Human interleukin-1α gene expression is regulated by Sp1 and a transcriptional repressor

www.elsevier.com/locate/issn/10434666 Cytokine 30 (2005) 141e153

Human interleukin-1a gene expression is regulated by Sp1 and a transcriptional repressor Tarra L. McDowell1, Julian A. Symons1,*, Gordon W. Duff Division of Genomic Medicine, Medical School, University of Sheffield, Beech Hill Road, Sheffield S10 2RX, UK Received 17 September 2004; received in revised form 30 November 2004; accepted 15 December 2004

Abstract The regulation of the human IL-1a gene was studied using a series of 5# deletion promoter chloramphenicol acetyltransferase (CAT) reporter constructs. The IL-1a promoter from ÿ967 to C64 produced no significant expression of CAT. Progressive 5# deletion indicated the presence of a repressor binding site between ÿ477 and ÿ305 bp as deletion in this region resulted in CAT expression. Electrophoretic mobility shift assay (EMSA) analysis confirmed that protein(s) bound to this region and DNaseI footprinting localized the binding site to between ÿ448 and ÿ435. Deletion of the IL-1a promoter to ÿ42 resulted in reduced CAT expression suggesting the presence of a positive regulatory element in this region. EMSA experiments using IL-1a promoter DNA from ÿ163 to C64 demonstrated protein binding to this region and DNaseI footprinting demonstrated protection between ÿ59 and ÿ40. Transcriptional activity of the IL-1a promoter was also tested using an in vitro transcription assay. Reactions using ÿ163, ÿ100 and ÿ52 promoter templates all produced a correctly sized transcript but deletion to ÿ42 resulted in no transcript production. Analysis of the promoter indicated that a potential Sp1 binding site existed in the region from ÿ52 to ÿ45. An EMSA using an antiSp1 antibody indicated that Sp1 specifically bound to the ÿ52 to C64 region. Ó 2005 Elsevier Ltd. All rights reserved. Keywords: Gene regulation; Interleukin-1a; Repressor protein; Sp1; Transcriptional regulation

1. Introduction Interleukin-1 (IL-1) is the term used to describe the biological activities of two proinflammatory cytokine proteins (IL-1a and IL-1b) that are produced during infection, trauma and antigenic challenge [1]. Isolation of genomic clones for human IL-1a [2] and human and murine IL-1b [3e5] demonstrated that the two molecules shared a similar gene structure, both containing 7 exons and 6 introns. The genes encoding these proteins in humans are located on chromosome 2 in the region q13 to q21 [6e8]. Although there are relatively few * Corresponding author at: Roche Palo Alto, 3431 Hillview Avenue, Palo Alto, CA 94304, USA. Tel.: C1 650 354 7169; fax: C1 650 852 1187. E-mail address: [email protected] (J.A. Symons). 1 These authors contributed equally to this work. 1043-4666/$ - see front matter Ó 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.cyto.2004.12.010

reports describing functional elements important for IL-1a gene expression, regulation of the IL-1b gene has been extensively explored. In contrast to the IL-1a gene, the IL-1b gene contains a classical TATA box at position ÿ31 bp and two putative CAAT boxes at ÿ125 bp and ÿ75 bp. Other transcription factors shown to be important for IL-1b expression include Sp1 [9], Spi-1/PU.1 [10], NF-IL6 [11], CREB [11], NF-kB [12] and a lipopolysaccharide/IL-1 inducible STAT-like factor [13]. Analysis of the 5# flanking region of the human IL-1a gene demonstrated that classical TATA and CAAT boxes were absent and that a region from ÿ63 to ÿ48 relative to the start site shared high homology to a known positive acting element characterized in the adenovirus major late promoter (AdMLP) [2]. It was proposed that the major late transcription factor

142

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

(MLTF) or USF may bind to this site and play a role in the regulation of IL-1a gene expression [2]. Several studies have shown the functional significance of the proximal promoter region in IL-1a gene regulation [14e16]. We and others have shown that an AP-1 site located between ÿ13 and ÿ5 may be important for IL-1a gene expression in PC12 cells [14] and Mono Mac 6 [15]. Additionally, transactivation of the IL-1a promoter in T cells by the HTLV-1 Tax protein has been described suggesting that NF-kB may be involved in the transcriptional regulation of IL-1a [17]. Recently, an NF-IL-1a binding site has been shown to be important for aberrant constitutive expression of IL-1a in fibroblasts from patients with systemic sclerosis [18]. EMSA analysis showed that this protein appeared to be absent in extracts from normal fibroblasts. We were interested in identifying important regulatory elements that control expression of the IL-1a gene. We describe using reporter gene analysis, EMSA analysis and DNaseI footprinting that the IL-1a gene is regulated by a novel repressor motif (GCTGCCAAGTATTC) located between ÿ448 and ÿ435 bp and that this element can repress a heterologous promoter. Further, we identified an Sp1 binding site (GCCACGCC) between

ÿ52 and ÿ45. We confirmed by promoter deletion analysis that this element is functional, that this sequence is protected using DNaseI footprinting analysis and that the DNA binding protein is Sp1 using an anti-Sp1 antibody in EMSA experiments.

2. Results 2.1. Expression of IL-1a mRNA and protein in HeLa cells Analysis of IL-1a mRNA production by RTePCR (indicated by the open arrow, Fig. 1a) showed that IL-1a was not expressed in resting HeLa cells (lane 1). The level of IL-1a mRNA was weakly detectable by 2 h (lane 3), maximal between 4 and 8 h (lanes 4 and 5) and decreased by 12 and 18 h (lanes 6 and 7). Equal amounts of RNA were used in each reaction shown by amplification of control 7B6 (indicated by the open arrow, lanes 1e7, Fig. 1b). Kinetics of IL-1a protein production as determined by specific ELISA showed that IL-1a was detectable in intracellular fractions from stimulated HeLa cells but not from unstimulated cells (Fig. 1c).

Fig. 1. Detection of IL-1a mRNA and protein in PMA stimulated HeLa cells. (a) Analysis of IL-1a mRNA in HeLa cells using RTePCR. Lanes 1e7 show hybridization of an IL-1a oligonucleotide to reverse transcribed/amplified RNA isolated from PMA stimulated HeLa at timepoints 0, 1, 2, 4, 8, 12 and 18 h. The PCR product is indicated by the open arrow. (b) Amplification of 7B6 from the RNA samples used in (a). The PCR product is indicated by the open arrow. (c) Intracellular fractions obtained from stimulated cells (indicated by the solid circles) contained IL-1a protein as determined by ELISA. Extracellular fractions from stimulated cells (open circles), intracellular fractions from unstimulated cells (solid squares) and extracellular fractions from unstimulated cells (open squares) did not contain detectable IL-1a protein.

