Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability

Article

Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability Graphical Abstract

Authors Britney Johnson, Laura A. VanBlargan, Wei Xu, ..., Daisy W. Leung, Michael S. Diamond, Gaya K. Amarasinghe

Correspondence [email protected] (M.S.D.), [email protected] (G.K.A.)

In Brief

Highlights d

A 2.55 A˚ X-ray crystal structure of cap 0 RNA-bound human IFIT1-IFIT3CTD is presented

d

Human IFIT3CTD binding to IFIT1 facilitates IFIT1 binding to cap 0 RNA

d

Human IFIT3 binding to IFIT1 stabilizes expression of IFIT1 in cells

d

Human IFIT1 inhibition of viruses lacking 20 -O methylation requires IFIT3

Johnson et al., 2018, Immunity 48, 1–13 March 20, 2018 ª 2018 Elsevier Inc. https://doi.org/10.1016/j.immuni.2018.01.014

Prior studies have suggested that human IFIT1, unlike its mouse ortholog, might not recognize viral RNA molecules lacking 20 -O methylation on their cap structures. Johnson et al. report a crystal structure between cap 0 (m7GpppN) RNA bound to human IFIT1 in complex with the C-terminal domain (CTD) of human IFIT3. The CTD of IFIT3 bound to IFIT1 and allosterically regulated the IFIT1 RNAbinding channel and promoted selective recognition of cap 0 RNA. Functional studies demonstrated that IFIT3 interaction with IFIT1 was important for stabilizing IFIT1 expression and was required for restricting infection of viruses lacking 20 -O methylation in their RNA cap structures

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Immunity

Article Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability Britney Johnson,1,11 Laura A. VanBlargan,2,11 Wei Xu,10,11 James P. White,2 Chao Shan,6 Pei-Yong Shi,6,7,8,9 Rong Zhang,2 Jagat Adhikari,3 Michael L. Gross,3 Daisy W. Leung,1 Michael S. Diamond,1,2,4,5,* and Gaya K. Amarasinghe1,4,12,* 1Department

of Pathology & Immunology, Washington University School of Medicine, St. Louis, MO 63110, USA of Medicine, Washington University School of Medicine, St. Louis, MO 63110, USA 3Department of Chemistry, Washington University, St. Louis, MO 63130, USA 4Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, MO 63110, USA 5The Andrew M. and Jane M. Bursky Center for Human Immunology and Immunotherapy Programs, Washington University School of Medicine, St. Louis, MO 63110, USA 6Department of Biochemistry & Molecular Biology, University of Texas Medical Branch, Galveston, TX 77555, USA 7Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX 77555, USA 8Institute for Translational Science, University of Texas Medical Branch, Galveston, TX 77555, USA 9Institute for Human Infections and Immunity, University of Texas Medical Branch, Galveston, TX 77555, USA 10Guangzhou Eighth People’s Hospital, Guangzhou Medical University, Guangzhou 510060, China 11These authors contributed equally 12Lead Contact *Correspondence: [email protected] (M.S.D.), [email protected] (G.K.A.) https://doi.org/10.1016/j.immuni.2018.01.014 2Department

SUMMARY

Although interferon-induced proteins with tetratricopeptide repeats (IFIT proteins) inhibit infection of many viruses by recognizing their RNA, the regulatory mechanisms involved remain unclear. Here we report a crystal structure of cap 0 (m7GpppN) RNA bound to human IFIT1 in complex with the C-terminal domain of human IFIT3. Structural, biochemical, and genetic studies suggest that IFIT3 binding to IFIT1 has dual regulatory functions: (1) extending the half-life of IFIT1 and thereby increasing its steady-state amounts in cells; and (2) allosterically regulating the IFIT1 RNA-binding channel, thereby enhancing the specificity of recognition for cap 0 but not cap 1 (m7GpppNm) or 50 -ppp RNA. Mouse Ifit3 lacks this key C-terminal domain and does not bind mouse Ifit1. The IFIT3 interaction with IFIT1 is important for restricting infection of viruses lacking 20 -O methylation in their RNA cap structures. Our experiments establish differences in the regulation of IFIT1 orthologs and define targets for modulation of human IFIT protein activity.

INTRODUCTION To restrict viral infection, host cells must recognize invasion and elicit a rapid inhibitory response. Pathogen-associated molecular patterns (PAMPs) in viruses include single-stranded and double-stranded nucleic acids that are detected by pattern recognition receptors (PRRs) such as Toll-like receptors (including TLR3, TLR7, TLR8, and TLR9), RIG-I-like receptors (including RIG-I and MDA5), and DNA sensors (including

cGAS, DAI, and IFI16) (Cai et al., 2014; Kawai and Akira, 2006; Keating et al., 2011; Leung and Amarasinghe, 2016). PRR binding of viral PAMPs triggers signaling cascades that induce the expression of immunomodulatory and antiviral genes, including type I interferons (IFNs). Type I IFNs signal in autocrine and paracrine manners to induce hundreds of IFN-stimulated genes (ISGs), including genes encoding IFN-induced proteins with tetratricopeptide repeats (IFIT proteins) (Diamond and Farzan, 2013). IFIT family members regulate immune responses and restrict viral infections through a variety of mechanisms, including the restriction of viral RNA translation (Diamond and Farzan, 2013; Zhou et al., 2013). There is substantial species variation in the IFIT locus; for example, the human IFIT locus encodes five family members (IFIT1, IFIT1B, IFIT2, IFIT3, and IFIT5), whereas the mouse locus encodes six genes (Ifit1, Ifit2, Ifit3, and several less well-characterized paralogs, Ifit1b, Ifit1c, and Ifit3b). IFIT proteins are structurally related and contain tandem copies of helix-turn-helix tetratricopeptide repeat (TPR) motifs (Abbas et al., 2017; Abbas et al., 2013). However, IFIT orthologs vary in their sequence, number, and organization of TPR motifs (Diamond and Farzan, 2013; Zhou et al., 2013) (Figures S1A and S1B). A recent study highlighted the functional differences of IFIT1 gene orthologs; human IFIT1 and mouse Ifit1 vary in their ability to inhibit viruses with distinct mRNA cap structures (Daugherty et al., 2016). Several IFIT family members recognize PAMPs on the 50 end of viral RNA (Daffis et al., 2010; Hyde and Diamond, 2015; Hyde et al., 2014; Kumar et al., 2014). Canonical eukaryotic capping of mRNA involves modification of the 50 through a series of enzymatic steps. The 50 cap structure contains an inverted N-7-methylated guanosine linked to the mRNA moiety by a triphosphate bridge (m7GpppN, cap 0 structure). In higher eukaryotes, additional methylation of mRNA occurs at the 20 -O position of the first ribose sugar (m7GpppNm, cap 1 structure) via a nuclear 20 -O methyltransferase enzyme. Because some Immunity 48, 1–13, March 20, 2018 ª 2018 Elsevier Inc. 1

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

IFIT family members (e.g., mouse Ifit1) directly recognize cap 0 RNA, host 20 -O methylation serves to distinguish self and non€st self RNA (Daffis et al., 2010; Werner et al., 2011; Zu et al., 2011). Although human IFIT1 inhibits infection of viruses by reducing cap-dependent protein translation (Habjan et al., 2013; Hyde et al., 2014; Pichlmair et al., 2011), mouse Ifit1 selectively inhibits viruses lacking 20 -O-methylation of their mRNA 50 caps (Daffis et al., 2010; Daugherty et al., 2016). IFIT1 and Ifit1 might also sense and sequester uncapped 50 -ppp viral RNA (Habjan et al., 2013; Pichlmair et al., 2011). Studies with Ifit1/ mouse fibroblasts and myeloid cells show enhanced replication of vesicular stomatitis virus (VSV) despite normal production of type I IFN and other inflammatory cytokines. In vivo, Ifit1/ mice are more vulnerable to infection with VSV, and higher virus-induced mortality has been observed (Pichlmair et al., 2011). This result has not yet been corroborated—subsequent experiments revealed no difference in mortality between Ifit1/ and wild type (WT) mice after infection with VSV (Fensterl et al., 2012) or other negative-strand RNA viruses (Pinto et al., 2015) that display 50 -ppp moieties on their genomic RNA. IFIT family members also engage in protein-protein interactions, including interactions with IFIT proteins and other host defense molecules (Habjan et al., 2013; Pichlmair et al., 2011). For example, when IFIT2 and IFIT3 interact with IFIT1, the interactions reportedly enhance its antiviral activity (Habjan et al., 2013; Pichlmair et al., 2011). Consistent with this observation, gene silencing of IFIT1, IFIT2, or IFIT3 results in increased replication of Rift valley fever virus, VSV, and influenza A virus (IAV) (Fensterl et al., 2012; Schmeisser et al., 2010), whereas ectopic expression of IFIT1, IFIT2, or IFIT3 independently has less inhibitory effect (Pichlmair et al., 2011). Although IFIT-IFIT complexes are hypothesized to be necessary for optimal antiviral effects, their regulatory mechanisms remain unclear. In vitro studies suggest that IFIT3 has antiviral and/or immunomodulatory activity. Ectopic expression of human IFIT3 in human A549 cells results in decreased VSV and encephalomyocarditis infection, and reciprocally, gene silencing results in modestly increased viral titers (Schmeisser et al., 2010). Analogous results were seen with porcine reproductive and respiratory syndrome and swine influenza viruses after ectopic expression of porcine IFIT3 (Li et al., 2015; Zhang et al., 2013). Silencing of IFIT3 in human A549 cells also results in increased dengue virus infection and is associated with greater cell death (Hsu et al., 2013). IFIT3 might also regulate innate immune responses, given that its ectopic expression enhanced IRF3-mediated gene induction (Liu et al., 2011) via an interaction with TBK1 and MAVS on mitochondria, and silencing of human IFIT3 results in diminished STAT1 phosphorylation in human astrocytoma cells (Imaizumi et al., 2016). To date, no studies have described an antiviral effect of mouse Ifit3, which is shorter than it is in other species and lacks 87 amino acids that are present at the C terminus in human IFIT3. Despite their postulated contribution to host-cell antiviral responses, the molecular basis and functional consequences of IFIT-IFIT interactions remain undetermined. Our report here of a 2.55 A˚ heterotrimeric crystal structure of 50 -cap 0 RNA-bound to human IFIT1 in complex with C-terminal residues of IFIT3 provides insight into a regulatory role for IFIT2 Immunity 48, 1–13, March 20, 2018

