Human myoblast transplantation in mice infarcted heart alters the expression profile of cardiac genes associated with left ventricle remodeling

International Journal of Cardiology 202 (2016) 710–721

Contents lists available at ScienceDirect

International Journal of Cardiology journal homepage: www.elsevier.com/locate/ijcard

Human myoblast transplantation in mice infarcted heart alters the expression profile of cardiac genes associated with left ventricle remodeling B. Wiernicki 1, N. Rozwadowska 1, A. Malcher, T. Kolanowski, A. Zimna, A. Rugowska, M. Kurpisz ⁎ Department of Reproductive Biology and Stem Cells, Institute of Human Genetics, Polish Academy of Sciences, Poznan, Poland

a r t i c l e

i n f o

Article history: Received 31 March 2015 Received in revised form 24 September 2015 Accepted 27 September 2015 Available online xxxx Keywords: Heart regeneration Heart remodeling Human myoblasts

a b s t r a c t Background: Myocardial infarction (MI) and left ventricle remodeling (LVR) are two of the most challenging disease entities in developed societies. Since conventional treatment cannot fully restore heart function new approaches were attempted to develop new strategies and technologies that could be used for myocardial regeneration. One of these strategies pursued was a cell therapy — particularly applying skeletal muscle stem cells (SkMCs). Methods and results: Using NOD-SCID murine model of MI and human skeletal myoblast transplantation we were able to show that SkMC administration significantly affected gene expression profile (p b 0.05) (NPPB, CTGF, GATA4, SERCA2a, PLB) of the heart ventricular tissue and this change was beneficial for the heart function. We have also shown, that the level of heart biomarker, NT-proBNP, decreased in animals receiving implanted cells and that the NT-proBNP level negatively correlated with left ventricle area fraction change (LVFAC) index which makes NT-proBNP an attractive tool in assessing the efficacy of cell therapy both in the animal model and prospectively in clinical trials. Conclusions: The results obtained suggest that transplanted SkMCs exerted beneficial effect on heart regeneration and were able to inhibit LVR which was confirmed on the molecular level, giving hope for new ways of monitoring novel cellular therapies for MI. © 2015 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Myocardial infarction (MI) is one of the most common causes of death in developed countries. It has been assessed that ~15% of all patients in the United States diagnosed with MI dies and that MI shortens a patient's life by approximately 16.6 years [1]. The main cause of MI is a coronary artery occlusion due to atherosclerotic plaque rupture followed by cardiomyocyte death and activation of the immune response to heart injury. As a result, rigid and incapable of contraction a fibrous scar is formed, which can lead to progressive left ventricular dilatation, deficiency in systolic heart function, arrhythmia, hypertrophy of preserved cardiomyocytes, and fibrosis. This process is known as left ventricular remodeling and is controlled by activation of a specific gene expression pattern known as a fetal gene profile as it resembles gene expression in developing hearts [2]. Although mainly present after MI, heart remodeling may also occur as a result of other disorders i.e. hypertension, myocarditis, cardiomyopathy and others [3]. ⁎ Corresponding author at: Institute of Human Genetics, Pol. Acad. Sci., Department of Reproductive Biology and Stem Cells, Strzeszynska 32, 60-479 Poznan, Poland. E-mail address: [email protected] (M. Kurpisz). 1 Contributed equally to this study.

http://dx.doi.org/10.1016/j.ijcard.2015.09.115 0167-5273/© 2015 Elsevier Ireland Ltd. All rights reserved.

The recommended approach to treat patients with MI involves pharmacological and non-pharmacological (i.e. revascularization and other surgical approaches) therapies [4]. These therapies have been proven to be effective as they significantly reduced short-term [5] and longterm [6] mortality among patients with MI, however the usefulness of these methods is strongly dependent on time of admission. Moreover, these therapies have limited value as they reduce scar size only to a certain extent and do not inhibit left ventricle remodeling. Therefore, development of new efficacious therapies has become a public demand in recent years. One of the considered strategies is application of unipotent human skeletal muscle stem cells (SkMCs) in autologous transplantations into the infarcted heart. SkMC-based cell therapy has many advantages: relatively easy cell isolation and in vitro culture, ability to differentiate into contractile cells as well as a high survival rate under hypoxic conditions [7]. Furthermore, since SkMCs are patientderived, there is no moral dilemma or immunological issues to be considered. The biggest concerns regarding using SkMCs in therapeutic ways come from the fact that once differentiated, they do not express gap junction proteins which can potentially induce arrhythmias in patients receiving the cells [8]. This, however, was not proven during the first randomized, placebo-controlled, double-blind study [9] and long-term follow up of the patients receiving SkMCs after MI [10].