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

After 8 h IL-1a protein was detectable, levels were maximal between 12 and 18 h and decreased by 24 h. By 36 h IL-1a protein was undetectable. IL-1a protein was not detected in extracellular supernatants at any time. 2.2. IL-1a 5# flanking region and expression of IL-1a/CAT constructs in HeLa cells Expression of CAT by HeLa cells transfected with IL-1a promoter deletion constructs is shown in Fig. 2a. Expression of CAT driven by the full length (ÿ967 to C64) IL-1a promoter in HeLa cells was weak. However, deletion of the IL-1a promoter to ÿ305 resulted in an approximate 5-fold increase in CAT expression. The ÿ163, ÿ100 and ÿ52 reporter constructs transfected into cells also resulted in expression of CAT (approximately 12-fold increase). Whereas deletion of the IL-1a promoter to ÿ42 lead to a loss of CAT expression. Further, stimulation of transfected cells with PMA did not result in augmented CAT expression using any of the deletion constructs (data not shown). To ensure that the differences in levels of CAT protein were a result of

143

differential expression of CAT plasmids and not due to differences in transfection efficiency, the quantity of CAT plasmid in transfected cells was determined. Lysates prepared from cells were treated with RNase A and proteinase K and hybridized with a 32P-labeled CAT plasmid probe. CAT protein levels were adjusted for the efficiency of transfection. 2.3. Characterization of the IL-1a putative repressor region The initial CAT reporter gene assays suggested that the potential repressor region was located between ÿ477 and ÿ305. The functional importance of this region of DNA was then studied. We initially targeted analyzing the ÿ477 to ÿ418 region as motifs with homology to other known repressor elements (murine stearoyl-CoA desaturase [19], stromelysin [20] and IL-2R/HIV [21]) were identified in this region. A 211 bp fragment (ÿ589 to ÿ379) spanning the putative repressor element was amplified by PCR and cloned upstream of both an active IL-1a promoter construct and an SV40 promoter CAT plasmid containing an SV40 enhancer element (CAT control; Promega, UK), in both the correct and reverse orientations. We observed that the CAT control plasmid was 2.7-fold more active than the IL-1a ÿ163 promoter construct and results are expressed as a percentage of expression compared to CAT control or IL-1a promoter plasmids (Fig. 2b). The repressor element within the IL-1a fragment (ÿ589 to ÿ379) was able to repress approximately 67% or 76% of the CAT expression driven by the IL-1a promoter cloned in the sense or anti-sense orientations, respectively. Expression of CAT from cells transfected with the SV40 promoter/enhancer CAT plasmid showed that the 211 bp fragment cloned in the sense or anti-sense orientation was able to inhibit the expression of CAT by approximately 70% and 92%, respectively. 2.4. EMSA analysis and DNaseI footprinting of the putative repressor region

Fig. 2. Expression of IL-1a promoter CAT constructs. (a) HeLa cells were transfected (nZ4) with a library of IL-1a deletion constructs linked to the reporter gene CAT. The 5# end is shown on the left hand side and expression of CAT (meanGSEM) is shown as a bar on the right-hand side. (b) HeLa cells were transfected (nZ6) with constructs containing the repressor element linked to an active IL-1a promoter or the repressor linked to an SV40 promoter/enhancer. Constructs are indicated on the left and expression of CAT (meanGSEM) shown as the bar on the right-hand side. Results are shown as a percentage of expression compared to CAT control or IL-1a promoter plasmids.

Data from the expression of IL-1a promoter CAT constructs suggested that a transcriptional repressor was binding to a site between ÿ477 and ÿ379. To determine whether a transcription factor bound to this region of the IL-1a promoter, the ÿ544 to C64 construct was digested with HgiAI (New England BioLabs, UK) to isolate a 138 bp fragment (ÿ544 to ÿ406). This fragment was radiolabeled and used in EMSA reactions with protein extracts prepared from HL-60, HeLa, THP-1, U937 and SVK-14. The results from these DNA binding experiments (Fig. 3a) demonstrated that one or more proteins from these cells bound to a sequence within this probe (indicated by the open arrow, lanes 2, 5, 8, 11 and 14). This binding was shown to be specific as a 100-fold

144

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

Fig. 3. EMSA and DNaseI footprinting analysis of the repressor region. (a) Extracts from HL-60 (lanes 2e4), HeLa (lanes 5e7), THP-1 (lanes 8e10), U937 (lanes 11e13) and SVK-14 (lanes 14e16) were used in EMSA reactions with a radiolabeled IL-1a fragment (ÿ544 to ÿ406). Competitors were as follows: 100-fold excess of unlabeled probe (lanes 3, 6, 9, 12 and 15) and 100-fold excess non-specific competitor (lanes 4, 7, 10, 13 and 16). Free probe indicated by solid arrow, complexes indicated by open arrow. (b) EMSA experiment using extracts from HL-60 (lane 2), THP-1 (lane 3), U937 (lane 4), SVK-14 (lane 5), HeLa (lane 6), HOS (lane 7), Molt 4 (lane 8), Jurkat (lane 9) and Raji (lane 10). Free probe indicated by solid arrow, complexes indicated by open arrow. (c) Analysis of DNA binding site by DNaseI footprinting. Footprint is indicated by the brackets containing the sequence protected. Maxam Gilbert ladder (MG) and HeLa nuclear extract (0, 10, 20 and 40 mg protein added).

excess of unlabeled probe competed for binding of this protein (lanes 3, 6, 9, 12 and 15) but a 100-fold excess of non-specific competitor did not (lanes 4, 7, 10, 13 and 16). It was then of interest to determine whether this potential repressor protein was present in other cell lines. As shown in Fig. 3b, a binding protein(s) in nuclear extracts from human osteosarcoma cells (HOS) (lane 7), T-cell lines Molt 4 (lane 8) and Jurkat (lane 9) and the human EpsteineBarr virus transformed B-cell line Raji (lane 10) bound to the repressor probe. DNA binding was shown to be specific by addition of excess of unlabeled probe (data not shown). To identify the location of the repressor binding site within the IL-1a ÿ544 to ÿ406 region, DNaseI footprinting was performed. Addition of HeLa extract (10 to 40 mg) produced a strongly protected region between ÿ448 and ÿ435, indicated by the bracket (Fig. 3c). Analysis of the sequence in this region revealed no homology to known repressor elements.