IFIT interactions. Our structural studies, combined with biochemical, genetic, and biophysical experiments, reveal how IFIT3 binding has dual regulatory functions for IFIT1. Binding of the C-terminal domain of IFIT3 enhanced IFIT1 protein stability and modulated the IFIT1 RNA-binding-pocket conformation, resulting in preferential recognition of cap 0 RNA. To validate the functional significance of the IFIT1-IFIT3 interaction, we have shown that the infectivity of viruses lacking 20 -O methylation of their 50 RNA caps was inhibited by IFIT1 only when IFIT3 was co-expressed. Collectively, these results define how IFIT-IFIT interactions enable selective recognition of non-self RNA to inhibit viral infections, and they explain evolutionary differences in IFIT gene structure and function across species. RESULTS Human IFIT3 Binds to Human IFIT1 Mass spectrometry has previously revealed a multimeric complex of human IFIT proteins that could regulate the cap recognition and antiviral activity of IFIT1 (Habjan et al., 2013). We performed biochemical studies to discern which IFIT proteins directly bind to IFIT1. We generated a series of constructs including IFIT2, IFIT3, and IFIT5 and evaluated binding to maltose binding protein (MBP)-tagged IFIT1 via in vitro co-precipitation assays. Only IFIT3, and not IFIT2 or IFIT5, bound strongly to MBP-IFIT1 (Figures 1A–1C and Figures S1C and S1D). Reversal of the MBP tag did not affect the IFIT3-IFIT1 interaction; MBP-IFIT3 bound to native IFIT1 (Figures 1C and 1D). Subsequently, we engineered N-terminal and C-terminal truncated versions of IFIT3, IFIT3 1-403 (IFIT3DCTD), and IFIT3 403-490 (IFIT3CTD) and tested for interaction with MBP-tagged IFIT1. Because a minimal IFIT3CTD, but not IFIT3DCTD, retained binding to IFIT1 (Figures S1E and S1F), we can conclude that the C-terminal 87 amino acids of IFIT3 are necessary and sufficient for IFIT1-IFIT3 interaction. To assess for species-specific variation in IFIT1-IFIT3 interactions, we evaluated the reciprocal binding of human (IFIT1 and IFIT3) with murine (Ifit1 and Ifit3) proteins because the corresponding human IFIT3CTD residues are absent in the murine Ifit3 ortholog (Figure S1A). In co-precipitation assays, IFIT3 failed to interact with Ifit1 (Figure S1G), and Ifit3 did not bind Ifit1 (Figure S1H) or IFIT1 (Figure S1I). However, a chimeric construct Ifit3-IFIT3CTD bound to IFIT1 (Figure S1J). These results indicate species-specific differences in IFIT-IFIT interactions; the C-terminal domain of human IFIT3 interacts with human IFIT1, whereas the mouse Ifit3 ortholog lacks the C terminus and does not bind appreciably to either IFIT1 or Ifit1. The C-terminal Domain of IFIT3 Interacts with IFIT1 Bound to RNA To define the molecular determinants of IFIT1-RNA and IFIT1IFIT3 binding, we solved an X-ray crystal structure of cap 0 RNA-bound IFIT1-IFIT3CTD complex at 2.55 A˚ resolution in the P1 space group (Figure 1 and Table 1). The overall IFIT1 structure in our complex was similar to the previously described IFIT1 and RNA-bound IFIT1 structures (PDB 4HOU and PDB 5W5H). IFIT1 is composed of 23 a helices, which form subdomain I (SDI) (a1-a6), SDII (a7-a14), pivot (a15-a16), and SDIII (a17-a23).

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Figure 1. Structure of the RNA-Bound IFIT1-IFIT3CTD Complex Co-precipitation assays between IFIT1 and (A) IFIT2, (B) IFIT5, and (C–D) IFIT3. MBP-tagged IFIT proteins were incubated with amylose resin (lane 1), and unbound MBP-tagged protein was washed (lanes 2–5). Prebound MBP-tagged IFIT (lane 6) was incubated with untagged IFIT proteins (lane 7) prior to washes (lanes 8–11) and final beads (lane 12). Bound protein was eluted with maltose-containing buffer (lane 13). Final beads and eluted samples (boxed) were assessed for binding. Corresponding molecular weights of the marker, M, are shown to the left of each Coomassie-stained SDS-PAGE. Data shown are representative of at least two independent experiments. (E) Domain organization of IFIT1 and location of TPR regions (left). Cartoon representation of the X-ray crystal structure of IFIT1 bound to 50 cap 0 RNA colored by subdomain (right). (F) The crystallographic asymmetric unit contains IFIT1 Mol A (green), IFIT1 Mol B (cyan), IFIT3CTD Mol C (magenta), IFIT3CTD Mol D (yellow), and two 50 cap 0 RNA (orange). See also Figures S1 and S2.

The subdomains arrange to form a central RNA-binding channel accommodating a single-stranded A-form RNA with ten nucleotides and a 50 cap 0 structure (Figure 1E). In the crystal structure, we also observed two heterotrimeric complexes, each consisting of cap 0 RNA-bound IFIT1-IFIT3CTD complexes (Figure 1F). IFIT3CTD residues 417–460 form three a helices and, with IFIT1, three potential interaction interfaces, which we termed interfaces 1, 2, and 3 (Figure S2). Interactions along interface 1 are predominantly hydrophobic between IFIT3CTD (Mol C) and IFIT1 Mol B helices of SDI (Figure S2A), and the interface results in a buried surface area of 290 A˚2. In contrast, interface 2 consists of three hydrogen bonds and hydrophobic interactions between IFIT3CTD and IFIT1 pivot helices (a15-a16) of molecule A and results in a buried surface area of 173 A˚2 (Figure S2B). Analysis of symmetry mates suggested an alternative interface

between IFIT3CTD (Mol C) and symmetry mate Mol B’ (Figure S2C). This symmetry-related interface 3 results in the largest buried surface area, of approximately 1,045 A˚2, and is comprised of five hydrogen bonds and numerous hydrophobic interactions between IFIT3CTD and IFIT1 helices (a20-a23) of SDIII (Figure S2C). To validate the interaction interface between IFIT1 and IFIT3, we performed hydrogen-deuterium exchange with mass spectrometry (HDX-MS). A series of samples, including IFIT1, IFIT3, and IFIT1-IFIT3, with and without cap 0 RNA, were evaluated for structural perturbations upon complex formation, as determined by differential hydrogen-deuterium exchange rates. In each experiment, we used IFIT1 or IFIT3 alone as a comparison to generate differential exchange rates upon binding. Upon IFIT3 binding, differential deuterium uptake of IFIT1 was observed with Immunity 48, 1–13, March 20, 2018 3

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Table 1. Data Collection, Structure Solution, and Refinement Statistics Data Collection Space Group Unit cell parameters

P1 a, b, c (A˚)

51.96, 80.50, 88.06

a, b, g ( )

80, 80, 90

o

Resolution range (A˚)

50.00–2.55 (2.59–2.55)

Unique reflections

45147 (1762)

Redundancy

3.4 (2.9)

Completeness (%)

90.9 (75.6)

Wilson B factor

18.2

I/Is

13.59 (3.19)

CC1/2 last shell

(0.87)

Phase Determination, Structure Solution, and Refinement Figure of merit

0.8036

Resolution range (A˚)

50.00–2.55 (2.59–2.55)

No. of reflections

45147/2330 1762/89

Completeness (%)

90.9 (75.6)

Total No. of non-hydrogen atoms

3745

Rwork/Rfree (%)

18.0/23.8

RMS deviations B-factors (A˚2)

bond lengths (A˚)

0.014

bond angles (o)

1.719

protein

39.2 (chain A)

protein

37.7 (chain B)

protein

48.9 (chain C)

protein

45.2 (chain D)

protein

62.4 (chain E)

protein

60.7 (chain F)

water

34.3

Ramachandran plot outliers (%) Average B, all atoms (A˚2)

0.00%

Molprobity Clashscore, all atoms

4.43 (99th percentile)

Molprobity Score

1.89 (90th percentile)

40.3

Values in parentheses are for the shell with the highest resolution.

protection of the SDII helices (a11–14; approximately 5%–15%) and SDIII helices (a17–23; approximately 25%–70%) (Figure 2A). The C-terminal peptides of interface 3 (residues 401–465) of IFIT1 were protected from deuterium uptake by as much as 70% (Figure 2B). In contrast, there was minimal perturbation of HDX rates for interfaces 1 and 2 (Figure S3A; peptides 48–83 and 70–96, and 302–323, respectively). Notably, IFIT3 C-terminal peptides (residues 419–458) were protected (20%–60%) from deuterium uptake when bound to IFIT1, further confirming the IFIT3CTD critical binding site. All other regions of IFIT1 and IFIT1-RNA complexes bound to IFIT3 showed no difference in hydrogen-deuterium exchange (Figure S3A). To corroborate these findings, we determined the dissociation constants for complex formation for full-length IFIT1 bound to IFIT3, IFIT3CTD, and IFIT3DCTD. Isothermal titration calorimetry defined a high-affinity interaction between IFIT1 and IFIT3 (KD = 1.5 ± 2.0 nM) and 1:1 binding stoichiometry (n = 0.93 ± 0.01) (Figure 2C). IFIT3DCTD did not bind to IFIT1, whereas 4 Immunity 48, 1–13, March 20, 2018

IFIT3CTD bound with an affinity similar to that of full-length IFIT3 (Figures 2D and 2E). We next computationally analyzed interface contributions with HyPare analysis (Figures S3B and S3C), which calculates association and disassociation rates between IFIT1 and IFIT3 on the basis of structural analysis. These results identified several amino acids (K426, E439, L445, S451, I453, and F457) with the highest likelihood of affecting IFIT3 binding to IFIT1. To test these predictions, we generated a mutant IFIT1 protein with all six residues changed; this mutant protein folded correctly, as determined by circular dichroism spectroscopy (Figure S3D), but failed to bind IFIT3, as predicted (Figure 2F). Collectively, these results suggest that IFIT3CTD interacts with IFIT1 and that interface 3 is required for this interaction. RNA Binding Induces Conformational Changes in IFIT1 We next utilized HDX-MS with IFIT1 alone or in complex with cap 0 RNA to identify regions of differential hydrogen-deuterium

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Figure 2. Biophysical Validation of the IFIT1-IFIT3 Interface with HDX-MS and ITC (A) The molecular interface between IFIT1 and IFIT3 is defined by HDX-MS. Differences in deuterium uptake induced by IFIT3 binding are displayed as a color gradient (see text insert in figure) and highlighted in the cartoon representation of IFIT1. (B) Comparison of deuterium uptake kinetic curves of IFIT1 (black) and IFIT1-IFIT3 (green) for selected peptides. Representative ITC raw data and binding isotherms of two independent experiments. (C) IFIT1 and IFIT3. Measured values are KD = 1.5 ± 2.0 nM, DH =  1.3 ± 0.02 3 104 cal/mol, DS =  2.19 cal/mol/deg, and n (no. of sites) = 0.93 ± 0.01. Representative ITC raw data and binding isotherms of four independent experiments. The values (KD, DH, and n) are the mean ± SD of the four independent experiments. (D) IFIT1 and IFIT3DCTD. KD = not determined. Representative ITC raw data and binding isotherms of four independent experiments. The values (KD, DH, and n) are the mean ± SD of the four independent experiments. (E) IFIT1 and IFIT3CTD. Measured values are KD = 1.4 ± 3 nM, DH =  1.7 ± 0.06 3 104 cal/mol, DS =  2.08 cal/mol/deg, and n (number of sites) = 0.97 ± 0.03. Representative ITC raw data and binding isotherms of four independent experiments. The values (KD, DH, and n) are the mean ± SD of the four independent experiments. (F) IFIT1 and IFIT3CTD mut (IFIT3 CTD K426A-E439A-L445A-S451A-I453A-F457A). KD = not determined. Representative ITC raw data and binding isotherms of four independent experiments. The values (KD, DH, and n) are the mean ± SD of the four independent experiments. See also Figure S3.

