate HRP-conjugated secondary antibody (Bioworld, Nanjing, China) for 2 h at room temperature. After washing, immunoreactivity was visualized with an ImageQuant LAS 4000 mini System (GE Healthcare, Piscataway, NJ). Each experiment was performed three times.
2.10. Statistical analysis Data were statistically analyzed using GraphPad Prism version 5.0 (GraphPad Software Inc., La Jolla, CA, USA). All results are presented as mean ± standard deviation (SD) (n = 4–6 mice/group). Significant differences in mean values among the groups were determined by oneway ANOVA and Student–Newman–Keuls tests. P b 0.05 was considered to indicate statistical significance.
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
209
Fig. 4. hBD3 attenuated P. gingivalis LPS-accelerated atherosclerotic plaque formation in ApoE−/−mice. Mice received three doses of LPS per week for 8 consecutive weeks. (A) Representative photographs of en face Oil Red O-stained aortas of different groups. (B) The extent of plaques were shown as a percentage of the total lesion area in the whole intima area (n = 5). (C) Serial cryosections of the aortic sinus were stained with Oil Red O solution. (D) Quantitative analysis of the Oil Red O-stained cryosections. Data are expressed as mean ± SD (n = 5 mice/group). *P b 0.05.
3. Results 3.1. hBD3 decreased serum inflammatory markers in ApoE−/− mice exposed to P. gingivalis LPS Serum levels of TNF-α and IL-6 were detected by BD-CBA to explore whether hBD3 could attenuate the inflammation caused by P. gingivalis LPS. We found that hBD3 significantly decreased serum levels of TNF-α and IL-6 in the acute phase of the inflammatory response to P. gingivalis LPS. While hBD3 diminished serum levels of IL-6 alone in mice
continuously stimulated with P. gingivalis LPS (Fig. 1). These findings suggest that hBD3 exerts anti-inflammatory effects on the responses to both acute and chronic P. gingivalis LPS stimulation. 3.2. hBD3 attenuates acute inflammation in the aortic wall of ApoE−/− mice We analyzed the expression of inflammatory cytokines (ICAM-1, VCAM-1, MCP-1, and IL-6) in the aorta of mice in each group. Two hours after stimulation, mRNA levels of ICAM-1, MCP-1 and IL-6 were
210
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
Fig. 5. hBD3 mitigated atherosclerotic changes in the aorta of P. gingivalis LPS-treated mice. Hematoxylin and eosin staining shows the changes in vascular wall. Immunohistological staining of CD68 demonstrates macrophage infiltration. Masson Trichrome shows the condition of the elastic lamina and SMC in the aortic roots. Black arrows indicate discontinuous internal elastic lamina and abnormal smooth muscle cells.
significantly increased in the aorta of P. gingivalis LPS-treated mice, whereas the levels of these cytokines were significantly downregulated by hBD3 (Fig. 2A). Furthermore, immunohistochemical staining revealed corresponding decreases in pro-inflammatory markers when the P. gingivalis LPS-treated mice were given hBD3 (Fig. 2B). These findings demonstrate the anti-inflammatory effects of hBD3 in vivo. 3.3. hBD3 attenuates inflammation of the aortic wall of ApoE −/− mice chronically treated with P. gingivalis LPS In the chronic inflammatory response model, we observed that hBD3 significantly diminished the mRNA levels of MCP-1 and IL-6 in the aortic wall (Fig. 3A), demonstrating the anti-inflammatory effect of hBD3 in vivo. Immunohistochemical analysis showed that hBD3 reduced the expression of MCP-1 and IL-6 in the aortic root of P. gingivalis LPS-treated mice (Fig. 3B). 3.4. hBD3 alleviates the progression of AS accelerated by P. gingivalis LPS in ApoE−/− mice The aortic trees were stained with Oil Red O to detect lipid deposition. The total area of the atherosclerotic lesion in hBD3 + P. gingivalis LPS-treated mice were significantly smaller than those treated with P. gingivalis LPS alone, which in turn, was significantly larger than those in the control group (Fig. 4A, B). The plaque burden in both the aortic arch and the thoracic aorta was lowered by hBD3. Furthermore, hBD3 significantly decreased the plaque size at the aortic sinus in P. gingivalis LPS-treated mice (Fig. 4C, D). Immunostaining of sections for CD68 expression showed a larger CD68-positive area and more advance plaque formation in mice treated with P. gingivalis LPS than those treated with hBD3 ± P. gingivalis LPS and those in the control groups. Masson Trichrome staining was performed to identify the continuity and morphology of the elastic lamina, as well as the structure and orientation of smooth muscle cells (SMCs). In the control groups, the internal elastic lamina was continuous and distinct, and SMCs were arranged neatly along the tunica media layer. In contrast, the internal elastic
lamina in the aortic root of P. gingivalis LPS-treated mice became discontinuous and indistinct, the media layer turned thicker, with greater numbers of interspersed SMCs observed. In conclusion, hBD3 ameliorated the pathological changes in the aortic root of P. gingivalis LPS-treated mice (Fig. 5). 3.5. hBD3 downregulates the expression of inflammatory cytokine expression in macrophages rather than in vascular endothelial cells Macrophages and HUVECs were stimulated with P. gingivalis LPS without or with hBD3 to investigate the target cell population. Three hours after treatment, hBD3 significantly reduced the concentrations of TNF-α, IL-1β, and IL-6 in the culture supernatant of macrophages stimulated with P. gingivalis LPS. This trend turned more obvious after 6 h. However, hBD3 did not influence the TNF-α, IL-6, and IL-8 level in the culture supernatants of HUVECs stimulated with P. gingivalis LPS (Fig. 6). Furthermore, hBD3 downregulated the mRNA levels of TNF-α, IL-1β, IL-6, IL-8, VCAM-1, and IL-10 in macrophages stimulated with P. gingivalis LPS (Fig. 7). 3.6. Both the MAPK and NF-κB signaling pathways participates in the antiinflammatory effects of hBD3 Since both the NF-κB and MAPK signaling pathways play an important role in response to P. gingivalis LPS, we investigate the ability of hBD3 to suppress the P. gingivalis LPS-induced activation of the NF-κB and MAPK signaling pathways. Macrophages were stimulated for 30 min with 50 μg/mL of P. gingivalis LPS in the presence or absence of hBD3 (2 μg/mL or 10 μg/mL). Untreated cells or cells treated with hBD3 alone (2 μg/mL or 10 μg/mL) were used as controls. Levels of the following proteins were determined by Western blotting: phosphorylated p38, p38, phosphorylated JNK, JNK, phosphorylated Erk1/2, Erk1/ 2, phosphorylated IκB-alpha, phosphorylated NF-κB p65, and NF-κB p65. GAPDH was used as a loading control. We found that hBD3 (10 μg/mL) suppressed the P. gingivalis LPS-induced activation of the p38 and JNK pathways. The ERK1/2 pathway was not activated by P. gingivalis LPS (Fig. 8A).
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
211
Fig. 6. hBD3 decreased the concentrations of TNF-α, IL-1β, and IL-6 in the culture supernatants of macrophages but not HUVECs. Macrophages were stimulated with 5 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 3 h or 6 h. HUVECs were treated with 50 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 8 h. The concentrations of inflammatory cytokines in culture supernatants were measured using cytometric bead arrays. Results are expressed as means ± SD of three independent experiments. *P b 0.05.
When macrophages were treated with P. gingivalis LPS, less p65 and more phosphorylated p65 were detected in the cytoplasm, indicating an activation of the NF-κB signaling pathway. But when the P. gingivalis LPS-treated macrophages were given hBD3, more p65 and less phosphorylated p65 were detected in the cytoplasm. These results suggest that hBD3 inhibits the activation of NF-κB signaling pathway activated by P. gingivalis LPS (Fig. 8B).
4. Discussion Previous studies have yielded very limited evidence for the role of hBD3 in vessels. Human umbilical vein endothelial cells produce hBD3 in response to pro-inflammatory stimuli. Therefore, it has been suggested that hBD3 participates in the innate immune response of these cells [30]. In addition, most previous studies on the anti-inflammatory effect of hBD3 were performed in vitro.
Fig. 7. hBD3 downregulates the mRNA levels of pro-inflammatory markers in macrophages stimulated with P. gingivalis LPS. Cells were treated with 5 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 3 h. The mRNA levels of TNF-α, IL-1β, IL-6, IL-8, VCAM-1, and IL-10 in macrophages were quantified by quantitative PCR. Relative quantities of mRNAs were calculated using the ΔΔCt method and were normalized against GAPDH. Results are expressed as means ± SD. *P b 0.05.
212
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
Fig. 8. Both the MAPK and NF-κB signaling pathways participate in the anti-inflammatory effects of hBD3. Macrophages were stimulated with 50 μg/mL P. gingivalis LPS in the presence or absence of hBD3 (2 μg/mL or 10 μg/mL) for 30 min. Untreated cells or cells treated with hBD3 alone (2 μg/mL or 10 μg/mL) were used as controls. Protein levels of phosphorylated p38, p38, phosphorylated JNK, JNK, phosphorylated Erk1/2, Erk1/2 in whole cell extracts and phosphorylated IκB-alpha, phosphorylated NF-κB p65, and NF-κB p65 in the cytoplasm were determined by Western blotting. GAPDH was used as loading control.