2.5. EMSA analysis and DNaseI footprinting of the proximal region (ÿ163 to C64) The IL-1a fragment from ÿ163 to C64 was radiolabeled and used in EMSA reactions with extracts prepared from HL-60 and HeLa cells (Fig. 4a). These results showed that one or more DNA binding proteins from these cells was able to bind to this fragment (indicated by the open arrow, lanes 2 and 5). This binding was shown to be specific as addition of 100-fold excess of unlabeled probe competed for binding of this protein (lanes 3 and 6) but a 100-fold excess of a nonspecific competitor did not (lanes 4 and 7). To identify the location of the transcription factor binding site, DNaseI footprinting was performed using radiolabeled ÿ163 to C64 IL-1a DNA. The results are shown in Fig. 4b. Addition of HeLa extract (10 to 40 mg) produced two protected regions indicated by the brackets. We observed protection between ÿ92 and ÿ77 and a region

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

145

Fig. 4. EMSA, DNaseI footprinting and in vitro transcription analysis of the IL-1a proximal region. (a) Extracts from HL-60 (lanes 2e4) and HeLa (lanes 5e7) were used in EMSA reactions with a radiolabeled fragment (ÿ163 to C64). Competitors were as follows, 100-fold excess of unlabeled probe (lanes 3 and 6) and 100-fold excess non-specific competitor (lanes 4 and 7). (b) Analysis of DNA binding site by DNaseI footprinting. Footprints are indicated by the brackets containing the sequences protected. The Sp1 binding site (ÿ52 to ÿ45) is shown in bold typeface. Maxam Gilbert ladder (MG) and HeLa nuclear extract (0, 10, 20 and 40 mg protein added). (c) In vitro transcription analysis. HinfI digested f DNA labeled with 32P (lane 1), transcripts produced using IL-1a fragments ÿ163 (lane 2), ÿ100 (lane 3), ÿ52 (lane 4) and ÿ42 (lane 5). Transcripts using IL-1a fragments are indicated by the open arrow. Transcripts using the CMV promoter template are indicated by the closed arrow.

between ÿ59 and ÿ40 that contains a potential Sp1 DNA binding site (ÿ52 to ÿ45, shown in bold typeface). 2.6. In vitro transcription of IL-1a constructs The transcriptional activity of the proximal IL-1a promoter constructs was also tested using an in vitro transcription system. Transcripts produced from linearized plasmid templates are shown in Fig. 4c. The transcript produced from the IL-1a promoter (663 bp in length) is shown by the open arrow and the lower solid arrow shows a control transcript produced using a CMV promoter fragment (336 bp in length) that was added to reactions to standardize each transcription reaction.

The transcription reactions using ÿ163, ÿ100 and ÿ52 promoter fragment templates all show the production of a correctly sized transcript (lanes 2e4) but deletion to ÿ42 showed that no transcript was produced (lane 5). These results confirmed that the region from ÿ52 to ÿ42 is important for transcription of the IL-1a constructs. 2.7. EMSA using oligonucleotides and antibodies The IL-1a fragment from ÿ52 to C64 was end labeled and used in EMSA reactions with extracts prepared from HeLa cells (Fig. 5a). These results showed that one or more DNA binding proteins (indicated by the open arrow) from HeLa cells were able

146

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

Fig. 5. EMSA analysis of IL-1a proximal region. (a) EMSA using extract from HeLa cells and radiolabeled DNA (ÿ52 to C64). Competitors were as follows, no competitor (lane 2), 50-fold excess unlabeled probe (lane 3), 50-fold molar excess AdMLP oligonucleotide (lane 4), 50-fold molar excess wild-type IL-1a oligonucleotide (CGCACTTGTAGCCACGTAGCCACGCCTACT, lane 5), 50-fold molar excess IL-1a mutant oligonucleotide (CGCACTTGTAGCCACGCTTAGACGCCTACT, lane 6). The core wild-type Sp1 and mutant Sp1 elements present in the oligonucleotides are shown in bold typeface and the underlined sequence indicates mutated nucleotides. Free probe indicated by the solid arrow, complexes indicated by the open arrow. (b) EMSA analysis using radiolabeled ÿ58 wild type (lanes 1e5) and ÿ58 mutant (lanes 6e10) promoter fragments and extract from HeLa cells. Competitors were as follows: no competition (lanes 2 and 7), 50-fold excess unlabeled probe (lanes 3 and 8), cross competition of 50-fold excess of unlabeled probes (lanes 4 and 9) and 50-fold excess of non-specific competitor (lanes 5 and 10). Free probe indicated by the solid arrow, complexes indicated by the open arrow. (c) EMSA using radiolabeled AdMLP (lanes 1e5) and IL-1a (lanes 6e10) oligonucleotides (sequence shown above) with nuclear extract from HeLa cells. Free probe (lanes 1 and 6), no antibody (lanes 2 and 7), anti-USF antibody (lanes 3 and 8), anti-myc antibody (lanes 4 and 9), normal rabbit serum (lanes 5 and 10). Free probe indicated by the solid arrow, complexes indicated by the open arrows, neutralized complexes indicated by the open arrow with the asterisk. (d) EMSA using radiolabeled proximal IL-1a fragment (ÿ52 to C64) and nuclear extract from HeLa cells. Antibodies included are as follows, no antibody (lane 2), anti-Sp1 (lane 3), anti-USF (lane 4), anti-myc (lane 5) and normal rabbit serum (lane 6). Free probe indicated by the solid arrow, complexes indicated by the open arrows, supershifted complexes indicated by the open arrow with the asterisk.

to bind to this fragment (lane 2) and that this binding was competed using unlabeled probe (lane 3). Competition experiments showed that addition of an oligonucleotide homologous to the AdMLP that contained the E Box motif was not able to inhibit DNAeprotein interactions (lane 4, 50-fold molar excess). In contrast, addition of an

oligonucleotide spanning a putative Sp1 site in the IL-1a promoter was able to compete (lane 5). Mutation of the first three base pairs of the putative Sp1 binding site in the IL-1a sequence (GCCACGCC to TAGACGCC) resulted in no competition when this oligonucleotide (M) was included in EMSA reactions (lane 6). To further

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

characterize this site, the sequence of the IL-1a promoter was mutated to the sequence shown as M. Wild-type and mutant ÿ58 to C64 IL-1a promoter were end labeled and used as probes in EMSA reactions (Fig. 5b, complexes indicated by the open arrow). The results showed that the ÿ58 mutant fragment was unable to compete for binding when ÿ58 wild type DNA was used as the probe (lane 4). The ÿ58 IL-1a mutant probe showed reduced binding compared to the wild type probe (lane 7) and the complexes observed were competed by addition of both wild-type and mutant ÿ58 IL-1a DNA (lanes 8 and 9, respectively). These results suggested that the sequence from ÿ52 to ÿ46 was important for the observed DNAeprotein interactions. To determine if USF was binding to the IL-1a E boxlike element, radiolabeled oligonucleotide probe (ÿ70 to ÿ41) was used in EMSA reactions with extracts from HeLa cells and an anti-USF antibody (a generous gift from Michele Sawadogo) was added. The results from these experiments are shown in Fig. 5c. Anti-USF antibodies included in the EMSA reactions were only able to neutralize the slower migrating complex present when the AdMLP probe was used (lane 3, open arrow with asterisk) and did not affect the migration of the faster migrating complex using either the AdMLP or IL-1a probe (open arrow). Addition of anti-myc antibodies (a generous gift from Gerard I. Evan) shown in lanes 4 and 9 or normal rabbit serum (lanes 5 and 10)