exchange and define the RNA binding channel on IFIT1 in solution (Figure 1E). SDII, pivot, and SDIII helices form a positively charged, RNA-binding channel in IFIT1 and were protected (> 30%) from deuterium uptake in solution (Figure 3A and Figure S4A); these regions interact with the triphosphate bridge and RNA strand via electrostatic interactions. This channel is occupied by cap 0 single-stranded RNA; a total of ten nucleotides span the groove and the extended C-terminal region of SDIII. In contrast, the N-7 methyl guanosine binding

pocket was comprised of mostly hydrophobic interactions (Figure S4B). Comparison of our IFIT1-IFIT3-cap 0 RNA structure to a crystal structure of the N-terminal residues (8–277) of IFIT1 (Abbas et al., 2013) revealed an overall similar structure (root-meansquare deviation [RMSD = 0.8 A˚]). However, a number of conformational changes were observed. In particular, helices in the SDII region rearranged to make direct contact with the RNA and formed a more compact structure (Figure 3B). In Immunity 48, 1–13, March 20, 2018 5

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Figure 3. Molecular Determinants of RNA Recognition by IFIT1 (A) Surface electrostatic potential representation of IFIT1 (10 kTe1 to +10 kTe1; red to blue) with cap 0 RNA (cartoon). Diameter of the IFIT1 binding channel is indicated by the white bar. (B) Structural alignment of IFIT1 (PDB: 4HOU; magenta) and cap 0 RNA bound-IFIT1 (cyan) (RMSD = 0.8 A˚). (C) SDII residues that undergo conformational change upon cap 0 RNA binding are highlighted in a box and shown in stick representation. (D) IFIT1 residues involved in direct binding to cap 0 RNA are shown in stick representation. (E–G) Filter binding assays measuring IFIT1 (black), IFIT1 R187A-Y218A (purple), IFIT1 L46A-T48A (red), IFIT1 Y157A-F191A (green), IFIT1 R38A-K151A (orange), and IFIT1 W147A (blue) binding to (E) 50 -ppp, (F) cap 0, or (G) cap 1 RNA. The results are the average of at least two independent experiments. See also Figure S4.

the IFIT1-IFIT3-cap 0 RNA complex structure, triphosphate binding residues R255, Y218, and K155 shifted more than 4 A˚ to make electrostatic interactions with RNA (Figure 3C). In addition, the SDII helices, which form the cap-binding pocket, rearranged to fit the N7-methyl guanosine cap (Figure 3C), and flexible loop residues L46 and T48 moved 6 A˚ (Figure 3C). Additional residues along the RNA-binding channel did not undergo conformation changes but nonetheless contacted the cap 0 RNA. For example, W147 makes p-p stacking interactions with the N7-methyl guanosine moiety, and residues R38, K151, and Y157 coordinate the triphosphate bridge to the ribose of the guanosine nucleoside (Figure 3D). IFIT3 Modulates RNA Binding Specificity of IFIT1 To determine the functional significance of the channel residues of IFIT1 for RNA binding, we tested structure-guided IFIT1 mutants for their ability to recognize 50 -ppp, cap 0, and cap 1 RNA in filter-binding assays (Figures 3E–3G). Initially, we determined the binding affinity of wild-type (WT) IFIT1 for differentially capped versions of 10 nucleotide single-stranded RNA. WT IFIT1 bound cap 0 RNA (KD = 175 ± 8 nM) with higher affinity than cap 1 RNA (KD = 710 ± 4.4 nM) or 50 -ppp RNA (KD = 8,500 ± 500 nM). Alanine mutations in cap-binding loop residues L46A and T48A resulted in minor changes for cap 0 and cap 1 RNA recognition (6- to 7-fold reduction, p < 0.07), whereas an alanine substitution at the m7G-binding residue W147 abrogated binding to cap 0 6 Immunity 48, 1–13, March 20, 2018

and cap 1 RNA (2,000- to 3,000-fold reduction, p < 0.05). Alanine mutations of R38, K151, and R187, which surround the triphosphate bridge, also disrupted binding (2,000- to 3,000-fold reduction, p < 0.05) of cap 0 and cap 1 RNA. In contrast, mutation of other residues (e.g., Y157 and F191) within the binding channel had minimal impact on binding. These results suggest that IFIT1 interactions with both the guanosine cap and triphosphate bridge are critical for RNA binding. To address whether IFIT1 interacts with IFIT3 in an RNA-independent manner, we tested the ability of IFIT3 to bind to an IFIT1 mutant (R38A and K151A) that is unable to bind cap 0 RNA (Figure 3F and Kumar et al., 2014). The IFIT1-RNA binding mutant (R38A and K151A) bound to IFIT3 with an affinity (KD = 2.1 ± 6 nM) similar to that of WT IFIT1 (Figure S4C). To define the regulatory role of IFIT3 in IFIT1 RNA recognition, we compared our structure to the published 50 -ppp RNA bound to IFIT5 (Abbas et al., 2013), cap 0 RNA-bound dimeric IFIT1, and cap 0 RNA-bound monomeric IFIT1 L457E and L464E (Abbas et al., 2017). Although the secondary structures of IFIT1 and IFIT5, dimeric IFIT1, and IFIT1 L457E and L464E are similar (RMSD = 1.47 A˚, 0.45 A˚, and 0.55 A˚, respectively), differences between IFIT5-50 -ppp RNA and IFIT1-IFIT3-cap 0 RNA were apparent. IFIT5 and IFIT1 SDIII helices diverge up to 22.5 A˚, and IFIT1 SDII and pivot subdomains create a more closed channel around cap 0 RNA (Figure 4A). Similarly, structural comparisons of IFIT1-IFIT3-cap 0 RNA and dimeric IFIT1-cap 0 RNA

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Figure 4. IFIT1-RNA Interaction Is Modulated by IFIT3 (A) Comparison of 50 -ppp RNA-bound IFIT5 (green) (PDB: 4HOR) and IFIT1 bound to cap 0 RNA and IFIT3CTD (cyan; current structure). (B) Structural changes, as defined by HDX-MS, to IFIT1 once it binds to IFIT3. Differences in deuterium uptake induced by IFIT3 binding to IFIT1-cap 0 RNA complex are displayed as a color gradient (see legend) and highlighted in the cartoon representation of IFIT1. Data shown are representative of two independent experiments. Multiple peptides were identified by MS/MS, and only the ten highest abundant peptides were used in the analysis. (C) Filter binding assay measuring IFIT1 (solid) and IFIT1-IFIT3CTD (dotted) binding to cap 0 RNA (black), cap1 RNA (red), and 50 -ppp RNA (blue). The results are the average of at least three independent experiments. Error bars represent standard error of the mean (SEM). See also Figure S5.

structures revealed that conformational changes of IFIT1 SDIII helices result in a more compact channel at the time of IFIT3 binding (Figure S5A). In contrast, the conformation of the IFIT1 SDIII helices appears to be farther from the channel than the conformation of the same helices in the monomeric IFIT1 L457E and L464E-cap 0 RNA structure; these conformational changes suggest that the oligomeric state of IFIT1 and IFIT3 modulates IFIT1 interaction with the RNA (Figure S5B). To gain insight into IFIT3’s role in regulating IFIT1, we performed HDX-MS analysis for IFIT1-cap 0 RNA and IFIT1-IFIT3cap 0 RNA complexes. As expected, the IFIT1 SDIII interface was protected by IFIT3 binding. The helices along the IFIT1RNA binding channel showed an increased rate of deuterium uptake (5%–30%) as a result of IFIT3 binding (Figure 4B), which suggests an additional allosteric impact of IFIT3. To define the functional role of IFIT3 in the allosteric control of IFIT1, we performed RNA-binding experiments for the IFIT1-IFIT3 complex and IFIT1 alone. These experiments demonstrated that the IFIT1-IFIT3 complex displayed a higher binding affinity for cap 0 RNA (KD = 49.1 ± 5.7 nM) than did free IFIT1 (KD = 175 ± 8.3 nM) (Figure 4C). In comparison, there was no major impact of IFIT3 binding on IFIT1-cap 1 RNA recognition: IFIT1 and IFIT1-IFIT3 bound cap 1 RNA with KD values of 710 ± 4.4 nM and 641 ± 4.9 nM, respectively. Under similar experimental conditions, IFIT1 weakly bound 50 -ppp RNA (KD = 8,500 ± 500 nM), whereas no appreciable 50 ppp RNA binding was observed after IFIT1-IFIT3 complex formation. This suggests that IFIT3 binding allosterically regulates the IFIT1 RNA-binding channel and leads to enhanced and preferential recognition of cap 0 RNA. Selective Restriction of Viruses Lacking 20 -O Methylation Requires IFIT1 and IFIT3 Co-expression We next explored the impact of IFIT3 on IFIT1 binding to cap 0 RNA upon infection of isogenic WT and mutant viruses containing or lacking 20 -O methylation of their genomic RNA. To first investigate the antiviral effects of IFIT3, we generated 293T cells lacking IFIT3 (herein called IFIT3mut/mut; Figure S6A) by CRISPR-

Cas9 gene editing and then trans-complemented them with IFIT3, IFIT3DCTD, or a control gene, firefly luciferase (fluc) (Figures S6A and S6B). Subsequently, we infected the 293T-IFIT3mut/mut + IFIT3, 293T-IFIT3mut/mut + IFIT3DCTD, and 293T-IFIT3mut/mut + fluc cells with cDNA clone-derived West Nile virus (WNV) WT (New York 1999 strain) or WNV NS5 E218A, a mutant lacking 20 -O methyltransferase activity, which produces a genomic viral RNA with a cap 0 structure (Daffis et al., 2010). After infection, we measured the percentage of WNV-infected cells at 24 hr post-infection (hpi) by flow cytometry. Notably, WNV WT infection in 293T-IFIT3mut/mut + IFIT3, 293T-IFIT3mut/mut + IFIT3DCTD, and 293T-IFIT3mut/mut + fluc cells was not significantly different (p > 0.2), whereas WNV NS5 E218A infection in 293T-IFIT3mut/mut + IFIT3 cells was less than in 293TIFIT3mut/mut + IFIT3DCTD or 293T-IFIT3mut/mut + fluc cells (p < 0.02 for both comparisons; Figure 5A and Figure S6C). Virus production in the supernatants of 293T-IFIT3mut/mut + IFIT3 and 293T-IFIT3mut/mut + fluc cells revealed a similar pattern: the growth of WNV NS5 E218A but not WNV WT was reduced in 293T-IFIT3 compared to 293T-fluc cells (Figures 5B and 5C). These data suggest that IFIT3 specifically restricts viruses lacking 20 -O methylation of their RNA caps and that the antiviral effect depends on the C-terminal tail. One limitation in interpreting these studies is that we independently observed differential expression of IFIT1 in IFIT3mut/mut cells trans-complemented with IFIT3 or luciferase after exogenous IFN-b treatment (Figure 5D). An increase in IFIT1 expression in IFIT3-expressing cells depended on the presence of the C-terminal domain of IFIT3, as IFIT3mut/mut + IFIT3DCTD cells had similar IFIT1 amounts as the fluc control, and IFIT3mut/mut cells trans-complemented with chimeric mouse IFIT3 having the human C-terminal domain appended resulted in similar IFIT1 amounts as IFIT3mut/mut + IFIT3 cells (Figure 5D). Thus, the antiviral effect of IFIT3 on WNV NS5 E218A could be multifactorial; IFIT3 modulates the cap recognition specificity of IFIT1 and independently affects IFIT1 mRNA induction or protein stability and overall expression. To address whether the effect of IFIT3 on IFIT1 was due to transcriptional Immunity 48, 1–13, March 20, 2018 7

