Human fetal adrenal hydroxysteroid sulphotransferase: cDNA cloning, stable expression in V79 cells and functional characterisation of the expressed enzyme

ELSEVIER

Molecular and Cellular Endocrinology 112 (1995) 53-60

Human fetal adrenal hydroxysteroid sulphotransferase: cDNA cloning, stable expression in V79 cells and functional characterisation of the expressed enzyme * Kathleen J. Forbes”, Maria Hagen”, Hansruedi Glattb, Robert Humeqc,d, Michael W.H. Coughtrie* a ‘Departmentof Biochemical Medicine, University of Dundee, NineweUs Hospital and Medical School, Dundee DDl 9sY; Scotlanrl, UK bInstitutfiir Toxikmbgie, UniversitiitMaim, Obere Zahlbacher Strasse 67, D-55131 Maim, Gennany CDepartment of Obstem’cs and Gynaecology, Universi~ of Dundee, Ninewelh Hospital and Medical School, Dundee DDl9Sx Scotland, UK ‘Department of Child Health, University of Dun&e, Ninewells Hospital and Medical School, Dundee DDI 9SY, Scotland, UK

Received 22 February 1995; revision received 12 May 1995; accepted 12 May 1995

Dehydroepiandrosterone sulphate (DHEAS) is a major adrenal secretory product, particularly in the fetus where it serves as a substrate for oestrogen biosynthesis by the placenta. The enzyme in the adrenal responsible for synthesising DHEAS, hydroxysteroid sulphotransferase (HST), is therefore essential for human development. We have isolated a full-length cDNA clone, encoding human fetal adrenal HST, and constructed a stable cell line expressing it by transfection into V79 Chinese hamster lung fibroblast cells. This cDNA was essentially identical to that isolated from adult human liver, where the role of HST is less well understood. This recombinant cell line allowed determination of the substrate specificity and kinetic properties of this enzyme towards various steroid hormones, and by comparison of these activities with human liver cytosol we have shown that HST is the major sulphotransferase responsible for the sulphation of DHEA, androsterone and pregnenolone in man and that, functionally, the hepatic and adrenal enzymes are very similar. The expressed HST was also active with testosterone, cortisol (although at low levels) and the xenobiotic 17a-ethinyloestradiol, but not with oestrone or 1-naphthol. We have therefore created a valuable resource for the study of this important enzyme.

Kqrwordr Sulphotransferase; Adrenal; Fetus; Dehydroepiandrosterone; cDNA cloning; Expression

1.IntrodUction Sulphation (or more correctly, sulphonation) is an important pathway for the metabolism and inactivation of a host of xenobiotics and endogenous compounds, including steroid hormones, bile salts and monoamine neurotransmitters (Jakoby et al., 1980; Mulder and Jakoby, 1990, Falany, 1991). The reactions are catalysed by a family of cytoplasmic en-

*The nucleotide sequence reported herein has been submitted to the EMBL databank, and has been assigned Accession Number X844316 *Corresponding author.

zymes, the sulphotransferases (ST& which are present in most body tissues and are encoded by a multigene family (Falany, 1991; Weinshilboum and Otterness, 1994; Yamazoe et al., 1994). Addition of the sulphonate group from the activated donor molecule 3’-phosphoadenosine S-phosphosulphate (PAPS) normally results in decreased biological activity compared to the parent compound, and the resulting increased hydrophilic@ facilitates excretion. At least two sub-families of this multi-gene family have been identified in man on the basis of protein purification studies (e.g. Heroux and Roth, 1988; Falany et al., 1989,1990, Forbes-Bamforth and Coughtrie, 1994) and more recently cDNA and genomic cloning (e.g.

0303-7207/95/$09.50 0 1995 Elsevier Science Ireland Ltd. AI1 rights reserved. 0303-7207(95)03585-U

SSDI

54

RJ. Forbes et al. /Molecular and Cellular Endocrinology 112 (1995) 53-60

Ottemess et al., 1992; Wilbom et al., 1993; Xhu et al., 1993; Wood et al., 1994; Aksoy et al., 1994; Dooley et al., 1994). Hydroxysteroid ST (HST) appears to exist as a single isoenzyme in humans (in contrast to rats where several forms exist (Watabe et al., 1994)), with broad substrate specificity towards steroid hormones (principally androgens), cholesterol and bile acids (Falany et al., 1989; Radominska et al., 1990; Aksoy et al., 1993a). The purified enzyme is most active towards the steroid dehydroepiandrosterone (DHEA) (Falany et al., 1989). Sulphation of steroids is an important inactivation reaction as it abolishes the action of these compounds at their receptors, however, sulphation has a role beyond inactivation and excretion. Quantitatively, DHEA and its sulphate DHEAS, along with cortisol, are the most important secretory products of the adrenal cortex and DHEAS is the most abundant circulating steroid. The fetal adrenal gland produces large quantities of DHEAS (up to 200 mg/day), principally through the action of HST expressed in the fetal zone (Korte et al., 1982; Barker et al., 1994; Parker et al., 19941, where the enzyme protein is present at approximately 6-fold higher levels than in the fetal liver (Barker et al., 1994). The principal role of DHEAS in the human fetus is to provide the major substrate for oestrogen biosynthesis by the placenta, and therefore to maintain pregnancy (Hobkirk, 1985; Kuss, 1994). To date, it has not been unambiguously demonstrated that the HST expressed in the human fetal adrenal (and which is obviously one of the most important enzymes in development) is the same as the HST extensively studied in the adult human liver. Immunochemically and enzymatically, the enzymes isolated from human adult adrenal and liver appear very similar (Comer and Falany, 19921, however, the only human HST cDNAs which have so far been isolated are from liver (Ottemess et al., 1992; Kong et al., 1992; Comer et al., 1993). Here we report the first cloning and stable expression in V79 Chinese hamster lung tibroblasts of a human fetal adrenal HST cDNA. The protein encoded by this cDNA shares amino acid sequence identities of 100% (Ottemess et al., 1992) and 99.7% (Kong et al., 1992; Comer et al., 1993) with the deduced amino acid sequences of previously reported adult human liver HSTs. Analysis of the substrate specificity and kinetic properties of the stably expressed enzyme indicates it has similar properties to human liver HST and is therefore a valuable and renewable resource for the study of human HST. 2. Materials and methods 2.1. Chemicals and reagents Human fetal adrenal 5’-stretch hgtll cDNA library