147

did not alter the migration of complexes using either the AdMLP or IL-1a probe. These results show that USF does not bind to this region of the IL-1a gene. An EMSA was then carried out using radiolabeled ÿ52 to C64 IL-1a DNA as the probe with extract prepared from HeLa cells (complexes indicated by the open arrows). In these experiments, an anti-Sp1 antibody was included in the binding reaction. The results shown in Fig. 5d demonstrate that addition of anti-Sp1 antibodies supershifted complexes to slower migrating positions (lane 3, open arrows with asterisks). Antibodies against other transcription factors and control serum were also included in these experiments (anti-USF, lane 4; anti-myc, lane 5; normal rabbit serum, lane 6) but these did not affect the mobility of the complexes. These results suggest that Sp1 binds to the proximal region of the IL-1a promoter and may play a role in the regulation of human IL-1a gene expression. A summary of the results is shown in Fig. 6. The sequence shown spans the region of the IL-1a promoter investigated. The IL-1a/CAT constructs used in transfection experiments is shown and the activity indicated in the brackets. The repressor binding site between ÿ448 and ÿ435, a region between ÿ92 and ÿ77 that was shown to be protected in DNaseI footprinting experiments and the Sp1 binding site between ÿ52 and ÿ45 are indicated by bold boxes. Also shown are an NF-IL-1a binding site, a USF homologous binding site,

Fig. 6. DNA sequence of the IL-1a 5# flanking region. IL-1a deletion constructs are shown with relative activity shown in brackets. The repressor motif (between ÿ448 and ÿ435), a protected region (between ÿ92 and ÿ77) and Sp1 element (between ÿ52 to ÿ45) are indicated by boxes. The TATA-like sequence, NF-IL-1 alpha, USF and AP-1 binding sites are shown underlined. The IL-1a transcriptional start site is indicated by an arrow.

148

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

a TATA-like motif and an AP-1 binding site. The IL-1a transcriptional start site is indicated by an arrow.

3. Discussion In this report, transient transfection experiments using an IL-1a 5# flanking fragment (ÿ967 to C64) cloned upstream of the CAT reporter gene indicated that a negative element may exist within this region. We also showed that PMA stimulation of cells transfected with the IL-1a/CAT deletion library did not result in augmentation of CAT expression. This data would appear to indicate that the inducible element responsible for PMA stimulated IL-1a gene induction is not present in the region encompassed by our promoter constructs. Further, generation of an IL-1a 5# deletion library suggested that the negative element was located around ÿ477 as this was the last promoter construct in the series unable to drive CAT expression. Cloning a 211 bp fragment that contained the putative repressor element upstream of an active IL-1a or heterologous promoter in either the correct or reverse orientation resulted in reduced CAT expression. DNA binding experiments showed that DNA binding protein(s) specifically bound to a radiolabeled IL-1a probe (ÿ544 to ÿ406) and this protein was present in all cell lines tested. Further analysis using DNaseI footprinting demonstrated protection of a 14 bp sequence between ÿ448 and ÿ435. We did not observe any other protected regions within the 211 bp fragment. Further characterization of this element could involve deletion of the putative repressor sequence from the full length IL-1a/CAT reporter construct or by using the 14 bp sequence to repress an active construct. It would also be of interest to determine the identity of this repressor protein. Sequence analysis of this protected region has not revealed homology to any other known transcriptional repressor binding elements. However, it is possible that this repressor is involved in the regulation of other genes. Many cytokine and cytokine receptor genes have been found to contain negative regulatory elements in their 5# flanking regions including GM-CSF [22], IL-1b [23] IL-2 [24,25], IL-2Ra [21], IL-3 [26], IL-4 [27], IL-6 [28,29], IL-8 [30], IL-12 p40 [31], IFNb [32] and murine lymphotoxin (LT, TNFb) [33], emphasizing that the potent inflammatory/immunomodulatory properties of these cytokines requires tightly regulated gene expression. The nuclear protein NF-kB has been described as a pivotal transcription factor in the regulation of genes that are relevant to chronic inflammatory diseases [34]. A repressor of NF-kB activity has been described (NF-kB-repressing factor, NRF) that binds to the negative regulatory element (NRE) in the IL-8 and IFNb promoters. An NRE-related sequence has also been identified in the IL-2Ra promoter. Studies have shown that NRF

actively represses transcription by interacting with NFkB proteins and through DNAeprotein interactions [30,32]. Repression of IL-4 by candidate factor Rep-1, IL-6 by CBF1, p53 and RB, IL-12 p40 by GAP-12 and IL-2 by ZEB demonstrates that there are several different mechanisms for regulating cytokine gene expression. IL-1a promoter deletion constructs ÿ305, ÿ163, ÿ100 and ÿ52 all demonstrated expression in transfection experiments. Interestingly, deletion from ÿ52 to ÿ42 resulted in reduced CAT expression. As the ÿ52 promoter construct was expressed at high levels in HeLa cells despite the absence of the USF binding site, we suggest that the USF site may not play a role in expression of IL-1a in these cells. In support of this finding, anti-USF antibodies failed to supershift DNAprotein complexes containing this putative site. Analysis of the IL-1a sequence from ÿ52 to ÿ42 suggested that this region contained an Sp1 binding site and that this element may be functionally important as deletion led to reduced CAT expression. Further, this region of the promoter is protected in DNaseI footprinting experiments, DNA binding is greatly reduced by mutation of the Sp1 DNA binding site and supershift experiments using specific anti-Sp1 antibody demonstrate that Sp1 binds to the GCCACGCC element present in this region. Furutani [35] generated various IL-1a promoter/CAT fusion constructs and transfected these into COS-7 (monkey kidney), MG-63 (human osteosarcoma) and EC-GI (human esophageal carcinoma) cells. Expression of CAT was observed from constructs containing 875, 421, 103 and 70 bp of the IL-1a 5# flanking sequence. However, deletion to ÿ47 bp resulted in a loss of reporter gene activity. Although we did not observe CAT expression with our ÿ967 construct, expression of CAT from the ÿ421, ÿ103 and ÿ70 constructs reported by Furutani is compatible with our results. The ÿ47 bp IL-1a deletion construct reported by Furutani [35] does not contain the complete Sp1 binding site and in fact contains only the final two cytosine residues in the GCCACGCC binding site providing further evidence for the importance of this site in IL-1a gene regulation. Description of aberrant constitutive IL-1a gene expression in fibroblasts from patients with systemic sclerosis [18] showed very high luciferase expression of a library of constructs from ÿ1437 to ÿ86. Deletion to ÿ82 resulted in a reduced expression. We did not observe CAT expression until deletion to ÿ305 but this is probably due to differences in the cell lines used in transfection experiments. It has been shown that fibroblasts from the lesional skin of patients with systemic sclerosis (SSc) constitutively express IL-1a [36] whereas the HeLa cells used in this study required stimulation with PMA in order induce IL-1a production. Using nuclear extracts prepared from SSc fibroblasts in EMSA experiments it was demonstrated that NF-IL-1a binds to the IL-1a promoter (ÿ96