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Figure 5. Effect of IFIT3 Expression on Infection of WNV WT and WNV NS5-E218A IFIT3 gene edited (IFIT3mut/mut) 293T cells were trans-complemented with IFIT3 (IFIT3mut/mut + IFIT3), IFIT3 lacking the C-terminal tail (IFIT3mut/mut + IFIT3DCTD), or firefly luciferase (IFIT3mut/mut + fluc). (A) 293T-IFIT3mut/mut + IFIT3 and 293T-IFIT3mut/mut + fluc cells were infected at an MOI of 5 with WNV WT or isogenic WNV NS5-E218A lacking 20 -O methylation of the cap structure of genomic RNA. Flow cytometry and staining for intracellular WNV E protein were used for measuring infection 24 hpi. The fraction of infected 293T-IFIT3mut/mut + IFIT3 cells relative to infected 293T-IFIT3mut/mut + fluc are shown for both viruses. Data are the mean of three independent experiments, and error bars represent SEM. (legend continued on next page)

8 Immunity 48, 1–13, March 20, 2018

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

activation, we transduced IFIT3 or fluc into 293T cells expressing a flag-tagged version of IFIT1 under a heterologous doxycyclineinducible promoter (293T-IFIT1-doxy cells). At baseline (0 ng/mL of doxycycline), low but equivalent amounts of IFIT1 were detected in IFIT3- and fluc-expressing cells (Figures 5E and 5F). Following doxycycline treatment, IFIT1 amounts were higher in IFIT3-expressing cells than in fluc cells, indicating that the IFIT3-mediated increase of IFIT1 expression was independent of endogenous IFIT1 gene transcription. To test whether IFIT1 protein stability was enhanced by IFIT3, we performed pulsechase studies in 293T-IFIT1-doxy cells + IFIT3 or + fluc with doxycycline followed by puromycin treatment to halt new translation. In the absence of IFIT3, IFIT1 degraded rapidly (t1/2 of 1.9 hr) (Figures 5G and 5H). However, in the presence of IFIT3 expression, the half-life of IFIT1 was prolonged substantially (t1/2 of 25.9 h; for IFIT3 + 100 ng/mL doxy versus fluc + 100 ng/mL, p = 0.002 at 2 hr, p < 0.0001 at 4 and 8 hr; additionally, all IFIT3 versus fluc comparisons for all doses were significantly different at 2, 4, and 8 hr, p < 0.05). Thus, IFIT3 binding stabilizes IFIT1, which correlates with the greater steady-state amounts of IFIT1 observed. To determine whether the antiviral effect of IFIT3 required IFIT1 expression, we abrogated IFIT1 expression completely in 293TIFIT3mut/mut + IFIT3 and 293T-IFIT3mut/mut + fluc cells by using CRISPR-Cas9 gene editing and two IFIT1-specific single-guide RNAs (sgRNAs) or scrambled sgRNAs as controls (Figure 5I, IFIT1 and control lanes). We infected these cells with WNV WT or WNV NS5 E218A and measured the percentage of WNV-infected cells at 24 hpi by flow cytometry. Notably, WNV WT infected 293T-IFIT3mut/mut + IFIT3 and 293T-IFIT3mut/mut + fluc similarly, regardless of whether IFIT1 was expressed (Figure 5J, left panel). WNV NS5 E218A showed reduced infectivity of 293TIFIT3mut/mut + IFIT3 cells compared to 293T-IFIT3mut/mut + fluc cells when scrambled sgRNAs were used. However, infection of WNV NS5 E218A was similar in 293T-IFIT3mut/mut + IFIT3 cells and 293T-IFIT3mut/mut + fluc cells when IFIT1 was geneedited and not expressed (Figure 5J [right panel] and Figure S6D). Similar results were observed after infection of 293T-IFIT3mut/mut + IFIT3 and 293T-IFIT3mut/mut + fluc cells with ZIKV NS5 E218A (Figure 5K). These data suggest that IFIT3-de-

pendent restriction of viruses lacking 20 -O methylation of their 50 RNA caps requires expression of IFIT1. IFIT1 Inhibition of Viruses Lacking 20 -O Methylation Is Augmented by IFIT3 To further assess whether IFIT1-mediated restriction of viruses lacking 20 -O methylation is enhanced by co-expression of IFIT3, we introduced IFIT3- or fluc-expression plasmids into 293T-IFIT1-doxy cells (see Figure 5E). One day after transfection, we treated cells with doxycycline to induce IFIT1 expression, and 16 hr later we infected them with WNV WT or WNV NS5 E218A. Doxycycline-induced expression of IFIT1 failed to restrict infectivity of WNV WT, and ectopic expression of IFIT3 did not modulate this (Figure 6A). Thus, increases in IFIT1 expression mediated by IFIT3 (see Figures 5E–5H) were insufficient to inhibit infection of WNV displaying cap 1 (20 -O methylated) mRNA structures. In contrast, IFIT1 restricted WNV NS5 E218A infection in a doxycycline-dose-dependent manner (Figure 6B). Moreover, compared to fluc-transfected cells, IFIT3-expressing cells required less doxycycline and IFIT1 induction (Figure 5E) to restrict infection of WNV NS5-E218A (Figure 6B and Figure S6E). Thus, IFIT1 restriction of WNV NS5E218A is enhanced by the expression of IFIT3. To corroborate and extend these findings, we assessed the effect of IFIT1 and IFIT3 co-expression on Venezuelan equine encephalitis virus (VEEV) strain TC83, a positive-stranded RNA alphavirus that naturally has a cap 0 RNA but whose 50 untranslated region lacks a secondary structure element that antagonizes Ifit1 restriction (Hyde et al., 2014). Doxycycline-induced expression of IFIT1 failed to restrict infectivity of VEEV-TC83 in cells trans-complemented with fluc (Figure 6C). Analogously, IFIT3 expression in the absence of IFIT1 induction had little effect on VEEV-TC83 infection (Figure 6C) (0 ng/mL doxycycline treatment). However, co-expression of IFIT3 with doxycyclineinduced IFIT1 resulted in markedly reduced VEEV-TC83 infection (Figure 6C and Figure S6F). In comparison, VSV, a negative-sense RNA virus with a 50 -ppp genomic RNA and a cap 1 mRNA (Rhodes and Banerjee, 1975), was also restricted by IFIT1 in an IFIT3-dependent manner (Figure 6D), although this inhibition was less (50% reduction) than that in VEEV-TC83

(B–C) 293T-IFIT3mut/mut + IFIT3 and 293T-IFIT3mut/mut + fluc cells were infected with WNV WT or WNV NS5-E218A at an MOI of 0.001. Supernatant was collected at the indicated times after infection and analyzed by focus-forming assay. Data are the mean titers from six independent experiments, and errors bars represent SEM. (D) IFIT3mut/mut + IFIT3, IFIT3mut/mut + hIFIT3DCTD, IFIT3mut/mut + mIfit3CTD, and IFIT3mut/mut + fluc cells were stimulated with IFN-b and assessed for IFIT1 expression via immunoblotting. One representative experiment of three is shown. (E and F) 293T cells expressing human IFIT1-flag under an inducible promoter (293T-IFIT1-doxy) were trans-complemented with IFIT3 or fluc and analyzed for IFIT1 expression (anti-flag tag) via immunoblotting. (E) One of two representative immunoblots is shown. (F) IFIT1 protein amounts were normalized to GAPDH in IFIT3- or fluc-transduced cells treated with doxycycline. Error bars represent SEM from two independent experiments. (G and H) 293T-IFIT1-doxy cells transfected with IFIT3 or fluc were stimulated with doxycycline for 16 hr at indicated concentrations, subsequently treated with 50 mM puromycin so that translation would be arrested, and analyzed for IFIT1 (anti-flag tag) at the indicated time after puromycin treatment. (G) One of three representative immunoblots is shown. (H) Amounts of IFIT1 were quantified and normalized to the 0 hr post-puromycin treatment. Error bars represent SEM from three independent experiments. The statistical significance shown is for the comparison of IFIT3 + 100 ng/mL doxy versus fluc + 100 ng/mL doxy; comparisons between other doses yielded similar results. (I–K) CRISPR-Cas9 gene editing was used for abolishing IFIT1 expression from 293T-IFIT3mut/mut + IFIT3 and 293T-IFIT3mut/mut + fluc cells with two different IFIT1targeting sgRNAs or as a control, scrambled sgRNAs. (I) IFIT1 expression following IFN-b stimulation was determined by immunoblot. (J–K) 293T-IFIT3mut/mut + IFIT3 and 293T-IFIT3mut/mut + fluc cells that received IFIT1 or scrambled sgRNAs were infected with WNV WT or WNV NS5-E218A at an MOI of 5 (J) or WT or NS5E218A ZIKV (Cambodia, 2010; strain FSS13025) at an MOI or 1 (K) and scored for infectivity at 24 (J) or 30 (K) hpi by flow cytometry. Infectivity was normalized to the fraction of infected 293T-IFIT3mut/mut + fluc cells that received scrambled sgRNAs. The mean relative infectivity from three (K) and five (J) independent experiments is shown, and error bars represent the SEM. In this figure, statistical significance was determined with the use of an ANOVA test followed by Tukey’s (A, B, and C) or Sidak’s (H, J, and K) multiple comparisons tests. ns, not significant; *p > 0.05; ***p < 0.001; ****p < 0.0001). See also Figure S6.

