Human Hair Keratin‐Associated Proteins (KAPs)

Human Hair Keratin‐Associated Proteins (KAPs) Michael A. Rogers,* Lutz Langbein,{ Silke Praetzel‐Wunder,{ Hermelita Winter,* and Ju¨rgen Schweizer* *Section of Normal and Neoplastic Epidermal DiVerentiation German Cancer Research Center, Heidelberg, Germany Division of Cell Biology, German Cancer Research Center Heidelberg, Germany

{

Elucidation of the genes encoding structural proteins of the human hair follicle has advanced rapidly during the last decade, complementing nearly three previous decades of research on this subject in other species. Primary among these advances was both the characterization of human hair keratins, as well as the hair keratin associated proteins (KAPs). This review describes the currently known human KAP families, their genomic organization, and their characteristics of expression. Furthermore, this report delves into further aspects, such as polymorphic variations in human KAP genes, the role that KAP proteins might play in hereditary hair diseases, as well as their modulation in several different transgenic mouse models displaying hair abnormalities. KEY WORDS: Keratin‐associated protein, Hair follicle, Gene expression, Polymorphism, Keratin, Genodermatosis. ß 2006 Elsevier Inc.

I. Introduction One of the most fascinating and current areas of scientific study is the development and diVerentiation of the hair follicle. Growing downward from the embryonal epidermis, the hair follicle develops into one of the morphologically most complex structures of the human body, consisting of 7–8 distinct tissue compartments (Fig. 1). This epidermal appendage is largely active throughout the life of an individual, undergoing continual cycles of proliferation (anagen), regression (catagen), and quiescence (telogen; This International Review of Cytology, Vol. 251 Copyright 2006, Elsevier Inc. All rights reserved.

209

0074-7696/06 $35.00 DOI: 10.1016/S0074-7696(06)51006-X

210

ROGERS ET AL.

FIG. 1 The various tissue compartments of the human anagen hair follicle. This figure is a modification of Hoepke, 1927.

process is best understood in mice, see Muller‐Rover et al., 2001). The mature anagen hair follicle is often seen as a rod‐like series of concentric cell sheaths, the outermost sheath being the multilayered outer root sheath (ORS), followed by a single cell layer, termed the companion layer (Fig. 1). Medial to these layers is the inner root sheath (IRS), which is further subdivided into three compartments, the Henle layer (outermost), the Huxley layer (central), and the IRS cuticle (inner). The hair fiber fills the center of this multilayered cylinder, and is also subdivided into several regions, those being the hair cuticle, which lies adjacent to the IRS cuticle, and the cortex which comprises the major body of the hair fiber. Occasionally, in the center of the hair fiber there is a column of cells termed the medulla (Fig. 1). In humans, this column occurs in all sexual hairs, but is also present to a varying degree in scalp hairs.

HUMAN KERATIN‐ASSOCIATED PROTEINS

211

At the base of the hair follicle is a region known as the bulb. A part of this structure consists of dermal fibroblasts (the dermal papilla), which appear important for morphogenesis and hair follicle cycling. Surrounding these cells is the so‐called matrix cell region, which comprises the proliferative compartment of the hair follicle (Fig. 1). These cells divide and diVerentiate, forming, with the exception of the ORS, the various compartments of the hair follicle, in addition to producing the main structural components of hair, the hair keratins, and their associated proteins, KAPs. Keratins, a subset of the intermediate filament protein superfamily, comprise one of the major groups of structural proteins in epithelial cells and have been a point of study for nearly 50 years (Fuchs and Weber, 1994; Langbein and Schweizer, 2005; Rogers, 2003; Steinert and Roop, 1988). Keratin proteins can be divided into two major families, the type I (acidic) keratins and the type II (basic‐neutral) keratins. Keratin intermediate filaments (KIFs) consist of higher ordered copolymers of individual, type I and type II family members, whose structural organization has been an area of intense study during the last several decades (Steinert et al., 1994). In general, keratins have been most completely studied in humans. The 54 functional genes of the two keratin families are clustered together on human chromosome 12q13.13 (26 type II members and one type I member) and 17q21.2 (27 type I members) (Hesse et al., 2004; Rogers et al., 2004a, 2005), and the tissue‐specific expression of keratin genes has been well studied (Langbein et al., 1999, 2001; Moll, 1993; Moll et al., 1982). Keratin proteins show strong amino acid sequence conservation, especially in the central portions of the molecules (the so‐called rod domains), which possess four series of a‐helical subdomains, termed the 1A, 1B, 2A, and 2B regions, separated by three short non‐helical linker regions (termed L1, L1/2, and L2, see Fig. 2a, Fuchs and Weber, 1994; Steinert et al., 1985). The head and tail domains are largely globular in nature, and often show sequence conservation among the individual members of each family. This has allowed the further subdivision of the head and tail regions of many keratins into end (E), variable (V), and homologous (H) domains. Further diVerences in protein properties allow an additional division of the proteins of both families into epithelial (cyto‐) keratins and hair (trichocytic‐ or ‘‘hard’’) keratins (For a detailed review of keratins found in the hair follicle, see Langbein and Schweizer, 2005). For example, epithelial keratins often possess head and tail domains rich in glycine and serine, and several epithelial keratins exhibit polymorphic variants due to diVerences in the number of amino acid repeats of the form GGX (Hanukoglu and Fuchs, 1983; Korge et al., 1992a,b). Although these domains usually have low proline content and no cysteine residues, hair keratins possess a high cysteine and proline content in their head and tail domains (Dowling et al., 1986; Rogers et al., 1998, 2000; Tobiasch et al., 1992; Winter et al., 1994).

212

ROGERS ET AL.

DiVerences also exist in the gene structure of type I epithelial and hair keratins (Johnson et al., 1985; Krieg et al., 1985; Rogers et al., 1998, 2000, Tyner et al., 1985; Wilson et al., 1988) (Fig. 2b). While both type II epithelial and hair keratin genes contain 9 exons and 8 introns, type I epithelial keratin genes consist of 8 exons and 7 introns. All of the exons contain protein‐ encoding sequences. In contrast, type I hair keratin genes possess 7 exons, and most of the gene intron‐exon boundaries are shared with those of the epithelial keratins (Fig. 2b). Initial electron microscopic evaluation of keratin intermediate filaments seen in cross sections of sheep wool stained with osmium tetroxide showed a striking, nearly crystalline arraying of filaments into bundles that were imbedded in an amorphous osmophilic mass, termed the hair matrix (Birbeck and Mercer, 1957a,b; Rogers, 1959a,b). It should be noted that confusion often arises with this term, for the region of the hair follicle in which cell proliferation occurs (the lower bulb region) is traditionally called the hair follicle matrix region. In this review, matrix refers to the osmophilic mass found between KIFs of precortical and cortical cells, and matrix cells refer to the proliferative cell region of the follicle. Moreover, in electron microscopic cross‐sections of merino sheep wool, diVerent types of IF bundling were observed. In the so‐called paracortical region, the intermediate filaments were loose and the amount of surrounding matrix large. Orthocortical

FIG. 2 Keratin protein and gene structure. (a) Proteins: 1A, 1B, 2A, and 2B designate a‐helical regions; L1, L1/2, and L2 are linker regions. The double headed arrow delineates the rod domain. (b) Genes: Boxes show exons. Black boxes, exons that encode the rod domain; grey boxes, amino and carboxyterminal portions of exon; white boxes, 50 and 30 noncoding regions of exon. Asterisks, exons in which the structural borders (1A, L1, 1B, L1/2, 2A, L2, 2B) seen in Figure 2A occur.

HUMAN KERATIN‐ASSOCIATED PROTEINS

213

regions, in contrast, showed tight packing of IF bundles with less matrix substance found between them. In addition, a third type of IF packing, the so‐called mesocortical packing, was also occasionally found, which resulted in a very tight, near hexagonal arrangement of the IF bundles with very little matrix seen between the bundles (Fig. 3, for a comprehensive review see Powell and Rogers, 1997). In wool there appeared to be a relationship between the presence of orthocortical/paracortical regions and the crimp or bending of the wool fiber, the paracortex usually following the inside of the bend. However, the presence of ortho‐, para‐, and mesocortical regions were highly variable both among diVerent strains of sheep as well as in other mammals. In human hairs no such striking morphological division comparable to that in merino sheep has been observed, but cells exhibiting orthocortical and paracortical packing were also seen (Swift, 1997). Concomitant with attempts to discern the nature of the intermediate filaments were eVorts to determine what composed the amorphous mass surrounding the KIF bundles. One indication that the matrix might be composed of molecules, perhaps proteins, high in sulfur content was the fact that the osmium tetroxide stain used to visualize the amorphous mass in electron microscopy was known to bind well to sulfhydryl groups (Bahr,

FIG. 3 Transmission electron micrograph of sheep wool showing ortho/paracortical subdivision. Light area‐IF bundles; Dark areas‐hair matrix. The picture is a generous gift of Professor George E. Rogers, Adelaide University, Adelaide, Australia.

214

ROGERS ET AL.

1954). Work by several laboratories led to the development of biochemical separation techniques (diVerential fractionation and two‐dimensional gel electrophoresis) for both keratins and a large number of small proteins assumed to be the matrix components (keratin‐associated proteins, KAPs, see Fig. 4. For comprehensive reviews see Crewther, 1976; Gillespie, 1983). One of these methods, namely reduction and denaturation of the highly cross‐linked wool fiber, followed by diVerential precipitation of individual fractions based on diVerences in protein solubility, resulted in the isolation of groups of proteins, each exhibiting distinctive biochemical properties (Gillespie, 1983). In the end, the wool proteins could be divided into three groups, the first consisting of proteins with a relatively low sulfur composition, which upon further analysis were shown to represent the KIF proteins. The second group was shown by amino acid analysis to be rich in cysteine, threonine, and proline (i.e., the ‘‘high sulfur KAP proteins’’ in their widest sense). In contrast, the third group exhibited a relatively high glycine and

FIG. 4 One separation scheme used for the isolation of wool keratin‐associated proteins, KAPs. The figure was derived from Gillespie, 1983.

HUMAN KERATIN‐ASSOCIATED PROTEINS

215

tyrosine amino acid content (i.e., the ‘‘high glycine‐tyrosine’’ KAP proteins in their widest sense). Further fractionation of the proteins of this group resulted in their subclassification into the type I high glycine‐tyrosine KAP proteins, which possessed a moderate percentage of these amino acids, and the type II glycine‐tyrosine KAP proteins which exhibited a high percentage (Gillespie, 1972). The high sulfur KAPs of sheep wool were also further divided, somewhat arbitrarily, into high sulfur KAPs, which contained less than 30 mol % cysteine and ultrahigh sulfur KAPs, which possessed more than 30 mol % cysteine (Gillespie and Broad, 1972; Gillespie and Reis, 1966; Powell and Rogers, 1997). Two‐dimensional gel electrophoresis showed that a large number of high/ ultrahigh sulfur and high glycine‐ tyrosine KAPs existed (50–100) and that these proteins were relatively small in size (ca. 10–30 kDa). These biochemical separation techniques allowed, in the end, the amino acid sequencing of several wool KAP family members (Elleman, 1971, 1972a,b; Elleman and Dopheide, 1972; Parris and Swart, 1975; Swart and Haylett, 1971, 1973). These members were divided, based on their isolation characteristics, into the high sulfur B2 (later termed the KAP1 family, see Section II.B.1), B3A (KAP2 family), and B3B (KAP3 family). In addition, one high glycine‐tyrosine member was also characterized by amino acid sequencing (Dopheide, 1973). Thereafter, the advent of molecular cloning techniques allowed the discovery of several new members of the high sulfur (Aoki et al., 1998; Cole and Reeves, 1998; Frenkel et al., 1989; Huh et al., 1994; Kuhn et al., 1999; Mitsui et al., 1998; Powell et al., 1983; Swart et al., 1976; Takaishi et al., 1998), ultrahigh sulfur (Fratini et al., 1994; Jenkins and Powell, 1994; MacKinnon et al., 1990; McNab et al., 1989; Perez et al., 1999; Powell et al., 1995) and high glycine‐tyrosine (Aoki and Ito, 1997; Fratini et al., 1993; Kuczek and Rogers, 1985, 1987) KAP families in sheep, rabbit, rat and mouse by isolation of their cDNA or gene sequences. The increasing diversity of the KAPs, coupled with their non‐ uniform naming, led Powell and Rogers to suggest a new nomenclature (Powell and Rogers, 1997; Rogers and Powell, 1993), dividing the KAP members of all species known at that time into 11 families. The previous high sulfur KAPs were ordered into the KAP1–3 and KAP10–11 families, the ultrahigh sulfur KAPs into the KAP4, KAP5, and KAP9 families and the high glycine‐tyrosine KAPs into the KAP6–8 families. As will be seen in the following section on human KAPs, further bioinformatic analysis of KAP genes from all species described since the nomenclature change has resulted, to date, in the description of a total of 23 families, 21 of them in humans (Rogers et al., 2001, 2002, 2004b; Yahagi et al., 2004). Recently, the Human Genome Nomenclature Committee has adopted a standardized nomenclature for human KAP gene sequences. This consists of the gene designation KRTAP (for keratin‐associated protein) followed by the family number, thereafter a hyphen, and a number designating the specific gene in

216

ROGERS ET AL.

the family (e.g., KRTAP5‐1 for the gene; KAP5.1 for its protein). Finally, although the majority of the KAP gene/cDNA/protein sequences known at the time of the review by Powell and Rogers (1997) were non‐human, three reports on human KAP gene sequences already existed for two members of the KRTAP1 (Zhumbaeva et al., 1992), and for two members of the KRTAP5 gene family (MacKinnon et al., 1990; Perez et al., 1999).

II. Hair Keratin‐Associate Proteins (KAPs) A. KAP Gene Domains In the past, a multitude of data pointed to the grouping of KAP genes in mammalian genomes. For example, the original isolation of genes for several members of the sheep B2 (KAP1) family showed the presence of two of these genes on a single l‐clone (Powell et al., 1983). Thereafter, several such colocalizations were described in mammals, either through sequencing of the genes (Kuhn et al., 1999; Zhumbaeva et al., 1992) or by showing multiple, KAP‐specific hybridization patterns on P1 Artificial Chromosome (PAC) or cosmid clones (Cole and Reeves, 1998; MacKinnon et al., 1990). The recent sequencing of the entire human genome provided the ideal model for analyses of KAP genes in mammals, and confirmed the assumption that KAP genes were organized into domains. To date, five domains of KAP genes are known in humans (Fig. 5) (Rogers et al., 2001, 2002, 2004b; Yahagi et al., 2004). While the high/ultrahigh sulfur KAP genes are spread across five regions of the human genome (17q21.2, 21q22.1, 21q22.3, 11p15.5, and 11q13.4), high glycine‐tyrosine KAP genes are found in only one region, namely imbedded into the high sulfur KAP gene domain on chromosome 21q22.1. The first published domain was a ca. 350 kb region on chromosome 17q21.2 (Fig. 5a). Originally this was thought to consist of 37 functional KAP genes and four KAP pseudogenes, but was later shown to harbor only 33 functional genes (Kariya et al., 2005; Rogers et al., 2001; see also Section II.C). Particularly interesting was the fact that this KAP gene cluster was embedded into the type I keratin gene domain, being inserted between the hair keratin genes KRTHA3A and KRTA36 (Rogers et al., 2001, 2004a; see also Fig. 5a). Somewhat later, two further domains of KAP genes were found on chromosome 21. The first consisted of a ca. 525 kb region on chromosome 21q22.1 (Fig. 5b), and contained 17 functional high glycine‐ tyrosine‐KAP and 7 functional high sulfur‐KAP genes, as well as nine KAP pseudogenes (Rogers et al., 2002). The second domain, found on chromosome 21q22.3, was recently reported by two separate groups (Fig. 5c). While

HUMAN KERATIN‐ASSOCIATED PROTEINS

FIG. 5 (continued)

217

218

ROGERS ET AL.