In this study, we demonstrated that hBD3 suppresses the inflammatory response in the aortic wall of mice treated acutely with P. gingivalis LPS. Significant decreases in ICAM-1, IL-6, and MCP-1 expression in the aortic wall were observed at both mRNA and protein levels when the P. gingivalis LPS-treated mice were given hBD3. These findings substantiate an anti-inflammatory role of hBD3 in AS. Furthermore, we found that hBD3 significantly diminished the atherosclerotic lesion area in P. gingivalis LPS-treated mice. The atherosclerotic lesion in mice treated with hBD3 + P. gingivalis LPS were milder than those treated with P. gingivalis LPS, with less advanced plaque formation, more continuous and distinct elastic lamina, and much more normal SMCs arranged along the media elastic lamina. In this long term study, hBD3 alleviated IL-6 and MCP-1 expression in the aortic wall of P. gingivalis LPS-treated mice. Interestingly, IL-6 has been shown to play an important role in the progression of AS [40,41]. And MCP-1 has been shown to play key roles in foam cell formation, which is considered as the initiation of atherosclerosis [42]. Therefore, it can be speculated that hBD3 contributes greatly to the management of AS by downregulating the expression of IL-6 and MCP-1 in the aortic wall. Macrophages and vascular endothelial cells play critical roles in the initiation and development of AS. Therefore, we explored whether hBD3 exerts anti-inflammatory effects by targeting these cell types. We observed decreased inflammatory responses in macrophages stimulated by P. gingivalis LPS, whereas the innate immune responses were not altered in HUVECs treated with P. gingivalis LPS. These results suggest that hBD3 exerts anti-inflammatory effects by targeting macrophages rather than vascular endothelial cells. Next step, we investigated the signaling pathways that may mediate this effect. hBD3 has been shown to prevent TLR signaling and inhibit the activation of NF-κB pathway in macrophages [34]. Our observation on the NF-κB signaling pathway was consistent with this report. The proteins targeted by hBD3 were speculated to be shared by the MyD88 and TRIF pathways. MyD88 is also involved in the activation of MAPK signaling pathways, which can be activated by LPS and play an important role in inflammatory disorders. Therefore, we investigated whether hBD3 could suppress the P. gingivalis LPS-induced activation of MAPK signaling pathways. We found that the P. gingivalis LPS-induced activation of both the p38 pathway and the JNK pathway were inhibited by hBD3 (10 μg/mL). While we also observed that the p38 MAPK pathway was activated by 10 μg/mL of hBD3 alone, which is consistent with the former hypothesis that high concentrations of hBD3 exert pro-inflammatory effects to eliminate pathogens [34,43]. Our findings provide an initial insight into the effects of hBD3 on the progression of AS aggravated by P. gingivalis LPS. Downregulation of
inflammatory cytokines in macrophages is pivotal in this protective effect of hBD3. Although hBD3 did not decrease the expression of inflammatory cytokines in vascular endothelial cells, we cannot rule out the possibility that hBD3 protects the function of vascular endothelial cells in some other way. Recently, a novel effect of hBD3 was discovered in a study demonstrating that hBD3 enhanced the barrier function of skin by regulating the content of tight-junction proteins. [44]. Tightjunction proteins are cell-cell junctions which form the major barrier controlling the paracellular movement of water, ions, and solutes across epithelial cell sheets [45]. Tight junctions also exist widely in the vascular endothelium and their destruction results in decreased endothelial barrier function, which is associated with abnormal vascular permeability and the onset and progression of AS [46,47]. Further investigations are still required to confirm the ability of hBD3 to protect the vascular endothelium in similar ways. It is worth noting that hBD3 has a broad spectrum of antimicrobial activity. Thus, in addition to the anti-inflammatory properties discussed here, hBD3 may also protect the periodontal and cardiovascular tissue via these antimicrobial properties. Therefore, these dual effect of antiinflammatory and antimicrobial properties indicate the potential of hBD3 in a new strategy for the management of AS.
Acknowledgements This study was supported by the National Natural Science Foundation project (No. 81371152), the Key Project of Science and Technology Bureau of Jiangsu Province (No. BL2013002), the “Six Talent Peaks” of High Level Talent Selection and Training Project of Jiangsu Province (No. 2013-SWYY-006), and the Natural Science Foundation of Jiangsu Province (No. BK20131079). We thank Junhua Wu, Yibing Ding, Mei Zheng, and Yue Dai from Translational Medicine Core Facilities, Medical School of Nanjing University for their kindness on machine access and instruction.
References [1] M.A. Saffi, M.V. Furtado, C.A. Polanczyk, M.M. Montenegro, I.W. Ribeiro, C. Kampits, A.N. Haas, C.K. Rosing, E.R. Rabelo-Silva, Relationship between vascular endothelium and periodontal disease in atherosclerotic lesions: review article, World J. Cardiol. 7 (1) (2015) 26–30. [2] C.M. Ardila, A.Y. Perez-Valencia, W.L. Rendon-Osorio, Tannerella forsythia is associated with increased levels of atherogenic low density lipoprotein and total cholesterol in chronic periodontitis, J. Clin. Exp. Dent. 7 (2) (2015) e254–e260. [3] B. Soder, J.H. Meurman, P.O. Soder, Gingival inflammation associates with stroke - a role for oral health personnel in prevention: a database study, PLoS One 10 (9) (2015) e0137142.
L. Li et al. / International Immunopharmacology 38 (2016) 204–213 [4] M. Szulc, W. Kustrzycki, D. Janczak, D. Michalowska, D. Baczynska, M. RadwanOczko, Presence of periodontopathic bacteria DNA in atheromatous plaques from coronary and carotid arteries, Biomed. Res. Int. 2015 (2015) 825397. [5] C. Kudo, W.S. Shin, M. Minabe, K. Harai, K. Kato, H. Seino, E. Goke, N. Sasaki, T. Fujino, N. Kuribayashi, Y.O. Pearce, M. Taira, H. Maeda, S. Takashiba, Analysis of the relationship between periodontal disease and atherosclerosis within a local clinical system: a cross-sectional observational pilot study, Odontology 103 (3) (2015) 314–321. [6] S. Kiechl, G. Egger, M. Mayr, C.J. Wiedermann, E. Bonora, F. Oberhollenzer, M. Muggeo, Q. Xu, G. Wick, W. Poewe, J. Willeit, Chronic infections and the risk of carotid atherosclerosis: prospective results from a large population study, Circulation 103 (8) (2001) 1064–1070. [7] W. Huang, L. Zhao, Y. Jia, J.J. Chen, Y.F. Wu, Effect of Porphyromonas gingivalis lipopolysaccharide on the expression of CC chemokine receptor 2 in monocytes, Zhonghua Kou Qiang Yi Xue Za Zhi 48 (7) (2013) 393–397. [8] J.M. Gitlin, C.D. Loftin, Cyclooxygenase-2 inhibition increases lipopolysaccharide-induced atherosclerosis in mice, Cardiovasc. Res. 81 (2) (2009) 400–407. [9] N. Nakamura, M. Yoshida, M. Umeda, Y. Huang, S. Kitajima, Y. Inoue, I. Ishikawa, T. Iwai, Extended exposure of lipopolysaccharide fraction from Porphyromonas gingivalis facilitates mononuclear cell adhesion to vascular endothelium via Toll-like receptor-2 dependent mechanism, Atherosclerosis 196 (1) (2008) 59–67. [10] M. Triantafilou, F.G. Gamper, P.M. Lepper, M.A. Mouratis, C. Schumann, E. Harokopakis, R.E. Schifferle, G. Hajishengallis, K. Triantafilou, Lipopolysaccharides from atherosclerosis-associated bacteria antagonize TLR4, induce formation of TLR2/1/CD36 complexes in lipid rafts and trigger TLR2-induced inflammatory responses in human vascular endothelial cells, Cell. Microbiol. 9 (8) (2007) 2030–2039. [11] O. Andrukhov, I. Steiner, S. Liu, H.P. Bantleon, A. Moritz, X. Rausch-Fan, Different effects of Porphyromonas gingivalis lipopolysaccharide and TLR2 agonist Pam3CSK4 on the adhesion molecules expression in endothelial cells, Odontology 103 (1) (2015) 19–26. [12] L. Lei, H. Li, F. Yan, Y. Li, Y. Xiao, Porphyromonas gingivalis lipopolysaccharide alters atherosclerotic-related gene expression in oxidized low-density-lipoprotein-induced macrophages and foam cells, J. Periodontal Res. 46 (4) (2011) 427–437. [13] P.J. Pussinen, K. Mattila, Periodontal infections and atherosclerosis: mere associations? Curr. Opin. Lipidol. 15 (5) (2004) 583–588. [14] M. Qi, H. Miyakawa, H.K. Kuramitsu, Porphyromonas gingivalis induces murine macrophage foam cell formation, Microb. Pathog. 35 (6) (2003) 259–267. [15] H.K. Kuramitsu, I.C. Kang, M. Qi, Interactions of Porphyromonas gingivalis with host cells: implications for cardiovascular diseases, J. Periodontol. 74 (1) (2003) 85–89. [16] H.K. Kuramitsu, M. Qi, I.C. Kang, W. Chen, Role for periodontal bacteria in cardiovascular diseases, Ann. Periodontol. 6 (1) (2001) 41–47. [17] R. Ross, Atherosclerosis–an inflammatory disease, N. Engl. J. Med. 340 (2) (1999) 115–126. [18] H. Ait-Oufella, S. Taleb, Z. Mallat, A. Tedgui, Recent advances on the role of cytokines in atherosclerosis, Arterioscler. Thromb. Vasc. Biol. 31 (5) (2011) 969–979. [19] A.E. Moran, G.A. Roth, J. Narula, G.A. Mensah, 1990–2010 global cardiovascular disease atlas, Glob. Health 9 (1) (2014) 3–16. [20] C. Tie, K. Gao, N. Zhang, S. Zhang, J. Shen, X. Xie, J.A. Wang, Ezetimibe attenuates atherosclerosis associated with lipid reduction and inflammation inhibition, PLoS One 10 (11) (2015) e0142430. [21] M. Back, G.K. Hansson, Anti-inflammatory therapies for atherosclerosis, Nat. Rev. Cardiol. 12 (4) (2015) 199–211. [22] I.F. Charo, R. Taub, Anti-inflammatory therapeutics for the treatment of atherosclerosis, Nat. Rev. Drug Discov. 10 (5) (2011) 365–376. [23] S.L. Verweij, F.M. van der Valk, E.S. Stroes, Novel directions in inflammation as a therapeutic target in atherosclerosis, Curr. Opin. Lipidol. 26 (6) (2015) 580–585. [24] R. Khan, V. Spagnoli, J.C. Tardif, P.L. L'Allier, Novel anti-inflammatory therapies for the treatment of atherosclerosis, Atherosclerosis 240 (2) (2015) 497–509. [25] J. Rohrl, D. Yang, J.J. Oppenheim, T. Hehlgans, Human beta-defensin 2 and 3 and their mouse orthologs induce chemotaxis through interaction with CCR2, J. Immunol. 184 (12) (2010) 6688–6694. [26] Y. Lai, R.L. Gallo, AMPed up immunity: how antimicrobial peptides have multiple roles in immune defense, Trends Immunol. 30 (3) (2009) 131–141. [27] P.H. Warnke, I.N. Springer, P.A. Russo, J. Wiltfang, H. Essig, M. Kosmahl, E. Sherry, Y. Acil, Innate immunity in human bone, Bone 38 (3) (2006) 400–408. [28] J. Harder, J. Bartels, E. Christophers, J.M. Schroder, Isolation and characterization of human beta-defensin-3, a novel human inducible peptide antibiotic, J. Biol. Chem. 276 (8) (2001) 5707–5713.