Immunity 48, 1–13, March 20, 2018 9

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Figure 6. Effect of IFIT3 on IFIT1-Mediated Restriction of Viruses with Cap 0 and Cap 1 RNA (A, B, and E) 293T-IFIT1-doxy cells were transfected with plasmids encoding fluc, IFIT3, or the indicated IFIT3 mutants and treated with doxycycline prior to infection with (A) WNV WT or (B and E) WNV NS5 E218A. Infection and transfection data were analyzed by flow cytometry 24 hpi (A and B, left; also see Figure S6E) to determine the percentage of transfected cells that were positive for intracellular WNV E protein. Data are representative of three independent experiments, and error bars represent SEM (A and B, right; and E). Data are normalized to infectivity of doxycycline-untreated cells for each independent transfection (IFIT3, IFIT3 mutants, or fluc) experiment. Error bars represent the SEM, and data was pooled from three to six independent experiments for statistical analysis (below). (C and D) 293T-IFIT1-doxy cells were trans-complemented with IFIT3 or fluc and infected with (C) VEEV-TC83 (MOI of 1, 16 h) or (D) VSV (MOI of 1, 6 h). Left panels show the mean percentage of infected cells from one representative experiment of three, and error bars indicate the SEM from triplicate replicates. Right panels show data normalized to infectivity of doxycycline-untreated cells. Error bars represent the SEM, and data was pooled from three independent experiments. In this figure, statistical significance was determined with a t test (A) or an ANOVA followed by Sidak’s (B, C, and D) or Dunnett’s (E) multiple comparisons tests (ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). See also Figure S6.

or WNV E218A (90%–98% reduction) (Figures 6B and 6C). These data confirm a role for IFIT3 in enhancing IFIT1-mediated restriction of viruses lacking 20 -O methylation and establish a partial effect on a negative strand RNA virus. This latter effect might reflect the enhanced expression of IFIT1 in IFIT3-expressing cells. Our structural data suggested that the C-terminal tail of IFIT3 (residues 403–490) is required for IFIT1-IFIT3 binding and that IFIT3 residues K426, E439, L445, S451, I453, and F457 mediate part of the physical interaction. Accordingly, we tested the 10 Immunity 48, 1–13, March 20, 2018

functional effect of C-terminal tail mutations on IFIT3-dependent enhancement of IFIT1 restriction of WNV NS5 E218A. When the C-terminal tail of IFIT3 was deleted (IFIT3DCTD), IFIT3 no longer enhanced IFIT1 restriction of WNV NS5 E218A (Figure 6E). When alanine mutations were introduced at residues K426, E439, L445, S451, I453, and F457 of IFIT3, expression was maintained but modulation of IFIT1-mediated viral restriction was lost (Figure 6E and Figure S6G). However, when mutations at K426 and E439 alone were introduced, IFIT1-mediated viral restriction was retained (Figure 6E). Remarkably, transfection of the IFIT3

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

tail alone (IFIT3CTD) enhanced IFIT1 function equally as well as full-length IFIT3 did (Figure 6E). These data confirm a functional role for residues in the C-terminal tail of IFIT3 in regulating IFIT1mediated restriction of WNV E218A, a virus lacking 20 -O methylation on its genomic RNA. DISCUSSION In the present study, we evaluated the molecular mechanisms and the corresponding functional impact of the interaction between IFIT1 and IFIT3. We report an X-ray crystal structure of cap 0 RNA-bound IFIT1 in complex with IFIT3CTD. The IFIT3CTD observed in this structure is a region of the protein that is absent in the murine ortholog, Ifit3. The high-affinity interaction of the C-terminal domain of IFIT3 with IFIT1 enhances IFIT1 protein stability in cells and allosterically modulates the IFIT1 RNA-binding channel and SDIII, resulting in preferential recognition of cap 0 RNA. We determined the functional importance of an IFIT1IFIT3 interaction in the context of restriction of several RNA viruses lacking 20 -O methylation of the cap structures on their genomic RNA. Our results also reveal key differences between human and mouse IFIT1 and IFIT3 orthologs, and these differences impact the proteins’ ability to preferentially recognize RNA moieties and inhibit viruses lacking 20 -O methyltransferase activity. These findings have implications for how differences in IFIT protein family members across species restrict viral infections. The IFIT family of proteins functions as antiviral molecules by virtue of their recognition of non-self RNA (50 -ppp and cap 0 RNA), inhibition of cap-dependent and cap-independent translation, and modulation of immune responses (Diamond and Farzan, 2013). Although the IFIT protein family shares conserved features throughout mammalian phylogeny, gene duplication and sequence variation occur within individual mammalian species, perhaps as a result of evolutionary pressures by viral pathogens (Daugherty et al., 2016). Indeed, recent studies of mammalian IFIT1 and IFIT3 proteins have suggested functional differences among orthologs and paralogs with regard to their RNA-binding specificity and antiviral restriction. Differences in the specificity of IFIT1 and Ifit1 for specific RNA moieties might be due to their descent from distinct paralogs (Daugherty et al., 2016). Mouse Ifit1 discriminates between cap 0 and cap 1 mRNA and specifically inhibits viral mutants lacking 20 -O methylation of their mRNAs. Although human IFIT1B is a nonfunctional allele, it is more closely related to primate and rabbit IFIT1B orthologs that have RNA binding specificity similar to that of mouse Ifit1 (Daugherty et al., 2016). In comparison, human IFIT1 in isolation appears to lack discrimination between cap 0 and cap 1 RNA. Our data provide an explanation for this apparent paradox of why human IFIT1 alleles (IFIT1 and IFIT1B) lack the ability to recognize and inhibit viruses with cap 0 RNA structures (Daugherty et al., 2016): human IFIT1 requires interaction with the C-terminal domain of IFIT3 to alter its RNA ligand specificity and bind viral RNA lacking 20 -O methylation. We are planning future studies to assess whether the C-terminal domain of IFIT3 analogously binds IFIT1B and alters its RNA binding properties and stability. Although structural studies have been performed with individual IFIT proteins and RNA, these experiments did not evaluate

the effect of IFIT-IFIT and IFIT-heterologous protein interactions, which have been described biochemically (Habjan et al., 2013; Pichlmair et al., 2011). We found that the C-terminal region of IFIT3 binds IFIT1 and allosterically modulates the structure of the IFIT1 RNA-binding channel. In the structure, we observed conformational changes within the RNA binding pocket that were supported by our HDX-MS data. In addition to changes in the specific side chains in the RNA binding channel, we noted several structural shifts when comparing our IFIT1-IFIT3-RNA complex to a published IFIT1-RNA complex (Abbas et al., 2017). Collectively, these data support a model where interaction between IFIT1 and IFIT3 results in a greater affinity of IFIT1 binding to cap 0 but not cap 1 or 50 -ppp RNA than occurs with IFIT1 alone, supporting a role for enhanced specificity. The binding of the C-terminal region of IFIT3 enhanced the selective restriction by human IFIT1 of cap 0-expressing WNV NS5 E218A but not cap 1-expressing WNV WT. Although our biochemical and functional data establish a role for IFIT3-mediated regulation of IFIT1 binding of cap 0 RNA with antiviral consequences, IFIT3-dependent effects on IFIT1 expression also most likely contribute to the IFIT1-dependent antiviral phenotype. Experiments with non-native doxycycline-inducible promoter suggest that IFIT3dependent regulation of IFIT1 did not occur transcriptionally. Rather, pulse-chase studies indicate that binding of the C-terminal region of IFIT3 prolonged the half-life of IFIT1, and this prolonged half-life resulted in increased steady-state amounts of protein. Additional studies are needed if we are to determine precisely how IFIT3 binding modulates IFIT1 stability; for example, whether IFIT3 prevents ubiquitination and proteasomal degradation of IFIT1. Previous studies have shown that ectopic expression of IFIT3 can restrict infection of multiple viruses, including porcine reproductive and respiratory syndrome virus (PRRSV) and IAV (Li et al., 2015; Schmeisser et al., 2010; Zhang et al., 2013). Given that direct binding of IFIT3 to RNA has not been described, IFIT3 was believed to exert its antiviral effect indirectly through interactions with other IFIT proteins or host defense molecules (Habjan et al., 2013; Kumar et al., 2014; Pichlmair et al., 2011). For example, IFIT3 reportedly enhances IFN-b promoter activity (Li et al., 2015; Zhang et al., 2013) and promotes cell survival after infection (Hsu et al., 2013). IFIT3 can bind to MAVS and TBK-1, resulting in the induction of IRF3- and NF-kB-responsive genes (Li et al., 2015; Liu et al., 2011). We also observed an antiviral effect of IFIT3 on ectopic expression, but this occurred only for flavivirus mutants lacking 20 -O methylation of their 50 caps. The antiviral effect of IFIT3 in this context was mediated via IFIT1 as demonstrated by the fact that gene editing of IFIT1 abolished the inhibitory activity of ectopically expressed IFIT3. These data support a model in which IFIT3 can play an indirect antiviral role by forming a complex and enhancing the ability of IFIT1 to bind and sequester cap 0 RNA to restrict virus replication. IFIT3IFIT1 interactions mediated a partial antiviral effect on VSV, which has both cap 1 mRNA and genomic negative-sense 50 -ppp RNA; these results are consistent with prior studies (Daugherty et al., 2016; Pichlmair et al., 2011). Although further studies are needed to determine whether VSV infection is inhibited by IFIT1-IFIT3 by virtue of IFIT1 recognition of VSV mRNA or genomic RNA, WNV-WT, which has a cap 1 mRNA, was not inhibited under the same conditions. However, when Immunity 48, 1–13, March 20, 2018 11

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

cellular IFIT1 expression was increased substantially through transfection of an expression IFIT1 plasmid under the control of an EF1a promoter, infection of WNV WT was inhibited, and this effect did not require IFIT3 co-expression (data not shown). These results are consistent with earlier in vitro studies suggesting that IFIT1 can globally inhibit cap-dependent translation (Hui et al., 2003). Beyond this, it remains to be determined whether IFIT3’s other antiviral functions, which are mediated through MAVS and TBK-1, also require interactions with other IFIT proteins. The C-terminal tail of IFIT3 (residues 403–490) was necessary and sufficient to mediate the IFIT1-IFIT3 interaction and enhance IFIT1-mediated virus restriction. This observation has implications for the functional variability of IFIT orthologs, such as murine Ifit3, which lacks the C-terminal tail. It is consistent with our observation that Ifit3 did not bind to murine Ifit1 or human IFIT1, although appending residues 403–490 of human IFIT3 to the end of murine Ifit3 resulted in efficient binding of murine Ifit3 to human IFIT1. These data help to explain the speciesspecificity of IFIT1-IFIT2-IFIT3 complex formation, which was not observed for mouse Ifit1-Ifit3 (Habjan et al., 2013). Moreover, this observation is consistent with a porcine IFIT3 study that showed that the C-terminal tail was required for its antiviral effects against PRRSV (Li et al., 2015). However, that study did not explore the IFIT1 dependence of this phenotype. The lack of murine Ifit1-Ifit3 interaction raises questions as to how murine Ifit1 mediates specificity of RNA cap binding and the function of Ifit3. If murine Ifit3 does not participate in IFITIFIT protein interactions, what is the role of Ifit3 and its nearly identical paralog, Ifit3b, in host defense? Although the N-terminal region of human IFIT3 reportedly interacts with TBK1 and MAVS to regulate IRF3 activation (Liu et al., 2011) and is conserved among gene orthologs, a corresponding function of murine Ifit3 has yet to be ascribed. These questions, coupled with our results, suggest that IFIT proteins could have multiple aspects of control and that some of the regulation might be dependent on IFIT-IFIT interactions for preferential recognition of non-self RNA. Future studies that assess IFIT-IFIT and IFITprotein interactions could define additional regulatory mechanisms for control of host-defense pathways and virus infections.