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

711

Fig. 1. Experimental design. Two separate sets of mice were used for NT-proBNP level and gene expression analysis. The experimental groups are described in detail in the text.

Although using SkMCs as a cell therapy for myocardial infarction has been documented to be effective in both human [11–13] and animal models of MI [14–16], the mechanism of this improvement is still unclear. Most results suggest that the beneficial effect of cell injection is the consequence of left ventricle remodeling attenuation, particularly by reducing left ventricle dilation [17] and infarct size [18]. It is however, uncertain whether it is due to the releasing of paracrine factors or improvement of heart muscle contractility and strengthening, or a combination of both. Since left ventricular remodeling often correlates with heart failure, clinicians apply a variety of prognostic tests including biomarker analysis. One of the standard biomarkers for a failing heart is measurement of plasma NT-proBNP level. This 76 amino acid protein is the N-terminal part of natriuretic peptide B (BNP) which is secreted in both atria and ventricles in response to volume overload [19]. NT-proBNP has been previously described [20–23], and it is well established that NT-proBNP level correlates with left ventricular remodeling within two years after myocardial infarction [24] and with left ventricle fractional area change (LVFAC) among patients with heart failure (HF) [25]. The key role of BNP is lowering blood pressure, which is achieved by vascular smooth muscle relaxation and increased excretion of water. BNP is also known

as an anti-fibrotic and anti-hypertrophic factor [26] and has an active role in inhibiting inflammatory response after MI [27]. In our study, we performed gene expression analysis of selected genes associated with left ventricle remodeling. The genes were selected based on available data concerning the biological role of their products. We focused on three aspects of left ventricle remodeling: hemodynamic overload (GATA4, BNP), calcium transport significant for the appropriate contraction of the heart muscle (SERCA2a, PLB) and fibrosis occurring heavily after MI injury (TGF-ß, CTGF). Since myoblast transplantation might carry a risk of inducing arrhythmias due to the lack of proper gap junction formations [17], we also evaluated connexin expression 43 (Cx43). GATA4 is a transcriptional factor responsible for NPPB gene expression and is expressed during hemodynamic overload. ATPase, Ca2 + transporting, cardiac muscle, slow twitch 2 (SERCA2a) protein is a calcium channel and its expression has been proven to be altered after myocardial infarction and correlates negatively with NPPB gene expression [28]. The channel's activity is regulated by phospholamban (PLB) — small protein that binds to SERCA2a and decreases its affinity to calcium [29]. Connective tissue growth factor (CTGF) belongs to the CCN protein family responsible for heart muscle fibrosis [30].

Table 1 Set of primers used for PCR reactions of genes under study.

qPCR

PCR

Gene

Forward primer

Reverse primer

Product size

NPPB CTGF GATA4 SERCA2a PLB TGF-ß3 Cx43 HPRT TPT1 AR2 MYF5 ß-act

5′-ATGGATCTCCTGAAGGTGCTG-3′ 5′- CAGCGGTGAGTCCTTCCAAA-3′ 5′-AACCAGAAAACGGAAGCCCA-3′ 5′- AGTCTTTGCTGAGGATGCCC-3′ 5′-TACCTCACTCGCTCGGCT-3′ 5′-ATGACCCACGTCCCCTATCA-3′ 5′-CTTACCACGCCACCACC-3′ 5′-ACAGGCCAGACTTTGTTGGAT-3′ 5′-GGCAAACTTGAAGAGCAGAAACC-3′ 5′-GCCTGCAGGTTAATGCTGAAGACCT-3′ 5′-CCTGTCTGGTCCCGAAAGAA-3′ 5′-GGCTGTATTCCCCTCCATCG-3′