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

to ÿ82) and that this element is the major cis-acting element for IL-1a expression in fibroblasts from patients with systemic sclerosis. Results from these studies also showed that no specific band for NF-IL-1a was present in normal fibroblasts by EMSA analysis. We observed protection (between ÿ92 and ÿ77) overlapping with the reported NF-IL-1 alpha site (Fig. 4c and Fig. 6). However, our data does not support a major role for this site in IL-1a gene regulation in HeLa cells. Another report analyzed the function of the ÿ258 to C64 region in the IL-1a promoter [16]. This study showed by EMSA analysis that specific protein(s) bound to this region and DNaseI footprinting demonstrated protection between ÿ65 and ÿ41. Further, mutation of residues within this GCC motif resulted in a 90% decrease in basal activity in transfection studies and reduced DNA/protein complex formation as determined by EMSA analysis, however, the element was not further characterized. Proximal elements in either TATA-containing or TATA-less promoters have been shown to be functionally important, and these are not solely found in genes encoding ‘housekeeping’ proteins. One of the DNA elements involved in the regulation of many of these genes, the GC box, binds Sp1 and enhances gene expression. Sp1 is ubiquitously expressed and has often been implicated in the transcription of TATA-less genes. Increasing evidence suggests that Sp1 expression, binding affinity, post-translational modifications such as glycosylation, phosphorylation and multimerization may confer tissue specific and developmental regulation of target genes. Sp1 activity may be modified by interaction with other proteins, competition for DNA binding sites with other transcription factors and methylation of Sp1 binding sites (reviewed in [37e39]). Expression of Sp1 is highly regulated and plays an important role in hematopoietic cell development [40], erythroid specific gene expression [41e43], lymphocyte specific gene expression [44], myeloid specific gene expression [45,46] and regulation of many immunomodulatory cytokines and cell surface proteins such as IL-1b [9], IL-3 receptor alpha [47], IL-6 [48,49], IL-10 [50,51], IL-12p35 [52], GROa [53], CD11b [45], CD14 [46] and MCP-1 [54e56]. Most notable is the requirement for Sp1 for transcription of the IL-1b gene. An uncharacteristic Sp1 element (TCCCCTCCCCT) located between ÿ170 and ÿ131 in the IL-1b promoter was shown to be important for expression of this cytokine in keratinocytes [9]. It was demonstrated by EMSA experiments using a radiolabeled IL-1b probe that an oligonucleotide derived from a homologous promoter segment of the human IL-1a gene was unable to compete with the binding of Sp1 to this probe. Our findings indicate that the Sp1 site in the IL-1a promoter is at least 80 bp further downstream of the oligonucleotide used as a competitor in the reported IL-1b EMSA experiments.

149

In conclusion, we have identified two important DNA regulatory elements within the IL-1a promoter, a repressor binding site from ÿ448 to ÿ435 and an Sp1 binding site between ÿ52 and ÿ45. Further experiments will be required to characterize how these factors interact to coordinate IL-1a gene expression. A greater understanding of the mechanisms of IL-1a gene expression/repression could lead to the development of novel anti-inflammatory therapies.

4. Materials and methods 4.1. Analysis of IL-1a mRNA and protein HeLa cells were maintained in RPMI 1640 (NBL, UK) pH 7.4, buffered with 7.5% (v/v) sodium bicarbonate (NBL, UK) and supplemented with 5% (v/v) fetal calf serum (NBL, UK) heat inactivated at 56  C for 30 min, penicillin (100 IU/ml), streptomycin (100 mg/ml) and glutamine (2 mM) (NBL, UK). All cultures were incubated at 37  C in a humidified 5% CO2/95% air atmosphere. To analyze production of IL-1a, HeLa cells were stimulated with phorbol myristate acetate (PMA 10 ng/ml) or cultured unstimulated for up to 48 h. Cells were harvested at 0, 1, 2, 4, 8, 12, 18, 24, 36 and 48 h and RNA prepared using RNAzol (Biogenesis, UK). Messenger RNA was isolated using the mRNA purification kit from Dynal (Wirral, UK) and cDNA prepared by reverse transcription (Promega, UK). Primers 5#-GTCTCTGAATCAGAAATCCTTCTATC-3# and 5#-CATGTCAAATTTCACTGTTTCATCC-3# were used to amplify a 421 bp fragment from the IL-1a cDNA and separated by polyacrylamide gel electrophoresis. After transferring cDNA to Zetaprobe (Biorad) the identity of the amplified products was confirmed by hybridizing with an IL-1a oligonucleotide 5#-CTTGGATGTTTTAGAGGTTTCAGA-3# end labeled with [g-32P]dATP internal to the amplification primers. Primers amplifying a cell cycle-independent transcript, previously designated 7B6 [57] were used to ensure equal loading of RNA. Supernatants from cultured HeLa cells were stored as extracellular fractions and intracellular fractions were obtained by freeze-thawing three times, samples were then centrifuged at 10,000!g for 5 min to remove cell debris. An IL-1a specific ELISA (Amersham, UK) was used to determine the quantity of IL-1a protein present in each sample. 4.2. Generation of IL-1a/CAT reporter gene constructs Two primers were designed from the published genomic sequence [2] to amplify the IL-1a 5# flanking region from ÿ967 to C64. The region was amplified by PCR using primers 5#-AAGCTTGTTCTACCACCT-