FIG. 5 Physical maps of the five human KAP gene domains. (a) Chromosome 17q21.2 domain; (b) Chromosome 21q22.1 domain; (c) Chromosome 21q22.3 domain; (d) Chromosome 11p15.5 domain; (e) Chromosome 11p13.4 domain. Black boxes, KAP gene loci; white boxes, KAP pseudogenes; gray boxes, keratin genes. The names of the genes are written below the boxes. Due to space considerations, the Human Genome Nomenclature Committee names (KRT, KRTAP) were not used. Double designation (i.e., 4.1/4.10, etc.) in (A) indicate polymorphic genes originally described as gene loci. c designates pseudogenes. Horizontal black arrows, direction of transcription; Black lines, bacterial artificial chromosome (BAC) clones of the region of interest. Accession number for these BAC clones are written below the black lines. The figure was derived from (Rogers et al., 2001, 2002, 2004b; Yahagi et al., 2004; and unpublished observations).

Rogers et al. (2004b) discovered a ca 165 kb (erroneously named 90 kb in the original paper) domain consisting of 16 high sulfur KAP genes and two KAP pseudogenes, Shibuya et al. (2004b) found the same number of functional KAP genes, but also three additional KAP pseudogenes. Especially interesting was the discovery that all of the KAP gene loci lying on this domain were part of the intron sequences for c21ORF29/TSPEAR (Shibuya et al., 2004b), a gene probably important in the pathogenesis of epilepsy (Scheel et al., 2002). This nesting of genes within another gene is not novel, one important example being the location of the T‐cell receptor delta chain genes within the T‐cell receptor alpha chain locus (Chien et al., 1987). Finally, two more domains of human KAP genes were found on chromosome 11 (Yahagi et al., 2004). One domain was present on chromosome 11p15.5 and contained 6 ultrahigh sulfur KAP gene loci (Fig. 5d); the second domain was found on chromosome 11q13.4 and harbored 5 ultrahigh sulfur KAP genes and two KAP pseudogene (Fig. 5e; note that we had also analyzed this region at this time and came to the conclusion that one of the pseudogenes might be

HUMAN KERATIN‐ASSOCIATED PROTEINS

219

functional, see Section II.B.5). These two KAP gene clusters may have arisen through domain duplication, for they all contain highly similar members of the same KAP family. The KAP genes on the five domains exhibit common characteristics. All of them are relatively small in size (ca. 1 kb) and all, in general, possess only a single exon (Rogers et al., 2001, 2002, 2004b; Shibuya et al., 2004b; Yahagi et al., 2004), although one report shows evidence for putative cryptic splicing of two KAP genes (Shibuya et al., 2004b). Both exon size and number are in agreement with KAP gene sequence data from other species (Kuczek and Rogers, 1987; Kuhn et al., 1999; Powell et al., 1983). Interestingly, strong evidence also exists for deletion polymorphisms in several of the human KAP genes (Kariya et al., 2005; Shimomura et al., 2002b; see Section II.C). In any given domain, no unified direction of KAP gene transcription is found. Also of interest is the gene density of the human KAP gene domains which, similar to keratin genes, is fairly high, ranging on average one gene per 9–20 kb. This value is 2 to 4 times higher than the average density of chromosome 19, the chromosome with the highest known gene density (Venter et al., 2001).

B. KAP Families and Their Members Like in other species, human KAP proteins can be placed into families based on similarities in their amino acid sequences. A relatively simple and eVective method to discern these similarities is to perform multiple amino acid sequence alignments of human, as well as other mammalian KAP sequences, using a sequence homology program such as CLUSTAL (Higgins et al., 2000) and then determine homology relationships between proteins using a graphical evolutionary tree building program such as CLUSTREE (Saitou and Nei, 1987, see Fig. 6a–c). Visual comparison of KAP protein amino acid homologies, which group together using this method, has largely confirmed its correctness, at least for KAP proteins (Figs. 7–9). The results obtained, however, vary strongly in their statistical significance due to the degree of repetitiveness of individual KAP members and the resulting software‐ induced gap formation. As such, this method is probably not a reliable measure of evolutionary development for these proteins. There are 21 human KAP families, termed KAP1–KAP13, KAP15– KAP17, and KAP19–KAP23. In addition, two further KAP families (KAP14 and KAP18), found only in mouse, have also been proposed (Rogers et al., 2002, see also Fig. 6b, color section). Very little is known about human KAP proteins, per se, for nearly all biochemical analysis has been performed primarily on sheep wool KAPs (see Section I). As such, what we do know about KAP amino acid sequences and the resulting division of KAP proteins into families has been primarily based on evaluation of the

220 FIG. 6a

221 FIG. 6b

FIG. 6c

HUMAN KERATIN‐ASSOCIATED PROTEINS

223

derived amino acid translations of human KAP genomic DNA sequences. In general, the individual KAP families can be distinguished based on four characteristics, (1) cysteine‐, glycine‐tyrosine amino acid content, (2) common head and tail motives, (3) the type and degree of repeat structures, and (4) unique motifs often found in individual families. The following is a short description of the human KAP gene families and their encoded proteins. 1. High/Ultrahigh Sulfur KAP Families on Chromosome 17q21.2 a. KAP 1 Family This family consists of four gene members KRTAP1‐1B, KRTAP1‐3, KRTAP1‐4, and KRTAP1‐5 (Rogers et al., 2001; see also Figs. 5a, 6a, and 7a). In addition, six other members (KRTAP1‐1A, KRTAP2, KRTAP1‐6, KRTAP1‐7, KRTAP1‐8, and KRTAP1‐9) have also been described, but were shown in follow‐up studies to be deletion polymorphisms of the KRTAP1‐1B and KRTAP1‐3 genes (Shimomura et al., 2002a,b, 2003; see also Section II.C). This KAP family is orthologous to the original B2 KAP family found in sheep and rat (Elleman, 1972a,b; Elleman and Dopheide, 1972; Mitsui et al., 1998). The encoded proteins fall into the group of high sulfur KAPs, showing 24.1–26.5 mol % cysteine, as well as a high amount of serine (12.9–17.5 mol %) and glycine (8.6–11.4 mol %) residues (Fig. 7a). The protein size ranges from 12.3–18.2 kDa, making them one of the larger KAP proteins. In addition, the proteins possess varying numbers of dimeric cysteine containing pentameric repeats, but exhibit two regions that appear specific for this family (see gray bars in Fig. 7a). b. KAP2 Family This KAP family consists of five gene members, termed KRTAP2‐1A, KRTAP2‐1B, KRTAP2‐2, KRTAP2‐3, and KRTAP2‐4 (Rogers et al., 2001), which are orthologs of the sheep B3A family (Figs. 5a, 6a, and 7b; Parris and Swart, 1975). KRTAP2‐1A and KRTAP2‐1B are two separate neighboring gene loci that encode the same amino acid sequence. All in all, the KAP2 high sulfur proteins are extremely homologous (over 97% identity) and possess the same number of amino acids (Fig. 7b). Major diVerences exist,

FIG. 6 Identification of KAP family members by evolutionary tree analysis. (a) High and ultrahigh sulfur KAPs. (b) High glycine‐tyrosine KAPs. (c) Segregation of the new KAP5 family from other high/ultrahigh sulfur KAPs. Vertical names, designate KAP amino acid sequences; black and green names, human (the names in green designate the two previously described KAP5 family members); blue names, sheep; red names, mouse; yellow names, rat; violet names, rabbit. Horizontal text denotes the clustering of KAPs from all species into common families. Homology analyses of complete KAP amino acid sequences were performed using the CLUSTAL program (Higgins and Sharp, 1988); graphical representation was made using the program CLUSTREE (Saitou and Nei, 1987). Accession numbers for all of the sequences can be found in Rogers et al. (2001, 2002, 2004b, and Table I).

224

ROGERS ET AL.

however, in the 50 and 30 noncoding regions of their respective genes. KAP2 proteins are ca. 13.5 kDa in size which makes them smaller than the KAP1 family members. Their cysteine content is only slightly higher, ranging from 27.3–28.1 mol %. KAP2 proteins contain a high proline content, as well as a high amount of serine‐threonine residues (10.1 and 11.7 mol %, respectively). KAP2 family members also possess several dimeric cysteine containing pentameric repeat structures; serine, threonine, proline, or valine are often found in positions 4–5 of these pentamers (see boxed regions in Fig. 7b).

c. KAP3 Family The KAP 3 gene family consists of three members, KRTAP3–1, KRTAP3–2, and KRTAP3–3 (Figs. 5a, 6a) and are the orthologs of the sheep B3B family (Frenkel et al., 1989; Haylett et al., 1971; Swart and Haylett, 1971). These proteins are the smallest of the high sulfur KAPs, ca. 10.3–10.5 kDa in size (Fig. 7c). Similar to the members of the KAP2 family, the KAP3 proteins have the same number of amino acids and show a fairly strong sequence identity (ca. 71%). The cysteine content of the proteins (18.4–19.4 mol %) is lower than that seen in the KAP1 and KAP2 proteins, but like the KAP2 proteins, the KAP3 members have a high proline and serine/threonine content. Interestingly, only a weak repeat structure is found in this family (Fig. 7c).

d. KAP4 Family This ultrahigh sulfur KAP family is striking due to its large number of members, their size heterogeneity, and the rigid repeat structure that they possess. Originally, 15 gene member have been described, KRTAP4‐1 to KRTAP4‐15 (Rogers et al., 2001), which are the human orthologs to individual KAP genes found in sheep and rabbit (Figs. 5a and 6a) (Fratini et al., 1994; Powell et al., 1995). However, the recent completion of the genomic region that harbors these genes has shown that four genes, KRTAP4‐1, KRTAP4‐4, KRTAP4‐6, and KRTAP4‐11 have polymorphic variants (KRTAP4‐10, KRTAP4‐13, KRTAP4‐15, and KRTAP4‐14, respectively; see Kariya et al., 2005), which reduces the number of gene loci to 11. The amino acid content of KAP4 proteins is interesting, for 6–7 amino acids make up the great majority of residues found in these proteins, these being cysteine (33.6–36.7 mol %) and serine (5.6–118. mol %), followed by proline, arginine, threonine, glutamine, and valine (Fig. 7d). This paucity of other amino acids is reflected in the repeat structures of the KAP4 family members, which consist of concatenates of monocysteine‐ and dicysteine‐containing pentameric repeats that cover a large portion in the midsection of the protein. The repeat begins invariantly with cysteine in positions 1 and/or 2. Proline is often found in position 4, and serine and threonine are frequently found in positions 4 and 5 of the pentamer (Fig. 7d).

HUMAN KERATIN‐ASSOCIATED PROTEINS

FIG. 7 (continued)

225

ROGERS ET AL.

226

FIG. 7 (continued)

HUMAN KERATIN‐ASSOCIATED PROTEINS

227

FIG. 7 Representative amino acid alignments of human individual high/ultrahigh KAP family members with orthologous sequences from other species. (a) KAP 1.3; (b) KAP2.1; (c) KAP3.1; (d) KAP4.6; (e) KAP9.4; (f) KAP10.1; (g) KAP11.1; (h) KAP12.1; (i) KAP13.1; (j) KAP15.1; (k) KAP16.1; (l) KAP17.1; (m) KAP23.1. Asterisks indicate amino acid identity; dots, amino acid homology. Hyphens in a sequence represent spaces generated by the CLUSTAL program. Boxed sequences, repeat structures. The accession number of the respective DNA sequence from which the amino acid translations were made can be found in Rogers et al. (2001, 2002, 2004b).

e. KAP9 Family There are eight genes (KRTAP9‐1 to KRTAP9‐8) encoding this family of ultrahigh sulfur KAP proteins (Rogers et al., 2001), and are, as a family, orthologous to mouse KRTAP9‐1 (McNab et al., 1989). In the original article describing the human KAP9 gene family, two members KAP9.8 and KAP9.9 were only found as isolated cDNA sequences. Recently, a genomic sequence highly similar to the KAP9.8 cDNA was found located between KRTAP9‐3 and KRTAP9‐4 on chromosome 17q21.2 (unpublished data, see Fig. 5a). The KAP9.9 cDNA shows strong similarity to

228

ROGERS ET AL.

KRTAP9‐5 and is currently presumed to have arisen as a deletion polymorphism of this gene (see Section II.C). Like the KAP4 proteins, KAP9 proteins are heterogeneous in size (16.4–26.3 kDa) and exhibit a multitude of pentameric monocysteine‐ and dicysteine‐ (31.3–32.7 mol %) containing repeat structures (Fig. 7e). In addition, the KAP9 proteins possess a high proline, serine, and glycine content and a still higher content of serine. Unlike the KAP4 proteins, the KAP9 proteins contain two domains of family‐specific amino acid sequence motifs (see gray bars in Fig. 7e). f. KAP16 Family This family contains only one gene, KRTAP16–1, which possesses fairly low homology to the other KAP family members, the highest known of those (ca. 50% homology) being the KAP10 family (see Section II. B.4). As such, this gene was given a separate family designation (Figs. 5a and 6a; Rogers et al., 2001). Also, similar to the KAP10 proteins, KAP16–1 is the largest KAP protein known (53.9 kDa). The KAP16.1 amino acid content has nearly equal amounts of cysteine and serine (18.4 and 18.6 mol %, respectively), followed by valine and proline (Fig. 7k). The protein contains repeat structures, which are, however, not as conserved as in other families. They show both pentameric and decameric characteristics, containing cysteine, proline, and valine as major components (Fig. 7k). g. KAP17 Family The single gene of this ultrahigh sulfur KAP family KRTAP17‐1 also possesses a low homology to other KAP families, with the possible exception of the KAP5 family members (ca. 50% identity). As such, it was also given its own family designation (Figs. 5a and 6a; Rogers et al., 2001). The KAP17‐1 protein is small (9.5 kDa). Similar to the KAP5 proteins (see following), 75% of the protein is composed of three amino acids, cysteine (36.2 mol %), glycine (29.5 mol %), and serine (11.4 mol %) (Fig. 7l). The repeat structure of KAP17–1 is diYcult to discern, but apparently consists of partially overlapping segments, often pentameric, exhibiting patterns such as CCGCG or G/SSCCG (Fig. 7l). In addition, KAP17‐1 does not possess the conserved, penultimate carboxyterminal motif common to members of the KAP5 family (see Section II.E and Fig. 9).