213
[29] J.R. Garcia, F. Jaumann, S. Schulz, A. Krause, J. Rodriguez-Jimenez, U. Forssmann, K. Adermann, E. Kluver, C. Vogelmeier, D. Becker, R. Hedrich, W.G. Forssmann, R. Bals, Identification of a novel, multifunctional beta-defensin (human beta-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction, Cell Tissue Res. 306 (2) (2001) 257–264. [30] C. Burgey, W.V. Kern, W. Romer, T. Sakinc, S. Rieg, The innate defense antimicrobial peptides hBD3 and RNase7 are induced in human umbilical vein endothelial cells by classical inflammatory cytokines but not Th17 cytokines, Microbes Infect. 17 (5) (2015) 353–359. [31] R. Tao, R.J. Jurevic, K.K. Coulton, M.T. Tsutsui, M.C. Roberts, J.R. Kimball, N. Wells, J. Berndt, B.A. Dale, Salivary antimicrobial peptide expression and dental caries experience in children, Antimicrob. Agents Chemother. 49 (9) (2005) 3883–3888. [32] B.A. Dale, R. Tao, J.R. Kimball, R.J. Jurevic, Oral antimicrobial peptides and biological control of caries, BMC Oral Health 6 (Suppl. 1) (2006) S13. [33] F. Semple, S. Webb, H.N. Li, H.B. Patel, M. Perretti, I.J. Jackson, M. Gray, D.J. Davidson, J.R. Dorin, Human beta-defensin 3 has immunosuppressive activity in vitro and in vivo, Eur. J. Immunol. 40 (4) (2010) 1073–1078. [34] F. Semple, H. MacPherson, S. Webb, S.L. Cox, L.J. Mallin, C. Tyrrell, G.R. Grimes, C.A. Semple, M.A. Nix, G.L. Millhauser, J.R. Dorin, Human beta-defensin 3 affects the activity of pro-inflammatory pathways associated with MyD88 and TRIF, Eur. J. Immunol. 41 (11) (2011) 3291–3300. [35] L.C. Pingel, K.G. Kohlgraf, C.J. Hansen, C.G. Eastman, D.E. Dietrich, K.K. Burnell, R.N. Srikantha, X. Xiao, M. Belanger, A. Progulske-Fox, J.E. Cavanaugh, J.M. Guthmiller, G.K. Johnson, S. Joly, Z.B. Kurago, D.V. Dawson, K.A. Brogden, Human beta-defensin 3 binds to hemagglutinin B (rHagB), a non-fimbrial adhesin from Porphyromonas gingivalis, and attenuates a pro-inflammatory cytokine response, Immunol. Cell Biol. 86 (8) (2008) 643–649. [36] S.H. Lee, D.H. Baek, Antibacterial and neutralizing effect of human beta-defensins on Enterococcus faecalis and Enterococcus faecalis lipoteichoic acid, J. Endod. 38 (3) (2012) 351–356. [37] S. Pan, L. Lei, S. Chen, H. Li, F. Yan, Rosiglitazone impedes Porphyromonas gingivalisaccelerated atherosclerosis by downregulating the TLR/NF-kappaB signaling pathway in atherosclerotic mice, Int. Immunopharmacol. 23 (2) (2014) 701–708. [38] M. Madan, B. Bishayi, M. Hoge, E. Messas, S. Amar, Doxycycline affects diet- and bacteria-associated atherosclerosis in an ApoE heterozygote murine model: cytokine profiling implications, Atherosclerosis 190 (1) (2007) 62–72. [39] P. Nigro, K. Satoh, M.R. O'Dell, N.N. Soe, Z. Cui, A. Mohan, J. Abe, J.D. Alexis, J.D. Sparks, B.C. Berk, Cyclophilin A is an inflammatory mediator that promotes atherosclerosis in apolipoprotein E-deficient mice, J. Exp. Med. 208 (1) (2011) 53–66. [40] J. Hartman, W.H. Frishman, Inflammation and atherosclerosis: a review of the role of interleukin-6 in the development of atherosclerosis and the potential for targeted drug therapy, Cardiol. Rev. 22 (3) (2014) 147–151. [41] J. Scheller, C. Garbers, S. Rose-John, Interleukin-6: from basic biology to selective blockade of pro-inflammatory activities, Semin. Immunol. 26 (1) (2014) 2–12. [42] M.J. Littlefield, E. Belilos, S.E. Carsons, A.B. Reiss, W. Dong, X. Wang, S. Bi, Z. Pan, S. Liu, H. Yu, H. Lu, X. Lin, X. Wang, T. Ma, W. Zhang, Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins, Biomed. Res. Int. 33 (5) (2014) 1161–1168. [43] L.E. Harvey, K.G. Kohlgraf, L.A. Mehalick, M. Raina, E.N. Recker, S. Radhakrishnan, S.A. Prasad, R. Vidva, A. Progulske-Fox, J.E. Cavanaugh, S. Vali, K.A. Brogden, Defensin DEFB103 bidirectionally regulates chemokine and cytokine responses to a pro-inflammatory stimulus, Sci. Rep. 3 (2013) 1232. [44] C. Kiatsurayanon, F. Niyonsaba, R. Smithrithee, T. Akiyama, H. Ushio, M. Hara, K. Okumura, S. Ikeda, H. Ogawa, Host defense (antimicrobial) peptide, human betadefensin-3, improves the function of the epithelial tight-junction barrier in human keratinocytes, J. Investig. Dermatol. 134 (8) (2014) 2163–2173. [45] N. Kirschner, R. Rosenthal, M. Furuse, I. Moll, M. Fromm, J.M. Brandner, Contribution of tight junction proteins to ion, macromolecule, and water barrier in keratinocytes, J. Investig. Dermatol. 133 (5) (2013) 1161–1169. [46] V.J. Krouwer, L.H. Hekking, M. Langelaar-Makkinje, E. Regan-Klapisz, J.A. Post, Endothelial cell senescence is associated with disrupted cell-cell junctions and increased monolayer permeability, Vasc. Cell 4 (1) (2012) 12. [47] C. Bian, G. Xu, J. Wang, J. Ma, M. Xiang, P. Chen, Hypercholesterolaemic serum increases the permeability of endothelial cells through zonula occludens-1 with phosphatidylinositol 3-kinase signaling pathway, J. Biomed. Biotechnol. 2009 (2009) 814979.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Human β-defensin-3 alleviates the progression of atherosclerosis accelerated by Porphyromonas gingivalis lipopolysaccharide Lili Li a,b, Tianying Bian a,b, Jinglu Lyu a,b, Di Cui a,b, Lang Lei a,c, Fuhua Yan a,b,⁎ a b c
Department of Periodontology, Nangjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, Jiangsu, China Central Laboratory of Stomatology, Nangjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, Jiangsu, China Department of Orthodontics, Nangjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, Jiangsu, China
a r t i c l e
i n f o
Article history: Received 19 December 2015 Received in revised form 1 June 2016 Accepted 2 June 2016 Available online xxxx Keywords: Human β-defensin-3 Atherosclerosis Porphyromonas gingivalis Lipopolysaccharide Periodontitis
a b s t r a c t Background and aim: Porphyromonas gingivalis (P. gingivalis) lipopolysaccharide (LPS) is reported to be associated with the progression of atherosclerosis (AS). In this study, we explored the potential of human β-defensin-3 (hBD3), an antimicrobial peptide with immunomodulatory properties, to alleviate AS progression accelerated by P. gingivalis LPS and the mechanism underlying this effect. Materials and methods: Apolipoprotein E-deficient mice were injected intraperitoneally with hBD3, P. gingivalis LPS, or hBD3 + P. gingivalis LPS. The aorta was assessed immunohistologically and mRNA levels of inflammatory cytokines were determined by quantitative PCR. Macrophages and vascular endothelial cells were stimulated in vitro to investigate the hBD3 target cells. Inflammatory cytokines in serum and cell culture supernatants were detected using cytometric bead arrays. Signaling pathways were investigated by Western blotting. Results: In P. gingivalis LPS-treated mice, hBD3 significantly reduced serum IL-6 and TNF-α levels and aortic expression of ICAM-1, IL-6, and MCP-1 (mRNA and protein). The area and severity of atherosclerotic lesions were also diminished, with less advanced plaque formation, more continuous and distinct elastic lamina, and more normal smooth muscle cells arranged along the tunica media layer. In vitro, hBD3 decreased TNF-α, IL-1β, IL-6 secretion and downregulated TNF-α, IL-1β, IL-6, IL-8, VCAM-1, and IL-10 mRNA levels in macrophages. hBD3 did not influence TNF-α, IL-6, and IL-8 levels in HUVECs culture supernatants. Furthermore, hBD3 suppressed P. gingivalis LPS-induced activation of the NF-κB, p38 and JNK pathways. Conclusion: hBD3 alleviates AS progression accelerated by P. gingivalis LPS in apolipoprotein E-deficient mice by downregulating the cytokine expression in macrophages via the MAPK and NF-κB signaling pathways. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Porphyromonas gingivalis (P. gingivalis) is a major pathogen involved in the pathogenesis of periodontitis, which is a chronic inflammatory disease with a high incidence. P. gingivalis lipopolysaccharide (LPS) in periodontal lesion may invade into bloodstream and impact the systemic conditions negatively. Efforts have been made to understand the association between periodontal disease and systemic condition including atherosclerosis (AS), which remains a hot topic [1–5]. Evidence has been provided that elevated serum level of P. gingivalis LPS is associated with the progression of AS [6,7]. Long-term exposure to P. gingivalis LPS promotes the formation of AS plaque in Apolipoprotein E-deficient (ApoE −/−) mice [8]. P. gingivalis LPS augments the production of pro-inflammatory cytokines and facilitates monocyte adhesion to vascular endothelial cells, which are the initial events of AS [9–11]. In addition, many studies demonstrate that P. gingivalis LPS promotes ⁎ Corresponding author at: 30 Zhongyang Road, Nanjing, Jiangsu 210008, China. E-mail address: [email protected] (F. Yan).