and Escherichia coli Y 1090 cells were purchased from Clontech, Palo Alto, U.S.A. Nylon blotting membrane and DIG (digoxigenin-dUTP) DNA labelling kit were obtained from Boehringer, Lewes, U.K. pBluescript SK(+) and E. coli XL1 Blue cells were from Stratagene, Cambridge, U.K., and all DNA modifying enzymes were from Promega, Southampton, U.K. pMPSV, pBSpacAp and pDKlO1 were generously provided by Dr. H. Hauser, Braunschweig, Germany, Dr. J. Or&, Madrid, Spain and Dr. B. Weisblum, Madison, U.S.A., respectively. DMEM, fetal calf serum, penicillin, streptomycin, L-glutamine, trypsin and EDTA were all from Sigma/Aldrich, Poole, U.K. 3H-labelled steroids were purchased from Du Pont/NEN, Stevenage, U.K., or from Amersham, Little Chalfont, U.K. l-[l-i4C]Naphthol was from Amersham. 2.2. Isolation and sequencing of human fetal adrenal HST cDNA A human fetal adrenal 5’-stretch hgtll cDNA library was titred and plated on LB medium in the host strain E. coli Y1090 on 145 mm Petri dishes. A total of 500000 recombinants were screened by plating 50000 plaque forming units per plate. Duplicate lifts were taken from each plate onto nylon filters and were probed with the rat HSTs, ST20 (Ogura et al., 1989) and ST40 (otherwise known as STa, Ogura et al., 1990). The ST20 and ST40 cDNAs were prepared by PCR from a female rat liver cDNA library using oligonucleotides derived from the published sequence (Ogura et al., 1990), followed by selective hybridisation with oligonucleotides specific for each isoform. These cDNAs were subcloned into the vector pDKlO1 at the XcmI site. The fragments used to probe the library were then isolated by digestion with NcoI and represented nucleotides 31-894 of the published sequence (Ogura et al., 1990). Hybridisation was performed at 57°C overnight using 26 ng of freshly denatured DIG-labelled ST20 and ST40 per ml of hybridisation medium (3 x SSC’; 1% (w/v) blocking reagent; 1% (w/v) N-lauroylsarcosine; 0.02% (w/v) SDS). Following hybridisation, the filters were washed twice at room temperature with 50 ml 2 x SSC’, 0.1% (w/v) SDS per 100 cm2 filter surface area. The filters were then subjected to immunochemical staining as described by the manufacturer (Boehringer). After the initial screening, two plaques were observed to hybridise to both probes, and were then subjected to repeated cycles of dilution and rescreening. After three rounds of screening of the two original positive clones, a full length clone, HST-hfa (assessed

‘1 x SSC = 150 mM sodium chloride, 15 mM sodium citrate, pH 7.0.

KJ. Forbes et al. /Molecular and Cellular Endocrinology 112 (1995) 53-60

by PCR amplification from the plaque and Southern blot/restriction analysis of the product) was then subcloned into the EcoRI site of pBluescript. The nucleotide sequence of this HST was determined by automated sequencing on an ABI 373A sequencer. Universal Ml3 forward and reverse sequencing primers were used to obtain the nucleotide sequence of the 5’ and 3’ ends of the clone, and various constructs were prepared and oligonucleotide primers designed to gain overlapping sequences until the entire cDNA was sequenced several times in both directions. 2.3. Stable expression of human fetal adrenal HST in V79 cells The HST-hfa cDNA was subcloned into the mam-