2. High Sulfur KAP Families on Chromosome 21q22.1 a. KAP11 Family KRTAP11‐1 is the only gene member of the human KAP11 family (Rogers et al., 2002) and is the ortholog of hacl1, a mouse cDNA isolated as a byproduct in the search for O6‐methylguanine DNA methyltransferases (Figs. 5b and 6a; Huh et al., 1994). The protein is 17.1 kDa in size and, like KAP1 and KAP2 family members, has a moderately high cysteine (12.8 mol %), serine (14.7 mol %), and threonine (14.1 mol %)

HUMAN KERATIN‐ASSOCIATED PROTEINS

229

content and possesses both monocysteine‐containing pentameric, as well as decameric repeat structures (Fig. 7g).

b. KAP13 Family This family was originally identified as a cDNA sequence (termed 4C32) which was expressed during the embryonic development of mouse skin (Figs. 5b and 6a; Takaishi et al., 1998). The human KAP13 gene family consists of four members, KRTAP13‐1 to KRTAP13‐4 (Rogers et al., 2002). The encoded proteins range from 17.8 to 18.2 kDa in size, and interestingly, contain a higher serine (20.6–23.4 mol %) than cysteine (12.0–12.8 mol %) content, followed by glycine and tyrosine (Fig. 7i). This family exhibits both pentameric and decameric single cysteine repeat structures, but the decameric structures are more pronounced in the single known mouse protein.

c. KAP15 Family This family consists of a single gene KRTAP15‐1 in humans (Rogers et al., 2002), which is orthologous to pmg2, a mouse KAP gene isolated together with a further neighboring KAP gene member, pmg1 (Figs. 5b and 6a; Kuhn et al., 1999). Pmg1 and pmg2 only possess ca. 50% homology to each other. Pmg1, however exhibits a strong homology to an additional mouse KAP cDNA sequence, originally termed mKAP13–1 (Aoki et al., 1998). This cDNA has only a weak relationship to the KAP13 family members previously described and therefore, the names for mKAP13.1 and pmg1 were recently re‐designated mKAP14.1 and mKAP14.2, and pmg2 renamed mKAP15.1 (Rogers et al., 2001). In humans, no functional KAP14 family member is known, but a pseudogene adjoining KRTAP15–1 (c13A, Fig. 5b) might be the ortholog of the mouse KAP14 family (Rogers et al., 2001). The human KAP15.1 protein is 14.9 kDa in size and, like the KAP12 family, possesses a lower cysteine (10.9 mol %) than serine (18.3 mol %) content (Fig. 7j). Glycine and tyrosine are also strongly represented. KAP15.1 contains few repeats, which, however, have a unique (SLG/DCG) pentameric structure (Rogers et al., 2002).

d. KAP23 family The KRTAP23‐1 gene is the sole member of this family (Fig. 5B) and was so named because its protein segregated independently from the proteins of the KAP13 family, to which it exhibits the closest homology (Fig. 6a, see color section; Rogers et al., 2002). KAP23.1, 6.9 kDa in size, is smaller than the KAP13 proteins, but like these possesses a higher serine (20.1 mol %) than cysteine (7.7 mol %) content as well as major amounts of leucine and glycine (Fig. 7m). This protein does not contain an obvious repeat structure.

230

ROGERS ET AL.

3. High Glycine‐Tyrosine KAP Families on Chromosome 21q22.1 a. KAP6 Family This family corresponds to the type II glycine‐tyrosine KAP proteins found in sheep, rabbit, and mice (Figs. 6b and 8a; Aoki and Ito, 1997; Fratini et al., 1993; Gillespie, 1991; Tkatchenko et al., 2001). Three members of this gene family exist in humans, termed KRTAP6–1 to KRTAP6–3 (Fig. 5b; Rogers et al., 2002). Like all high glycine‐tyrosine KAPs, the three proteins are small, ranging in size from 7.3 to 11.1 kDa, and possess a high glycine (32.3–38.0 mol %) and tyrosine (18.2–24.2 mol %) as well as a large cysteine and serine content (Fig. 8a). The central portions of these proteins consist of repetitive units of glycine‐tyrosine and glycine‐ tyrosine‐glycine residues (Rogers et al., 2002). b. KAP7 Family The gene for KRTAP7‐1, the only member of this family in humans (Rogers et al., 2002), shows strong homology to the single known sheep KAP7 member, component C2 (Figs. 5b and 6b; Kuczek and Rogers, 1987). The human KAP7.1 protein is 9.3 kDa in size, and, as would be expected for a type I high glycine‐tyrosine protein, shows a lower glycine and tyrosine amino acid content (21.8 and 12.6 mol %) when compared to the KAP6 family (Fig. 8b). KAP7.1 also exhibits a high serine and asparagine content. The number of glycine‐tyrosine repeat structures is small compared to the KAP6 family. c. KAP8 Family Although several members of this family, originally termed component F, are known in sheep (Dopheide, 1973; Kuczek and Rogers, 1987; Marshall et al., 1980) and a single mouse sequence has been described (Aoki and Ito, 1997), only one KRTAP8‐1 gene exists in humans (Figs. 5b and 6b; Rogers et al., 2002). The encoded protein is 6.8 kDa in size and possesses a high glycine (23.8 mol %), and tyrosine (19.0 mol %), as well as a high proline and serine content (Fig. 8c). Like the KAP6 family members, the central portion of the protein consists largely of glycine‐tyrosine dimeric repeats. d. KAP19 Family This gene family, KRTAP19‐1 to KRTAP19‐7 (Fig. 5b), encodes the largest number of high glycine‐tyrosine KAP proteins. It was originally named based on the unique clustering of its protein members in evolutionary analysis evaluations (see Fig. 6b, see color section; Rogers et al., 2002) together with other, previously described mouse KAP proteins. These were assigned to either the mouse KAP6 family (Aoki and Ito, 1997), or the mouse KAP16 family (Tkatchenko et al., 2001), the latter named based on the localization of their genes to mouse chromosome 16. In addition, it is noted that several further mouse high glycine‐tyrosine KAPs segregated independently from all other known KAP families, irrespective of species, and, as such, have been classified as the mouse specific KAP18 family (Rogers et al., 2002; see

HUMAN KERATIN‐ASSOCIATED PROTEINS

231

FIG. 8 Representative amino acid alignments of human high glycine‐tyrosine KAP family members with orthologous sequence in other species. (a) KAP6.1; (b) KAP7.1; (c) KAP8.1; (d) KAP19.1; (e) KAP20.1; (f) KAP21.1; (g) KAP22.1. For details see Fig. 7. The accession number for the respective DNA sequence from which the amino acid translations were made can be found in Rogers et al., 2002.

Fig. 6b, color section). Recently, Pruett et al. (2004), performed a bioinformatic evaluation of the region on mouse chromosome 16 syntenic to that of human chromosome 21q22.1, and demonstrated a colinearity in gene arrangement for KAP family members in both species. The human KAP19 proteins range in size

ROGERS ET AL.

232

from 5.7–9.1 kDa and possess a high glycine (26.9–38.9 mol %) and tyrosine (15.4–23.6 mol %) content, as well as a moderate amount of serine and phenylalanine residues (Fig. 8d). The KAP19 members have a fairly large number of dimeric and trimeric glycine and/or tyrosine containing repeat structures. e. KAP20 Family This family contains two gene members KRTAP20‐1 and KRTAP20‐2 (Fig. 5b). The encoded proteins, KAP20.1 and KAP20.2, were also identified as separate branches in evolutionary analysis studies (Rogers et al., 2002) and appeared orthologous to the protein for one previously described mouse high glycine‐tyrosine KAP cDNA (Figs. 6b and 8e; Aoki and Ito, 1997). The two human KAP20 proteins are, respectively, 6.2 and 6.9

FIG. 9 (continued)

HUMAN KERATIN‐ASSOCIATED PROTEINS

233

FIG. 9 Multiple amino acid homology alignment of human and sheep KAP5 family members. For details, see Fig. 7. The accession numbers (BAC clones and open reading frames) for the human KAP5 genes can be found in Table I. The accession numbers for the sheep KAP5 family members are sKAP5.1; x55294; sKAP5.2, (no database entry, see Jenkins and Powell, 1994); sKAP5.4; x73434; sKAP5.5; x73435.

kDa in size and have major amounts of glycine (35.7–36.9 mol %) , tyrosine (32.1 and 24.6 mol %), and cysteine, with repeat structures similar to that of the KAP19 family (Fig. 8e). f. KAP21 Family The two members of the human KAP21 gene family, KRTAP21‐1 and KRTAP21‐2 (Fig. 5b), possess sequence homology to two other, previously described, mouse glycine‐tyrosine KAP cDNA sequences

234

ROGERS ET AL.

(Aoki and Ito, 1997; Rogers et al., 2002; Tkatchenko et al., 2001; Figs. 6b and 8f). The two KAP21 proteins are 7.9 and 8.5 kDa in size, and possess a high glycine (35.4 and 35.3 mol %) and tyrosine (17.7 and 19.3 mol %), as well as high cysteine and serine amino acid content (Fig. 8f). These proteins also exhibit repetitive dimeric and trimeric glycine and/or tyrosine containing repeat structures through the entire central portions of the molecules. g. KAP22 Family A single human KAP22 gene, KRTAP22‐1 (Fig. 5b), encodes the smallest of the high glycine‐tyrosine KAPs found to date (5.2 kDa; Figs. 6b and 8g). The KAP22.1 protein also has the lowest glycine and tyrosine content (22.9 and 14.6 mol %, respectively) and the degree of repetitiveness is very low (Fig. 8g). 4. High Sulfur KAP Families on Chromosome 21q22.3 a. KAP10 Family This is one of the most recently discovered human high sulfur KAP gene families. It consists of 12 members, KRTAP10‐1 to KRTAP10‐12 and was described independently by two separate laboratories (Rogers et al., 2004b; Fig. 5c; Shibuya et al., 2004b). This has raised problems concerning the naming of the genes. Shibuya et al. (2004b) designated them as members of the KAP18 family, whereas Rogers et al. (2004b) classified them as the KAP10 family, for the amino acid sequence of the encoded proteins was strongly homologous to that of sheep KRTAP10–1 (Figs. 6a and 7f). This sequence, originally described by Powell and Rogers (1997), was apparently not added into a database. The Human Genome Nomenclature Committee (HGNC) has recently designated this family as the KAP10 family. Moreover, in another paper, Shibuya et al. (2004a) went on to show that this KAP gene domain on human chromosome 21q22.3 can also be found in orthologous domains of chimpanzees and baboons. The authors hypothesized that these domains arose from a common ancestor, and that the original number of KAP10 genes members was probably 17. The human KAP10 gene family encodes, together with the single KAP16.1 family member, the largest known KAP proteins (22.3–40.4 kDa). Similar to the KAP4 and KAP9 families, the KAP10 protein repeat structure is pentameric, consisting of both monocysteine and dicysteine (24.3–27.4 mol %) repeats with also a large serine (19.3–22.3 mol %), proline, alanine, and valine content (Fig. 7f). b. KAP12 Family The four members of the human KAP12 gene family, termed KRTAP12‐1 to KRTAP12‐4, are clustered together with the KAP10 gene family on chromosome 21q22.3 (Rogers et al., 2004b; Shibuya et al., 2004b; see also Figs. 5c and 6a). KAP12 proteins are the orthologs of mouse KAP12.1, whose gene was identified as one of several KAP genes on mouse chromosome 10, in a region syntenic to that of human chromosome

HUMAN KERATIN‐ASSOCIATED PROTEINS

235

21q22–23 (Cole and Reeves, 1998). The KAP12 proteins are 9.7–14.7 kDa in size, and have a moderately high cysteine content (21.2–23.2 mol %) followed by serine (17.7–21.9 mol %), proline, and valine. As such, their single cysteine containing pentameric repeats consist primarily of these amino acids, and cover the entire middle sections of the proteins (Fig. 7h). 5. Ultrahigh Sulfur KAP Family on Chromosome 11p15.5 and 11q13.4 a. KAP5 Family The human KAP5 gene family is the newest family to be completely characterized (Yahagi et al., 2004). While bioinformatic analysis of human chromosome 11p15.5 and 11q13.4 indicated the presence of 11 putative KAP5 gene members (Yahagi et al., 2004), analysis of this region revealed an additional, putative, KAP5 gene that has been designated KAP5‐12 (see Figs. 5d, 5e, and 6c). Prior to the publication of Yahagi et al. (2004), two human KAP5 genes, KERA and KERB, were reported (Perez et al., 1999), with KERA also being previously identified in a further analysis (MacKinnon et al., 1990). At a later date, this gene was renamed KRTAP5‐1 in order to make it match with the current nomenclature (Jenkins and Powell, 1994). Although Yahagi et al. (2004) mentioned KERA and KERB, and cited both MacKinnon et al. (1990) and Jenkins et al. (1994), the authors ignored this change of designation, choosing instead to name the members of this gene family based upon their linear order on the two KAP 5 gene domains (see Fig. 5d, 5e), with the old KRTAP5‐1 (KERA) becoming KRTAP5‐9 and KERB being now designated KRTAP5‐8. Recently, the HGNC has confirmed these designations. The currently known KAP5 proteins range in size from 11.7–25.2 kDa, respectively (see Fig. 9 and Table I), and are orthologs of several KAP5 family members found in sheep and mouse (Jenkins and Powell, 1994; MacKinnon et al., 1990; Powell et al., 1991). The KAP5 proteins are extremely rich in cysteine (29.0–35.7 mol %), serine (17.7–24.8 mol %), and glycine (6.4–31.6 mol %). The repeat structures of the human KAP5 proteins are largely pentameric, but often overlap and are diYcult to discern.

C. KAP Polymorphisms The discovery that human KAP genes possess in‐frame deletion polymorphisms has progressed concomitantly with the characterization of the human genome and the KAP gene domains localized therein. Although, prior to this time, KAP protein studies in humans suggested that polymorphic variants might exist (Marshall and Gillespie, 1982), and several variants of the sheep B2 (KAP1) family had been described (Rogers et al., 1994), these data went relatively unnoticed during the search for new human KAP genes. Because of

ROGERS ET AL.