http://dx.doi.org/10.1016/j.intimp.2016.06.003 1567-5769/© 2016 Elsevier B.V. All rights reserved.
macrophages transformation to foam cells. The expression of pro-inflammatory cytokines, growth factors, and adhesion molecules in macrophages is upregulated by P. gingivalis LPS [12–16]. Collectively, these findings indicate that P. gingivalis LPS from periodontal lesions may contribute to the development of AS. Essentially, AS is a chronic inflammatory disease of the arterial wall with inflammation implicated in every stage of its progression [17,18]. Currently, treatment of AS depends predominantly on lipid-lowering drugs. Despite various therapies targeting serum lipoprotein levels, AS remains to be the most significant cause of death in the industrialized world [19]. As the fundamental role of inflammation in AS has been characterized, more and more attention has been paid to anti-inflammation therapy [20–23]. Agents targeting chronic systemic inflammatory conditions have shown promise in the treatment of AS both experimentally and clinically [24]. Human β-defensins (hBDs) are small, cationic host defense peptides with immunomodulatory properties and chemoattractant activity for human monocytes, lymphocytes and DCs, suggesting that they contribute to the link between innate and adaptive immunity [25,26]. Human
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
β-defensin-3 (hBD3) exerts diverse innate immune activities and is considered to be the most promising of its class in preventing inflammatory disease [27,28]. hBD3 is widely expressed in many tissues including oral and vascular epithelium, where it participates in inflammation and the initiation of innate immune responses [29–32]. Many studies have shown that hBD3 suppresses the inflammatory effect caused by Escherichia coli lipopolysaccharide (LPS) in vitro and in vivo [33–35]. In addition, hBD3 exerts anti-inflammatory effect against Enterococcus faecalis to induce TNF-α, IL-8, and ICAM-1 expression in human monocytic cell line, THP-1 [36]. Based on the anti-inflammatory effect and antimicrobial property of hBD3, we hypothesized that hBD3 may play a role in the development of AS. However, very limited evidence regarding the effect of hBD3 on AS is currently available. In this study, we demonstrated that P. gingivalis LPS accelerates the progression of AS in ApoE −/− mice. And hBD3 alleviates these unfavorable effects by downregulating the expression of pro-inflammatory cytokine expression. Furthermore, target cells and related signaling pathways were investigated in vitro to elucidate the underlying mechanism of the anti-inflammatory effects of hBD3. Our results demonstrated that hBD3 downregulates inflammatory cytokine expression in macrophages rather than vascular endothelial cells. Both the mitogenactivated protein kinase (MAPK) and NF-κB signaling pathways participate in the anti-inflammatory effects of hBD3. Based on these observations, we speculated that hBD3 alleviates the progression of AS accelerated by P. gingivalis LPS from periodontal lesions.
205
approximately 100 μg/mouse) or hBD3 + P. gingivalis LPS. Mice were euthanized 2 h later. Based on the observation of the anti-inflammatory effect of hBD3, we conducted a long term experiment to investigate the role of hBD3 in AS. Forty randomly selected mice were divided into four groups and injected intraperitoneally with sterile phosphate-buffered saline, hBD3 solution (0.1 mg/kg, approximately 2 μg/mouse), P. gingivalis LPS (0.5 mg/kg, approximately 10 μg/mouse), or hBD3 + P. gingivalis LPS. Treatments were administered three times per week. Mice were fed a high-fat diet containing 10% lard, 4% milk powder, 2% cholesterol and 0.5% sodium cholate. Eight weeks later, the mice were euthanized and atherosclerotic plaques were observed. 2.3. Tissue harvesting and preparation Blood was collected immediately after the mice were anesthetized by overdose of isoflurane and euthanized. Then they were dissected and perfused with 10 mL PBS via the left ventricle, followed by 10 mL of 4% phosphate-buffered paraformaldehyde phosphate. The aortic trees (from the aortic valve to the iliac bifurcation) were carefully dissected. Five of them in each group were preserved in 4% buffered paraformaldehyde phosphate and processed for en face morphometric analysis [37,38]. The other five were homogenized using a TissueLyser (Shanghai JingXin) at 65 Hz for 90 s in TRIzol (Sigma, MO, USA) and stored at −80 °C until further processing for quantitative PCR. The proximal aortas together with hearts of all mice were fixed in 4% phosphatebuffered paraformaldehyde.
2. Materials and methods 2.4. Atherosclerotic plaque assessment 2.1. Reagents and instruments used Ultrapure P. gingivalis LPS was purchased from Invivogen (Carlsbad, CA, USA). Recombinant human BD-3 was purchased from PEPROTECH (Rocky Hill, NJ, USA). Phosphate-buffered saline solution was purchased from Hyclone (Logan, UT, USA). BD Cytometric Bead Array Human Inflammatory Cytokines Kits and the Mouse Enhanced Sensitivity Flex Set of TNF and IL-6 were purchased from BD Biosciences. Anti-CD68 antibody and anti-MCP-1 antibody were from Wuhan Boster Biological Technology (Wuhan, China). Anti-ICAM-1 antibody, anti-IL-6 antibody, and anti-VCAM-1 antibody were from ProteinTech Group (Chicago, IL, USA). The following antibodies were purchased from Cell signaling (Cell Signaling Technology, MA, USA): anti-p44/42 MAPK (Erk1/2) antibody (catalog number 4695), anti-phosphorylated p44/42 MAPK (Erk1/ 2) antibody (catalog number 4370), anti-p38 MAPK antibody (catalog number 8690), anti-phosphorylated p38 MAPK antibody (catalog number 4511), anti-SAPK/JNK antibody (catalog number 9252), anti-phosphorylated JNK antibody (catalog number 4668), anti-phosphorylated IkappaB-alpha antibody (catalog number 2859), anti-phosphorylated NF-κB p65 antibody (catalog number 3033), and anti-NF-κB p65 antibody (catalog number 8242). The anti-GAPDH antibody was obtained from Bioworld (Nanjing, China). 2.2. ApoE−/− mice Nine-week-old male ApoE−/− mice on a C57BL/6 background were purchased from the Department of Laboratory Animal Science, Beijing University (Beijing, China). The mice were maintained in a specific pathogen-free facility on a 12 h light: 12 h dark cycle at 25 °C. Throughout the treatment period, body weight and food intake were monitored at weekly intervals. All surgery on animals was performed in accordance with the Animal Ethics Committee of Nanjing University (China). Firstly, we explored the role of hBD3 in the acute inflammatory response caused by P. gingivalis LPS. Twenty-four randomly selected mice were divided into four groups (n = 6 per group) and injected intraperitoneally with sterile phosphate-buffered saline, hBD3 (0.5 mg/ kg, approximately 10 μg/mouse), P. gingivalis LPS (5 mg/kg,
The extent of aortic atherosclerotic lesions was analyzed by en face staining with Oil red O, as previously described [39]. Briefly, the aortic tissue of each mouse (n = 5 mice per group) was harvested from the aortic valve to the iliac bifurcation. All adventitial fat and connective tissue were carefully removed. The aorta was then opened longitudinally, followed by fixation overnight in 4% paraformaldehyde. The next day, the aorta was rinsed with 5 mL of 60% isopropanol and pinned out to black wax simultaneously to reveal the entire luminal surface area. Then the aorta was stained in 5 mL of filtered 60% Oil Red O solution (Sigma, MO, USA) for 15 min at 57 °C, followed by rinsing with 60% isopropanol for 5 min. Finally, the aorta was submerged in PBS and photographed. Photographs were obtained using a digital camera (Canon EOS 650D) with a macro lens (EF 100 mm f/2.8L Macro IS USM). The lesion area was selected using Photoshop 8.0 (Adobe) software and quantified using Image-Pro Plus 6.0 (Media Cybernetics) software. 2.5. Histology and immunohistochemistry of the aortic sinus After fixation in 4% phosphate-buffered paraformaldehyde phosphate for 48 h, five samples in each group were embedded in optimal cutting temperature compound (OTC; Sakura Finetek, Beijing, China). Serial cryosections (8 mm thick) of the aortic sinus were cut and 4–6 sections from each sample were selected for Oil Red O staining to detect lipids in the plaque. The other samples in each group were embedded in paraffin. Sections (5 μm thick) were prepared and stained with hematoxylin and eosin (HE) or Masson Trichrome or used for immunostaining. Immunohistochemical staining was performed to determine the expression levels of several inflammatory markers in the aortic root. Briefly, sections were deparaffinized and rehydrated before antigen retrieval using EDTA buffer (pH 9.0). The sections were incubated with H2O2 (0.3%) for 25 min at room temperature and protected from light to block endogenous peroxidase activity. Then the sections were blocked with 3% bovine serum albumin for 30 min at room temperature to prevent non-specific binding. Subsequently, the sections were incubated
206
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
Table 1 Primers used in quantitative PCR for aortic wall of ApoE−/− mouse. Gene
Forward primer (5′–3′)
Reverse primer (5′–3′)
IL-6 MCP-1 ICAM-1 GAPDH
CTGCAAGAGACTTCCATCCAG ACTCACCTGCTGCTACTCATTC GTCCGCTGTGCTTTGAGAAC ATCACTGCCACCCAGAAG
AGTGGTATAGACAGGTCTGTTGG TGTCTGGACCCATTCCTTCTTG GTGAGGTCCTTGCCTACTTG TCCACGACGGACACATTG
dehydrated and mounted. The primary antibody was replaced with PBS in negative controls. Micrographs were obtained using an OLYMPUS BX51 microscope (Olympus Co., Tokyo, Japan) and an Olympus DP camera (magnification: 40–200 ×). Quantitative analysis was performed using the Image-Pro Plus 6.0 (Media Cybernetics).