malian expression vector pMPSV (in the EcoRI/HindIII orientation), which drives expression from the LTR promoter of the myeloproliferative sarcoma virus (Artelt et al., 1988). To ensure that the HST-hfa cDNA would be in the correct orientation, the cDNA was first excised from pBluescript by digestion with PstI and Hind111 and then subcloned into the plasmid pUC19, digested with the same enzymes (directed subcloning). The cDNA was then excised from pUC19 by digestion with Sal1 and Hind111 and ligated into the Sal1 and Hind111 sites of pMPSV (pMPSV/HST-hfa). Transfection of HST-hfa DNA into Chinese hamster lung fibroblast cells (V79) was by the calcium phosphate/glycerol shock method. Nine micrograms of recombinant pMPSV/HST-hfa were co-transfected with 1 pg pBSpacAp, which confers resistance to the antibiotic puromycin (de la Luna et al., 1988), into V79 cells (7.5 X 10’ cells/94 mm plate grown overnight). Cells were maintained in DMEM with 10% fetal calf serum supplemented with 50 units/ml penicillin and 0.05 mg/ml streptomycin. The cells were then grown under 5% CO, at 37°C for 4 h. The media was carefully removed and the cells subjected to glycerol shock by the addition of DMEM (as above) containing 15% (v/v) glycerol. After 2 min, this was thoroughly washed away using Dulbecco’s phosphate-buffered saline (PBS) and the cells were incubated with fresh medium overnight. Selection for V79 cells which had taken up pBSpacAp took place in the above medium for approximately 12 days in the presence of 5 pg/ml puromycin. When surviving colonies could be seen with the naked eye on the bottom of the plate, clones were picked using cloning rings and grown in flat bottomed six-well plates until confluent, split into 75 cm* flasks, and again grown until 70% confluent. Cells were harvested by trypsinisation into DMEM, followed by centrifugation (1000 rev./min) to pellet. Pellets were washed twice with PBS and homogenised using a micropestle in an Ep-

55

pendorf tube. Homogenates were centrifuged at room temperature for 10 min at 10000 X g. This resulting 10000 X g supematant was then used for immunoblot analysis and enzyme assay to identify surviving V79 clones which expressed human fetal adrenal HST (V79/HSThfal, since little difference was observed in the specific activities obtained with this fraction and with cytosol prepared by centrifugation at 105000 X g. 2.4. Immunoblot analysis and enzyme assay of V79 / HST-hfa

Samples were resolved on SDS-polyacrylamide gels (11% acrylamide monomer), proteins electrophoretitally transferred to nitrocellulose and immunostaining with chemiluminescent detection (ECL, Amersham, Little Chalfont, U.K.1 performed as described previously (Jones et al., 1993). The primary antibody used was anti-rat liver HST, previously prepared in the laboratory (Sharp et al., 1993). Protein content was estimated by the method of Bradford (1976) with bovine serum albumin as the standard. DHEA ST activity was measured in 75 ~1 of 10000 X g supematant (approx. 200-400 pg total protein) with DHEA (6 PM) and PAPS (24 PM) in duplicate in a total assay volume of 250 ~1. The buffer comprised 10 mM Tris-HCl, 2 mM MgCl,, pH 7.5 and the reaction was terminated by the addition of 3 ml chloroform followed by 250 ~1 0.25 M Tris-HCl, pH 8.7, after 45 min incubation. Following a single extraction, an aliquot of the aqueous layer was subjected to liquid scintillation counting. This optimised assay was used to measure DI-IEA ST activity in chosen passages and for all other enzyme analysis performed with the V79/HST-hfa. ST activity towards all other steroids was measured using the same procedure, with radiolabelled substrate at a concentration of 6 PM, and 1-naphthol ST activity was measured as described (Bamforth et al., 1992). 3. Results 3.1. cDNA cloning of human fetal adrenal HST

Using probes prepared from two closely-related rat HSTs, ST 20 and ST 40 (94.4% nucleotide sequence identity), we isolated a full-length HST cDNA clone (HST-hfa) from a human fetal adrenal cDNA library. The cDNA is 1095 bp in length and contains an open reading frame of 855 bp (beginning at nucleotide 461, coding for a protein of 285 amino acids with a predicted subunit molecular mass of 33783 Da (Fig. 1). The coding region nucleotide sequence of HST-hfa is identical to that described for human liver HST by Ottemess et al. (19921, however, there are minor differences with the other two human liver HST CDNAs isolated. HST-hfa differs in two nucleotides in

56

RJ. Forbes et al. /Molecular and CellularEndocrinology112 (1995) 53-M)