236

TABLE I Characteristics of the KAP5 Gene Family and their Encoded Ultrahigh Sulfur Proteins

KAP designation

Accession nr. genomic sequences

Open reading frame

Strand

Molecular weight of protein (Da)

Cysteine residues (mol %)

Chromosome 11p15.5 KAP5.1

AC130310

1862–2698




24193

30.6

KAP5.2

AC130310

15172–15705




16270

32.8

KAP5.3

AC130310

25134–25850




22105

33.2

KAP5.4

AC130310

38874–39740




25248

29.8

KAP5.5

AC130310

47489–48154

þ

19827

31.2

KAP5.6

AC130310

111904–112293

þ

11783

34.8

Chromosome 11q13.4 KAP5.7

AP000867

55198–55695

þ

15149

35.7

KAP5.8

AP000867

65953–66516

þ

17519

35.2

KAP5.9

AP000867

76555–77064

þ

16275

35.5

KAP5.10

AP000867

93485–94093

þ

17983

32.7

KAP5.12 (KAP5P2)

AP000867

107611–107799




6336

29.0

KAP5.11

AP000867

110264–110734




14609

35.3

cKAP5A (KAP5P1)

AP000867

96511–96831

þ

The open reading frame positions of the KAP5 genes are given in bp of the accession sequence. þ
, designate DNA strand of the accession number sequence. KAP5P1 and KAP5P2 are names for two putative pseudogene described in Yahagi et al. (2004). c, designates a pseudogene found in this laboratory; Da, Dalton; bp, base pair.

this, several KAP cDNA/partial gene sequences derived from the incomplete sequence of the human KAP domain on chromosome 17q21.2 were identified that possessed extremely high homologies to other gene sequences in this region, but which also showed variations resulting from repeat motif insertion/deletions as well as single nucleotide exchanges in the coding portions of these sequences (Rogers et al., 2001). Such ‘‘orphan’’ cDNA/gene sequences were thought, at that time, to be proof of further, highly homologous gene loci located somewhere on the, as yet, unfinished portion of the human genome. Examples for these ‘‘orphan’’ sequences were KRTAP1‐1A, KRTAP1‐2, KRTAP1‐8, and KRTAP1‐9, described during the initial characterization of the chromosome 17q21.2 KAP domain (Rogers et al., 2001; Zhumbaeva et al., 1992), as well as KAP1.6 and KAP1.7, two KAP1 family members which were identified by cDNA sequencing shortly thereafter (Shimomura et al., 2002a). The discovery that these orphan sequences were

HUMAN KERATIN‐ASSOCIATED PROTEINS

237

not associated with unique gene loci arose during mutation analysis studies on individuals possessing hereditary hair abnormalities. As an unexpected result, Shimomura et al. (2002b) noted that genomic PCR of KRTAP1‐1B and KRTAP1‐3 in aVected and non‐aVected individuals resulted in a series of PCR products of diVerent size in some individuals of Japanese ancestry. The sequencing of these PCR bands showed, besides the sought‐after allele, that several of these variants were either identical to previously described ‘‘orphan’’ KAPs (e.g., KRTAP1‐6), or constituted new sequences with high identity to KRTAP1‐1B or KRTAP1‐3, but with varying numbers of polymorphic repeats in the coding region of these genes. Subsequent RT‐PCR analyses showed that these deletion polymorphisms were expressed in human scalp RNA. Two of these polymorphisms, KRTAP1‐6 (polymorphism of KRTAP1‐1B) and KRTAP1‐8B (polymorphism of KRTAP1‐3), were found almost exclusively in the Japanese population. Furthermore, these two alleles appeared to be linked together, for Japanese individuals that possessed one of the allelic variant had inevitably the other (Shimomura et al., 2002b). Recently, 13 further polymorphic variants of the KAP4 gene family have also been identified (Kariya et al., 2005), now using the completed human genome sequence as a reference. This has led to the reduction of the known KAP4 gene loci from 15 to 11, and the discovery of 9 new polymorphic variants, making 10 of the 11 KAP4 gene loci polymorphic. The mechanism of this genetic variation is unknown but might include processes such as gene conversion, unequal crossover, or slipped strand mispairing (Kariya et al., 2005; Rogers and Schweizer, 2005; Rogers et al., 1994). The significance of these in‐frame deletion polymorphisms remains currently unknown and further research is necessary to show whether these variants are indeed transcribed into proteins. Further studies are also needed to see whether other KAP families or other human populations possess polymorphic variants. In the end, these studies might help answer the questions of whether these polymorphic proteins play a role in hair fiber shape/bending and whether they can be used as a tool in forensic examinations or population genetics studies.

III. Modulation of KAP Gene Expression A. KAP Gene Expression Not fully unexpectedly, the patterns of KAP expression in the human hair follicle mirror, to a certain degree, that of hair keratin expression. Like hair keratins genes (Langbein and Schweizer, 2005), specific KAP gene expression can be found in the proliferative compartment of the hair follicle (the matrix

238

ROGERS ET AL.

cell region), in the diVerentiated portions of the hair cortex, and in the hair cuticle as well. With the exception of the high sulfur and high glycine‐tyrosine KAP genes on chromosome 21q22.1 and a single KAP gene (KRTAP17‐1) on chromosome 17q21.2, the members of each of the remaining KAP gene families exhibit a uniform hair follicle expression pattern that is characteristic for the region in which these gene families are located. Thus, the expression of the previously described members of the chromosome 17q21.2 KAP1– KAP4 and KAP 9 families (i.e., KAP1.1–KAP1.5, KAP3.3, KAP4.3, and KAP9.2; Rogers et al., 2001; Shimomura et al., 2002a,b, 2003) found on chromosome 17q21.2, as well as new expression data for members of these families presented in this report (KAP2.3, KAP4.4, KAP4.5, KAP9.7; see Fig. 10a, A—G, color section and Table II), selectively occurs high up in the diVerentiated portion of the hair cortex. This is the identical region, where a loss of water and an absence of free sulfhydryl groups associated with hair fiber crosslinking was previously shown (Powell and Rogers, 1997). No expression was found in the proliferative cell matrix compartment, the IRS or the ORS, and it could never be observed for the various individual KAP genes tested, in the medulla. At present, the expression of nearly half of the KAP genes found on chromosome 17q21.2 has been investigated, all showing this same expression site. In addition, this holds true for several of these KAP family members in other species (Fratini et al., 1994; Mitsui et al., 1998; Powell et al., 1995). To further emphasize this point of region‐specific gene expression, transcripts of all 16 genes of the high sulfur KAP10/KAP12 families found on chromosome 21q22.3 proved to be specifically located high up in the hair cuticle, ca. 20 cell layers above the apex of the dermal papilla (Rogers et al., 2004b; see Fig. 10b (color section) for examples). Again, no other regions of hair follicle expression were found. Surprisingly, an identical location could also be seen for the mRNA of KAP17.1. At present the KRTAP17‐1 gene seems to be the only KAP gene on chromosome 17q21.2 whose expression pattern diVers from that of the other KAP genes on this domain (Rogers et al., 2001; Fig. 10a, H, see color section). This is perhaps not surprising, for KAP17.1 possesses the closest homology (ca 50%) to the KAP5 family members all of which also possess cuticular expression patterns (see Section II.B.5). Concomitant with the publication of the paper by Yahagi et al. (2004), our laboratory was also involved in the characterization of the KAP5 family members via isolation of KAP5 cDNA clones from an arrayed human scalp cDNA library using previously described methods (Rogers et al., 2001). That data, shown in Table III, largely confirms the work of Yahagi et al. (2004). In addition, we have performed hair follicle in situ hybridizations for all KAP5 family members using probes generated from the 30 noncoding region of the genes (see Table III for oligonucleotide sequences and PCR

239

HUMAN KERATIN‐ASSOCIATED PROTEINS

FIG. 10a

ROGERS ET AL.

240

conditions). The in situ hybridization results showed that, like the KAP10 and KAP12 family members, all 11 members of the KAP 5 family (KAP5.1– KAP5.11) exhibited mRNA expression high up in the hair cuticle (compare Fig. 10b and c). The expression of KRTAP5‐12 designated by Yahagi et al. (2004) as a pseudogene, despite an open reading frame, was not observed in this study. All in all, our data correlates well with what was seen initially for human KERA/KAP5.1 (see Section II.B.5) (MacKinnon et al., 1990) and for several sheep KAP5 members (Jenkins and Powell, 1994; MacKinnon et al., 1990), but deviates strongly from two putative murine KAP5 members (termed UHSP1 and UHSP2), whose mRNAs were localized in the inner root sheath and interfollicular epidermis (Wood et al., 1990). Recently, Soma et al., (2005) has also demonstrated a cuticular mRNA expression for five of the human KAP5 family members on chromosome 11q13.4, while one member, which they designated KAP 5.3 (originally also termed KERA/KAP1 and now known as KAP5.9) (MacKinnon et al., 1990; Perez et al., 1999; Yahagi et al., 2004), also exhibited cortical expression. One reason for this discrepancy between the expression patterns might be cross‐hybridization with other KAP family members, for the probe used by Soma et al. (2005) contained portions of the coding region for this gene which is ca. 75% similar to those of the cortically expressed KAP4 family members (Soma et al., 2005; and Rogers et al., unpublished data). The expression data of the KAP5, KAP10, KAP12, and KAP17 families strongly raise the question why are so

FIG. 10b

241

HUMAN KERATIN‐ASSOCIATED PROTEINS

FIG. 10c

ROGERS ET AL.

242

FIG. 10d

HUMAN KERATIN‐ASSOCIATED PROTEINS

243

FIG. 10e mRNA expression of representative human KAP family members. The in situ hybridization signals of the radioactively labeled mRNAs are detected by reflection microscopy and are shown in red false color. This signal was merged with the respective transmission image of same tissue section (for procedure, see Langbein et al., 2004). 10a) Chromosome 17q21.2 high/ultrahigh sulfur KAPs: A, KAP1.5; B, KAP2.3; C, KAP3.3; D, KAP4.4; E, KAP4.5; F, KAP9.2; G, KAP9.7; H, KAP17.1 (insert, cross‐section). A and C, derived from Rogers et al., 2001; all others, this publication (see Table I for probes used for in situ hybridization). 10b) Chromosome 21q22.3 KAPs: A, KAP10.1; B, KAP10.2/KAP10.9; C, KAP10.3; D, KAP12.1/ 12.2; E, KAP12.3; F, KAP12.4. Derived from Rogers et al. (2004b). 10c) Chromosome 11q13.4 and 11p15.5 KAP5 members: A, A0 , A00 , A000 , KAP5.8; B, KAP5.7; C, KAP5.10; D, KAP5.11; E, KAP5.1; F, KAP5.2; G, KAP5.3; H, KAP5.4; I, KAP5.5; J, KAP5.6. Note that due to space considerations the in situ hybridization for KAP5.9, which has been previously reported by others (MacKinnon et al., 1990; Soma et al., 2005), has not been included in this figure. All in situ hybridizations shown originate from this publication (see Table III for probes used for in situ hybridization). 10d) Chromosome 21q22.1 high glycine‐tyrosine KAPs: A, KAP6.1; B, KAP7.1; C, KAP8.1; D, KAP19.2; E, KAP19.4; F, KAP19.6; G, KAP20.1; H, KAP21.1. 10e) Chromosome 21q22.1 high sulfur KAPs: A, KAP11.1; B, KAP13.1; C, KAP13.2; D, KAP15.1, E, KAP12.1. Figs. 10d and 10e were derived from Rogers et al., 2002. co, Cortex; cu, hair fiber cuticle; dp, dermal papilla; irs, inner root sheath; ors, outer root sheath; bars, 150 mm.

many KAPs (28) co‐expressed in upper cuticular cells, and the same question holds true for KAPs of the diVerentiated portion of the hair cortex, whose cells contain a large number of KAP proteins from varying families (see Fig. 10a, d, e). One plausible explanation for the large degree of cortical KAP synthesis could be that in this region the highest number of hair keratins (ca. 9 members) are synthesized. The formation of a hard and compact hair fiber can, most probably, only be achieved by multiple cross‐linkings of keratin intermediate filaments with multiple KAP proteins. Similar aspects may apply to the formation of the hair cuticle, whose extremely hard

ROGERS ET AL.

244

TABLE II In Situ Hybridization Probe Primer Sequences and PCR Conditions for Several Chromosome 17q21.2 KAP Family Members KAP PCR products

PCR primer sequence

Size of PCR product (bp)

Annealing temperature (C )

KAP1.5*

ccacttgctgaaagccagtttg tctgtgtccccagtgaa

204

55

KAP2.3

ccctcaacgcacgaaac atgtggggaaatagataggatg

147

60

KAP3.3*

catagaagctttagcattcacc ccaaaccacccacagaa

234

51

KAP4.4

ctcaccagattctcatcaac tcagagcaaaatacaacttat

179

50

KAP4.5

cctgccagtttgtctcat agatcacagttagtgtccc

160

50

*KAP9.2/ KAP9.4/

ctgctgatcacgtttcaagag

182

55

KAP9.9

gaagtatcctgccctccctcaa

KAP9.7

cccacgagtgtctacctg aagttcaccctaagttcacttt

281

55

KAP17.1

atgcagtcccaccgaaag cccaaagacaccttgaagaaga

300

55

* The cDNA sequences for KAP9.2, KAP9.4, and KAP9.9 are so conserved that the in situ hybridization probe probably recognizes all three members. bp, base pair.

scale‐shaped cells are interlinked/meshed with those of the IRS‐cuticle. Moreover, and contrary to cortical cells, cuticular cells consist of several morphologically distinct subcellular compartments (endocuticle, exocuticle, epicuticle, and A layer; see Powell and Rogers, 1997; Rogers, 2004), and it remains to be seen whether distinct KAPs are specifically expressed in one of these compartments. In contrast to the expression characteristics of the above mentioned KAP gene families, the members of the KAP gene families on chromosome 21q22.1 showed no unified expression sites in the hair follicle (Fig. 10d and e show representative examples, see also Rogers et al., 2002). Two thirds of the 11 high glycine‐tyrosine and 6 high sulfur KAP genes on this domain exhibited a low, to very low, and heterogeneous mRNA expression (Fig. 10d, A, E–H as well as Fig. 10e, B—E, see color section). This was probably one reason why so few cDNA clones could be isolated for the KAP genes of this region (Rogers et al., 2002). Only the high glycine‐tyrosine KRTAP7‐1, KRTAP8‐1, KRTAP19‐1, KRTAP19‐2 genes and the high sulfur KRTAP11‐1 gene showed high levels of expression (see Fig. 10d, B–D,

245

HUMAN KERATIN‐ASSOCIATED PROTEINS

TABLE III In Situ Hybridization Probe Primer Sequences and PCR Conditions of the KAP5 Family Members, as well as Accession Numbers for KAP5 cDNA Sequences Isolated in this Laboratory

KAP PCR products

PCR primer sequence

Size of PCR product‐bp

Annealing temperature (C )

cDNAs foundþ

cDNA accession numbers

KAP5.1

cccaccctcctgccttgc ggggtgagcggtttattggatg

292

60

DKFZp636 G2466Q4

#

KAP5.2

ccgactgccacgatgttcc ggtcctgatggtggttgagaag

148

57

DKFZp636 L2256Q4

AJ628245

KAP5.3

ctctgcccacaaacctcagtg tcaggaaaggaagacgggattc

227

58

DKFZp636 J1029Q4

AJ628246

KAP5.4

caaattctctccccaagtcaac cctcttaaacgcccacctt

177

56




KAP5.5

cacaccagtgcttccgaaact gctgtcagggtctaaggggtct

153

57

DKFZp636 K0462Q4

KAP5.6

ctgcatttcagttctggctgtc agggagcttgttggaggaga

195

57




KAP5.7

ttccgaagctgtgacctgtcct ccgcagttgcagttgacttgg

171

56

DKFZp636 D0962Q4

AJ628243

KAP5.8

ctgaggtcatgagggcttctgg ggcagcaggtcggaggattc

179

59

DKFZp636 L0454Q4

#

KAP5.9

cttggctcagggcgtctttttc aaggggaattccaggctcttgc

184

58




KAP5.10

gccctgccttcagcctcctcac gcctggccttgtggggtcagac

177

61




KAP5.11

cctgggctgactgagatgcta ggagacaacaggaaggaaggag

176

57

DKFZp636 G0358Q4

KAP5.12

atcagcataaagccgtgaatca gaggaagaggagcggtctcat

172

58




cKAP5A

atcagcataaagccgtgaatca gaagcaggagcggtctcat

170

56




AJ628247

AJ628244

cDNA designations in bold type are full length sequences. The isolated cDNA clones can be obtained from the German Human Genome Resource Center (RZPD, Berlin, Germany) under the designations found in the table. #, indicates short cDNA clones whose sequence was not entered into the EMBO database. c, designates a pseudogene; bp, base pair.

10e, A, color section; Rogers et al., 2002). Another common feature of the chromosome 21q22.1 gene domain was that several high glycine‐tyrosine‐ and high sulfur‐KAP genes showed expression adjacent to or in the proliferating matrix cell region of the hair follicle. Primary among those was the strongly expressed mRNAs of the high glycine‐tyrosine KAP8.1 and the high sulfur KAP11.1 (Fig. 10d, C, color section; and 10e, A), while KAP19.6,

246

ROGERS ET AL.