5′-GTGCTGCCTTGAGACCGAA-3′ 5′- TCTTCCAGTCGGTAGGCAGC -3′ 5′- AGTACTGAATGTCTGGGACATGG-3′ 5′- ACTCCAGTATTGCGGGTTGT-3′ 5′-CGGTGCGTTGCTTCCC-3′ 5′-CAGACGGCCAGTTCATTGTG-3′ 5′-ATTCGCCCAGTTTTGCTC-3′ 5′-TGCAGATTCAACTTGCGCTC-3′ 5′-TCACGGTAGTCCAGGAGAGCAA-3′ 5′-TCCTGGGCCCTGAAAGGTTAGTGT-3′ 5′-GACGTGATCCGATCCACAAT-3′ 5′-CCAGTTGGTAACAATGCCAT-3′

242 225 217 240 225 185 200 160 158 326 566 192

Primers and product sizes of genes used in gene expression analysis, cell survival, and verification of DNA isolation and reverse transcriptase reaction. NPPB—natriuretic peptide B; CTGF—connective tissue growth factor; SERCA2a—ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2; PLB—phospholamban; TGF-ß3—tumor growth factor ß3; Cx43—connexin 43; HPRT—hypoxanthine guanine phosphoribosyl transferase; TPT1—tumor protein, translationally-controlled 1; AR2—androgen receptor, exon 2; MYF5—myogenic factor 5; ß-actin—beta actin.

712

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

Fig. 2. Flow cytometry analysis. Cells were stained with antibody specific for CD56 (A). Negative control—cells incubated with PBS and 2% FBS (fetal bovine serum) (B).

Transforming growth factor ß3 (TGF-ß3) is a pleiotropic cytokine, which plays a role in inflammatory response inhibition and fibrosis modulation during heart infraction and subsequent myocardial scar formation [31] while connexin 43 is responsible for gap junction formation and proper electrophysiological conductivity. All of these gene products have been described before and it is generally accepted that they demonstrate a crucial role in modulating heart response after MI. The aim of this study was to examine the impact of SkMC cell therapy on the infarcted heart of NOD-SCID mice in terms of plasma NTproBNP levels and gene expression associated with left ventricular remodeling. 2. Materials and methods The Local Ethical Committee of the Medical University of Poznan approved the protocol for human tissue collection that was used for transplantation and The Local Ethical Committee for Animal Research in Poznan approved the protocol for experiments performed in mice model. 2.1. In vitro cell culture SkMCs were obtained from the patient in consequence of cruciate ligament reconstruction procedure. Cells were cultured in standard Dulbecco's modified Eagle's medium with 4.5 g/l of glucose, supplemented with 20% bovine fetal serum (Lonza, Switzerland), 1% antibiotics, 1% Ultraglutamine and bFGF (Sigma-Aldrich,USA) as previously described [32]. Cells were maintained in vitro in standard cell culture environment (95% humidity, 5% CO2 at 37 °C). The medium was changed every 48 h and to avoid spontaneous myotube formation cells were passaged when they reached 70% confluence using 0.25% trypsin (Lonza, Switzerland). Before transplantation, the cells were harvested and suspended in DMEM medium without phenol red (Lonza, Switzerland) and enriched in 2% BSA (Sigma-Aldrich,USA). Final concentration of the cells was 106/100 μl of DMEM. 2.2. Flow cytometry evaluation The myoblast population was evaluated with flow cytometry using CD56 antibodyPC5 conjugate (Beckman Coulter, Brea, USA). Briefly, 2.5 × 105 cells were harvested, centrifuged and suspended in 100 μl PBS with 2% FBS and 10 μl of antibodies (1:200 dilution).