the coding region compared to the human liver HST cDNA isolated by Comer et al. (1993): nucleotides 314 and 315 of HST-hfa are CG, whereas the corresponding nucleotides of the sequence reported by Comer et al. (1993) are GC. These differences result in a threonine residue in the deduced amino acid sequence of HST-hfa, whereas the corresponding residue in the human liver HST of Comer et al. (1993) is serine. In the other two human liver HST cDNAs isolated by Kong et al. (1992) and Ottemess et al. (1992), these nucleotides are CG coding for a threonine residue, and Otterness et al. (1992) sequenced a peptide generated from purified human liver HST and found the corresponding residue to be threonine. The sequence for adult human liver HST reported by Kong et al. (1992), differs from HST-hfa in that the nucleotides at positions 520 and 521 in HST-hfa are CG but in the cDNA (STa) of Kong et al. (1992) they are GC. The C + G change at nucleotide 520 results in a valine residue at position 159 in the STa amino acid sequence compared to a leucine in the HST-hfa and also in the adult liver HSTs reported by Ottemess et al. (1992) and Comer et al. (1993). The G + C change at nucleotide 521 is silent. These two amino acid differences which occur between the four cDNAs (90 Thr -+ Ser and 159 Leu -+ Val) are ‘conservative’, and it is not clear at this stage whether or not they would affect the activity and/or substrate specificity of HST. 3.2. Stable expression of HST-hfa in V79 cells The HST-hfa cDNA was introduced into the mammalian expression vector pMPSV and co-transfected with the puromycin resistance vector pBSpacAp into the Chinese hamster lung fibroblast cell line V79. Following selection by culturing cells in the presence of puromycin, surviving clones were cultured, assayed for DHEA ST activity and subjected to Western immunoblot analysis with an antibody raised against a rat liver HST (Sharp et al., 19931, which is known to selectively recognise human HST (Sharp et al., 1993; Barker et al., 1994), to determine which cells had also taken up pMPSV/HST-hfa. Fig. 2 shows that V79/HST-hfa, which exhibited enzyme activity with DHEA as substrate (Fig. 2, lanes 6-111, also carried a protein of subunit molecular mass of approximately 35 kDa which was reactive against anti-rat liver HST, and which migrated at the same rate as the HST protein present in human liver cytosol (Fig. 2, lane 1). Thus one clone was chosen from a total of 17 displaying both enzyme activity towards DHEA and immunoreactive protein on Western immunoblot analysis. This clone had HST activity (DHEA as acceptor substrate) in the middle of the range of activities obtained, since we found that the cell lines expressing the highest activities did not apparently carry stably

integrated HST as the activity reduced dramatically over several passages (not shown). This clone was maintained in DMEM and passaged 24 times to demonstrate stability of integration of the pMPSV/HST-hfa as assessed by measuring DHEA ST enzyme activity (Fig. 3). A ‘control’ cell line, which had been transfected as described but which displayed no DHEA ST activity or enzyme protein, was maintained in parallel (Fig. 31, and anti-(rat liver HST) immunoreactive protein (Fig. 2). Thus, we have constructed a stable cell line, V79/HST-hfa, expressing human fetal adrenal HST. 3.3. Functional properties of HST-hfa stably expressed in V79 cells

To evaluate the validity of this cell line for use as a model system for studying the substrate specificity and properties of HST, we determined its ability to sulphate a range of steroid hormones believed to be substrates for this enzyme, determined kinetic properties of the cell line for the sulphation of these compounds, and compared these data with those obtained with human liver cytosol, a commonly used source of HST enzyme activity. Table 1 shows that of the compounds studied, DHEA gave the highest ST activity with both V79/HST-hfa cell 10000 x g supematant and adult human liver cytosol, and that the level of enzyme activity present in the expressed cells was approximately 30% of that seen with the sample of human liver cytosol used. V79/HST-hfa was able to sulphate DHEA, androsterone, pregnenolone, 17aethinyloestradiol, testosterone and cortisol, but not 1-naphthol or oestrone (Table 1). Comparing the relative activities of V79/HST-hfa towards these compounds with adult human liver cytosol, it seems likely that androsterone and pregnenolone are principally sulphated by HST in human liver cytosol. The relative activity (compared to DHEA) towards 17oethinyloestradiol was 16% in V79/HST-hfa and 31% in human liver cytosol, confirming that whilst this compound is a substrate for HST, other enzymes are involved in its sulphation. There is broad overlap in specificity for this substrate by different ST isoenzymes in human liver (e.g. Falany et al., 1994), but it is sulphated by the human liver EST (Forbes-Bamforth and Coughtrie, 1994). Cortisol was sulphated with low activity in both human liver cytosol and V79/HST-hfa. It is possible to conclude that HST is the enzyme principally responsible for the sulphation of cortisol by human liver cytosol; however, more extensive analysis of the ability of other human STs to sulphate this compound is required. Testosterone was also sulphated with low activity in both test systems, but it is possible that HST is the principal ST responsible for the sulphation of this compound. V79/HST-hfa was

57

RJ. Forbes et al. /Molecular and Cellular Endocrinology 112 (1995) 53-60

1

GGCTACAGTTGMACCCTCACACCACGCAGGAAGAGGTCATCATC

Met Ser Asp Asp Phe Leu Trp Phe Glu Gly Ile Ala Phe Pro Thr Met Gly 46 E TCG GAC GAT TTC TTA TGG TTT GAA GGC ATA GCT TTC CCT ACT ATG GGT

17

Phe Arg Ser Glu Thr Leu Arg Lys Val Arg Asp Glu Phe Val Ile Arg Asp 97 TTC AGA TCC GAA ACC TTA AGA AAA GTA CGT GAT GAG TTC GTG ATA AGG GAT

34

Glu Asp Val Ile Ile Leu Thr Tyr Pro Lys Ser Gly Thr Asn Trp Leu Ala 148 GAA GAT GTA ATA ATA TTG ACT TAC CCC AAA TCA GGA ACA AAC TGG TTG GCT

51

Glu Ile Leu Cys Leu Met His Ser Lys Gly Asp Ala Lys Trp Ile Gln Ser 199 GAG ATT CTC TGC CTG ATG CAC TCC AAG GGG GAT GCC AAG TGG ATC CAA TCT