KAP19.7, KAP21.2, the KAP13 family, and KAP15.1 transcripts were only weakly expressed (Figs. 10d, F, H; 10e, B–E, see color section; Rogers et al., 2002). This early pattern of KAP expression seems to conflict with the view that hair keratins are expressed prior to KAPs, and that coexpression is restricted to the mid‐ and upper cortex region where KAP/KAP or KAP/ keratin crosslinking occurs (reviewed previously in Rogers, 2004). One must keep in mind that also in this early region several hair keratins are synthesized, forming filaments that may have to be crosslinked. Although most of the KAP members on the 21q22.1 domain were seen in the cortex/matrix cell region, the high glycine‐tyrosine KAP19.4 showed expression exclusively in the diVerentiated region of the hair cuticle (Fig. 10d, E, see color section; Rogers et al., 2002). Furthermore, KAP19.1, KAP19.6, KAP21.2, and the high sulfur members KAP13.2, KAP15.1, and KAP23.1 all showed cuticular expression which was accompanied, however, by diVering degrees of cortical expression (Fig. 10d, F, H, see color section; Rogers et al., 2002). KAP7.1 was of interest due to an apparent body region‐specific variation of expression, for its mRNA was strongly expressed in scalp hairs but only weakly present in plucked beard hairs (Fig. 10d, B, see color section; Rogers et al., 2002). Likewise remarkable was the semi‐longitudinal cortical expression of KAP8.1 and, to a certain degree KAP19.1 (Fig. 10d, C, see color section; Rogers et al., 2002). A similar expression pattern has been observed for distinct KAP6 and KAP4 family members in merino sheep wool. In cross‐ sections, this wool clearly possessed an obvious orthocortical/paracortical division, with KAP6 being expressed in the orthocortex and KAP4 in the paracortex (Fratini et al., 1993, 1994; Powell and Rogers, 1997). This morphological division and associated KAP expression was hypothesized as possibly playing a role in Merino wool hair bending (crimp). However, such a half longitudinal expression was not seen in one rabbit KAP4 family member (Powell et al., 1995). To date, a comparable longitudinal division in ortho‐ and paracortex was not observed in humans. In addition, further analysis of this ortho‐paracortical relationship is complicated by the fact that detection of single KAP members is restricted to in situ hybridization, because monospecific antisera production is complicated by the high common homology of the KAP protein families. As such, it is not currently certain if the concept of longitudinal ortho‐paracortical division of KAP proteins holds true in humans. A further species‐specific deviation of KAP expression was found for mouse KAP13.1 (originally termed 4C32, see Takaishi et al., 1998). In situ hybridization of mouse skin from embryonic day 13.5 to 16.5 revealed expression of KAP13.1 mRNA in interfollicular body and tail epidermis, as well as tongue epithelium, but not in any stage of hair follicle morphogenesis. In summary (Fig. 11, see color section), KAP mRNA expression patterns for nearly all of the genes analyzed on chromosome 17q21.2 (KAP1‐3;

HUMAN KERATIN‐ASSOCIATED PROTEINS

247

FIG. 11 Scheme of KAP gene expression sites in the human hair follicle. The size of the KAP lettering mirrors the degree of mRNA expression with large type, strong expression; small type, weak expression. Asterisks, KAP gene families.

KAP4, and KAP9 families) are strong, with their transcripts localized to the so‐called keratinizing region of the hair cortex. Expression of the KAP genes on chromosome 21q22.3 (KAP10 and KAP12 families), 11p15.5 and 11q13.4 (KAP5 family) show strong expression in the upper hair cuticle. The same expression pattern is also found for KRTAP17‐1. In contrast, the KAP genes on chromosome 21q22.1 are not uniform as to the type of KAP gene expressed (irrespective if high glycine‐tyrosine or high sulfur), the degree‐ or the localization‐ of expression. With the exception of KRTAP7‐1, KRTAP8‐1, KRTAP19‐1, and KRTAP19‐2, all other genes on this domain were weakly expressed. This is the only KAP gene domain which contains several members expressed in the matrix cell region, and the only domain in which single specific genes exhibit both cortical and cuticular expression (Fig. 11, see color section).

B. KAP Expression in Human Disease and in Mouse Models Very little data exist indicating that mutations in KAP genes might be directly causal for a hereditary hair disease phenotype. Shimomura et al. (2002b) described a small, two‐generation family in which one member suVered from a hair disorder characterized by sparse, lusterless, brittle hair.

248

ROGERS ET AL.

Mutation analysis in this family showed that the aVected person possessed a heterozygous nonsense mutation in codon 51 of the KRTAP1‐1B gene. In addition, the second, allele, termed KRTAP1‐6 in this review, contained an in‐frame deletion repeat polymorphism which, in addition, was found in a minority of the Japanese population (see Section II.C on KAP polymorphisms; Shimomura et al., 2002b). Unfortunately, the size of the family was too small for linkage analysis, and the father of the aVected individual, who also possessed the mutation, showed no obvious phenotype. However, strong intra‐familial phenotypic variations have also been seen in other hair disorders, such as monilethrix (Winter et al., 1998), which is predominantly caused by mutations of the type II hair keratins Hb1 or Hb6 (Smith, 2003; Winter et al., 1997a,b). In contrast to direct KAP mutations, more evidence exists for the indirect modulation of KAP gene expression in human hair disorders. In addition, several spontaneous mouse mutations possess a hair phenotype which includes changes in KAP expression (reviewed previously in Powell and Rogers, 1997), and transgenic studies involving overexpression/ablation of hair follicle‐associated transcription factors (as well as overexpression constructs driven by KAP promoters) have allowed an initial evaluation of these changes and the role that they exert on KAP gene expression. 1. KAPs and Human Hereditary Hair Diseases The best characterized hereditary hair disease showing KAP involvement is trichothiodystrophy (TTD) (Price et al., 1980). This autosomal recessive disorder shows a wide degree of phenotypic variation, however it possesses one commonality, a strong decrease in hair cysteine content (Pollitt and Stonier, 1971; Price et al., 1980), which results in brittle, fractured hair. Two dimensional gel electrophoresis studies of total protein extracts of TTD hairs indicated that the decreased cysteine content was due to the specific reduction of a large group of ultrahigh sulfur KAP proteins (Gillespie and Marshall, 1983; Price et al., 1980). In addition to decreased KAP protein levels, TTD patients often possess all or part of a complex of symptoms termed PIDIS (Photosensitivity, Ichthyosis, Brittle hair, Impaired intelligence, Decreased fertility, Short stature) (Bergmann and Egly, 2001). The majority of these symptoms are also observed in another epidermal disease, xeroderma pigmentosum (XP) (Lehmann, 2003; Stary and Sarasin, 1996), a disease characterized by UV‐ photosensitivity, increased skin pigmentation, and dramatically increased risk (>1000 fold) of basal‐, squamous cell carcinoma as well as melanoma (Stary and Sarasin, 1996). XP has been shown to be due to mutations in several members of the nucleotide excision repair (NER) pathway, which is responsible for the elimination of DNA damage primarily caused by

HUMAN KERATIN‐ASSOCIATED PROTEINS

249

ultraviolet radiation (Lehmann, 2003). Cell complementation studies performed in cultured fibroblasts derived from a large number of XP patients have allowed the division of these mutations into 7 complementation groups (XPA–XPG). The majority of TTD patients fall into two of these complementation groups (XPB and XPD), as well as one further TTD‐specific complementation group (TTD‐A). As such, both TTD and XP belong to a group of hereditary diseases caused by the mutation of proteins found in the NER pathway. That mutations in the XPD gene are causal for TTD has been also confirmed by introducing such a mutation into mice, which developed the major signs of the human TTD phenotype (de Boer et al., 1998). However, although several of the symptoms found in TTD patients correlate with XP, others do not. For example, a minority of the TTD patients do not show photosensitivity, and more importantly, TTD patients often do not have an increased risk of skin cancer, the primary hallmark of XP. An answer to these apparent discrepancies appears to lie in the dual function of the proteins involved in TTD. Both XPB and XPD are not only components of NER pathway but are also members of the transcription factor II H (TFIIH) complex, which is involved in the basal transcription of all mRNAs (Frit et al., 1999; Woychik and Hampsey, 2002). XPB is a member of the TFIIH core complex and is very sensitive to mutation. XPD, however, is an auxiliary member, and it appears that certain mutations in XPD, especially in its carboxyterminal region, might have only a limited eVect on TFIIH‐mediated gene transcription. This, therefore, appears to explain why a mutation in a protein associated with a general transcription factor might have only minor consequences, such as the changes in KAP expression seen in TTD patients. To date, there has been no direct examination of individual KAP gene expression in TTD patients. Such an examination, however, would be a good starting point toward creation of an in vitro model allowing the study of KAP gene expression and its deregulation in TTD patients. A further hereditary disease exhibiting a hair phenotype with a possible KAP protein association is hidrotic ectodermal dysplasia (also known as HED or Clouston’s syndrome). Amino acid analysis of hair fiber proteins from HED patients showed a fairly strong decrease in cysteine, as well as proline and serine levels, and an increase in tyrosine and phenylalanine (Gold and Scriver, 1972). These alterations in amino acid content were accompanied by a general decline in the SCMK‐B fraction in fractionated hair proteins (See Section I and Fig. 4). Electron microscopic studies of hairs from Clouston syndrome patients showed major changes in the hair fiber, including a loosening of cortical structure and a loss/sloughing of the hair cuticle, when compared to controls (Escobar et al., 1983). In general, HED belongs to the large group of partially hereditary ectodermal dysplasias (ca. 170 diVerent phenotypes); which exhibit abnormalities in

250

ROGERS ET AL.

epidermal appendages (hair, nail, and sweat or sebaceous glands) (Lamartine, 2003). HED is characterized by sparse hair/baldness, nail dystrophy, and skin hyperpigmentation, and is often associated with strabismus, mental deficiency, clubbing of the fingers, and palmer hyperkeratosis. These patients do not have alterations in sebaceous or sweat glands which is characteristic of the better known X‐chromosome linked anhidrotic ectodermal dysplasia, often caused by mutations in the EDA gene (Kere et al., 1996). Recently, mutations in connexin 30, a gap junction protein, have been found in patients with Clouston syndrome, but, to date, it is not known whether these patients possess altered KAP protein expression (Lamartine et al., 2000; Rabionet et al., 2002). 2. Expression of KAP Promoter‐Containing Genes in Transgenic Mice To date there has only been one report in which a KAP promoter was used to drive hair follicle–specific ectopic expression of a foreign gene. McNab et al. (1990) generated transgenic mice which overexpressed chloramphenicol acetyl transferase (CAT) under the control of a 671 bp proximal promoter of a mouse ultrahigh sulfur KAP9 gene. CAT activity was shown to be present in mouse anagen hair follicle of these animals. Comparison of in situ hybridizations using probes specific for the CAT construct as well as for the endogenous mKAP9.1 mRNA showed a close correlation between CAT and mKAP9.1 expression, in the upper hair cortex of these animals (McNab et al., 1989; Vogeli et al., 1991). Vogeli et al. (1991) used these hair follicles grown in organotypic culture to activate the KAP9‐CAT promoter construct after application of minoxidil, a stimulator of hair growth (Messenger and Rundegren, 2004). In another series of experiments, Powell and Rogers showed in transgenic sheep that ectopic expression of a cuticular KAP5 gene in the hair cortex by means of the promoter for a type II cortex keratin (KII‐10, termed Hb3 in humans), resulted in the formation of novel protein inclusion bodies in the wool cortex, which exhibited a laminar form similar to that seen in the exocuticle of diVerentiating wool cuticle cells (Powell and Rogers, 1997). 3. Transgenic Mouse Models Showing Modified KAP Expression Several transgenic mouse models, as well as mice possessing spontaneous mutations, have been shown to display variations in their KAP gene expression patterns (previously reviewed in Powell and Rogers, 1997). One well‐ studied recent example is Hoxc13 (Awgulewitsch, 2003; Langbein and Schweizer, 2005). Hox genes encode a large number of transcription factors possessing a common DNA‐binding domain, termed the homeodomain.

HUMAN KERATIN‐ASSOCIATED PROTEINS

251

These proteins modulate gene expression by binding to specific DNA enhancer elements found in the promoter region of Hox responsive genes. Thirty‐nine (39) Hox genes have been found in humans and mice, which are localized into four clusters (termed Hoxa–Hoxd) on the human and mouse genome. The genes on a specific cluster possess the same direction of transcription and are characterized by an apparent spatio‐temporal expression pattern during morphogenesis. The expression of Hox genes initiates anteriorly in the developing organism (e.g., for the four Hoxa1‐Hoxd1 genes) and progresses posteriorly toward the final expression of the four Hox13 members (Hoxa13–Hoxd13). Although this anterior‐posterior, colinear expression pattern often occurs, exceptions have been seen, among others in Hoxc13 and Hoxb13 expression (Godwin and Capecchi, 1998; Mack et al., 2005). Ablation of the Hoxc13 gene in transgenic mice using the b‐galactosidase gene as an insertional element, has allowed the identification of tissue‐ specific Hoxc13 expression sites in heterozygous mice. In addition to the expression in tail vertebrae, an unexpected expression occurred in developing hair follicles, as well as in tongue and nail, all typical regions of hair‐keratin and (possibly) KAP expression. Although the Hoxc13
/
mice possessed hair follicles, they were essentially naked, the hair fibers apparently breaking oV at the skin surface. Interestingly, Hoxc13 overexpressing mice also showed a fragile hair phenotype (Tkatchenko et al., 2001). Microarray analysis of these mice compared to controls revealed that Hoxc13 overexpression resulted in the down‐regulation of a plethora of high sulfur KAP and high glycine‐ tyrosine KAP genes (Tkatchenko et al., 2001). These included the high sulfur mKRTAP 11‐1 (hacl1), mKRTAP14‐1 (pmg1), and mKRTAP15‐1 (pmg2) genes, as well as 10 novel mouse high glycine‐tyrosine KAP genes designated as the KAP16 family, due to the location of these genes on mouse chromosome 16. The mouse KAP16 family is not a homogenous entity and is not related to the single human KAP16 family member, KAP16.1 (Rogers et al., 2001). Rather, these murine KAPs have recently been shown to be similar to several members of the human high glycine‐tyrosine KAP6, KAP19, and KAP 21 families as well as to a novel mouse KAP family, which was designated the mouse KAP18 family (Pruett et al., 2004; Rogers et al., 2001: see Section II.B.3). In humans, several 8 bp HOXC13 enhancer elements have been identified in the promoters of the type I hair keratin genes KRTHA2 and KRTHA5, as well as in the majority of the genes for KAP10 and KAP12 family members (Jave‐ Suarez et al., 2002; Rogers et al., 2004b). Furthermore, transfection studies in epithelial cell lines have shown HOXC13 activation of hair keratin genes KRTHA2 and KRTHA5. In line with these finding, both HOXC13 mRNA and protein could be demonstrated in the hair matrix, precortex, and cuticle (Jave‐Suarez et al., 2002). Preliminary data indicate the expression of a further Hox family member, Hoxc12 in mouse hair follicles, whose expression is

252

ROGERS ET AL.