After 20-minute incubation, the cells were centrifuged, resuspended in PBS with 2%FBS and analyzed with Cell Lab Quanta flow cytometer (Beckman Coulter, Brea, USA). 2.3. Immunocytochemistry Immunocytochemical staining was performed with antibody specific for desmin, which is a marker for smooth, skeletal and heart muscle. The cells were fixed in 4% paraformaldehyde in PBS. After three-time wash with PBS, the cells were incubated for 15 min with 0.1% Triton X-100 in PBS to permeabilize the cell membranes. Next, the cells were incubated with 3% H2O2 to deactivate endogenous peroxidase for 10 min and – after washing with PBS – with 1% murine serum in PBS, to block unspecific epitopes for another 10 min. Subsequently, the cells were incubated overnight in 4 °C with murine antibody for human desmin (Sigma Aldrich, USA). The secondary antibody conjugated with peroxidase (Sigma Aldrich, USA) was used the next day, and the incubation lasted for 1 h. After three-time wash with PBS, AEC solution (Sigma-Aldrich, USA) was added as a substrate for peroxidase. To visualize the cell nuclei hematoxylin was applied and red stains confirming the presence of desmin were observed under microscope after 5-minute incubation with staining solution. 2.4. Animal model The experiments were performed on non-obese diabetic/severe combined immunodeficiency (NOD-SCID) mice. This strain provides limited adaptive immunity and a low number of NK cells, which do not reject xenografts. 2.5. Experimental design The experiments with NT-proBNP levels involved six animals. The blood was collected seven days prior to MI induction and then 5 and 21 days after left coronary artery ligation. A day before cell transplantation (27th day), the echocardiographic (ECG) examination was performed. To evaluate the effect of transplanted cells on NT-proBNP level, we randomly divided the animals into two groups and 28 days after MI induction, we have injected myoblast cell suspension (n = 3) or 0.9% NaCl solution (n = 3) into the heart muscle. The NT-proBNP level was assessed 33 days after MI and 5 days after cell/saline intervention. On the 56th day, we again performed an ECG examination. To evaluate the effect of MI and SkMC intervention on gene expression we used overall 30 animals divided into 6 groups: Control group (healthy animals; n = 4), MI + 21 group (animals 21 days after MI induction; n = 5), MI + 33 (Mb) (animals 33 days after MI induction receiving myoblast suspension; n = 6), MI + 33 (0.9% NaCl) (animals 33 days after MI induction receiving physiological saline; n = 6), MI + 70 (Mb) (animals 70 days after MI induction receiving myoblast suspension; n = 4), MI + 70 (0.9% NaCl)

Fig. 3. Immunocytochemical analysis of cell population. Cells stained with antibody specific for desmin (A). Negative control—cells incubated with PBS only (B).

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

713

Fig. 4. Results of PCR reactions confirmed the presence of human DNA in left ventricles isolated from mouse heart. The reaction was performed using primers specific for exon 2 of androgen receptor. The PCR protocol for gene amplification was performed as described in Materials and methods. A 2% agarose gel was used. Positive control (PC)-human cDNA as a template for reaction and lack of the band in negative control (NC) confirmed the presence of human DNA in the heart muscle.

(animals 70 days after MI induction receiving physiological saline; n = 5). Similarly to the NT-proBNP level experiment, the cell intervention took place 28 days after MI. The experimental design is shown in Fig. 1.

heparin to prevent coagulation. Within 30 min, the blood was centrifuged (10 min, 5000 rpm) and plasma was isolated and stored in −80 °C until further analysis. 2.7. Heart infarction induction

2.6. Blood collection Blood samples for NT-proBNP analysis were collected from the tail vein. A small piece of the tail was cut off and droplets of blood were collected into a glass capillary coated with

Myocardial infarction was performed on NOD-SCID mice purchased from the Jackson Laboratory USA as previously described [17]. There were no significant differences in terms of weight among animals (Supplementary Table 1). Briefly, mice were anesthetized

Fig. 5. Heart remodeling at 70 days after myocardial infarction. A. Heart isolated from healthy animal. Normal shape and wall thickness of left ventricle. B. Visible collagen deposition, formation of loose, fibrous scar (marked by arrows) and left ventricle wall thinning 70 days after MI induction.

714

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

with 2% isoflurane. After opening the thorax through the fourth intercostal space, left coronary artery ligation was performed. After the muscle and skin suture, the animals were allowed to breath a mixture of air and oxygen until recovery. 2.8. Cell transplantation Cell or 0.9% NaCl administrations were performed 28 days after the heart infarction procedure. The myoblasts were transplanted in three, 10 μl each, injections into the border zone of the myocardial scar. The final number of transplanted cells to the heart was 3 × 105. 2.9. Echocardiography The animals were anesthetized by intraperitoneal administration of xylazine/ ketamine. Long and short axis measurements of left ventricle area, in both systole and diastole, were performed using GE Vivid 7 high-resolution ultrasound scanner equipped with a M12L linear transducer (GE Healthcare, USA). The measurements were used to calculate left ventricle fractional area change (LVFAC) in order to monitor left ventricle remodeling. Calculations were performed using the formula below:

LVFAC ð%Þ ¼ 100  ðLV area d−LV area sÞ=ðLV area dÞ:

LVFAC left ventricle fractional area change LV area d left ventricle area in diastole LV area s left ventricle area in systole 2.10. Heart tissue collection The mice were terminated at specific time points described in the experimental design by cervical dislocation. The isolated hearts were washed three times in 0.9% NaCl solution. Next, left ventricles were isolated, photographed and stored in RNALater (Ambion, USA) solution in −80 °C.