68

Val Pro Ile Trp Glu Arg Ser Pro Trp Val Glu Ser Glu Ile Gly Tyr Thr 250 GTG CCC ATC TGG GAG CGA TCA CCC TGG GTA GAG AGT GAG ATT GGG TAT ACA

85

Ala Leu Ser Glu Thr Glu Ser Pro Arg LeU Phe Ser Ser His Leu Pro Ile 301 GCA CTC AGT GAA ACG GAG AGT CCA CGT TTA TTC TCC TCC CAC CTC CCC ATC

102

Gln Leu Phe Pro Lys Ser Phe Phe Ser Ser Lys Ala Lys Val Ile Tyr Leu 352 CAG TTA TTC CCC AAG TCT TTC TTC AGT TCC AAG GCC AAG GTG ATT TAT CTC

119

Met Arg Asn Pro Arg Asp Val Leu Val Ser Gly Tyr Phe Phe Trp Lys Asn 403 ATG AGA AAT CCC AGA GAT GTT TTG GTG TCT GGT TAT TTT TTC TGG AAA AAC

136

Met Lys Phe Ile Lys Lys Pro Lys Ser Trp Glu Glu Tyr Phe Glu Trp Phe 454 ATG AAG TTT ATT AAG AAA CCA AAG TCA TGG GAA GAA TAT TTT GAA TGG TTT

153

Cys Gln Gly Thr Val Leu Tyr Gly Ser Trp Phe Asp His Ile His Gly Trp 505 TGT CAA GGA ACT GTG CTA TAT GGG TCA TGG TTT GAC CAC ATT CAT GGC TGG

170

Met Pro Met Arg Glu Glu Lys Am Phe Leu Leu Leu Ser Tyr Glu Glu Leu 556 ATG CCC ATG AGA GAG GAG AU AAC TTC CTG TTA CTG AGT TAT GAG GAG CTG

187

Lys Gln Asp Thr Gly Arg Thr Ile Glu Lys Ile Cys Gln Phe Leu Gly Lys 607 AAA CAG GAC ACA GGA AGA ACC ATA GAG AAG ATC TGT CAA TTC CTG GGA AAG

204

Thr Leu Glu Pro Glu Glu Leu Asn Leu

Ile Leu Lys Asn

Ser Ser Phe Gln

221

658 ACG TTA GAA CCC GAA GAA CTG AAC TTA ATT CTC AAG AAC AGC TCC TTT CAG Ser Met Lys Glu Asn Lys Met 709 AGC ATG AAA GAA AAC AAG ATG

Ser Asn Tyr Ser Leu Leu Ser Val Asp Tyr TCC AAT TAT TCC CTC CTG AGT GTT GAT TAT

238

Val Val Asp Lys Ala Gln Leu Leu Arg Lys Gly Val Ser Gly Asp Trp Lys 760 GTA GTG GAC AAA GCA CAA CTT CTG AGA AAA GGT GTA TCT GGG GAC TGG AAA

255

Asn His Phe Thr Val Ala Gln Ala Glu Asp Phe Asp Lys Leu Phe Gln Glu 811 AAT CAC TTC ACA GTG GCC CAA GCT GAA GAC TTT GAT AAA TTG TTC CAA GAG

272

Lys Met Ala Asp Leu Pro Arg Glu Leu Phe Pro Trp Glu Stop 862 AAG ATG GCA GAT CTT CCT CGA GAG CTG TTC CCA TGG GAA m CGTCCAAAACA

285

915 CTCTGGATCTTATATGGAGAATGACATTGATTCTCTCCTGTCCTTGTA~TGTACCT~CT~T~T 982 TGTGTAAGACTTATTATTTTATCCTGAAACCTTTATAAAC CCGGTACCAGCTTTTAAACCC 1049 CGATACCGTCGACCTCGAFig. 1.Nucleotide sequence andderived amino acid sequence of human fetal adrenal HST.The start andstop codons are underlined.

58

KJ. Forbes et al. /Molecular

12

and Cellular Endocrinology 112 (1995) 53-M)

34

5

6

78

91011

HST 35kD? Fig. 2. Immunoblot analysis of V79 cells expressing human fetal adrenal HST. Cytosols WO pg protein) prepared from different passages of V79/HSThfa expressing HST enzyme activity with DHEA as substrate (lanes 6-11; passages 20-25, respectively) were subjected to irnmunoblot analysis using anti-rat liier HST coupled with enhanced chemihrminescence detection. Lanes 4 and 5 contained cytosol(100 pg) prepared from untransfected V79 cells cultured in the absence and presence of puromycin, respectively. Shown for comparison are adult human (100 fig, lane l), female (5 pg, lane 2) and male (5 pg, lane 3) rat liver cytosols.