found in the upper hair cortex, suggesting that a role for this transcription factor in late hair fiber diVerentiation might exist (Shang et al., 2002). Another model showing variations in KAP gene expression is the nude mouse (Flanagan, 1966). This mouse is characterized by hair loss and severe T‐cell immunodeficiency caused by morphological disorder of the thymus leading to failure of T‐cell activation. Nude mice have fully developed hair follicles, but the hair follicle formed is faulty, showing abnormalities in the upper portion of the hair cuticle, cortex, and IRS‐cuticle. The resulting hairs are brittle and are unable to break through to the skin surface (Ko¨pf‐Maier et al., 1990). Genetic mapping studies followed by positional cloning identified the Foxn1 gene (initially termed whn, winged helix nude) as being causal for this phenotype (Nehls et al., 1994a,b). Mutations in FOXN1 have been found in a child suVering from congenital alopecia and T‐cell deficiency, confirming the nude phenotype in humans (Frank et al., 1999). Foxn1 is one member of a large family (ca. 40 members in humans) of forkhead box (Fox) transcription factors known to regulate the expression of genes associated with the development of a myriad of regions such as the integument, eye, thyroid, palate, as well as hearing and speech development (Lehmann et al., 2003a). Foxn1 binds to an 11 bp DNA sequence containing an invariant 4 bp core motif (Schlake et al., 1997). Foxn1 expression has been localized to the skin, hair follicle, nail, thymus, tongue, palate and teeth, many of these regions also being associated with hair keratin/ KAP gene expression (Lee et al., 1999; Meier et al., 1999), and several lines of evidence point to Foxn1 being eVectively involved in hair keratin and KAP expression. For example, partial characterization of mouse hair keratins in nude as well as control mice, reveal a strong decrease in the expression of the type I hair keratins Ha1, Ha4, Hb6 as well as a near elimination of Ha3 expression, whose gene has been shown to possess a Foxn1 binding site in intron 1 (Meier et al., 1999; Schlake et al., 2000). Evidence for direct involvement of Foxn1 in hair keratin expression has been provided by stable transfection of the Foxn1 cDNA into HeLa cells under the control of a tetracycline sensitive (tet‐on) promoter. The induction of Foxn1 in these cells, resulted in the expression of hair keratins Ha3‐II and Hb5, as well as the up‐regulation of Hb1 and Hb6 expression, suggesting a direct mechanisms of activation for these genes (Schlake et al., 2000). The plethora of data associated with hair keratin regulation by Foxn1 suggests that changes in KAP expression might also play a role in the nude mouse. This appears to be the case. Indeed, nails in nude mice are deformed, the nail plate being thin and breaking before separating from the hyponychium. In comparison to controls, nails of nude mice have a much lower sulfur content, which might indicate a decrease in high/ultrahigh sulfur KAP proteins (Mecklenburg et al., 2004). In addition, comparative microarray analysis of hair follicles from nude versus controls mice showed that several

HUMAN KERATIN‐ASSOCIATED PROTEINS

253

members of the mouse high/ultrahigh sulfur KAP and high‐glycine‐tyrosine KAP families were indeed down‐regulated in nude mice, including members of the mouse KAP5 family (Schlake et al., 2000). Other dysregulated members of the Fox gene family also possess hair phenotypes. One of these is FOXE1/TTF2, whose gene is important in embryonic thyroid development (Zannini et al., 1997). A missense mutation in the FOXE1/TTF2 gene was found in patients suVering from Bamforth‐ Lazarus syndrome, a hereditary disease characterized by congenital hypothyroidism, spiky hair, and cleft palate (Bamforth et al., 1989; Clifton‐Bligh et al., 1998). The hairs from these patients exhibit a reduced hair shaft diameter and a loss of the hair cuticle. In mouse and human, Foxe1 appears to be expressed in the basal layer of the ORS, which might indicate an indirect eVect on hair formation (Brancaccio et al., 2004; Eichberger et al., 2004). Foxe1 seems to be activated by the sonic hedgehog (shh) signaling cascade, because mice overexpressing a dominant negative mutation of gli2, a transcription factor associated with this cascade, lose normal Foxe1 gene expression. A third Fox family member in which mutations produce a hair phenotype is Foxq1. Deletion mutation in this gene appear responsible for the silky coat of the satin (sa) mouse (Hong et al., 2001). Normally, Foxq1 expression is found in the proliferative matrix cell region and in the medulla of hair follicles. Satin mice possess a disorganized medulla which does not contain the typical vacuoles found in control mice. Satin mice also exhibit medullar melanin clumping. Despite the drastic disturbances in the medulla, the general structure of the hair fiber appears not to be compromised. An additional mouse mutant, the naked mouse (Lebedinsky and Dauvart, 1927), exhibited a hereditary hair loss characterized by patchy hair growth and a lusterless coat occurring mainly on the back skin and above the forepaws. Similar to the nude mouse, this phenotype appeared to be due to the breaking of hair as it reaches the skin surface. Light and electron microscopy of naked mouse hair demonstrated partial loss of the hair cuticle, as well as cortical abnormalities (David, 1932; Raphael et al., 1982). Amino acid analysis of naked mice hair showed a strong decrease in glycine and tyrosine when compared to wild type mice (Raphael et al., 1984; Tenenhouse and Gold, 1976; Tenenhouse et al., 1974). Radioactive labeling and two‐dimensional gel separation of hair protein from wild type, as well as heterozygous and homozygous naked mice revealed a decrease in nearly all glycine‐tyrosine proteins in these animals. Further changes in homozygous animals occurred in high sulfur KAPs as well as hair keratins (Raphael et al., 1984). The naked mutant was originally thought to be a putative model for hidrotic ectodermal dysplasia (ED) (see Section III.B.1). However, the changes that occur in the naked mouse (decreased glycine‐tyrosine KAP production; Tenenhouse et al., 1974) appear opposite to that seen in ED (increased glycine‐tyrosine KAP production, Gold and Scriver, 1972).

254

ROGERS ET AL.

IV. Concluding Remarks To date, a total of 85 KAP genes have been identified in the human genome. The human KAP genes discovered, to date, are grouped together in five domains on four chromosomes, and the majority of the KAP genes identified in the human genome are transcriptionally active. The proteins derived from the genes possess either a high cysteine or high glycine‐tyrosine content. Sixty‐eight (68) of them fall into the class of high sulfur proteins; 17 exhibit a high glycine‐tyrosine content. A majority of the KAPs exhibit regions of repetitiveness, and the complexity of the repeat structure in a given KAP is often variable due to repeat deletion polymorphisms in the underlying gene. KAP expression has only been found in distinct cell populations of the hair follicle involved in the formation of the hair fiber, namely the proliferative matrix cells and the cells of the cortex and cuticle. To date, several areas of indirect evidence point toward the involvement of KAPs in human hair anomalies, and several hair follicle–associated proteins (primarily transcription factors) appear to be involved in KAP expression. In summary, it appears that we have come full circle, going from a purely protein chemistry approach in the 1970s–1990s, through a genome research‐oriented gene discovery approach during the last decade, back to a molecular biology supported biochemical approach to KAP research. In the future, continuing studies are needed in several major areas. First among these is the final elucidation of the role that KAPs play in hair fiber formation. This requires the knowledge of the nature and mechanisms of KAP/KAP as well as KAP/ KIF interactions, without excluding the possibility that KAPs might play other roles outside of a purely structural aspect. Also in need of further clarification is whether KAP proteins are directly involved in hereditary hair anomalies. Due to the number of KAP genes in the human genome, this task appears fairly daunting, but linkage analysis of aVected persons and their families might give an initial clue as to whether a disease phenotype is linked to one of the KAP gene domains. Unfortunately, mutation analysis is further complicated by the polymorphic variations found in certain KAP genes. The continued study of these variations are, therefore, of further interest, for increased polymorphism analysis of all KAP genes in a larger number of human populations could help both in the interpretation of data from mutation analysis, as well as in additional forensic and population genetic studies. Finally, in view of the bewildering expression characteristics of KAPs, the elucidation of KAP gene regulation will be a major challenge in the future. Some putative factors have been identified (Hoxc13, Foxn1), but further research is needed to broaden our knowledge of regulatory proteins and the role that they play during hair morphogenesis.

HUMAN KERATIN‐ASSOCIATED PROTEINS

255

Acknowledgments We wish to thank Professor G. E. Rogers for allowing us to use the illustration found in Fig. 3. This work was supported by the German Research Council (DFG) under the number SCHW539/4‐1,‐2.

References Aoki, N., and Ito, M. (1997). Isolation and characterization of mouse high‐glycine/tyrosine proteins. J. Biol. Chem. 272, 30512–30518. Aoki, N., Ito, K., and Ito, M. (1998). Hair follicle has a novel anagen‐specific protein, mKAP13. J. Invest. Dermatol. 111, 804–809. Awgulewitsch, A. (2003). Hox in hair growth and development. Naturwissenschaften 90, 193–211. Bahr, G. F. (1954). Osmium tetroxide and ruthenium tetroxide and their reactions with biologically important substances. Electron stains. III. Exp. Cell Res. 7, 457–479. Bamforth, J. S., Hughes, I. A., Lazarus, J. H., Weaver, C. M., and Harper, P. S. (1989). Congenital hypothyroidism, spiky hair, and cleft palate. J. Med. Genet. 26, 49–51. Bergmann, E., and Egly, J. M. (2001). Trichothiodystrophy, a transcription syndrome. Trends Genet. 17, 279–286. Birbeck, M. S., and Mercer, E. H. (1957a). The electron microscopy of the human hair follicle. I. Introduction and the hair cortex. J. Biophys. Biochem. Cytol. 3, 203–214. Birbeck, M. S., and Mercer, E. H. (1957b). The electron microscopy of the human hair follicle. II. The hair cuticle. J. Biophys. Biochem. Cytol. 3, 215–222. Brancaccio, A., Minichiello, A., Grachtchouk, M., Antonini, D., Sheng, H., Parlato, R., Dathan, N., Dlugosz, A. A., and Missero, C. (2004). Requirement of the forkhead gene Foxe1, a target of sonic hedgehog signaling, in hair follicle morphogenesis. Hum. Mol. Genet. 13, 2595–2606. Chien, Y. H., Iwashima, M., Kaplan, K. B., Elliott, J. F., and Davis, M. M. (1987). A new T‐cell receptor gene located within the alpha locus and expressed early in T‐cell diVerentiation. Nature 327, 677–682. Clifton‐Bligh, R. J., Wentworth, J. M., Heinz, P., Crisp, M. S., John, R., Lazarus, J. H., Ludgate, M., and Chatterjee, V. K. (1998). Mutation of the gene encoding human TTF‐2 associated with thyroid agenesis, cleft palate and choanal atresia. Nat. Genet. 19, 399–401. Cole, S. E., and Reeves, R. H. (1998). A cluster of keratin‐associated proteins on mouse chromosome 10 in the region of conserved linkage with human chromosome 21. Genomics 54, 437–442. Crewther, W. G. (1976). Primary structure and chemical properties of wool. In ‘‘Proceedings of the 5th International Wool Textile Research Conference’’ (K. Ziegler, Ed.), pp. 1–101. German Wool Res. Inst, Aachen, Germany. David, L. T. (1932). The external expression and comparative dermal histology of hereditary hairlessness in mammals. Zeitschrift fu¨r Zellforschung und Mikroskopische Anatomie 14, 616–710. de Boer, J., de Wit, J., van Steeg, H., Berg, R. J., Morreau, H., Visser, P., Lehmann, A. R., Duran, M., Hoeijmakers, J. H., and Weeda, G. (1998). A mouse model for the basal transcription/DNA repair syndrome trichothiodystrophy. Mol. Cell 1, 981–990. Dopheide, T. A. (1973). The primary structure of a protein, component 0.62, rich in glycine and aromatic residues, obtained from wool keratin. Eur. J. Biochem. 34, 120–124.

256

ROGERS ET AL.

Dowling, L. M., Crewther, G., and Inglis, A. (1986). The primary structure of component 8c‐1, a subunit protein of intermediate filaments in wool keratin. Biochem. J. 236, 695–703. Eichberger, T., Regl, G., Ikram, M. S., Neill, G. W., Philpott, M. P., Aberger, F., and Frischauf, A. M. (2004). FOXE1, A new transcriptional target of GLI2 is expressed in human epidermis and basal cell carcinoma. J. Invest. Dermatol. 122, 1180–1187. Elleman, T. C. (1971). Amino‐acid sequence of a high‐sulphur protein from wool. Nat. New Biol. 234, 148. Elleman, T. C. (1972a). The amino acid sequence of protein SCMK‐B2A from the high‐sulphur fraction of wool keratin. Biochem. J. 130, 833–845. Elleman, T. C. (1972b). The amino acid sequence of protein SCMK‐B2C from the high‐sulphur fraction of wool keratin. Biochem. J. 128, 1229–1239. Elleman, T. C., and Dopheide, T. A. (1972). The sequence of SCMK‐B2B, a high‐sulfur protein from wool keratin. J. Biol. Chem. 247, 3900–3909. Escobar, V., Goldblatt, L. I., Bixler, D., and Weaver, D. (1983). Clouston syndrome: An ultrastructural study. Clin. Genet. 24, 140–146. Flanagan, S. P. (1966). ‘‘Nude,’’ a new hairless gene with pleiotropic eVects in the mouse. Genet. Res. 8, 295–309. Frank, J., Pignata, C., Panteleyev, A. A., Prowse, D. M., Baden, H., Weiner, L., Gaetaniello, L., Ahmad, W., Pozzi, N., Cserhalmi‐Friedman, P. B., Aita, V. M., Uyttendaele, H., Gordon, D., Ott, J., Brissette, J. L., and Christiano, A. M. (1999). Exposing the human nude phenotype. Nature 398, 473–474. Fratini, A., Powell, B. C., and Rogers, G. E. (1993). Sequence, expression, and evolutionary conservation of a gene encoding a glycine/tyrosine‐rich keratin‐associated protein of hair. J. Biol. Chem. 268, 4511–4518. Fratini, A., Powell, B. C., Hynd, P. I., Keough, R. A., and Rogers, G. E. (1994). Dietary cysteine regulates the levels of mRNAs encoding a family of cysteine‐rich proteins of wool. J. Invest. Dermatol. 102, 178–185. Frenkel, M. J., Powell, B. C., Ward, K. A., Sleigh, M. J., and Rogers, G. E. (1989). The keratin BIIIB gene family: Isolation of cDNA clones and structure of a gene and a related pseudogene. Genomics 4, 182–191. Frit, P., Bergmann, E., and Egly, J. M. (1999). Transcription factor IIH: A key player in the cellular response to DNA damage. Biochimie. 81, 27–38. Fuchs, E., and Weber, K. (1994). Intermediate filaments: Structure, dynamics, function and disease. In ‘‘Annual Review of Biochemistry’’ (C. C. Richardson, Ed.), pp. 345–382. Annual Reviews Inc, Palo Alto, Calif. Gillespie, J. M. (1972). Proteins rich in glycine and tyrosine from keratins. Comp. Biochem. Physiol. B. 41, 723–734. Gillespie, J. M. (1983). The structural proteins of hair: Isolation, characterization and regulation of biosynthesis. In ‘‘Biochemistry and Physiology of the Skin’’ (L. A. Goldsmith, Ed.), pp. 475–510. Oxford University Press, Oxford. Gillespie, J. M. (1991). The structural proteins of hair: Isolation, characterization and regulation of biosynthesis. In ‘‘Physiology, Biochemistry and Molecular Biology of the Skin’’ (L. A. Goldsmith, Ed.), pp. 625–659. Oxford University Press, Oxford. Gillespie, J. M., and Broad, A. (1972). Ultra‐high‐sulphur proteins in the hairs of the artiodactyla. Aust. J. Biol. Sci. 25, 138–145. Gillespie, J. M., and Marshall, R. C. (1983). A comparison of the proteins of normal and trichothiodystrophic human hair. J. Invest. Dermatol. 80, 195–202. Gillespie, J. M., and Reis, P. J. (1966). The dietary‐regulated biosynthesis of high‐sulphur wool proteins. Biochem. J. 98, 669–677. Godwin, A. R., and Capecchi, M. R. (1998). Hoxc13 mutant mice lack external hair. Genes Dev. 12, 11–20.