2.12. RNA and DNA isolation After collection, left ventricle tissue was cut into ~1 mm3 pieces, put in 1 ml of TRI Reagent (Sigma-Aldrich, USA) and homogenized (Homogenizer Workcenter T10 Basic ULTRA-TURRAX®, Germany). Afterwards, a standard protocol for RNA and DNA isolation was used provided by the manufacturer. Isolated total RNA was further purified with Oligo(dT)25 (Invitrogen, USA) in order to obtain mRNA fraction. SuperScript III (Invitrogen, USA) was then used in reverse transcriptase reaction where mRNA was transcribed to cDNA. The outcome of cDNA synthesis was evaluated by regular PCR reaction with primers for ß-actin gene. The quality of isolated DNA was ensured by PCR reaction with primers specific for murine myogenic factor 5 (MYF5). 2.13. Human DNA detection To confirm the presence of transplanted cells in mouse myocardium, we used regular PCR reaction using primers specific for exon 2 of human androgen receptor gene (AR2). These primers do not provide PCR product in murine DNA. Afterwards, we performed standard gel electrophoresis for PCR product. The PCR reactions were performed using PTC-200 Thermocycler (MJ Research, USA). 2.14. qRT-PCR analysis Relative expression of seven genes associated with left ventricular remodeling was evaluated by qRT-PCR using SYBRGreen (iQ SYBR Green Supermix, Bio-Rad, USA). Relative expression was calculated using two housekeeping genes — hypoxanthine guanine phosphoribosyl transferase (HPRT) and tumor protein, translationally controlled 1 (TPT1). PCR reaction efficiency for applied primer sets was obtained from standard curves. Serial dilution 102–108 copies/μl of plasmid (pSC-A plasmid—StrataClone, Agilent Technologies, USA) containing amplicon for every assessed gene was prepared. The qRT-PCR reactions were performed to amplify cDNA fragments with specific primers spanning exon junctions. All of the primers and product sizes are listed in Table 1. The qRT-PCR experiments were performed using iCycler detecting system (Bio-Rad, USA). All of the PCR and qRT-PCR reaction conditions are shown as supplementary data (Supplementary Table 2). 2.15. Western immunoblotting

2.11. Plasma NT-proBNP levels NT-proBNP levels were analyzed with Enzyme-Linked Immunosorbent Assay Kit for N-Terminal Pro Brain Natriuretic Peptide (Uscn Life Science Inc., Wuchan, China). The procedure was conducted according to the manufacturer's manual. The collected plasma samples were diluted 5 times. All of the samples were added to wells pre-coated with antibody specific for NT-proBNP to immobilize the protein. Next, biotin-conjugated antibody antiNT-proBNP followed by Avidin-HRP was added. After HRP substrate addition a colorimetric reaction was measured spectrophotometrically and the NT-proBNP concentration was calculated using standard curve.

The protein extract from heart muscle was isolated at the opportunity of RNA extraction according to the manufacturer's protocol of TRI Reagent® (Sigma-Aldrich). At the end, the proteins were dissolved in 8 M urea, 50 mM Tris–HCl, pH 8.0 with 1% SDS (1:1) containing protease inhibitor cocktail (Roche). The total protein concentration was determined using the Lowry method. The 100 μg of protein was separated on 4–8% gel for SERCA2a, 4–16% for HPRT, Cx43, GATA4, CTGF, 4–20% for PLB and then, electrotransferred overnight at 4 °C to PVDF Immobilon-P membrane (Merck Millipore). The membrane was blocked with blocking buffer containing non-fat milk (Bio-Rad). Immunodetection was performed using the following antibodies: anti-SERCA2a-ab3625/1:3000—115 kDa, anti-

Fig. 6. LVFAC (%) index calculated using the measurements performed in long (A) and short (B) axis in both analyzed groups of animals before and after cell (MI + Mb, n = 3)/saline solution (MI + 0.9% NaCl, n = 3) administration. No significant differences between groups were found. LVFAC—left ventricle fractional area change, Mb—myoblast suspension, MI—myocardial infarction.