B

Co-immunoprecipitation assays Pulse-chase studies B Immunoblotting EXPERIMENTAL MODEL AND SUBJECT DETAILS B Cells B Virus production and infection QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND SOFTWARE AVAILABILITY B

d

d d

SUPPLEMENTAL INFORMATION Supplemental Information includes six figures and can be found with this article online at https://doi.org/10.1016/j.immuni.2018.01.014. ACKNOWLEDGMENTS This work was supported by the following grants from the NIH: R01 AI10497 and U19 AI109680 (to M.S.D.), U19 AI083019 (to M.S.D. and G.K.A.), GM103422 (to M.L.G), AI107056 (to D.W.L), AI120943 (to G.K.A., D.W.L, and M.L.G,), and AI109945 (to G.K.A). AUTHOR CONTRIBUTIONS B.J., L.A.V., W.X., J.A., M.L.G., D.W.L., M.S.D., and G.K.A. designed the experiments. B.J., L.A.V., W.X., and J.A. performed the experiments. C.S., P.Y.S., R.Z., and J.P.W. contributed key reagents. B.J., L.A.V., W.X., D.W.L, M.S.D., and G.K.A. analyzed the data. B.J. and L.A.V. wrote the first draft of the paper with M.S.D., and G.K.A providing major editorial comments. All authors participated in editing the final version of the manuscript. Received: August 28, 2017 Revised: December 4, 2017 Accepted: January 30, 2018 Published: March 6, 2018 REFERENCES Abbas, Y.M., Pichlmair, A., Go´rna, M.W., Superti-Furga, G., and Nagar, B. (2013). Structural basis for viral 50 -PPP-RNA recognition by human IFIT proteins. Nature 494, 60–64. Abbas, Y.M., Laudenbach, B.T., Martı´nez-Montero, S., Cencic, R., Habjan, M., Pichlmair, A., Damha, M.J., Pelletier, J., and Nagar, B. (2017). Structure of human IFIT1 with capped RNA reveals adaptable mRNA binding and mechanisms for sensing N1 and N2 ribose 20 -O methylations. Proc. Natl. Acad. Sci. USA 114, E2106–E2115.

STAR+METHODS

Brien, J.D., Lazear, H.M., and Diamond, M.S. (2013). Propagation, quantification, detection, and storage of West Nile virus. Curr Protoc Microbiol 31, 15D.3.1–15D.3.18 1–15D.

Detailed methods are provided in the online version of this paper and include the following:

Cai, X., Chiu, Y.H., and Chen, Z.J. (2014). The cGAS-cGAMP-STING pathway of cytosolic DNA sensing and signaling. Mol. Cell 54, 289–296.

d d d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING METHODS DETAILS B IFIT protein expression constructs B Protein Expression and Purification B RNA for structural studies B IFIT1-IFIT3-cap 0 RNA complex formation B Data Collection and Structure Determination B Isothermal titration calorimetry B Hydrogen deuterium exchange mass spectrometry (HDX-MS) B Filter binding assays B Circular dichroism studies

12 Immunity 48, 1–13, March 20, 2018

Cowtan, K. (2006). The Buccaneer software for automated model building. 1. Tracing protein chains. Acta Crystallogr D Biol Crystallogr. 62, 1002–1011. Daffis, S., Szretter, K.J., Schriewer, J., Li, J., Youn, S., Errett, J., Lin, T.-Y., Schneller, S., Zust, R., Dong, H., et al. (2010). 20 -O methylation of the viral mRNA cap evades host restriction by IFIT family members. Nature 468, 452–456. Daugherty, M.D., Schaller, A.M., Geballe, A.P., and Malik, H.S. (2016). Evolution-guided functional analyses reveal diverse antiviral specificities encoded by IFIT1 genes in mammals. eLife 5, 5. Davis, I.W., Leaver-Fay, A., Chen, V.B., Block, J.N., Kapral, G.J., Wang, X., Murray, L.W., Arendall, W.B., 3rd, Snoeyink, J., Richardson, J.S., and Richardson, D.C. (2007). MolProbity: all-atom contacts and structure validation for proteins and nucleic acids. Nucleic Acids Res. 35, W375–W383. Diamond, M.S., and Farzan, M. (2013). The broad-spectrum antiviral functions of IFIT and IFITM proteins. Nat. Rev. Immunol. 13, 46–57.

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Emsley, P., and Cowtan, K. (2004). Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126–2132.

of a humanized monoclonal antibody with therapeutic potential against West Nile virus. Nat. Med. 11, 522–530.

Fensterl, V., White, C.L., Yamashita, M., and Sen, G.C. (2008). Novel characteristics of the function and induction of murine p56 family proteins. J. Virol. 82, 11045–11053.

Oliphant, T., Nybakken, G.E., Engle, M., Xu, Q., Nelson, C.A., Sukupolvi-Petty, S., Marri, A., Lachmi, B.E., Olshevsky, U., Fremont, D.H., et al. (2006). Antibody recognition and neutralization determinants on domains I and II of West Nile Virus envelope protein. J. Virol. 80, 12149–12159.

Fensterl, V., Wetzel, J.L., Ramachandran, S., Ogino, T., Stohlman, S.A., Bergmann, C.C., Diamond, M.S., Virgin, H.W., and Sen, G.C. (2012). Interferon-induced Ifit2/ISG54 protects mice from lethal VSV neuropathogenesis. PLoS Pathog. 8, e1002712. Habjan, M., Hubel, P., Lacerda, L., Benda, C., Holze, C., Eberl, C.H., Mann, A., Kindler, E., Gil-Cruz, C., Ziebuhr, J., et al. (2013). Sequestration by IFIT1 impairs translation of 2’O-unmethylated capped RNA. PLoS Pathog. 9, e1003663. Hsu, Y.L., Shi, S.F., Wu, W.L., Ho, L.J., and Lai, J.H. (2013). Protective roles of interferon-induced protein with tetratricopeptide repeats 3 (IFIT3) in dengue virus infection of human lung epithelial cells. PLoS ONE 8, e79518. Hui, D.J., Bhasker, C.R., Merrick, W.C., and Sen, G.C. (2003). Viral stressinducible protein p56 inhibits translation by blocking the interaction of eIF3 with the ternary complex eIF2.GTP.Met-tRNAi. J. Biol. Chem. 278, 39477–39482. Hyde, J.L., and Diamond, M.S. (2015). Innate immune restriction and antagonism of viral RNA lacking 2‫׳‬-O methylation. Virology 479-480, 66–74. Hyde, J.L., Gardner, C.L., Kimura, T., White, J.P., Liu, G., Trobaugh, D.W., Huang, C., Tonelli, M., Paessler, S., Takeda, K., et al. (2014). A viral RNA structural element alters host recognition of nonself RNA. Science 343, 783–787. Imaizumi, T., Yoshida, H., Hayakari, R., Xing, F., Wang, L., Matsumiya, T., Tanji, K., Kawaguchi, S., Murakami, M., and Tanaka, H. (2016). Interferon-stimulated gene (ISG) 60, as well as ISG56 and ISG54, positively regulates TLR3/ IFN-b/STAT1 axis in U373MG human astrocytoma cells. Neurosci. Res. 105, 35–41. Kawai, T., and Akira, S. (2006). Innate immune recognition of viral infection. Nat. Immunol. 7, 131–137. Keating, S.E., Baran, M., and Bowie, A.G. (2011). Cytosolic DNA sensors regulating type I interferon induction. Trends Immunol. 32, 574–581. Kumar, P., Sweeney, T.R., Skabkin, M.A., Skabkina, O.V., Hellen, C.U., and Pestova, T.V. (2014). Inhibition of translation by IFIT family members is determined by their ability to interact selectively with the 50 -terminal regions of cap0-, cap1- and 5’ppp- mRNAs. Nucleic Acids Res. 42, 3228–3245. Laskowski, R.A., and Swindells, M.B. (2011). LigPlot+: multiple ligand-protein interaction diagrams for drug discovery. J. Chem. Inf. Model. 51, 2778–2786. Leung, D.W., and Amarasinghe, G.K. (2016). When your cap matters: structural insights into self vs non-self recognition of 50 RNA by immunomodulatory host proteins. Curr. Opin. Struct. Biol. 36, 133–141. Li, Y., Wen, Z., Zhou, H., Wu, S., Jia, G., Qian, W., and Jin, M. (2015). Porcine interferon-induced protein with tetratricopeptide repeats 3, poIFIT3, inhibits swine influenza virus replication and potentiates IFN-b production. Dev. Comp. Immunol. 50, 49–57. Liu, X.Y., Chen, W., Wei, B., Shan, Y.F., and Wang, C. (2011). IFN-induced TPR protein IFIT3 potentiates antiviral signaling by bridging MAVS and TBK1. J. Immunol. 187, 2559–2568. Oliphant, T., Engle, M., Nybakken, G.E., Doane, C., Johnson, S., Huang, L., Gorlatov, S., Mehlhop, E., Marri, A., Chung, K.M., et al. (2005). Development