HUMAN KERATIN‐ASSOCIATED PROTEINS

257

Gold, R. J., and Scriver, C. R. (1972). Properties of hair keratin in an autosomal dominant form of ectodermal dysplasia. Am. J. Hum. Genet. 24, 549–561. Hanukoglu, I., and Fuchs, E. (1983). The cDNA sequence of a type II cytoskeletal keratin reveals constant and variable structural domains among keratins. Cell 33, 915–924. Haylett, T., Swart, L. S., and Parris, D. (1971). Studies on the high‐sulphur proteins of reduced merino wool. Amino acid sequence of protein SCMKB‐3B 3. Biochem. J. 123, 191–200. Hesse, M., Zimek, A., Weber, K., and Magin, T. M. (2004). Comprehensive analysis of keratin gene clusters in humans and rodents. Eur. J. Cell Biol. 83, 19–26. Higgins, D. G., and Sharp, P. M. (1988). CLUSTAL: A package for performing multiple sequence alignment on a microcomputer. Gene 73, 237–244. Higgins, D. G., Thompson, J. D., and Gibson, T. J. (2000). Using CLUSTAL for multiple sequence alignments. Methods Enyzmol. 266, 383–402. Hoepke, H. (1927). Die Haare. In ‘‘Handbuch der mikroskopischen Anatomie’’ (W. V. Moellendorf, Ed.), pp. 68–88. Springer Verlag, Berlin. Hong, H. K., Noveroske, J. K., Headon, D. J., Liu, T., Sy, M. S., Justice, M. J., and Chakravarti, A. (2001). The winged helix/forkhead transcription factor Foxq1 regulates diVerentiation of hair in satin mice. Genesis 29, 163–171. Huh, N., Kashiwagi, M., Konishi, C., Hashimoto, Y., Kohno, Y., Nomura, S., and Kuroki, T. (1994). Isolation and characterization of a novel hair follicle‐specific gene, Hacl‐1. J. Invest. Dermatol. 102, 716–720. Jave‐Suarez, L. F., Winter, H., Langbein, L., Rogers, M. A., and Schweizer, J. (2002). HOXC13 is involved in the regulation of human hair keratin gene expression. J. Biol. Chem. 277, 3718–3726. Jenkins, B. J., and Powell, B. C. (1994). DiVerential expression of genes encoding a cysteine‐rich keratin family in the hair cuticle. J. Invest. Dermatol. 103, 310–317. Johnson, L. D., Idler, W. W., Zhou, X., Roop, D. R., and Steinert, P. M. (1985). Structure of a gene for the human epidermal 67‐kDa keratin. Proc. Nat. Acad. Sci. 82, 1896–1900. Kariya, N., Shimomura, Y., and Ito, M. (2005). Size polymorphisms in the human ultrahigh sulfur hair keratin‐associated protein 4, KAP4, gene family. J. Invest. Dermatol. 124, 1111–1118. Kere, J., Srivastava, A. K., Montonen, O., Zonana, J., Thomas, N., Ferguson, B., Munoz, F., Morgan, D., Clarke, A., Baybayan, P., Chen, E. Y., Ezer, S., Saarialho‐Kere, U., de la, C. A., and Schlessinger, D. (1996). X‐linked anhidrotic (hypohidrotic) ectodermal dysplasia is caused by mutation in a novel transmembrane protein. Nat. Genet. 13, 409–416. Ko¨pf‐Maier, P., Mboneko, V. F., and Merker, H. J. (1990). Nude mice are not hairless. Acta Anat. 139, 178–190. Korge, B. P., Compton, J. G., Steinert, P. M., and Mischke, D. (1992a). The two size alleles of human keratin 1 are due to a deletion in the glycine‐rich carboxyl‐terminal V2 subdomain. J. Invest. Dermatol. 99, 697–702. Korge, B. P., Gan, S.‐Q., McBride, W., Mischke, D., and Steinert, P. M. (1992b). Extensive size polymorphism of the human keratin 10 chain residues in the C‐terminal V2 subdomain due to variable numbers and sizes of glycine loops. Proc. Nat. Acad. Sci. 89, 910–914. Krieg, T. M., Schafer, M. P., Cheng, C. K., Filpula, D., Flaherty, P., Steinert, P. M., and Roop, D. R. (1985). Organization of a type I keratin gene: Evidence for evolution of intermediate filaments from a common ancestral gene. J. Biol. Chem. 260, 5867–5870. Kuczek, E., and Rogers, G. E. (1985). Sheep keratins: characterization of cDNA clones for the glycine þ tyrosine‐rich wool proteins using a synthetic probe. Eur. J. Biochem. 146, 89–93. Kuczek, E. S., and Rogers, G. E. (1987). Sheep wool (glycine þ tyrosine)‐rich keratin genes: a family of low sequence homology. Eur. J. Biochem. 166, 79–85.

258

ROGERS ET AL.

Kuhn, F., Lassing, C., Rang, A., Mueller, M., Hunziker, T., Ziemiecki, A., and Andres, A.‐C. (1999). Pmg‐1 and Pmg‐2 constitute a novel family of KAP genes diVerentially expressed during skin and mammary gland development. Mech. Dev. 86, 193–196. Lamartine, J. (2003). Towards a new classification of ectodermal dysplasias. Clin. Exp. Dermatol. 28, 351–355. Lamartine, J., Munhoz, E. G., Kibar, Z., Lanneluc, I., Callouet, E., Laoudj, D., Lemaitre, G., Hand, C., Hayflick, S. J., Zonana, J., Antonarakis, S., Radhakrishna, U., Kelsell, D. P., Christianson, A. L., Pitaval, A., Der, K.,V, Fraser, C., Blanchet‐Bardon, C., Rouleau, G. A., and Waksman, G. (2000). Mutations in GJB6 cause hidrotic ectodermal dysplasia [In Process Citation]. Nat. Genet. 26, 142–144. Langbein, L., and Schweizer, J. (2005). Keratins of the Human Hair Follicle. Int. Rev. Cytol. 243, 1–78. Langbein, L., Rogers, M. A., Winter, H., Praetzel, S., and Schweizer, J. (2001). The catalog of human hair keratins. II. expression of the six type II members in the hair follicle and the combined catalog of human type I and II keratins. J. Biol. Chem. 276, 35123–35132. Langbein, L., Spring, H., Rogers, M. A., Praetzel, S., and Schweizer, J. (2004). Hair keratins and hair follicle‐specific epithelial keratins. Methods Cell Biol. 78, 413–451. Langbein, L., Rogers, M. A., Winter, H., Praetzel, S., Beckhaus, U., Rackwitz, H.‐R., and Schweizer, J. (1999). The catalog of human hair keratins: I. Expression of the nine type I members in the hair follicle. J. Biol. Chem. 274, 19874–19884. Lebedinsky, N. G., and Dauvart, A. (1927). Atrochosis und ihre Vererbung bei der albinotischen Hausmaus. Biologisches Zentralblatt 47, 748–752. Lee, D., Prowse, D. M., and Brissette, J. L. (1999). Association between mouse nude gene expression and the initiation of epithelial terminal diVerentiation. Dev. Biol. 208, 362–374. Lehmann, A. R. (2003). DNA repair‐deficient diseases, xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy. Biochimie. 85, 1101–1111. Lehmann, O. J., Sowden, J. C., Carlsson, P., Jordan, T., and Bhattacharya, S. S. (2003a). Fox’s in development and disease. Trends Genet. 19, 339–344. Mack, J. A., Li, L., Sato, N., Hascall, V. C., and Maytin, E. V. (2005). Hoxb13 up‐regulates transglutaminase activity and drives terminal diVerentiation in an epidermal organotypic model. J Biol. Chem. 280, 29904–29911. MacKinnon, P. J., Powell, B. C., and Rogers, G. E. (1990). Structure and expression of genes for a class of cysteine‐rich proteins of the cuticule layers of diVerentiating wool and hair follicles. J. Cell. Biol. 111, 2587–2600. Marshall, R. C., and Gillespie, J. M. (1982). Comparison of samples of human hair by two‐ dimensional electrophoresis. J. Forens. Sci. Soc. 22, 377–385. Marshall, R. C., Gillespie, J. M., Inglis, A. S., and Frenkel, M. J. (1980). High‐tyrosine proteins of wool: Heterogeneity and biosynthetic regulation. In ‘‘Proceedings of the Sixth International Wool Textile Research Conference’’ (K. Ziegler, Ed.), pp. 147–158. German Wool Research Institute, Aachen. McNab, A. R., Andrus, P., Wagner, T. E., Buhl, A. E., Waldon, D. J., Kawabe, T. T., Rae, T. J., Groppi, V., and Vogeli, G. (1990). Hair‐specific expression of chloramphenicol acetyltransferase in transgenic mice under the control of an ultra‐high‐sulfur keratin promoter. Proc. Nat. Acad. Sci. 87, 6848–6852. McNab, A. R. P., Wood, L., Theriault, N., Gierman, T., and Vogeli, G. (1989). An ultra‐high sulfur keratin gene is expressed specifically during hair growth. J. Invest. Dermatol. 92, 263–266. Mecklenburg, L., Paus, R., Halata, Z., Bechtold, L. S., Fleckman, P., and Sundberg, J. P. (2004). FOXN1 is critical for onycholemmal terminal diVerentiation in nude (Foxn1) mice. J. Invest. Dermatol. 123, 1001–1011.

HUMAN KERATIN‐ASSOCIATED PROTEINS

259

Meier, N., Dear, T. M., and Boehm, T. (1999). Whn and mHa3 are components of the genetic hierarchy controlling hair follicle diVerentiation. Mech. Dev. 89, 215–221. Messenger, A. G., and Rundegren, J. (2004). Minoxidil: Mechanisms of action on hair growth. Br. J. Dermatol. 150, 186–194. Mitsui, S., Ohuchi, A., Adachi‐Yamada, T., Hotta, M., Tsuboi, R., and Ogawa, H. (1998). Structure and hair follicle‐specific expression of genes encoding the rat high sulfur protein B2 family. Gene 208, 123–129. Moll, I. (1993). Cytokeratine: Marker epithelialer diVerenzierung. Der Hautarzt. 44, 491–501. Moll, R., Franke, W. W., Schiller, D. L., Geiger, B., and Krepler, R. (1982). The catalog of human cytokeratins: Patterns of expression in normal epithelia, tumors and cultured cells. Cell 31, 11–24. Muller‐Rover, S., Handjiski, B., van, d., V, Eichmuller, S., Foitzik, K., McKay, I. A., Stenn, K. S., and Paus, R. (2001). A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages. J. Invest. Dermatol. 117, 3–15. Nehls, M., Luno, K., Schorpp, M., Krause, S., Matysiak‐Scholze, U., Prokop, C. M., Hedrich, H. J., and Boehm, T. (1994a). A yeast artificial chromosome contig on mouse chromosome 11 encompassing the nu locus. Eur. J. Immunol. 24, 1721–1723. Nehls, M., Pfeifer, D., Schorpp, M., Hedrich, H., and Boehm, T. (1994b). New member of the winged‐helix protein family disrupted in mouse and rat nude mutations. Nature 372, 103–107. Parris, D., and Swart, L. S. (1975). Studies on the high‐sulphur proteins of reduced mohair. The isolation and amino acid sequence of protein scmkb‐m1.2. Biochem. J. 145, 459–467. Perez, C., Auriol, J., Gerst, C., Bernard, B. A., and Egly, J. M. (1999). Genomic organization and promoter characterization of two human UHS keratin genes. Gene 227, 137–148. Pollitt, R. J., and Stonier, P. D. (1971). Proteins of normal hair and of cystine‐deficient hair from mentally retarded siblings. Biochem. J. 122, 433–444. Powell, B. C., and Rogers, G. E. (1997). The role of keratin proteins and their genes in the growth, structure and properties of hair. In ‘‘Formation and Structure of Human Hair’’ (P. Jolles H. Zahn, and H. Ho¨cker, Eds.), pp. 59–148. Birkha¨user Verlag, Basel. Powell, B. C., Arthur, J., and Nesci, A. (1995). Characterization of a gene encoding a cysteine‐ rich keratin associated protein synthesized late in rabbit hair follicle diVerentiation. DiVerentiation 58, 227–232. Powell, B. C., Nesci, A., and Rogers, G. E. (1991). Regulation of keratin gene expression in hair follicle diVerentiation. Ann. N. Y. Acad. Sci. 642, 1–19. Powell, B. C., Sleigh, M. J., Ward, K. A., and Rogers, G. E. (1983). Mammalian keratin gene families: Organization of genes coding for the B2 high‐sulphur protein of sheep wool. Nucleic Acids Res. 11, 5327–5346. Price, V. H., Odom, R. B., Ward, W. H., and Jones, F. T. (1980). Trichothiodystrophy. Sulfur‐ deficient brittle hair as a marker for a neuroectodermal symptom complex. Archives Dermatol. 116, 1375–1384. Pruett, N. D., Tkatchenko, T. V., Jave‐Suarez, L., Jacobs, D. F., Potter, C. S., Tkatchenko, A. V., Schweizer, J., and Awgulewitsch, A. (2004). Krtap16, characterization of a new hair keratin‐associated protein (KAP) gene complex on mouse chromosome 16 and evidence for regulation by Hoxc13. J. Biol. Chem. 279, 51524–51533. Rabionet, R., Lopez‐Bigas, N., Arbones, M. L., and Estivill, X. (2002). Connexin mutations in hearing loss, dermatological and neurological disorders. Trends Mol. Med. 8, 205–212. Raphael, K. A., Marshall, R. C., and Pennycuik, P. R. (1984). Protein and amino acid composition of hair from mice carrying the naked (N) gene. Genet. Res. 44, 29–38. Raphael, K. A., Chapman, R. E., Frith, P. A., and Pennycuik, P. R. (1982). The structure of hair and follicles of mice carrying the naked (N) gene. Genet. Res. 39, 139–148.

260

ROGERS ET AL.