2.6. Cell culture
Table 2 Primers used in quantitative PCR for human cells. Gene
Forward primer (5′–3′)
Reverse primer (5′–3′)
TNF-α IL-1β IL-6 IL-8 VCAM-1 IL-10 GAPDH
GGAGGGGTCTTCCAGCTGGAGA TTCCTGTTGTCTACACCAATGC AACAACCTGAACCTTCCAAAGA AGACATACTCCAAACCTTTCCACC GCAAGGTTCCTAGCGTGTAC TCCTTGCTGGAGGACTTTAAGGGT AGAACATCATCCCTGCCTCTACT
CAATGATCCCAAAGTAGACCTGC CGGGCTTTAAGTGAGTAGGAGA TCAAACTCCAAAAGACCAGTGA ACAACCCTCTGCACCCAGTT GGCTCAAGCTGTCATATTCAC TGTCTGGGTCTTGGTTCTCAGCTT GATGTCATCATATTTGGCAGGTT
overnight at 4 °C with different primary antibodies specific for intercellular adhesion molecule-1 (ICAM-1), monocyte chemoattractant protein-1 (MCP-1), IL-6, and vascular cell adhesion molecule-1 (VCAM-1) at dilutions recommended by the manufacturers. The sections were then washed and incubated with appropriate horseradish peroxidaseconjugated secondary antibodies for 1 h at room temperature. Immunoreactivity was evaluated using DAB (3,3′-diaminobenzidine) as a chromogenic substrate, which was monitored under an optical microscope. The sections were then counterstained with hematoxylin,
The human acute monocytic leukemia cell line, THP-1, was purchased from the Cell Bank of the Chinese Academic of Sciences (Shanghai, China) and cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (HyClone) and 1% antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin, HyClone). The human umbilical vein endothelial cell line, HUVEC, obtained from ScienCell (San Diego, CA, USA) were cultured in endothelial cell medium (ECM, ScienCell, USA) supplemented with 5% fetal bovine serum (FBS, 0025, ScienCell, USA), 1% endothelial cell growth supplement (ECGS, 1052, ScienCell, USA) and 1% antibiotics (0503, ScienCell, USA). All cells were maintained in a standard atmosphere containing humidified 5% CO2 at 37 ° C. The medium was changed every 2 to 3 days. Macrophages were stimulated with 5 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 3 h or 6 h. HUVECs were treated with 50 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 8 h. The concentrations of inflammatory cytokines in culture supernatants were measured using cytometric bead arrays and the mRNA levels of inflammatory cytokines in cells were measured by quantitative PCR.
Fig. 1. hBD3 decreased serum inflammatory markers in acute and chronic inflammatory responses to P. gingivalis LPS. Serum was collected 2 h after one dose of P. gingivalis LPS (A) or after 3 doses per week for consecutive 8 weeks (B) administered to ApoE−/− mice. Serum TNF-α and IL-6 were detected by cytometric bead arrays. Results are expressed as means ± SD (10 mice/group). *P b 0.05.
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
207
Fig. 2. hBD3 suppressed pro-inflammatory cytokine expression in the aorta of P. gingivalis LPS-treated ApoE−/− mice. Mice were treated with PBS, P. gingivalis LPS, hBD3 or hBD3 + P. gingivalis LPS for 2 h. (A) The mRNA levels of ICAM-1, MCP-1 and IL-6 were quantified by quantitative PCR. Relative quantities of mRNAs were calculated using the ΔΔCt method and were normalized against GAPDH. (B) Representative photographs of ICAM-1, MCP-1 and IL-6 immunostaining (200×). Results are expressed as means ± SD (n = 4–5 mice/group). *P b 0.05.
2.7. Cytokine measurement in serum and cell culture supernatant Cytometric bead arrays (CBA, BD Biosciences) were used according to the manufacturer to measure serum levels of IL-6 and TNF-α, as well as IL-8, IL-1β, IL-6, IL-10, TNF, and IL-12p70 in cell supernatant. Samples (50 μL) were assayed against a 10-point standard curve (0.274–200 pg/mL for serum and 20–5000 pg/mL for culture supernatant) for each cytokine measured using a BD FACSCalibur (BD Bioscience). FCAP Array software (BD version 3.1) was used to create the standard curves for each cytokine and convert the mean fluorescence intensity (MFI) values into cytokine concentrations. 2.8. Quantitative PCR Total RNA was isolated from cell lines and aortic tissue using TRIzol reagent (Invitrogen). The concentration and quality of RNA was assessed using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Middlesex, MA, USA). Reverse transcription was performed using the SuperScript VILO cDNA Synthesis Kit (Invitrogen) according to the manufacturer's instructions. Quantitative PCR of mRNA was performed with gene specific primer pairs using the SYBR® Select Master Mix (Applied Biosystems) according to the manufacturer's instructions.
Quantitative PCR was performed on the ViiA™ 7 Real-Time PCR System. Primer sequences are shown in Table 1 and Table 2. The relative expression of mRNA was obtained using the ΔΔCt method and was normalized to GAPDH.
2.9. Western blot Macrophages were stimulated with 50 μg/mL P. gingivalis LPS in the presence or absence of hBD3 (2 μg/mL or 10 μg/mL) for 30 min. Cells were washed twice with ice-cold PBS, and then lysed using cell lysis buffer (catalog number P0013K, Beyotime, China) containing protease inhibitor cocktail set III (1:200, Calbiochem, USA) and phosphatase inhibitor cocktail set II (1:100, Calbiochem, USA) to extract total protein in cells. The lysate was collected and then centrifuged at 12,000 × g for 5 min at 4 °C. The remaining cell lysate was prepared in 5 × SDS loading buffer. Cytoplasmic protein was extracted using the Nuclear and Cytoplasmic Protein Extraction Kit (Keygetec, China) according to the manual instruction. Briefly, 5 × 106 cells were collected with a cell scraper and washed twice with ice-cold PBS (4 °C, 500 × g, 3 min). Then the supernatant was removed carefully and 75 μL ice-cold Buffer A was added to the sediment. After a 15 second vortex, the lysis system was placed on ice.
208
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
Fig. 3. hBD3 suppressed the expression of pro-inflammatory markers in the aorta of ApoE−/− mice stimulated with P. gingivalis LPS. Mice were treated with PBS, P. gingivalis LPS, hBD3 or P. gingivalis LPS + hBD3 for eight consecutive weeks. (A) The mRNA levels of ICAM-1, MCP-1 and IL-6 were quantified by quantitative PCR. Relative quantities of mRNAs were calculated using the ΔΔCt method and were normalized against GAPDH. (B) Representative photographs of ICAM-1, MCP-1 and IL-6 immunostaining (200 ×). Results are expressed as means ± SD (n = 4–5 mice/group). *P b 0.05.