Otwinowski, Z., and Minor, W. (1997). Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307–326. Pascal, B.D., Willis, S., Lauer, J.L., Landgraf, R.R., West, G.M., Marciano, D., Novick, S., Goswami, D., Chalmers, M.J., and Griffin, P.R. (2012). HDX workbench: software for the analysis of H/D exchange MS data. J. Am. Soc. Mass Spectrom. 23, 1512–1521. Pichlmair, A., Lassnig, C., Eberle, C.A., Go´rna, M.W., Baumann, C.L., Burkard, €rckstu €mmer, T., Stefanovic, A., Krieger, S., Bennett, K.L., et al. (2011). T.R., Bu IFIT1 is an antiviral protein that recognizes 50 -triphosphate RNA. Nat. Immunol. 12, 624–630. Pinto, A.K., Williams, G.D., Szretter, K.J., White, J.P., Proenc¸a-Mo´dena, J.L., €hlberger, E., et al. (2015). Liu, G., Olejnik, J., Brien, J.D., Ebihara, H., Mu Human and Murine IFIT1 Proteins Do Not Restrict Infection of NegativeSense RNA Viruses of the Orthomyxoviridae, Bunyaviridae, and Filoviridae Families. J. Virol. 89, 9465–9476. Rhodes, D.P., and Banerjee, A.K. (1975). 50 -terminal sequence of vesicular stomatitis virus mRNA’s synthesized in vitro. J. Virol. 17, 33–42. Schmeisser, H., Mejido, J., Balinsky, C.A., Morrow, A.N., Clark, C.R., Zhao, T., and Zoon, K.C. (2010). Identification of alpha interferon-induced genes associated with antiviral activity in Daudi cells and characterization of IFIT3 as a novel antiviral gene. J. Virol. 84, 10671–10680. Shan, C., Xie, X., Muruato, A.E., Rossi, S.L., Roundy, C.M., Azar, S.R., Yang, Y., Tesh, R.B., Bourne, N., Barrett, A.D., et al. (2016). An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe 19, 891–900. Werner, M., Purta, E., Kaminska, K.H., Cymerman, I.A., Campbell, D.A., Mittra, B., Zamudio, J.R., Sturm, N.R., Jaworski, J., and Bujnicki, J.M. (2011). 20 -Oribose methylation of cap2 in human: function and evolution in a horizontally mobile family. Nucleic Acids Res. 39, 4756–4768. Zhang, L., Liu, J., Bai, J., Du, Y., Wang, X., Liu, X., and Jiang, P. (2013). Poly(I:C) inhibits porcine reproductive and respiratory syndrome virus replication in MARC-145 cells via activation of IFIT3. Antiviral Res. 99, 197–206. Zhao, H., Fernandez, E., Dowd, K.A., Speer, S.D., Platt, D.J., Gorman, M.J., Govero, J., Nelson, C.A., Pierson, T.C., Diamond, M.S., and Fremont, D.H. (2016). Structural Basis of Zika Virus-Specific Antibody Protection. Cell 166, 1016–1027. Zhou, Y., Ray, D., Zhao, Y., Dong, H., Ren, S., Li, Z., Guo, Y., Bernard, K.A., Shi, P.Y., and Li, H. (2007). Structure and function of flavivirus NS5 methyltransferase. J. Virol. 81, 3891–3903. Zhou, X., Michal, J.J., Zhang, L., Ding, B., Lunney, J.K., Liu, B., and Jiang, Z. (2013). Interferon induced IFIT family genes in host antiviral defense. Int. J. Biol. Sci. 9, 200–208. €st, R., Cervantes-Barragan, L., Habjan, M., Maier, R., Neuman, B.W., Zu Ziebuhr, J., Szretter, K.J., Baker, S.C., Barchet, W., Diamond, M.S., et al. (2011). Ribose 20 -O-methylation provides a molecular signature for the distinction of self and non-self mRNA dependent on the RNA sensor Mda5. Nat. Immunol. 12, 137–143.

Immunity 48, 1–13, March 20, 2018 13

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

WNV hE16

Diamond laboratory

Oliphant et al., 2005

WNV E60

Diamond laboratory

Oliphant et al., 2006

ZV-2

Diamond laboratory

Zhao et al., 2016

Anti-VSV-G [8G5F11]

Kerafast

EB0010

Anti-VEEV 3B4C4

Diamond laboratory

unpublished

anti-IFIT3 OTI1G1

Origene

TA500726

Antibodies

anti-HA

R&D Systems

MAB6875

anti-GFP

Abcam

ab6556

anti-IFIT1

Thermo Fisher

PA5-31254

anti-GAPDH

Cell Signaling Technology

2118

anti-IFIT3

Sen laboratory

Fensterl et al., 2008

anti-FLAG M2

Sigma-Aldrich

F3165

WNV-WT (Strain NY99)

Diamond laboratory

Daffis et al., 2010

WNV-NS5-E218A (Strain NY99)

Diamond laboratory

Daffis et al., 2010

ZIKV-WT (Cambodian strain FSS13025)

Diamond laboratory

Shan et al., 2016

ZIKV-NS5-E218A (Cambodian strain FSS13025)

Diamond laboratory

Shan et al., 2016

Bacterial and Virus Strains

VSV strain Indiana

Colonna laboratory

N/A

VEEV strain TC-83

Diamond laboratory

Hyde et al., 2014

Vero

ATCC

CVCL_0059

HEK293T

ATCC

CRL-3216

Flp-In T-Rex 293

Thermo Fisher

R78007

BHK21

ATCC

CCL-10

BL21(DE3)

Novagen

69450

Experimental Models: Cell Lines

Chemicals Human IFN-b

PBL Assay Science

11420-1

ScriptCap m7G Capping System

Cellscript

C-SCCE0625

ScriptCap 20 -O-Methyltransferase Kit

Cellscript

C-SCMT0625

This paper

https://www.rcsb.org/Code6C6K

Deposited Data Raw and analyzed data Recombinant DNA pSpCas9(BB)-2A-Puro (PX459)

Addgene

62988

pFCIV

Hope Center, Washington University

N/A

psPAX2

Addgene

12260

pMD2.G

Addgene

1225

pLentiCRISPR V2.0

Addgene

52961

pET15b vector

Novagen

69661

IFIT3 sgRNA: ACACCTAGATGGTAACAACG

This paper

N/A

IFIT1 sgRNA #1: ATGACAACCAAGCAAATGTG

This paper

N/A

IFIT1 sgRNA #2: CACTCCATTCTA-TAGCGGAA

This paper

N/A

Oligonucleotides

(Continued on next page)

e1 Immunity 48, 1–13.e1–e5, March 20, 2018

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

scrambled sgRNA #1: ACGGAGGCTAAGCGTCGCAA

This paper

N/A

scrambled sgRNA #2: CGCTTCCGCGGCCCGTTCAA

This paper

N/A

50 m7Gppp AUA GGC GGC G 30

TriLink Biotechnologies

N/A

Statistics: Prism 7

Graphpad

N/A

VP-Isothermal Titration Calorimeter

Malvern

N/A

ITC Data Processing/Fit

ORIGIN 7.0

N/A

LTQ-FTICR mass spectrometer

Thermo Fisher

13437

Mass analysis/LC-MS/MS: Mascot

Matrix Science

N/A

HDX Analysis

HDX Workbench

Pascal et al., 2012

Chirascan CD spectrometer

Applied Photophysics

N/A

Software and Algorithms

CONTACT FOR REAGENT AND RESOURCE SHARING Requests for data or reagents should be directed and will be fulfilled by the Lead Contact, Gaya K. Amarasinghe (gamarasinghe@ wustl.edu; 314-286-0619). METHODS DETAILS IFIT protein expression constructs The coding regions of IFIT1 (NCBI accession number NP_001539.3), IFIT2 (NCBI accession number NP_001538.4), IFIT3 (NCBI accession number NP_001540.2), IFIT5 (NCBI accession number NP_036552.1), ifit1(NCBI accession number NP_032357.2), and ifit3 (NCBI accession number NP_034631.1) were codon optimized for expression in E. coli (Genscript) and used as templates to subclone the coding regions into a modified pET15b vector (Novagen). Mutations were generated by overlap PCR method and verified by sequencing. Protein Expression and Purification IFIT1-Ifit1 and IFIT3-Ifit3 proteins were expressed in BL21(DE3) E. coli cells (Novagen), cultured in Luria Broth media at 37 C, induced at an OD600 (optical density at 600 nm) of 0.6 with 0.5 mM IPTG, and grown for 12-15 hr at 18 C. Cells were resuspended in lysis buffer containing 25 mM sodium phosphate (pH 7.5), 250 mM NaCl, 5 mM 2-mercaptoethanol, lysed using an EmulsiFlex-C5 homogenizer (Avestin) and clarified by centrifugation at 47,000 x g at 4 C for 40 min. Proteins were purified using a series of affinity and ion-exchange chromatographic columns (GE Healthcare). TEV protease digestion was used to remove the maltose binding protein (MBP) tag and the resulting sample was further purified by using size exclusion chromatography. Protein purity was assessed by Coomassie staining of SDS-PAGE and mass spectrometry. RNA for structural studies RNA was purchased from TriLink Biotechnologies (San Diego, CA) with 50 m7Gppp AUA GGC GGC G 30 sequence. IFIT1-IFIT3-cap 0 RNA complex formation Purified IFIT1 and IFIT3 were mixed in a 1:1.5 ratio followed by size exclusion chromatography. The complex was verified by SDS-PAGE and concentrated to 16 mg/mL. Complex and cap 0 RNA (10 nucleotide) were mixed in a 1:1.5 ratio prior to setup of crystallization trays using the vapor diffusion hanging drop method. Crystals were vitrified in a solution containing the crystallization condition and 25% glycerol by plunge freezing into liquid nitrogen. Data Collection and Structure Determination Crystals were screened at Advanced Photon Source Beamline 19ID. Table 1 shows data collection and refinement statistics. Diffraction images were processed by HKL3000 (Otwinowski and Minor, 1997). The structure was solved by molecular replacement using PDB: 4HOR as a search model. IFIT1 residues were built by Buccaneer (Cowtan, 2006) followed by manual building in COOT (Emsley and Cowtan, 2004) and refinement with REFMAC5 (Collaborative Computational Project, Number 4, 1994). The structure quality was assessed by MolProbity (Davis et al., 2007). Structure figures were prepared using PyMOL. Protein-protein interactions were analyzed using LigPlot+ (Laskowski and Swindells, 2011). The structural coordinates for the IFI3-IFIT1-RNA complex have been deposited (PDB: 6C6K).