not able to sulphate the xenobiotic 1-naphthol (which is a very good substrate for both human M-PST and P-PST (Jones et al., 1995)) nor oestrone. Determination of K, values for the sulphation of DHEA, androsterone, pregnenolone and testosterone (Table 2) showed that, with the exception of testosterone, the affinities of V79/HST-hfa and the HST activity present in human liver cytosol for these compounds were very similar, again supporting the view that HST is principally responsible for the sulphation of androsterone and pregnenolone. These data indicate that our stable cell line V79/HST-hfa expressing human fetal adrenal HST is a good model system for the study of HST. 4. Discussion A human fetal adrenal HST cDNA was isolated, sequenced and stably expressed in V79 cells. The protein encoded by this cDNA is essentially identical to that of adult human liver, both in amino acid sequence and catalytic properties. These results suggest that the major HST enzyme present in humans,

00 0

5

10

Passage Fig. 3. Stable expression of over 24 passages. Sulphation on 10000 x g supematants from mock-transfected V79

15

20

25

Number

human fetal adrenal HST in V79 cells of DHEA was determined in duplicate prepared from V79/HST-ha (O), or cells t n ) over a total of 24 passages.

whilst subject to tissue-specific and developmental regulation (e.g. Barker et al., 1994), is essentially the same gene product in adult liver and fetal adrenal. The mechanisms of this differential regulation remain to be determined. Various expression systems are available to analyse the functional properties of enzymes such as the human STs, and a number have been applied. For example, COS cells have been used for the transient expression of human liver HST, P-PST, M-PST and EST (e.g. Otterness et al., 1992; Wilborn et al., 1993; Wood et al., 1994; Aksoy et al., 19941, expression of human liver HST and P-PST in E. coli has been performed (Falany et al., 1994) and we have recently produced stable V79 cell lines expressing human platelet M-PSTs and P-PSTs (Jones et al., 1995). These various systems each have their own merits and disadvantages, and only by characterisation of these different systems for each individual isoenzyme will it be possible to define the optimum model. The substrate specificity data we obtained using V79/HST-hfa (Table 11, while in good agreement with that from e.g. Falany et al. (1994) for androgens, differs in that we did not find oestrone to be sulphated by this recombinant cell line, whereas it was sulphated by bacterially-expressed and partially purified recombinant human liver HST (Falany et al., 1994). The reasons for this are not immediately obvious, although it could be the result of the single amino acid change (Thr + Ser) in the deduced protein sequence of the HST isolated by Falany’s group (Comer et al., 1993) compared to our cDNA (Fig. 1). Also, bacterial expression of HST required some modification of the 5’ end of the human liver HST (nucleotide changes resulting in a serine to alanine amino acid change at position 2 - Falany et al., 1994), although this is unlikely to so dramatically affect the substrate specificity. Bacterial expression of our HST-hfa cDNA using a vector/host system which does not require alteration of the N-terminal amino acid sequence would possibly resolve this issue, as would site-directed mutagenesis of our HST to modify the threo-

59

KJ. Forbes et al. /Molecukzr and Cellular Endocrinology 112 (1995) 53-60 Table 1 Comparison of substrate specificities of V79/HSThfa

and human liver Human liver cytosol

V79/HSThfa

Substrate

Dehydroepiandrosterone Androsterone Pregnenolone 17a-Ethinyloestradiol Testosterone cortisol 1-Naphthol Oestrone

Specific activity

% of activity with DHEA

Specific activity

% of activity with DHEA

21.1 13.7 6.18 3.28 1.79 1.26 N.D. N.D.

100 65 29 16 9 6 N.D. N.D.

60.0

100 74 27 31 13 3 62 1

44.2 15.9 18.6 7.59 1.81 36.9 0.41

Specific activities are expressed as pmol/min/mg protein and were calculated from duplicate determinations of ST activity on a single sample of either 10000 X g supematant prepared from recombinant V79 cell homogenates or of human liver cytosol. N.D. = no detectable activity

nine at position 90 to serine. The observation that minor differences occur in the derived amino acid sequences of different HSTs is interesting in light of recent work which suggests that a genetic polymorphism for HST may exist in the human population (Aksoy et al., 1993b). Whilst the precise functions of adrenal C,, steroids are not fully understood, there is now evidence that these steroids are converted to androgens and estrogens, with the exception of androstene3/3,17pdiol, which could bind to the oestrogen receptor (Poortman et al., 1975; Adams et al., 1981). In fact, evidence exists that 3/3-hydroxysteroid dehydrogenase/A5-A4 isomerase, 17P-hydroxysteroid dehydrogenase, 5~-reductase, aromatase and sulphatase are expressed in a wide range of peripheral tissues (Evans et al., 1987; Labrie et al., 1991,1992; Martel et al., 1992; Thigpert et al., 19931, thus permitting the tissue-specific formation of potent androgens or oestrogens. Additional molecular analysis of the enzyme responsible, HST, will further our understanding of properties of these compounds. DHEAS has been implicated in protectTable 2 Comparision of the kinetic properties (K,) for the sulphation of a range of substrates by V79/HSThfa with human liver cytosol Substrate

DHEA Androsterone Pregnenolone Testosterone PAPS (DHEA as substrate)

V79/HSThfa

Human liver cytosol

2.7 2.6 1.0 2.2 2.7

3.7 5.7 4.4 10.9 1.6a

K, values were determined from duplicate assays on 10000 x g supematant prepared from V79/HSThfa cell homogenate and human liver cytosol and were calculated using the Regression software package (Blackwell Scientific). aK, for PAPS determined for purified adult human liver HST (Falany et al., 1989).