Ten minutes later, 11 μL ice-cold Buffer B was added to the lysis system, followed by a 5 second vortex. Then the lysis system was put on ice for 1 min. After a 5 second vortex, centrifugation was done at 16,000 × g for 5 min at 4 °C. The supernatant, which contain cytoplasmic protein, was carefully pipetted to a new Eppendorf tube. Then the cytoplasmic protein was prepared in 5 × SDS loading buffer. Equal amounts of protein were separated by SDS-PAGE (4%–12% gel; GenScript, Jiangsu, China) and then transferred to the PVDF membrane. After blocking in 5% BSA, the membrane was incubated with the following antibodies: anti-ERK1/2 antibody, anti-phosphorylated ERK1/2 antibody, anti-p38 MAPK antibody, anti-phosphorylated p38 MAPK antibody, anti-SAPK/JNK antibody, anti-phosphorylated JNK antibody, anti-phosphorylated IκB-α antibody, anti-phosphorylated NF-κB p65 antibody, and anti-NF-κB p65 antibody (all 1:1000) or anti-GAPDH antibody (1:5000) overnight at 4 °C. The blots were then washed and
incubated with the appropriate HRP-conjugated secondary antibody (Bioworld, Nanjing, China) for 2 h at room temperature. After washing, immunoreactivity was visualized with an ImageQuant LAS 4000 mini System (GE Healthcare, Piscataway, NJ). Each experiment was performed three times.
2.10. Statistical analysis Data were statistically analyzed using GraphPad Prism version 5.0 (GraphPad Software Inc., La Jolla, CA, USA). All results are presented as mean ± standard deviation (SD) (n = 4–6 mice/group). Significant differences in mean values among the groups were determined by oneway ANOVA and Student–Newman–Keuls tests. P b 0.05 was considered to indicate statistical significance.
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
209
Fig. 4. hBD3 attenuated P. gingivalis LPS-accelerated atherosclerotic plaque formation in ApoE−/−mice. Mice received three doses of LPS per week for 8 consecutive weeks. (A) Representative photographs of en face Oil Red O-stained aortas of different groups. (B) The extent of plaques were shown as a percentage of the total lesion area in the whole intima area (n = 5). (C) Serial cryosections of the aortic sinus were stained with Oil Red O solution. (D) Quantitative analysis of the Oil Red O-stained cryosections. Data are expressed as mean ± SD (n = 5 mice/group). *P b 0.05.
3. Results 3.1. hBD3 decreased serum inflammatory markers in ApoE−/− mice exposed to P. gingivalis LPS Serum levels of TNF-α and IL-6 were detected by BD-CBA to explore whether hBD3 could attenuate the inflammation caused by P. gingivalis LPS. We found that hBD3 significantly decreased serum levels of TNF-α and IL-6 in the acute phase of the inflammatory response to P. gingivalis LPS. While hBD3 diminished serum levels of IL-6 alone in mice
continuously stimulated with P. gingivalis LPS (Fig. 1). These findings suggest that hBD3 exerts anti-inflammatory effects on the responses to both acute and chronic P. gingivalis LPS stimulation. 3.2. hBD3 attenuates acute inflammation in the aortic wall of ApoE−/− mice We analyzed the expression of inflammatory cytokines (ICAM-1, VCAM-1, MCP-1, and IL-6) in the aorta of mice in each group. Two hours after stimulation, mRNA levels of ICAM-1, MCP-1 and IL-6 were
210
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
Fig. 5. hBD3 mitigated atherosclerotic changes in the aorta of P. gingivalis LPS-treated mice. Hematoxylin and eosin staining shows the changes in vascular wall. Immunohistological staining of CD68 demonstrates macrophage infiltration. Masson Trichrome shows the condition of the elastic lamina and SMC in the aortic roots. Black arrows indicate discontinuous internal elastic lamina and abnormal smooth muscle cells.
significantly increased in the aorta of P. gingivalis LPS-treated mice, whereas the levels of these cytokines were significantly downregulated by hBD3 (Fig. 2A). Furthermore, immunohistochemical staining revealed corresponding decreases in pro-inflammatory markers when the P. gingivalis LPS-treated mice were given hBD3 (Fig. 2B). These findings demonstrate the anti-inflammatory effects of hBD3 in vivo. 3.3. hBD3 attenuates inflammation of the aortic wall of ApoE −/− mice chronically treated with P. gingivalis LPS In the chronic inflammatory response model, we observed that hBD3 significantly diminished the mRNA levels of MCP-1 and IL-6 in the aortic wall (Fig. 3A), demonstrating the anti-inflammatory effect of hBD3 in vivo. Immunohistochemical analysis showed that hBD3 reduced the expression of MCP-1 and IL-6 in the aortic root of P. gingivalis LPS-treated mice (Fig. 3B). 3.4. hBD3 alleviates the progression of AS accelerated by P. gingivalis LPS in ApoE−/− mice The aortic trees were stained with Oil Red O to detect lipid deposition. The total area of the atherosclerotic lesion in hBD3 + P. gingivalis LPS-treated mice were significantly smaller than those treated with P. gingivalis LPS alone, which in turn, was significantly larger than those in the control group (Fig. 4A, B). The plaque burden in both the aortic arch and the thoracic aorta was lowered by hBD3. Furthermore, hBD3 significantly decreased the plaque size at the aortic sinus in P. gingivalis LPS-treated mice (Fig. 4C, D). Immunostaining of sections for CD68 expression showed a larger CD68-positive area and more advance plaque formation in mice treated with P. gingivalis LPS than those treated with hBD3 ± P. gingivalis LPS and those in the control groups. Masson Trichrome staining was performed to identify the continuity and morphology of the elastic lamina, as well as the structure and orientation of smooth muscle cells (SMCs). In the control groups, the internal elastic lamina was continuous and distinct, and SMCs were arranged neatly along the tunica media layer. In contrast, the internal elastic
lamina in the aortic root of P. gingivalis LPS-treated mice became discontinuous and indistinct, the media layer turned thicker, with greater numbers of interspersed SMCs observed. In conclusion, hBD3 ameliorated the pathological changes in the aortic root of P. gingivalis LPS-treated mice (Fig. 5). 3.5. hBD3 downregulates the expression of inflammatory cytokine expression in macrophages rather than in vascular endothelial cells Macrophages and HUVECs were stimulated with P. gingivalis LPS without or with hBD3 to investigate the target cell population. Three hours after treatment, hBD3 significantly reduced the concentrations of TNF-α, IL-1β, and IL-6 in the culture supernatant of macrophages stimulated with P. gingivalis LPS. This trend turned more obvious after 6 h. However, hBD3 did not influence the TNF-α, IL-6, and IL-8 level in the culture supernatants of HUVECs stimulated with P. gingivalis LPS (Fig. 6). Furthermore, hBD3 downregulated the mRNA levels of TNF-α, IL-1β, IL-6, IL-8, VCAM-1, and IL-10 in macrophages stimulated with P. gingivalis LPS (Fig. 7). 3.6. Both the MAPK and NF-κB signaling pathways participates in the antiinflammatory effects of hBD3 Since both the NF-κB and MAPK signaling pathways play an important role in response to P. gingivalis LPS, we investigate the ability of hBD3 to suppress the P. gingivalis LPS-induced activation of the NF-κB and MAPK signaling pathways. Macrophages were stimulated for 30 min with 50 μg/mL of P. gingivalis LPS in the presence or absence of hBD3 (2 μg/mL or 10 μg/mL). Untreated cells or cells treated with hBD3 alone (2 μg/mL or 10 μg/mL) were used as controls. Levels of the following proteins were determined by Western blotting: phosphorylated p38, p38, phosphorylated JNK, JNK, phosphorylated Erk1/2, Erk1/ 2, phosphorylated IκB-alpha, phosphorylated NF-κB p65, and NF-κB p65. GAPDH was used as a loading control. We found that hBD3 (10 μg/mL) suppressed the P. gingivalis LPS-induced activation of the p38 and JNK pathways. The ERK1/2 pathway was not activated by P. gingivalis LPS (Fig. 8A).
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
211
Fig. 6. hBD3 decreased the concentrations of TNF-α, IL-1β, and IL-6 in the culture supernatants of macrophages but not HUVECs. Macrophages were stimulated with 5 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 3 h or 6 h. HUVECs were treated with 50 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 8 h. The concentrations of inflammatory cytokines in culture supernatants were measured using cytometric bead arrays. Results are expressed as means ± SD of three independent experiments. *P b 0.05.
When macrophages were treated with P. gingivalis LPS, less p65 and more phosphorylated p65 were detected in the cytoplasm, indicating an activation of the NF-κB signaling pathway. But when the P. gingivalis LPS-treated macrophages were given hBD3, more p65 and less phosphorylated p65 were detected in the cytoplasm. These results suggest that hBD3 inhibits the activation of NF-κB signaling pathway activated by P. gingivalis LPS (Fig. 8B).
4. Discussion Previous studies have yielded very limited evidence for the role of hBD3 in vessels. Human umbilical vein endothelial cells produce hBD3 in response to pro-inflammatory stimuli. Therefore, it has been suggested that hBD3 participates in the innate immune response of these cells [30]. In addition, most previous studies on the anti-inflammatory effect of hBD3 were performed in vitro.
Fig. 7. hBD3 downregulates the mRNA levels of pro-inflammatory markers in macrophages stimulated with P. gingivalis LPS. Cells were treated with 5 μg/mL P. gingivalis LPS in the presence or absence of 5 μg/mL hBD3 for 3 h. The mRNA levels of TNF-α, IL-1β, IL-6, IL-8, VCAM-1, and IL-10 in macrophages were quantified by quantitative PCR. Relative quantities of mRNAs were calculated using the ΔΔCt method and were normalized against GAPDH. Results are expressed as means ± SD. *P b 0.05.