150

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

GAACTAGGC-3# and 5#-CTGCAGTGAGGACAATACCTTTGCTG-3#, producing a 1031 bp fragment. Restriction enzyme sites, HindIII (forward primer) and PstI (reverse primer), were engineered into the 5# ends of primers (underlined). The 1031 bp fragment was digested with HindIII/PstI (Promega, UK) and cloned upstream of the CAT reporter gene in the plasmid pBLCAT3 [58]. A 5# deletion library was then constructed from pBLCAT3 containing the 1031 bp IL-1a 5# flanking region. This construct (85 mg) was linearized using HindIII (Promega, UK) and 2U BAL31 (Gibco BRL, UK) added in a buffer containing 20 mM Trise HCl pH 8.1, 0.65 M NaCl, 10 mM MgCl2, 10 mM CaCl2, 1 mM Na2EDTA and 1 mg/ml heat-denatured calf thymus DNA to successively digest the IL-1a fragment from the 5# end. Aliquots of the digest were obtained at 5 min intervals and terminated by the addition of 3 ml of 0.5 M EGTA, pH 8.0. Samples were extracted with phenol/chloroform and ethanol precipitated. Pellets were resuspended in 15.5 ml of sterile water and digested with 3.8 U mung bean nuclease in 10 mM sodium acetate pH 5.0, 50 mM NaCl, 0.1 mM zinc acetate, 1 mM L-cysteine, 5% (v/v) glycerol and 0.5 mg/ ml calf thymus DNA. These reactions were incubated at 37  C for 1 h followed by extraction with phenol/ chloroform and ethanol precipitation. Samples were resuspended in 8 ml of sterile water and 8 ml (2 mg) of HindIII linkers added onto blunt ends using T4 DNA ligase in a buffer containing 1 mM ATP, 66 mM Trise HCl pH 7.6, 50 mM MgCl2, 50 mM dithiothrietol and 1 mg/ml bovine serum albumin. Following incubation at 16  C for 16 h, samples were incubated at 70  C for 15 min to heat inactivate ligase. After cooling on ice, DNA samples were digested using HindIII/PstI (Promega, UK) for 4 h at 37  C. Samples were electrophoresed on a 1% (w/v) agarose gel and the observed fragments isolated on DEAE paper and subsequently cloned into HindIII/PstI digested pBLCAT3. All constructs were sequenced to confirm identity. 4.3. Transfection and CAT assays The mammalian cells used in various experiments were obtained from the American Type Culture Collection, Bethesda, MD, USA. HeLa cells were transfected with 10 mg plasmid DNA using calcium phosphate DNA precipitation (Promega, UK). The day before transfection, cells were harvested by trypsinization and 2!105 cells were cultured overnight in 6-well plates in 2 ml complete RPMI 1640. The cells (70% confluent) were overlaid with 4.5 ml of fresh media 3 h prior to transfection. Cells were incubated with the precipitate for 4 h, washed with saline, overlaid with 5ml media and cultured for 24 h as described. Cells were harvested by overlaying with saline/1 mM Na2EDTA and scraped with a rubber policeman. Cells were

collected by brief centrifugation at 10; 000!g and resuspended in 100 ml 250 mM TriseHCl, pH 8.0. Lysates were obtained by freeze/thawing three times at ÿ70  C/37  C and stored at ÿ70  C until assayed for CAT protein. An ELISA was used to measure CAT levels (Roche Applied Science) and was performed according to the manufacturers instructions. To determine if CAT plasmids were transfected with similar efficiencies, lysates from transfected cells were transferred to Zetaprobe membrane and hybridized with a 32 P-labeled CAT cDNA probe [59]. An autoradiogram was obtained by exposing hyperfilm-MP for 24 h at ÿ70  C using intensifying screens. The membrane and autoradiogram were then aligned and the pieces of membrane containing the signal were excised and counted in a b-counter. The counts for each sample were then calculated and CAT protein levels adjusted for efficiency of transfection into the cells. 4.4. Electrophoretic mobility shift assays (EMSA) Cell extracts were prepared following a modified Dignam method [60] and the IL-1a DNA fragments of interest were end labeled with [a-32P]dCTP or [g-32P]dATP using Klenow (Promega, UK) or T4 polynucleotide kinase (Promega, UK), respectively. Cell extracts (10 mg) were incubated with an optimized concentration of poly(dI.dC).poly(dI.dC) (65e130 mg/ml; Pharmacia, UK) in 30 ml binding buffer (10 mM Trise HCl pH 7.5, 50 mM KCl, 5 mM MgCl2, 1 mM dithiothrietol, 1 mM Na2EDTA, 12.5% (v/v) glycerol and 0.1% (v/v) Triton X-100) for 30 min at room temperature. End labeled DNA (5 ng) was added and incubated for a further 30 min at room temperature. Cold competition experiments were performed using an excess of unlabeled probe or unrelated DNA. In supershifting experiments, antibodies were added following the addition of the labeled DNA and the reaction was incubated for 30 min at room temperature. Free probe and complexes were separated by electrophoresis using a 4.5% polyacrylamide gel in a buffer containing 6.7 mM TriseHCl pH 7.5, 3.3 mM sodium acetate and 1 mM EDTA at 100 V until the free probe had migrated to the bottom of the gel. Gels were prerun for 2 h at 100 V and the buffer recirculated between the compartments every 30 min. Autoradiographs were obtained by exposing Hyperfilm-MP (Amersham, UK) at ÿ70  C using intensifying screens. 4.5. DNase I Footprinting The sequences recognized by DNA binding proteins were determined using DNaseI footprinting. HeLa cell extract (0, 10, 20 and 40 mg) was incubated with optimal concentrations of poly(dI.dC).poly(dI.dC) (10e20 mg/ml; Pharmacia, UK) in 100 ml of binding buffer (10 mM

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

TriseHCl pH 7.5, 50 mM KCl, 5 mM MgCl2, 1 mM dithiothrietol, 0.1 mM EDTA, 12.5% (v/v) glycerol and 0.1% (v/v) Triton X-100) for 30 min at room temperature. End labeled probe (10 ng) was added and incubated for a further 30 min at room temperature. The concentration of CaCl2 was adjusted to 1 mM and 0.4 U DNaseI (Promega, UK) added. After incubation at room temperature for 1 min, 100 ml stop solution (100 mM TriseHCl pH 7.6, 0.375% (w/v) SDS, 15 mM EDTA, 100 mM NaCl), yeast tRNA to 50 mg/ml and proteinase K to 100 mg/ml were added to the reaction. After incubating at 37  C for 15 minutes and 90  C for 2 min, samples were phenol/chloroform extracted, ethanol precipitated and analyzed in an 8% polyacrylamide/7 M urea sequencing gel. The gel was washed, dried and subjected to autoradiography using b-max film (Amersham, UK). MaxameGilbert ladders of labeled probes were prepared following standard procedures [61]. 4.6. In vitro transcription The transcriptional activity of the IL-1a 5# deletion promoter constructs was assessed using a HeLa nuclear in vitro transcription system (Promega, UK). Before adding IL-1a promoter constructs to the reactions, the plasmids were linearized using NcoI. Each reaction contained 500 ng of plasmid template, 3 ml MgCl2 (6 mM final), 1 ml rNTP mix (0.4 mM ATP, 0.4 mM TTP, 0.4 mM GTP and 0.016 mM CTP, final) 1 ml [a-32P]CTP (3000 Ci/mmol; Amersham, UK), 15 ng CMV positive control DNA and 8 units of nuclear extract in a volume of 25 ml. This reaction was incubated at 30  C for 1 h. After this time 175 ml stop mix (provided in the kit) was added and the samples were extracted with phenol/chloroform/isoamyl alcohol (25:24:1). The aqueous phase was removed and transcripts precipitated by addition of 500 ml of 100% ethanol and storage in liquid nitrogen for 10 min. The samples were centrifuged at 10; 000!g for 20 min, pellets dried and resuspended in 10 ml of nuclease free water, an equal volume of loading dye added and finally, heated to 90  C for 10 min prior to loading into a denaturing polyacrylamide gel containing 8% (w/v) acrylamide, 7 M urea and 1! TBE. The gel was prerun at 200 V for 30 min before loading samples. The gel was washed, dried and an autoradiogram was obtained by exposing Hyperfilm-MP for 4 days at ÿ70  C using intensifying screens. Acknowledgements This work was supported by funding from the Arthritis and Rheumatism Council, Fisons Pharmaceuticals and the Medical Research Council (Fellowship to JAS). We thank Andrea di Napoli for help in preparation of the manuscript.