Rogers, G. E. (1959a). Electron microscope studies of hair and wool. Ann. N. Y. Acad. Sci. 83, 378–399. Rogers, G. E. (1959b). Electron microscopy of wool. J. Ultrastruct. Res. 2, 309–330. Rogers, G. E. (2004). Hair follicle diVerentiation and regulation. Int. J. Dev. Biol. 48, 163–170. Rogers, G. E., and Powell, B. C. (1993). Organization and expression of hair follicle genes. J. Invest. Dermatol. 101, 50s–55s. Rogers, G. R., Hickford, J. G., and BickerstaVe, R. (1994). Polymorphism in two genes for B2 high sulfur proteins of wool. Anim. Genet. 25, 407–415. Rogers, M. A. (2003). Keratins and keratin diseases. In ‘‘Nature: Encyclopedia of the Human Genome’’ (D. N. Cooper, Ed.), pp. 606–610. Nature Publishing Group, London. Rogers, M. A., and Schweizer, J. (2005). Human KAP genes, only the half of it? Extensive size polymorphisms in hair keratin‐associated protein genes. J. Invest. Dermatol. 124, vii–vix. Rogers, M. A., Winter, H., Langbein, L., Bleiler, R., and Schweizer, J. (2004a). The human type I keratin gene family: Characterization of new hair follicle specific members and evaluation of the chromosome 17q21.2 gene domain. DiVerentiation 72, 527–540. Rogers, M. A., Winter, H., Langbein, L., Wolf, C., and Schweizer, J. (2000). Characterization of a 300 kbp region of human DNA containing the type II hair keratin gene domain. J. Invest. Dermatol. 114, 464–472. Rogers, M. A., Winter, H., Wolf, C., Heck, M., and Schweizer, J. (1998). Characterization of a 190‐kilobase pair domain of human type I hair keratin genes. J. Biol. Chem. 273, 26683–26691. Rogers, M. A., Edler, L., Winter, H., Langbein, L., Beckmann, I., and Schweizer, J. (2005). Characterization of new members of the human type II keratin gene family and a general evaluation of the keratin gene domain on chromosome 12q13.13. J. Invest. Dermatol. 124, 536–544. Rogers, M. A., Langbein, L., Winter, H., Beckmann, I., Praetzel, S., and Schweizer, J. (2004b). Hair keratin associated proteins: Characterization of a second high sulfur KAP gene domain on human chromosome 21. J. Invest. Dermatol. 122, 147–158. Rogers, M. A., Langbein, L., Winter, H., Ehmann, C., Praetzel, S., Korn, B., and S.J., B. (2001). Characterization of a cluster of human high/ultrahigh sulfur keratin associated protein (KAP) genes imbedded in the type I keratin gene domain on chromosome 17q12–21. J. Biol. Chem. 276, 19440–19451. Rogers, M. A., Langbein, L., Winter, H., Ehmann, C., Praetzel, S., and Schweizer, J. (2002). Characterization of a first domain of human high glycine‐tyrosine and high sulfur keratin‐associated protein (KAP) genes on chromosome 21q22.1. J. Biol. Chem. 277, 48993–49002. Saitou, N., and Nei, M. (1987). The neighbor‐joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Scheel, H., Tomiuk, S., and Hofmann, K. (2002). A common protein interaction domain links two recently identified epilepsy genes. Hum. Mol. Genet. 11, 1757–1762. Schlake, T., Schorpp, M., Maul‐Pavicic, A., Malashenko, A. M., and Boehm, T. (2000). Forkhead/winged‐helix transcription factor whn regulates hair keratin gene expression: Molecular analysis of the nude skin phenotype [In Process Citation]. Dev. Dyn. 217, 368–376. Schlake, T., Schorpp, M., Nehls, M., and Boehm, T. (1997). The nude gene encodes a sequence‐ specific DNA binding protein with homologs in organisms that lack an anticipatory immune system. Proc. Nat. Acad. Sci. 94, 3842–3847. Shang, L., Pruett, N. D., and Awgulewitsch, A. (2002). Hoxc12 expression pattern in developing and cycling murine hair follicles. Mech. Dev. 113, 207–210. Shibuya, K., Kudoh, J., Obayashi, I., Shimizu, A., Sasaki, T., Minoshima, S., and Shimizu, N. (2004a). Comparative genomics of the keratin‐associated protein (KAP) gene clusters in human, chimpanzee, and baboon. Mamm. Genome 15, 179–192.

HUMAN KERATIN‐ASSOCIATED PROTEINS

261

Shibuya, K., Obayashi, I., Asakawa, S., Minoshima, S., Kudoh, J., and Shimizu, N. (2004b). A cluster of 21 keratin‐associated protein genes within introns of another gene on human chromosome 21q22.3. Genomics 83, 679–693. Shimomura, Y., Aoki, N., Rogers, M. A., Langbein, L., Schweizer, J., and Ito, M. (2002a). hKAP1.6 and hKAP1.7, Two Novel Human High Sulfur Keratin‐Associated Proteins are Expressed in the Hair Follicle Cortex. J. Invest. Dermatol. 118, 226–231. Shimomura, Y., Aoki, N., Rogers, M. A., Langbein, L., Schweizer, J., and Ito, M. (2003). Characterization of human keratin‐associated protein 1 family members. J. Invest. Dermatol. Symp. Proc. 8, 96–99. Shimomura, Y., Aoki, N., Schweizer, J., Langbein, L., Rogers, M. A., Winter, H., and Ito, M. (2002b). Polymorphisms in the human high sulfur hair keratin‐associated protein 1, KAP1, gene family. J. Biol. Chem. 277, 45493–45501. Smith, F. (2003). The molecular genetics of keratin disorders. Am. J. Clin. Dermatol. 4, 347–364. Soma, T., Iino, M., Tajima, M., and Kishimoto, J. (2005). Expression of novel keratin associated protein 5 genes in the cuticle layer of human hair follicles. Journal of Dermatol. Sci. 38, 110–112. Stary, A., and Sarasin, A. (1996). The genetic basis of xeroderma pigmentosum and trichothiodystrophy syndromes. Cancer Surv. 26, 155–171. Steinert, P. M., and Roop, D. R. (1988). Molecular and cellular biology of intermediate filaments. Ann. Rev. Biochem. 57, 593–625. Steinert, P. M., North, A. C. T., and Parry, D. A. D. (1994). Structural features of keratin intermediate filaments. J. Invest. Dermatol. 103, S19–S24. Steinert, P. M., Steven, A. C., and Roop, D. R. (1985). The molecular biology of intermediate filaments. Cell 42, 411–419. Swart, L. S., and Haylett, T. (1971). Studies on the high‐sulphur proteins of reduced Merino wool. Amino acid sequence of protein SCMKB‐3B 4. Biochem. J. 123, 201–210. Swart, L. S., and Haylett, T. (1973). Studies on the high‐sulphur proteins of reduced Merino wool. Amino acid sequence of protein SCMKB‐3A3. Biochem. J. 133, 641–654. Swart, L. S., Joubert, F. J., and Parris, D. (1976). Homology in the amino acid sequences of the high‐sulphur proteins from keratins. In ‘‘Proceedings of the 5th International Wool Textile Research Conference’’ (K. Ziegler, Ed.), pp. 254–264. German Wool Research Institute, Aachen. Swift, J. A. (1997). Morphology and biochemistry of human hair. In ‘‘Formation and Structure of Human Hair’’ (P. Jolles, H. Zahn, and H. Ho¨cker, Eds.), pp. 149–176. Birkha¨user Verlag, Berlin. Takaishi, M., Takata, Y., Kuroki, T., and Huh, N.‐H. (1998). Isolation and characterization of a putative keratin‐associated protein gene expressed in embryonic skin of mice. J. Invest. Dermatol. 111, 128–132. Tenenhouse, H. S., and Gold, R. J. (1976). Loss of a homologous group of proteins in a dominantly inherited ectodermal malformation. Biochem. J. 159, 149–157. Tenenhouse, H. S., Gold, R. J., and Kachra, Z. (1974). Biochemical marker in dominantly inherited ectodermal malformation. Nature 251, 431–432. Tkatchenko, A. V., Visconti, R. P., Shang, L., Papenbrock, T., Pruett, N. D., Ito, T., Ogawa, M., and Awgulewitsch, A. (2001). Overexpression of Hoxc13 in diVerentiating keratinocytes results in downregulation of a novel hair keratin gene cluster and alopecia. Development 128, 1547–1558. Tobiasch, E., Winter, H., and Schweizer, J. (1992). Structural features and sites of expression of a new murine 65 kD hair‐related keratin pair, associated with a special type of parakeratotic epithelial diVerentiation. DiVerentiation 50, 163–178. Tyner, A. L., Eichman, M. J., and Fuchs, E. (1985). The sequence of a type II keratin gene expressed in human skin: Conservation of structure among all intermediate filament genes. Proc. Nat. Acad. Sci. 4683–4687.

262

ROGERS ET AL.

Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G., Smith, H. O., Yandell, M., Evans, C. A., Holt, R. A., Gocayne, J. D., Amanatides, P., Ballew, R. M., Huson, D. H., Wortman, J. R., Zhang, Q., Kodira, C. D., Zheng, X. H., Chen, L., Skupski, M., Subramanian, G., Thomas, P. D., Zhang, J., Gabor Miklos, G. L., Nelson, C., Broder, S., Clark, A. G., Nadeau, J., McKusick, V. A., Zinder, N., Levine, A. J., Roberts, R. J., Simon, M., Slayman, C., Hunkapiller, M., Bolanos, R., Delcher, A., Dew, I., Fasulo, D., Flanigan, M., Florea, L., Halpern, A., Hannenhalli, S., Kravitz, S., Levy, S., Mobarry, C., Reinert, K., Remington, K., Abu‐Threideh, J., Beasley, E., Biddick, K., Bonazzi, V., Brandon, R., Cargill, M., Chandramouliswaran, I., Charlab, R., Chaturvedi, K., Deng, Z., Di, F.,V, Dunn, P., Eilbeck, K., Evangelista, C., Gabrielian, A. E., Gan, W., Ge, W., Gong, F., Gu, Z., Guan, P., Heiman, T. J., Higgins, M. E., Ji, R. R., Ke, Z., Ketchum, K. A., Lai, Z., Lei, Y., Li, Z., Li, J., Liang, Y., Lin, X., Lu, F., Merkulov, G. V., Milshina, N., Moore, H. M., Naik, A. K., Narayan, V. A., Neelam, B., Nusskern, D., Rusch, D. B., Salzberg, S., Shao, W., Shue, B., Sun, J., Wang, Z., Wang, A., Wang, X., Wang, J., Wei, M., Wides, R., Xiao, C., Yan, C., Yao, A., Ye, J., Zhan, M., Zhang, W., Zhang, H., Zhao, Q., Zheng, L., Zhong, F., Zhong, W., Zhu, S., Zhao, S., Gilbert, D., Baumhueter, S., Spier, G., Carter, C., Cravchik, A., Woodage, T., Ali, F., An, H., Awe, A., Baldwin, D., Baden, H., Barnstead, M., Barrow, I., Beeson, K., Busam, D., Carver, A., Center, A., Cheng, M. L., Curry, L., Danaher, S., Davenport, L., Desilets, R., Dietz, S., Dodson, K., Doup, L., Ferriera, S., Garg, N., Gluecksmann, A., Hart, B., Haynes, J., Haynes, C., Heiner, C., Hladun, S., Hostin, D., Houck, J., Howland, T., Ibegwam, C., Johnson, J., Kalush, F., Kline, L., Koduru, S., Love, A., Mann, F., May, D., McCawley, S., McIntosh, T., McMullen, I., Moy, M., Moy, L., Murphy, B., Nelson, K., Pfannkoch, C., Pratts, E., Puri, V., Qureshi, H., Reardon, M., Rodriguez, R., Rogers, Y. H., Romblad, D., Ruhfel, B., Scott, R., Sitter, C., Smallwood, M., Stewart, E., Strong, R., Suh, E., Thomas, R., Tint, N. N., Tse, S., Vech, C., Wang, G., Wetter, J., Williams, S., Williams, M., Windsor, S., Winn‐Deen, E., Wolfe, K., Zaveri, J., Zaveri, K., Abril, J. F., Guigo, R., Campbell, M. J., Sjolander, K. V., Karlak, B., Kejariwal, A., Mi, H., Lazareva, B., Hatton, T., Narechania, A., Diemer, K., Muruganujan, A., Guo, N., Sato, S., Bafna, V., Istrail, S., Lippert, R., Schwartz, R., Walenz, B., Yooseph, S., Allen, D., Basu, A., Baxendale, J., Blick, L., Caminha, M., Carnes‐Stine, J., Caulk, P., Chiang, Y. H., Coyne, M., Dahlke, C., Mays, A., Dombroski, M., Donnelly, M., Ely, D., Esparham, S., Fosler, C., Gire, H., Glanowski, S., Glasser, K., Glodek, A., Gorokhov, M., Graham, K., Gropman, B., Harris, M., Heil, J., Henderson, S., Hoover, J., Jennings, D., Jordan, C., Jordan, J., Kasha, J., Kagan, L., Kraft, C., Levitsky, A., Lewis, M., Liu, X., Lopez, J., Ma, D., Majoros, W., McDaniel, J., Murphy, S., Newman, M., Nguyen, T., Nguyen, N., and Nodell, M. (2001). The sequence of the human genome. Science 291, 1304–1351. Vogeli, G., Wood, L., McNab, A., Kaytes, P., Wagner, T. E., Rea, T. J., Groppi, V., Waldon, D. J., Kawabe, T. T., and Buhl, A. E. (1991). High‐sulfur protein gene expression in a transgenic mouse. Annals of the New York Academy of Science 642, 21–30. Winter, H., Siry, P., Tobiasch, E., and Schweizer, J. (1994). Sequence and expression of murine type I hair keratins mHa2 and mHa3. Exper. Cell Res. 212, 190–200. Wilson, B. W., Edwards, K. J., Sleigh, M. J., Byrne, C. R., and Ward, K. A. (1988). Complete sequence of a type‐1 microfibrillar wool keratin gene. Gene 73, 21–31. Winter, H., Labreze, C., Chapalain, V., Surleve‐Bazeille, J., Mercier, M., Rogers, M. A., Taieb, A., and Schweizer, J. (1998). A variable monilethrix phenotype associated with a novel mutation, glu402lys, in the helix termination motif of the type II hair keratin hHb1. J. Invest. Dermatol. 111, 169–172. Winter, H., Rogers, M. A., Gebhardt, M., Wollina, U., Boxall, L., Chitayat, D., Babul‐Hirji, R., Stevens, H. P., Zlotogorski, A., and Schweizer, J. (1997a). A new mutation in the type II hair cortex keratin hHb1 involved in the inherited hair disorder monilethrix. Hum. Gen. 101, 165–169.

HUMAN KERATIN‐ASSOCIATED PROTEINS

263

Winter, H., Rogers, M. A., Langbein, L., Stevens, H. P., Leigh, I. M., Labreze, C., Roul, S., Taieb, A., Krieg, T., and Schweizer, J. (1997b). Mutations in the hair cortex keratin hHb6 cause the inherited hair disease monilethrix. Nature Gen. 16, 372–374. Wood, L., Mills, M., Hatzenbuhler, N., and Vogeli, G. (1990). Serine‐rich ultra high sulfur protein gene expression in murine hair and skin during the hair cycle. J. Biol. Chem. 265, 21375–21380. Woychik, N. A., and Hampsey, M. (2002). The RNA polymerase II machinery: Structure illuminates function. Cell 108, 453–463. Yahagi, S., Shibuya, K., Obayashi, I., Masaki, H., Kurata, Y., Kudoh, J., and Shimizu, N. (2004). Identification of two novel clusters of ultrahigh‐sulfur keratin‐associated protein genes on human chromosome 11. Biochem. Biophys. Res. Commun. 318, 655–664. Zannini, M., Avantaggiato, V., BiVali, E., Arnone, M. I., Sato, K., Pischetola, M., Taylor, B. A., Phillips, S. J., Simeone, A., and Di Lauro, R. (1997). TTF‐2, a new forkhead protein, shows a temporal expression in the developing thyroid which is consistent with a role in controlling the onset of diVerentiation. EMBO J. 16, 3185–3197. Zhumbaeva, B. D., Gening, L. V., and Gazaryan, K. G. (1992). Cloning and structural characterization of human hair sulfur‐rich keratin genes. Mol. Biol. 26, 550–555.