212
L. Li et al. / International Immunopharmacology 38 (2016) 204–213
Fig. 8. Both the MAPK and NF-κB signaling pathways participate in the anti-inflammatory effects of hBD3. Macrophages were stimulated with 50 μg/mL P. gingivalis LPS in the presence or absence of hBD3 (2 μg/mL or 10 μg/mL) for 30 min. Untreated cells or cells treated with hBD3 alone (2 μg/mL or 10 μg/mL) were used as controls. Protein levels of phosphorylated p38, p38, phosphorylated JNK, JNK, phosphorylated Erk1/2, Erk1/2 in whole cell extracts and phosphorylated IκB-alpha, phosphorylated NF-κB p65, and NF-κB p65 in the cytoplasm were determined by Western blotting. GAPDH was used as loading control.
In this study, we demonstrated that hBD3 suppresses the inflammatory response in the aortic wall of mice treated acutely with P. gingivalis LPS. Significant decreases in ICAM-1, IL-6, and MCP-1 expression in the aortic wall were observed at both mRNA and protein levels when the P. gingivalis LPS-treated mice were given hBD3. These findings substantiate an anti-inflammatory role of hBD3 in AS. Furthermore, we found that hBD3 significantly diminished the atherosclerotic lesion area in P. gingivalis LPS-treated mice. The atherosclerotic lesion in mice treated with hBD3 + P. gingivalis LPS were milder than those treated with P. gingivalis LPS, with less advanced plaque formation, more continuous and distinct elastic lamina, and much more normal SMCs arranged along the media elastic lamina. In this long term study, hBD3 alleviated IL-6 and MCP-1 expression in the aortic wall of P. gingivalis LPS-treated mice. Interestingly, IL-6 has been shown to play an important role in the progression of AS [40,41]. And MCP-1 has been shown to play key roles in foam cell formation, which is considered as the initiation of atherosclerosis [42]. Therefore, it can be speculated that hBD3 contributes greatly to the management of AS by downregulating the expression of IL-6 and MCP-1 in the aortic wall. Macrophages and vascular endothelial cells play critical roles in the initiation and development of AS. Therefore, we explored whether hBD3 exerts anti-inflammatory effects by targeting these cell types. We observed decreased inflammatory responses in macrophages stimulated by P. gingivalis LPS, whereas the innate immune responses were not altered in HUVECs treated with P. gingivalis LPS. These results suggest that hBD3 exerts anti-inflammatory effects by targeting macrophages rather than vascular endothelial cells. Next step, we investigated the signaling pathways that may mediate this effect. hBD3 has been shown to prevent TLR signaling and inhibit the activation of NF-κB pathway in macrophages [34]. Our observation on the NF-κB signaling pathway was consistent with this report. The proteins targeted by hBD3 were speculated to be shared by the MyD88 and TRIF pathways. MyD88 is also involved in the activation of MAPK signaling pathways, which can be activated by LPS and play an important role in inflammatory disorders. Therefore, we investigated whether hBD3 could suppress the P. gingivalis LPS-induced activation of MAPK signaling pathways. We found that the P. gingivalis LPS-induced activation of both the p38 pathway and the JNK pathway were inhibited by hBD3 (10 μg/mL). While we also observed that the p38 MAPK pathway was activated by 10 μg/mL of hBD3 alone, which is consistent with the former hypothesis that high concentrations of hBD3 exert pro-inflammatory effects to eliminate pathogens [34,43]. Our findings provide an initial insight into the effects of hBD3 on the progression of AS aggravated by P. gingivalis LPS. Downregulation of
inflammatory cytokines in macrophages is pivotal in this protective effect of hBD3. Although hBD3 did not decrease the expression of inflammatory cytokines in vascular endothelial cells, we cannot rule out the possibility that hBD3 protects the function of vascular endothelial cells in some other way. Recently, a novel effect of hBD3 was discovered in a study demonstrating that hBD3 enhanced the barrier function of skin by regulating the content of tight-junction proteins. [44]. Tightjunction proteins are cell-cell junctions which form the major barrier controlling the paracellular movement of water, ions, and solutes across epithelial cell sheets [45]. Tight junctions also exist widely in the vascular endothelium and their destruction results in decreased endothelial barrier function, which is associated with abnormal vascular permeability and the onset and progression of AS [46,47]. Further investigations are still required to confirm the ability of hBD3 to protect the vascular endothelium in similar ways. It is worth noting that hBD3 has a broad spectrum of antimicrobial activity. Thus, in addition to the anti-inflammatory properties discussed here, hBD3 may also protect the periodontal and cardiovascular tissue via these antimicrobial properties. Therefore, these dual effect of antiinflammatory and antimicrobial properties indicate the potential of hBD3 in a new strategy for the management of AS.
Acknowledgements This study was supported by the National Natural Science Foundation project (No. 81371152), the Key Project of Science and Technology Bureau of Jiangsu Province (No. BL2013002), the “Six Talent Peaks” of High Level Talent Selection and Training Project of Jiangsu Province (No. 2013-SWYY-006), and the Natural Science Foundation of Jiangsu Province (No. BK20131079). We thank Junhua Wu, Yibing Ding, Mei Zheng, and Yue Dai from Translational Medicine Core Facilities, Medical School of Nanjing University for their kindness on machine access and instruction.
References [1] M.A. Saffi, M.V. Furtado, C.A. Polanczyk, M.M. Montenegro, I.W. Ribeiro, C. Kampits, A.N. Haas, C.K. Rosing, E.R. Rabelo-Silva, Relationship between vascular endothelium and periodontal disease in atherosclerotic lesions: review article, World J. Cardiol. 7 (1) (2015) 26–30. [2] C.M. Ardila, A.Y. Perez-Valencia, W.L. Rendon-Osorio, Tannerella forsythia is associated with increased levels of atherogenic low density lipoprotein and total cholesterol in chronic periodontitis, J. Clin. Exp. Dent. 7 (2) (2015) e254–e260. [3] B. Soder, J.H. Meurman, P.O. Soder, Gingival inflammation associates with stroke - a role for oral health personnel in prevention: a database study, PLoS One 10 (9) (2015) e0137142.
L. Li et al. / International Immunopharmacology 38 (2016) 204–213 [4] M. Szulc, W. Kustrzycki, D. Janczak, D. Michalowska, D. Baczynska, M. RadwanOczko, Presence of periodontopathic bacteria DNA in atheromatous plaques from coronary and carotid arteries, Biomed. Res. Int. 2015 (2015) 825397. [5] C. Kudo, W.S. Shin, M. Minabe, K. Harai, K. Kato, H. Seino, E. Goke, N. Sasaki, T. Fujino, N. Kuribayashi, Y.O. Pearce, M. Taira, H. Maeda, S. Takashiba, Analysis of the relationship between periodontal disease and atherosclerosis within a local clinical system: a cross-sectional observational pilot study, Odontology 103 (3) (2015) 314–321. [6] S. Kiechl, G. Egger, M. Mayr, C.J. Wiedermann, E. Bonora, F. Oberhollenzer, M. Muggeo, Q. Xu, G. Wick, W. Poewe, J. Willeit, Chronic infections and the risk of carotid atherosclerosis: prospective results from a large population study, Circulation 103 (8) (2001) 1064–1070. [7] W. Huang, L. Zhao, Y. Jia, J.J. Chen, Y.F. Wu, Effect of Porphyromonas gingivalis lipopolysaccharide on the expression of CC chemokine receptor 2 in monocytes, Zhonghua Kou Qiang Yi Xue Za Zhi 48 (7) (2013) 393–397. [8] J.M. Gitlin, C.D. Loftin, Cyclooxygenase-2 inhibition increases lipopolysaccharide-induced atherosclerosis in mice, Cardiovasc. Res. 81 (2) (2009) 400–407. [9] N. Nakamura, M. Yoshida, M. Umeda, Y. Huang, S. Kitajima, Y. Inoue, I. Ishikawa, T. Iwai, Extended exposure of lipopolysaccharide fraction from Porphyromonas gingivalis facilitates mononuclear cell adhesion to vascular endothelium via Toll-like receptor-2 dependent mechanism, Atherosclerosis 196 (1) (2008) 59–67. [10] M. Triantafilou, F.G. Gamper, P.M. Lepper, M.A. Mouratis, C. Schumann, E. Harokopakis, R.E. Schifferle, G. Hajishengallis, K. Triantafilou, Lipopolysaccharides from atherosclerosis-associated bacteria antagonize TLR4, induce formation of TLR2/1/CD36 complexes in lipid rafts and trigger TLR2-induced inflammatory responses in human vascular endothelial cells, Cell. Microbiol. 