ing against cardiovascular disease (Barrett-Connor et al., 1986) and DHEA has a therapeutic effect on experimental models of diabetes in mice (Coleman et al., 19821, and therefore may be of potential therapeutic value in the treatment of various types of diabetes in humans. Decreased secretion of DHEA is associated with advancing age in both sexes (Orentreich et al., 1984) and it has been suggested that women with subnormal levels of DHEAS are at increased risk of breast cancer (Bulbrook et al., 1971). However, using cross-sectional and prospective analysis, Barrett-Connor et al. (1990) failed to find evidence to suggest a protective role for plasma DHEAS in breast cancer risk in postmenopausal women. DHEAS may also be used to ripen the uterine cervix and trigger the onset of labour late in pregnancy (Sasaki et al., 1982). The synthesis and metabolism of such an interesting compound with wide-ranging and potentially valuable properties is therefore worthy of further investigation. In rats, HST is also implicated in the bioactivation to potent mutagens of certain procarcinogens, particularly the benzylic alcohols of polycyclic aromatic hydrocarbons (e.g. Watabe et al., 1994; Czich et al., 1994). We have shown that these compounds are also bioactivated to mutagens by STs present in adult human liver cytosol (Glatt et al., 19941, although the enzymes involved have as yet not been unambiguously determined. The availability of stable cell lines such as V79/HST-hfa will also contribute to our understanding and appreciation of this important phenomenon. Acknowledgements

This work was supported by the following: Sir Jules Thorn Charitable Trust (MWHC), Action Research (MWHC, RH), Commission of the European Com-

60

K J. Forbes et al. /Molecular and Cellular Endocrinology 112 (I 995) S3-60

munities, contract number BMHl-CT92-0097 (MWHC, HRG). KJF was the recipient of two Toxicology Fellowships from the European Science Foundation. We are grateful to Andrew Cassidy for nucleotide sequencing and to Drs. Andreas Czich, Ingrid Bartsch and Alwen Jones for their helpful advice and discussion. References Adams, J., Garcia, M. and Rochefort, H. (1981) Cancer Res. 41, 4720-4726. Aksoy, LA., Ottemess, D.M. and Weinshilboum, R.M. (1993aJ Drug Metab. Dispos. 21, 268-276. Aksoy, LA., Sochorov , V. and Weinshilboum, R.M. (1993b) Clin. Pharmacol. Ther. 54,498-506. Aksoy, IA., Wood, T.C. and Weinshilboum, R. (1994) Biochem. Biophys. Res. Commun. 200,1621-1629. Artelt, P., Morelle, C., Ausmeier, M., Fitzek, M. and Hauser, H. (1988) Gene 68,213-219. Bamforth, K.J., DalgIeish, K. and Coughtrie, M.W.H. (1992) Eur. J. Pharmacol. 228, 15-21. Barker, E.V., Hume, R., HaIIas, A. and Coughtrie, M.W.H. (1994) Endocrinology 134,982-989. Barrett-CoMor, E., Khaw, K-T., Yen, S.S.C. (1986) N. Engl. J. Med. 315,1519-1524. Barrett-Connor, E., Friedlander, N.J. and Khaw, K-T. (1990) Cancer Res. 50,6571-6574 Bradford, M.M. (1976) Anal, Biochem. 72, 248-254. Bulbrook, R.D., Hayward, J.L. and Spicer, C.C. (1971) Lancet 2, 395-398. Coleman, D.L., Leiter, E.H. and Schwizer R.W. (1982) Diabetes 31, 830-833. Comer, K.A., Falany J.L. and Falany C.N. (1993) Biochem. J. 289, 233-240. Comer, KA and FaIany, C.N. (1992) Mol. Pharmacol. 41,645651. Czich, A., Bartsch, I., Dogra, S., Homhardt, S. and Glatt, H.R. (1994) Chem. Biol. Interact. 92, 119-128 de la Luna, S., Soria, I., Pulido, D., Ort!n, J. and JimCnez, A. (19881 Gene 62, 121-126. Dooley, T-P., Mitchison, H.M., Munroe, P.B., Probst, P., Neal, M., Sicihano, M.J., Deng, Z., Doggett, N.A., CaIIen, D.F., Gardiner, R.M. and Mole, SE. (1994) B&hem. Biophys. Res. Commun. 205, 482-489. Evans, C.T., Corbin, C.J., Saunders, CT., Merrill, J.C., Simpson, E.R. and Mendelson, C.R. (1987) J. Biol. Chem. 262,6914-6920. Falany, C.N. (1991) Trends Pharmacol. Sci. 12, 255-259. Falany, C.N., Vazquez, M.E. and KaIb, J.M. (1989) Biochem. J. 260, 64-646. Falany, C.N., Vazquez, M.E., Herouz, J.A. and Roth, J.A. (19901 Arch. Biochem. Biophys. 278, 312-318. Falany, C.N., Wheeler, J., Oh, T.S. and Falany, J. (1994) J. Steroid B&hem. Mol. Biol. 48,369-375. Forbes-Bamforth, K.J. and Coughtrie, M.W.H. (19941 Biochem. Biophys. Res. Connnun. 198,707-711. Glatt H.R., Seidel, A., Harvey, R.G. and Coughtrie, M.W.H. (1994) Mutagenesis 9, 553-557. Herouz, J.A. and Roth, J.A. (1988) Mol. Pharmacol. 34, 194-199. Hobkirk, R. (1985) Can. J. B&hem. Cell Biol. 63, 1127-1144. Jakoby, W.B., Sekura, R.D., Lyon, E.S., Marcus, C.J. and Wang,