Immunity 48, 1–13.e1–e5, March 20, 2018 e2

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

Isothermal titration calorimetry Binding assays were performed on a VP-isothermal titration calorimeter (VP-ITC) (MicroCal). Protein samples were dialyzed against buffer (10 mM HEPES pH 7.5, 150 mM NaCl, and 2 mM Tris (2-carboxyethyl) phosphine (TCEP)) for 12 hr at 4 C. Titrations were set up with 50–100 mM protein solution (IFIT3) in the syringe and 4–10 mM protein solution (IFIT1 or mutant IFIT1) in the cell. A reference power of 3 mcal/s was used, and the resulting isothermal titration calorimetry data were processed and fit to a one-site binding model to determine n (number of binding sites) and KD (dissociation constant) using ORIGIN 7.0 software. Hydrogen deuterium exchange mass spectrometry (HDX-MS) IFIT1, IFIT3, IFIT1-cap 0 RNA, IFIT1-IFIT3, and IFIT1-IFIT3-cap 0 RNA samples were buffer-exchanged with PBS pH 7.4. Deuterium labeling was initiated by diluting samples (2 mL of 50 mM) 10-fold with D2O buffer, or H2O buffer for samples measured for no-deuterium control. At different time intervals (10, 30, 60, 120, 360, 900, 3600, and 14400 s), the labeling reaction was quenched by rapidly adjusting the pH to 2.5 with 30 mL of quench buffer (3 M urea, 1% trifluoroacetic acid, H2O) at 4 C. The protein mixture was immediately injected into a custom-built HDX device and passed through a column containing immobilized pepsin (2 mm 3 20 mm) at a flow rate of 100 ml/min in 0.1% formic acid, and the resulting peptic peptides were captured on a ZORBAX Eclipse XDB C8 column (2.1 mm 3 15 mm, Agilent) for desalting (3 min). The C8 column was then switched in-line with a Hypersil Gold C18 column (2.1 mm 3 50 mm, Thermo Fisher), and a linear gradient (4% to 40% acetonitrile, 0.1% formic acid, 50 m/min flow rate, over 5 min) was used to separate the peptides and direct them to a LTQ-FTICR mass spectrometer (Thermo Fisher) equipped with an electrospray ionization source. Valves, columns, and tubing for protein digestion and peptide separation were submerged in an ice-water bath to minimize back-exchange. The resulting data were processed and peptides identified by exact mass analysis and LC–MS/MS using Mascot (Matrix Science). Raw HDX spectra and peptide sets also were submitted to HDX Workbench (Pascal et al., 2012) for calculation and data visualization in a fully automated fashion. Peptides for each run were assessed based on relative representation and statistical validation. Only the top 6 peptides from each MS scan were used in the final analysis. Deuterium uptake at each time point was calculated by subtracting the centroid of the isotopic distribution of the undeuterated peptide from the deuterated peptide. The relative deuterium uptake was plotted versus the labeling time to afford kinetic curves. For comparison between apo states and complex samples, differences in deuterium uptake following all incubation time points were calculated. Absolute differences in perturbation values larger than 5% D were considered significant. The 15-min time point was mapped onto the protein three-dimensional (3D) structure for data visualization. Filter binding assays RNA (cap 0, cap 1, and 50 -ppp) were radiolabeled with 32P-a-GTP using capping reaction kit (Cellscript) and purified by 12% ureaPAGE. Labeled RNAs (5 nM) were heated at 95 C for 5 minutes, annealed on ice, mixed with increasing concentrations of IFIT1, IFIT3, or IFIT1-IFIT3 complex in a 96-well plate and incubated for 15 min. Samples were applied to a 96-well dot blot apparatus (Whatman) with nitrocellulose and nylon membranes (Bio-Rad). The amounts of 32P-labeled RNAs present on nitrocellulose and nylon membranes were quantified using a phosphoimager (GE Healthcare). Binding was calculated as the fraction of RNA bound to the nitrocellulose membrane compared to the sum of RNA bound to nitrocellulose and nylon membranes and plotted versus IFIT concentration using ORIGIN 7.0 software. Circular dichroism studies Wild-type and mutant IFIT protein samples were prepared in 25 mM sodium phosphate (pH 7), 150 mM NaCl, 2 mM tris(2-carboxyethyl)phosphine (TCEP) at 10 mM. CD spectra were acquired in triplicate using a Chirascan CD spectrometer (Applied Photophysics). Wavelength scans from 200 to 280 nm were performed to monitor the change in molar ellipticity of each protein at 4 C and at a 40 nm/min scan rate. Co-immunoprecipitation assays Amylose resin was pre-equilibrated with buffer (10 mM HEPES pH 7.5, 150 mM NaCl, and 2 mM tris(2-carboxyethyl)phosphine (TCEP)) prior to the addition of purified MBP-tagged proteins. The resin was incubated for 10 min followed by washes and subsequent resuspension. Purified untagged proteins were applied to the resin and incubated for 20 min prior to washes and final resuspension and elution with buffer containing 1% (w/v) maltose. Samples were taken at each step and visualized by Coomassie staining of SDS-PAGE. Pulse-chase studies Pulse-chase experiments were performed by stimulating 293T-IFIT1-doxy + IFIT3 and 293T-IFIT1-doxy + fluc cells with doxycycline for 16 hours, followed by treatment with 50 mM puromycin to arrest translation. At 0, 2, 4, and 8 hr post-puromycin treatment, cell lysates were collected and analyzed for IFIT1 expression by western blot using an anti-flag tag antibody. Immunoblotting Cells were disrupted using Radioimmunoprecipitation assay (RIPA) lysis and extraction buffer (Sigma-Aldrich) supplemented with protease inhibitor cocktail (Sigma-Aldrich). Immunoblots were performed using a rabbit polyclonal anti-IFIT1 (Thermo Fisher), rabbit e3 Immunity 48, 1–13.e1–e5, March 20, 2018

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

anti-GAPDH (Cell Signaling Technology), rabbit polyclonal anti-IFIT3 (Fensterl et al., 2008), or mouse monoclonal anti-FLAG M2 (Sigma-Aldrich), followed by IRDye 680RD goat anti-rabbit or IRDye 800CW goat anti-mouse (Li-Cor). Blots were imaged using a Li-Cor Odyssey infrared imaging system. EXPERIMENTAL MODEL AND SUBJECT DETAILS Cells All cell lines were maintained at 37 C in the presence of 5% CO2. HEK293T cells were passaged in Dulbecco’s Modified Eagle Medium (DMEM) (Invitrogen) supplemented with 10% fetal bovine serum (FBS) (Omega Scientific). Flp-In 293 T-REx cell lines were passaged in DMEM supplemented with 10% Tet System Approved FBS (Clontech Laboratories), 15 mg/mL blasticidin, and 200 mg/mL hygromycin B. Vero cells were passaged in DMEM supplemented with 5% FBS. To create IFIT3 gene-edited cells lines, the sgRNA 50 -ACACCTAGATGGTAACAACG-30 was cloned into the plasmid pSpCas9(BB)2A-Puro (PX459) V2.0 (Addgene #62988). This plasmid was transfected into 293T cells using the FugeneHD transfection reagent, and 24 hr later cells were treated with puromycin (2.5 ug/mL) for a three-day drug selection. A clonal cell line subsequently was isolated by limiting dilution and analyzed for IFIT3 loss-of-expression deletions by Sanger sequencing. For construction of 293T-IFIT3, 293TIFIT3DCTD, and 293T-fluc cell lines in the background of the IFIT3mut/mut cell line, genes for IFIT3, IFIT3 lacking C-terminal residues 403-490 (IFIT3DCTD), or fluc were cloned into the pFCIV lentivirus expression vector which expresses a GFP marker from an IRES promoter (Hope Center, Washington University). Lentiviruses were produced by transfecting HEK293T cells with psPAX2 (Addgene #12260), pMD2.G (Addgene #12259), and pFCIV plasmids. The 293T IFIT3mut/mut cell line was trans-complemented after transduction with IFIT3, IFIT3DCTD, or fluc lentiviruses and then sorted based on GFP expression before analysis of IFIT3 expression by Immunoblot and flow cytometry. CRISPR-based gene-editing of IFIT1 from the 293T-IFIT3 and 293T-fluc cell lines was performed by cloning sgRNAs targeting IFIT1 or scrambled control sgRNA into pLentiCRISPR V2.0 (Addgene # 52961). sgRNA sequences used were 50 -ATGACAACCAAGCAAATGTG-30 (IFIT1 sgRNA #1), 50 - CACTCCATTCTA-TAGCGGAA-30 (IFIT1 sgRNA #2), 50 - ACGGA GGCTAAGCGTCGCAA-30 (scrambled sgRNA #1), 50 -CGCTTCCGCGGCCCGTTCAA-30 (scrambled sgRNA #2). Lentiviruses were produced by co-transfection of HEK293T cells with a pLentiCRISPR plasmid and the packaging plasmids psPAX2 and pMD2.G. 293T-IFIT3 and 293T-fluc cells were transduced with lentiviruses and selected with puromycin for six days before downstream analysis. A 293T cell line was constructed to inducibly express IFIT1 with an N-terminal 2x Flag tag under the control of a tetracycline inducible CMV promoter using the Flp-In 293 T-Rex system (Invitrogen) according to the manufacturer’s instructions. To create 293TIFIT1-doxy cells that stably expressed IFIT3 or fluc, cells were transduced using the lentiviruses described above (pFCIV + IFIT3 or + fluc) and sorted based on GFP expression before analysis of IFIT3 or fluc expression by flow cytometry. Virus production and infection WNV-WT and WNV-NS5-E218A were propagated in BHK21-15 cells as previously described (Daffis et al., 2010; Zhou et al., 2007). ZIKV-WT and ZIKV-NS5-E218A were generated from an infectious cDNA clone of a Cambodian strain FSS13025 (2010) as previously described (Shan et al., 2016) and propagated in Vero cells. Viral titers were determined by focus-forming assay using Vero cells as previously described (Brien et al., 2013). VSV Indiana strain was propagated in BHK21 cells and titered by plaque assay on Vero cells. VEEV-TC83 was produced from an infectious cDNA clone in BHK21-15 cells and titered on Vero cells by focus forming assay, as previously described (Hyde et al., 2014). For viral growth analysis, multistep growth curves were performed using a multiplicity of infection (MOI) of 0.01. For flow cytometric analysis, cells were infected with WNV (MOI 5, 24 h) ZIKV (MOI 1, 30 h), VSV (MOI 1, 6 h), or VEEV-TC83 (MOI 1, 16 h). Following infection, cells were fixed with 1% paraformaldehyde for 10 min at room temperature, permeabilized with 0.1% saponin in HBSS with 10 mM HEPES, and stained for viral antigen using virus-specific antibodies human WNV-E16 (Oliphant et al., 2005), mouse E60 (Oliphant et al., 2006), mouse ZV-2 (Zhao et al., 2016), mouse anti-VSV-G (Kerafast), or mouse anti-VEEV-3B4.C4 (Diamond laboratory, unpublished). Cells were then stained with Alexa Fluor 647-conjugated goat anti-human IgG or anti-mouse IgG. For co-transfection and WNV infection experiments, 293T-IFIT1 cells were transfected with an pFCIV expression vector containing fluc with an N-terminal HA tag, IFIT3, IFIT3DCTD, IFIT3CTD, IFIT3 K426A-E439A-L445A-S451A-I453A-F457A, or IFIT3 K426A-E439A. One-day post-transfection, cells were treated with doxycycline at the indicated dose for 16 hr before infection with WNV-WT or WNV-NS5-E218A (MOI 5, 24 h). Following fixation and permeabilization, cells were co-stained with human WNV-E16, mouse anti-IFIT3 (OTI1G1, Origene), or HA-tagged fluc (mouse anti-HA, R&D Systems). IFIT3CTD lacks the epitope recognized by antiIFIT3 OTI1G1 and instead was monitored for GFP expression as a marker of transfection (rabbit polyclonal anti-GFP, Abcam). Cells then were stained with Alexa Fluor 647-conjugated goat anti-human IgG and Alexa Fluor 488-conjugated goat anti-mouse or antirabbit before analysis by flow cytometry. QUANTIFICATION AND STATISTICAL ANALYSIS Statistical analyses were performed using Prism software Version 7.0 for Mac OS X (GraphPad Software). For flow cytometry experiments, relative infectivity values were compared by Student’s t test when comparing two samples or, for comparisons of more than two samples, by two-way ANOVA followed by a Sidak’s, Dunnett’s, or Tukey’s correction for multiple comparisons where indicated. Immunity 48, 1–13.e1–e5, March 20, 2018 e4

Please cite this article in press as: Johnson et al., Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability, Immunity (2018), https:// doi.org/10.1016/j.immuni.2018.01.014

For Immunoblot quantification, relative protein amounts were compared by two-way ANOVA followed by a Sidak’s correction for multiple comparisons. Growth curves were analyzed by comparing log10 focus-forming unit (FFU)/mL values by two-way ANOVA followed by Tukey’s multiple comparisons test. Protein half-life was analyzed using single-phase exponential-decay curves. DATA AND SOFTWARE AVAILABILITY The accession number for the structure reported in this paper is PDB: 6C6K.

e5 Immunity 48, 1–13.e1–e5, March 20, 2018