9 (8) (2007) 2030–2039. [11] O. Andrukhov, I. Steiner, S. Liu, H.P. Bantleon, A. Moritz, X. Rausch-Fan, Different effects of Porphyromonas gingivalis lipopolysaccharide and TLR2 agonist Pam3CSK4 on the adhesion molecules expression in endothelial cells, Odontology 103 (1) (2015) 19–26. [12] L. Lei, H. Li, F. Yan, Y. Li, Y. Xiao, Porphyromonas gingivalis lipopolysaccharide alters atherosclerotic-related gene expression in oxidized low-density-lipoprotein-induced macrophages and foam cells, J. Periodontal Res. 46 (4) (2011) 427–437. [13] P.J. Pussinen, K. Mattila, Periodontal infections and atherosclerosis: mere associations? Curr. Opin. Lipidol. 15 (5) (2004) 583–588. [14] M. Qi, H. Miyakawa, H.K. Kuramitsu, Porphyromonas gingivalis induces murine macrophage foam cell formation, Microb. Pathog. 35 (6) (2003) 259–267. [15] H.K. Kuramitsu, I.C. Kang, M. Qi, Interactions of Porphyromonas gingivalis with host cells: implications for cardiovascular diseases, J. Periodontol. 74 (1) (2003) 85–89. [16] H.K. Kuramitsu, M. Qi, I.C. Kang, W. Chen, Role for periodontal bacteria in cardiovascular diseases, Ann. Periodontol. 6 (1) (2001) 41–47. [17] R. Ross, Atherosclerosis–an inflammatory disease, N. Engl. J. Med. 340 (2) (1999) 115–126. [18] H. Ait-Oufella, S. Taleb, Z. Mallat, A. Tedgui, Recent advances on the role of cytokines in atherosclerosis, Arterioscler. Thromb. Vasc. Biol. 31 (5) (2011) 969–979. [19] A.E. Moran, G.A. Roth, J. Narula, G.A. Mensah, 1990–2010 global cardiovascular disease atlas, Glob. Health 9 (1) (2014) 3–16. [20] C. Tie, K. Gao, N. Zhang, S. Zhang, J. Shen, X. Xie, J.A. Wang, Ezetimibe attenuates atherosclerosis associated with lipid reduction and inflammation inhibition, PLoS One 10 (11) (2015) e0142430. [21] M. Back, G.K. Hansson, Anti-inflammatory therapies for atherosclerosis, Nat. Rev. Cardiol. 12 (4) (2015) 199–211. [22] I.F. Charo, R. Taub, Anti-inflammatory therapeutics for the treatment of atherosclerosis, Nat. Rev. Drug Discov. 10 (5) (2011) 365–376. [23] S.L. Verweij, F.M. van der Valk, E.S. Stroes, Novel directions in inflammation as a therapeutic target in atherosclerosis, Curr. Opin. Lipidol. 26 (6) (2015) 580–585. [24] R. Khan, V. Spagnoli, J.C. Tardif, P.L. L'Allier, Novel anti-inflammatory therapies for the treatment of atherosclerosis, Atherosclerosis 240 (2) (2015) 497–509. [25] J. Rohrl, D. Yang, J.J. Oppenheim, T. Hehlgans, Human beta-defensin 2 and 3 and their mouse orthologs induce chemotaxis through interaction with CCR2, J. Immunol. 184 (12) (2010) 6688–6694. [26] Y. Lai, R.L. Gallo, AMPed up immunity: how antimicrobial peptides have multiple roles in immune defense, Trends Immunol. 30 (3) (2009) 131–141. [27] P.H. Warnke, I.N. Springer, P.A. Russo, J. Wiltfang, H. Essig, M. Kosmahl, E. Sherry, Y. Acil, Innate immunity in human bone, Bone 38 (3) (2006) 400–408. [28] J. Harder, J. Bartels, E. Christophers, J.M. Schroder, Isolation and characterization of human beta-defensin-3, a novel human inducible peptide antibiotic, J. Biol. Chem. 276 (8) (2001) 5707–5713.
213
[29] J.R. Garcia, F. Jaumann, S. Schulz, A. Krause, J. Rodriguez-Jimenez, U. Forssmann, K. Adermann, E. Kluver, C. Vogelmeier, D. Becker, R. Hedrich, W.G. Forssmann, R. Bals, Identification of a novel, multifunctional beta-defensin (human beta-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction, Cell Tissue Res. 306 (2) (2001) 257–264. [30] C. Burgey, W.V. Kern, W. Romer, T. Sakinc, S. Rieg, The innate defense antimicrobial peptides hBD3 and RNase7 are induced in human umbilical vein endothelial cells by classical inflammatory cytokines but not Th17 cytokines, Microbes Infect. 17 (5) (2015) 353–359. [31] R. Tao, R.J. Jurevic, K.K. Coulton, M.T. Tsutsui, M.C. Roberts, J.R. Kimball, N. Wells, J. Berndt, B.A. Dale, Salivary antimicrobial peptide expression and dental caries experience in children, Antimicrob. Agents Chemother. 49 (9) (2005) 3883–3888. [32] B.A. Dale, R. Tao, J.R. Kimball, R.J. Jurevic, Oral antimicrobial peptides and biological control of caries, BMC Oral Health 6 (Suppl. 1) (2006) S13. [33] F. Semple, S. Webb, H.N. Li, H.B. Patel, M. Perretti, I.J. Jackson, M. Gray, D.J. Davidson, J.R. Dorin, Human beta-defensin 3 has immunosuppressive activity in vitro and in vivo, Eur. J. Immunol. 40 (4) (2010) 1073–1078. [34] F. Semple, H. MacPherson, S. Webb, S.L. Cox, L.J. Mallin, C. Tyrrell, G.R. Grimes, C.A. Semple, M.A. Nix, G.L. Millhauser, J.R. Dorin, Human beta-defensin 3 affects the activity of pro-inflammatory pathways associated with MyD88 and TRIF, Eur. J. Immunol. 41 (11) (2011) 3291–3300. [35] L.C. Pingel, K.G. Kohlgraf, C.J. Hansen, C.G. Eastman, D.E. Dietrich, K.K. Burnell, R.N. Srikantha, X. Xiao, M. Belanger, A. Progulske-Fox, J.E. Cavanaugh, J.M. Guthmiller, G.K. Johnson, S. Joly, Z.B. Kurago, D.V. Dawson, K.A. Brogden, Human beta-defensin 3 binds to hemagglutinin B (rHagB), a non-fimbrial adhesin from Porphyromonas gingivalis, and attenuates a pro-inflammatory cytokine response, Immunol. Cell Biol. 86 (8) (2008) 643–649. [36] S.H. Lee, D.H. Baek, Antibacterial and neutralizing effect of human beta-defensins on Enterococcus faecalis and Enterococcus faecalis lipoteichoic acid, J. Endod. 38 (3) (2012) 351–356. [37] S. Pan, L. Lei, S. Chen, H. Li, F. Yan, Rosiglitazone impedes Porphyromonas gingivalisaccelerated atherosclerosis by downregulating the TLR/NF-kappaB signaling pathway in atherosclerotic mice, Int. Immunopharmacol. 23 (2) (2014) 701–708. [38] M. Madan, B. Bishayi, M. Hoge, E. Messas, S. Amar, Doxycycline affects diet- and bacteria-associated atherosclerosis in an ApoE heterozygote murine model: cytokine profiling implications, Atherosclerosis 190 (1) (2007) 62–72. [39] P. Nigro, K. Satoh, M.R. O'Dell, N.N. Soe, Z. Cui, A. Mohan, J. Abe, J.D. Alexis, J.D. Sparks, B.C. Berk, Cyclophilin A is an inflammatory mediator that promotes atherosclerosis in apolipoprotein E-deficient mice, J. Exp. Med. 208 (1) (2011) 53–66. [40] J. Hartman, W.H. Frishman, Inflammation and atherosclerosis: a review of the role of interleukin-6 in the development of atherosclerosis and the potential for targeted drug therapy, Cardiol. Rev. 22 (3) (2014) 147–151. [41] J. Scheller, C. Garbers, S. Rose-John, Interleukin-6: from basic biology to selective blockade of pro-inflammatory activities, Semin. Immunol. 26 (1) (2014) 2–12. [42] M.J. Littlefield, E. Belilos, S.E. Carsons, A.B. Reiss, W. Dong, X. Wang, S. Bi, Z. Pan, S. Liu, H. Yu, H. Lu, X. Lin, X. Wang, T. Ma, W. Zhang, Inhibitory effects of resveratrol on foam cell formation are mediated through monocyte chemotactic protein-1 and lipid metabolism-related proteins, Biomed. Res. Int. 33 (5) (2014) 1161–1168. [43] L.E. Harvey, K.G. Kohlgraf, L.A. Mehalick, M. Raina, E.N. Recker, S. Radhakrishnan, S.A. Prasad, R. Vidva, A. Progulske-Fox, J.E. Cavanaugh, S. Vali, K.A. Brogden, Defensin DEFB103 bidirectionally regulates chemokine and cytokine responses to a pro-inflammatory stimulus, Sci. Rep. 3 (2013) 1232. [44] C. Kiatsurayanon, F. Niyonsaba, R. Smithrithee, T. Akiyama, H. Ushio, M. Hara, K. Okumura, S. Ikeda, H. Ogawa, Host defense (antimicrobial) peptide, human betadefensin-3, improves the function of the epithelial tight-junction barrier in human keratinocytes, J. Investig. Dermatol. 134 (8) (2014) 2163–2173. [45] N. Kirschner, R. Rosenthal, M. Furuse, I. Moll, M. Fromm, J.M. Brandner, Contribution of tight junction proteins to ion, macromolecule, and water barrier in keratinocytes, J. Investig. Dermatol. 133 (5) (2013) 1161–1169. [46] V.J. Krouwer, L.H. Hekking, M. Langelaar-Makkinje, E. Regan-Klapisz, J.A. Post, Endothelial cell senescence is associated with disrupted cell-cell junctions and increased monolayer permeability, Vasc. Cell 4 (1) (2012) 12. [47] C. Bian, G. Xu, J. Wang, J. Ma, M. Xiang, P. Chen, Hypercholesterolaemic serum increases the permeability of endothelial cells through zonula occludens-1 with phosphatidylinositol 3-kinase signaling pathway, J. Biomed. Biotechnol. 2009 (2009) 814979.