J.-L. (19801 in Enzymatic Basis of Detozication (Jakoby, W.B., ed.1, pp. 199-228, Academic Press, New York. Jones, A.L., Roberts, R.C. and Coughtrie, M.W.H. (1993) Biochem. J. 296, 287-290. Jones, A.L., Hagen, M., Coughtrie, M.W.H., Roberts, R.C. and Glatt, H.R. (1995) Biochem. Biophys. Res. Commun. 208, 855-862. Kong, A.T., Yang, L., Ma, M., Tao, D. and Bjornsson, T.D. (1992) B&hem. Biophys. Res. Commun. 187,449-454. Korte, K., Hemsell, P.G. and Mason, J.I. (1982) J. Clin. Endocrinol. Metab. 55, 671-675. Kuss, E. (1994) Ezp. Clin. Endocrinol. 102, 135-165. Labrie, F.J., Simard, J., Luu-The, V., Trudel, C., Martel., C., Labrie, C., Zhao, E., Rhaume, E., Couet, J. and Breton, N. (1991) Int. J. Obesity 15,91-99. Labrie, F., Simard, V., Luu-The., V., Blanger, A. and Pelletier, G. (1992) J. Steroid Biochem. Mol. Biol. 43, 805-826. Martel, C.E., Rhaume, E., Takabasbi, M., TrudeI, C., Couet, J., Luu-The, V., Simard, J. and Labrie, F. (1992) J. Steroid Biochem. Mol. Biol. 41, 597-603. Mulder, G.J. and Jakoby, W.B. (1990) in Conjugation Reactions in Drug Metabolism (Mulder, G.J., ed.), pp. 107-161, Taylor & Francis, London. Ogura, K., Kajita, J., Narihata, H., Watabe, T., Ozawa, S., Nagata, K., Yamazoe, Y. and Kato, R. (1989) B&hem. Biophys. Res. Commun. 165, 168-174. Ogura, K., Kajita, J., Narihata, H., Watabe, T., Ozawa, S., Nagata, K., Yamazoe, Y. and Kato, R. (1990) Biochem. Biophys. Res. Commun. 166, 1494-1500. Orentreich, N., Brind, J.L., Rizer, R.L. and Vogehnan, J.H. (19841 J. Clin. Endocrinol. Metab. 59, 551-555. Ottemess, D.M., Wieben, E.D., Wood, T.C., Watson, R.W.G., Madden, B.J., McCormick, D.J. and WeinshiIboum, R.M. (1992) Mol. Pharmacol. 41, 865-872. Parker Jr, C.R., FaIany, C.N., Stockard, C.R., Stankovic, A.K. and Grizzle, W.E. (1994) J. Clin. Endocrinol. Metab. 78, 234-236. Poortman, J., Prenen, J.A.C., Schwarz, F. and Thijssen, J.H.H. (1975) J. Clin. Endocrinol. Metab. 40, 373-379. Radominska, A., Comer, K.A., Zimniak, P., Falany, J., Iscan, M. and FaIany, C.N. (1990) Biochem. J. 272,597~604. Sasaki, K., Nakano, R.. Kadoya, Y., Iwao, M., Shima, K. and Sowa, M. Br. J. Obstet Gynaecol. 89, 195-198. Sharp, S., Barker, E.V., Coughtrie, M.W.H., Lowenstein, P.R. and Hume, R. (1993) Eur. J. B&hem. 211,539-548. Thigpen, A.E., Silver, RI., Guileyardo, J.M., Casey, M.L., McConnell, J.D. and Russell, D.W. (1993) J. Clin. Invest. 92, 903-910. Watabe, T., Ogura, K., Satsukawa, M., Okuda, H. and Hiratsuka, A. (1994) Chem. Biol. Interact. 92, 87-105. Weinshilboum, R. and Ottemess, D. (1994) in Conjugation-Deconjugation Reactions in Drug Metabolism and Toxicity (Kauffman, F.C., ed.), pp. 45-78, Springer-Verlag, Berlin. Wilbom, T.W., Comer, K.A., Dooley, T.P., Reardon, I.M., Heinrikson, R.L. and Falany, C.N. (1993) Mol. Pharmacol. 43, 70-77. Wood, T.C., Aksoy, I.A., Aksoy, S. and Weinshilboum, R.M. (1994) Biochem. Biophys. Res. Commun. 198, 1119-1127. Xhu, X., Veronese, M.E., Bernard, C.C.A., Sansom, L.N. and McManus, M.E. (1993) B&hem. Biophys. Res. Commun. 195, 120-127. Yamazoe, Y., Nagata, K., Ozawa, S. and Kato, R. (1994) Chem. Biol. Interact. 92, 107-117.