151

References [1] Dinarello CA. Proinflammatory cytokines. Chest 2000;118:503e8. [2] Furutani Y, Notake M, Fukui T, Ohue M, Nomura H, Yamada M, et al. Complete nucleotide sequence of the gene for human interleukin 1 alpha. Nucleic Acids Res 1986;14:3167e79. [3] Clark BD, Collins KL, Gandy MS, Webb AC, Auron PE. Genomic sequence for human prointerleukin 1 beta: possible evolution from a reverse transcribed prointerleukin 1 alpha gene. Nucleic Acids Res 1986;14:7897e914. [4] Bensi G, Raugei G, Palla E, Carinci V, Buonamassa DT, Melli M. Human interleukin-1 beta gene. Gene 1987;52:95e101. [5] Telford JL, Macchia G, Massone A, Carinci V, Palla E, Melli M. The murine interleukin 1a gene: structure and evolution. Nucleic Acids Res 1986;14:9955e63. [6] Modi WS, Masuda A, Yamada M, Oppenheim JJ, Matsushima K, O’Brien SJ. Chromosomal localization of the human interleukin 1 alpha (IL-1 alpha) gene. Genomics 1988;2: 310e4. [7] Lafage M, Maroc N, Dubreuil P, de Waal Malefijt R, Pebusque MJ, Carcassonne Y, et al. The human interleukin-1a gene is located on the long arm of chromosome 2 at band q13. Blood 1989;73:104e7. [8] Webb AC, Collins KL, Auron PE, Eddy RL, Nakai H, Byers MG, et al. Interleukin 1 gene (IL-1) assigned to long arm of human chromosome 2. Lymphokine Res 1986;5:77e85. [9] Husmann M, Jehnichen P, Jahn B, Schlosshan D, Romahn E, Marx J. A novel SP1 site in the human interleukin-1a promoter confers preferential transcriptional activity in keratinocytes. Eur J Immunol 1996;26:3008e14. [10] Yang Z, Wara-aswapati N, Yoshida Y, Walker N, Galson DL, Listman J, et al. Dual regulatory role of human cytomegalovirus immediate-early protein in IL1B transcription is dependent upon Spi-1/PU.1. Biochem Biophys Res Commun 2002;294: 854e63. [11] Tsukada J, Saito K, Waterman WR, Webb AC, Auron PE. Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1 beta gene. Mol Cell Biol 1994;14:7285e97. [12] Monks BG, Martell BA, Buras JA, Fenton MJ. An upstream protein interacts with a distinct protein that binds to the cap site of the human interleukin 1a gene. Mol Immunol 1994;31:139e51. [13] Tsukada J, Waterman WR, Koyama Y, Webb AC, Auron PE. A novel STAT-like factor mediates lipopolysaccharide, interleukin 1 (IL-1) and IL-6 signaling and recognizes a gamma interferon activation site-like element in the IL1B gene. Mol Cell Biol 1996;16:2183e94. [14] Alheim K, McDowell TL, Symons JA, Duff GW, Bartfai T. An AP-1 site is involved in the NGF induction of IL-1a in PC12 cells. Neurochem Int 1996;29:487e96. [15] Bailly S, Fay M, Israel N, Gougerot-Pocidalo MA. The transcription factor AP-1 binds to the human interleukin 1 alpha promoter. Eur Cytokine Netw 1996;7:125e8. [16] Zaldivar F, Nugent DJ, Imfeld K, Berman MA. Identification of a novel regulatory element in the human interleukin 1 alpha (IL-1a) gene promoter. Cytokine 2002;20:130e5. [17] Mori N, Prager D. Transactivation of the interleukin-1a promoter by human T-cell leukemia virus type I and type II Tax proteins. Blood 1996;87:3410e7. [18] Kawaguchi Y, Hara M, Kamatani N, Wright TM. Identification of an IL1A gene segment that determines aberrant constitutive expression of Interleukin-1a in systemic sclerosis. Arthritis Rheum 2003;48:193e202. [19] Swick AG, Lane MD. Identification of a transcriptional repressor down-regulated during preadipocyte differentiation. Proc Natl Acad Sci USA 1992;89:7895e9.

152

T.L. McDowell et al. / Cytokine 30 (2005) 141e153

[20] Borghaei RC, Sullivan C Mochan E. Identification of a cytokineinduced repressor of interleukin-1 stimulated expression of stromelysin 1 (MMP-3). J Biol Chem 1999;274:2126e31. [21] Smith MR, Greene WC. The same 50-kDa cellular protein binds to the negative regulatory elements of the interleukin 2 receptor alpha-chain gene and the human immunodeficiency virus type I long terminal repeat. Proc Natl Acad Sci USA 1989;86:8526e30. [22] Fraser JK, Guerra JJ, Nguyen CY, Indes JE, Gasson JC, Nimer SD. Characterization of a cell-type-restricted negative regulatory activity of the human granulocyte-macrophage colonystimulating factor gene. Mol Cell Biol 1994;14:2213e21. [23] Lebedeva TV, Singh AK. Constitutive activity of the murine IL-1 beta promoter is regulated by a transcriptional repressor. Biochim Biophys Acta 1997;1353:32e8. [24] Williams TM, Moolten D, Burlein J, Romano J, Bhaerman R, Godillot A, et al. Identification of a zinc finger protein that inhibits IL-2 gene expression. Science 1991;254:1791e4. [25] Yasui DH, Genetta T, Kadesch T, Williams TM, Swain SL, Tsui LV, et al. Transcriptional repression of the IL-2 gene in Th cells by ZEB. J Immunol 1998;160:4433e40. [26] Mathey-Prevot B, Andrews NC, Murphy HS, Kreissman SG, Nathan DG. Positive and negative elements regulate human interleukin 3 expression. Proc Natl Acad Sci USA 1990;87:5046e50. [27] Georas S, Cumberland J, Burke T, Park E, Ono S, Casolaro V. Characterization of a novel negative regulatory element in the human interleukin 4 promoter. Leukemia 2000;14:629e35. [28] Santhanam U, Ray A, Sehgal PB. Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product. Proc Natl Acad Sci USA 1991;88:7605e9. [29] Kannabiran C, Zeng X, Vales LD. The mammalian transcriptional repressor RBP (CBF1) regulates interleukin-6 gene expression. Mol Cell Biol 1997;17:1e9. [30] Nourbakhsh M, Kalble S, Dorrie A, Hauser H, Resch K, Kracht M. The NF-kB repressing factor is involved in basal repression and interleukin (IL)-1-induced activation of IL-8 transcription by binding to a conserved NF-kB-flanking sequence element. J Biol Chem 2001;276:4501e8. [31] Becker C, Wirtz S, Ma X, Blessing M, Galle PR, Neurath MF. Regulation of IL-12 p40 promoter activity in primary human monocytes: roles of NF-kB, CCAAT/enhancer-binding protein b, and PU.1 and identification of a novel repressor element (GA-12) that responds to IL-4 and prostaglandin E2. J Immunol 2001;167:2608e18. [32] Nourbakhsh M, Hauser H. Constitutive silencing of IFN-beta promoter is mediated by NRF (NF-kappaB-repressing factor), a nuclear inhibitor of NF-kappaB. EMBO J 1999;18:6415e25. [33] Fashena SJ, Tang WL, Sarr T, Ruddle NH. The murine lymphotoxin gene promoter. Characterization and negative regulation. J Immunol 1990;145:177e83. [34] Barnes PJ, Karin M. Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 1997;336:1066e71. [35] Furutani Y. Molecular studies on interleukin 1a. Eur Cytokine Netw 1994;5:533e8. [36] Kawaguchi Y. IL-1a gene expression and protein production by fibroblasts from patients with systemic sclerosis. Clin Exp Immunol 1994;97:445e50. [37] Suske G. The Sp-family of transcription factors. Gene 1999; 238:291e300. [38] Bouwman P, Philipsen S. Regulation of the activity of Sp1-related transcription factors. Mol Cell Endocrinol 2002;195:27e38. [39] Black AR, Black JD, Azizkhan-Clifford J. Sp1 and Kruppel-like factor family of transcription factors in cell growth regulation and cancer. J Cell Physiol 2001;188:143e60. [40] Saffer JD, Jackson SP, Annarella MB. Developmental expression of Sp1 in the mouse. Mol Cell Biol 1991;11:2189e99. [41] Yu CY, Motamed K, Chen J, Bailey AD, Shen CK. The CACC box upstream of the human embryonic 3 globin gene binds Sp1

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

[58]

[59]

and is a functional promoter in vitro and in vivo. J Biol Chem 1991;266:8907e15. Gumucio DL, Rood KL, Blanchard-McQuate KL, Gray TA, Saulino A, Collins FS. Interaction of Sp1 with the human g globin promoter: binding and transactivation of normal and mutant promoters. Blood 1991;78:1853e63. Jane SM, Gumucio DL, Ney PA, Cunningham JM, Nienhuis AW. Methylatyion-enhanced binding of Sp1 to the stage selector element of the human g-globin gene promoter may regulate developmental specificity of expression. Mol Cell Biol 1993;13:3272e81. Spanopoulou E, Giguere V, Grosveld F. The functional domains of the murine Thy-1 gene promoter. Mol Cell Biol 1991;11: 2216e28. Chen HM, Pahl HL, Scheibe RJ, Zhang DE, Tenen DG. The Sp1 transcription factor binds the CD11b promoter specifically in myeloid cells in vivo and is essential for myeloid-specific promoter activity. J Biol Chem 1993;268:8230e9. Zhang DE, Hetherington CJ, Tan S, Dziennis SE, Gonzalez DA, Chen HM, et al. Sp1 is a critical factor for the monocytic specific expression of human CD14. J Biol Chem 1994;269:11425e34. Akagawa E, Muto A, Arai K, Watanabe S. Analysis of the 5# promoters for human IL-3 and GM-CSF receptor alpha genes. Biochem Biophys Res Commun 2003;300:600e8. Kang SH, Brown DA, Kitajima I, Xu X, Heidenreich O, Gryaznov S, et al. Binding and functional effects of transcription factor Sp1 on the murine interleukin 6 promoter. J Biol Chem 1996;271:7330e5. Sanceau J, Kaisho T, Hirano T, Wietzerbin J. Triggering of the human interleukin-6 gene by interferon-g and tumor necrosis factor-a in monocytic cells involves cooperation between interferon regulatory factor 1, NF-kB and Sp1 transcription factors. J Biol Chem 1995;270:27920e31. Tone M, Powell MJ, Tone Y, Thompson SA, Waldmann H. IL-10 gene expression is controlled by the transcription factors Sp1 and Sp3. J Immunol 2000;165:286e91. Brightbill HD, Plevy SE, Modlin RL, Smale ST. A prominent role for Sp1 during lipopolysaccharide-mediated induction of the IL-10 promoter in macrophages. J Immunol 2000;164:1940e51. Goriely S, Demonte D, Nizet S, De Wit D, Willems F, Goldman M, et al. Human IL-12(p35) gene activation involves selective remodeling of a single nucleosome within a region of the promoter containing critical Sp1 binding sites. Blood 2003;101:4894e902. Wood LD, Farmer AA, Richmond A. HMGI(Y) and Sp1 in addition to NF-kappa B regulate transcription of the MSGA/ GRO alpha gene. Nucleic Acids Res 1995;23:4210e9. Ueda A, Okuda K, Ohno S, Shirai A, Igarashi T, Matsunaga K, et al. NF-kappa B and Sp1 regulate transcription of the human monocyte chemoattractant protein-1 gene. J Immunol 1994;153: 2052e63. Ping D, Boekhoudt G, Zhang F, Morris A, Philipsen S, Warren ST, et al. Sp1 binding is critical for promoter assembly and activation of the MCP-1 gene by tumour necrosis factor. J Biol Chem 2000;275:1708e14. Boekhoudt GH, Guo Z, Beresford GW, Boss JM. Communication between NF-kappaB and Sp1 controls histone acetylation within the proximal promoter of monocyte chemoattractant protein 1 gene. J Immunol 2003;170:4139e47. Francis SE, Duff GW. 7B6, a ubiquitous mRNA: with significant homology to L41 human ribosomal protein RNA. Nucleic Acids Res 1993;21:2944. Luckow B, Schutz G. CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res 1987;15:5490. Abken H, Reifenrath B. A procedure to standardize CAT reporter gene assay. Nucleic Acids Res 1992;20:3527.

T.L. McDowell et al. / Cytokine 30 (2005) 141e153 [60] Andrews NC, Faller DV. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 1991;19: 2499.

153

[61] Sambrook J, Russel DW. Protocol 7 d Chemical sequencing. In: Sambrook J, Russel DW, editors. Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001. p. 12.61e12.73.