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

715

Fig. 7. Plasma NT-proBNP levels measured by ELISA test. A. NT-proBNP level measured at 5 and 21 days after MI compared to normal levels. B. NT-proBNP level before cell transplantation. C. NT-proBNP level 5 days after myoblast intervention. D. Changes in NT-proBNP level over time. Control—measurements before coronary artery ligation, MI + 5—NT-proBNP levels at 5 days after infarction, MI + 21—NT-proBNP levels 21 days after infarction, MI + 33 (Mb)—measurements at 5 days after myoblast administration, MI + 33 (0.9% NaCl)–measurements 5 days after saline solution administration. Values are given as means ± SD; *p b 0.05.

Fig. 8. Linear correlation between plasma NT-proBNP level and LVFAC (%) index a day before (R2 = 0.8958, p = 0.0148) (A) and 28 days after cell transplantation (R2 = 0.8919, p = 0.0156) (B). NT-proBNP—N-terminal part of natriuretic peptide B; LVFAC—left ventricle fractional area change.

716

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

Cx43-ab63851/1:500-43 kDa, anti-HPRT-ab109021/1:1000—25 kDa, anti-CTGF/ ab125943/1:1000—38 kDa, anti-PLB/ab85146/1:2000—6 kDa. The detection of the target protein was achieved by incubating the membrane with ECL Western Blotting Detection Reagents (GE Healthcare). The relative level of detected protein was normalized with reference to HPRT and analyzed with ChemiDoc™ XRS system (Bio-Rad).

2.16. Statistical analysis Relative expression levels were quantified using geNorm tool [33]. Calculated values were compared with t-Student test. NT-proBNP levels in blood plasma samples were compared by using one-way ANOVA test with Tukey's multiple comparison test, and t-Student test. Correlation between LVFAC (%) index and NT-proBNP level was assessed by linear regression analysis.

3. Results 3.1. Myoblast population Prior to transplantation, the cell population was harvested and characterized by flow cytometry test using CD56-specific antibody and immunocytochemistry evaluation based on desmin expression. FACS results showed, that over 85% of transplanted cells were CD56 positive (Fig. 2) and could be described as myogenic. Approximately, 70% of cells exhibited desmin expression (Fig. 3).

3.3. Animal model and echocardiography Overall, we performed MI induction on 52 mice. Three of them (5.7%) died during microsurgical procedure, four animals (7.7%) died prior to cell transplantation procedure. Two more animals (3.8%) did not survive cell/saline injection. After therapy, 6 mice (11.5%) receiving SkMCs died between 30 and 40 days after the procedure and 5 (9.6%) animals receiving 0.9% NaCl died between 25 and 35 days after the procedure. Every isolated left ventricle, except of the control group, had signs of myocardial infarction and left ventricle remodeling. There was visible scarring and decrease in wall thickness (Fig. 5). Hearts obtained from the animals 70 days after left coronary artery ligation were generally larger and the scar was noticeably thinner than those isolated 21 and 33 days after MI induction. The echocardiography performed after MI induction revealed no statistically significant differences between animals that were used for subsequent cells vs. NaCl solution transplantation protocols. LVFAC (%) index measured before and after cell transplantation showed that there were no significant differences between groups, however a decrease in the value of the LVFAC (%) does not seem to be as severe among animals receiving SkMCs as opposed to those receiving saline solution (Fig. 6). 3.4. Plasma NT-proBNP levels

3.2. Cell survival after transplantation Presence of myoblasts in myocardium five days after transplantation was confirmed by PCR reaction (Fig. 4). Only DNA samples isolated from hearts with transplanted human myoblasts contained the template for human AR gene specific primers.

Plasma NT-proBNP levels were significantly higher (p = 0.021) in animals at 21 days after induced MI while biomarker level at 5 days after MI was not altered. After SkMC injection, NT-proBNP level was significantly lower (p = 0.019) in MI + 33 (Mb) group (Fig. 7) compared to the 0.9% NaCl injected animals.

Fig. 9. The effect of myocardial infarction on selected gene expression in left heart ventricle. The expression of selected genes was normalized to two housekeeping genes (HPRT, TPT1). A. NPPB gene, B. CTGF, C. GATA4, D. TGF-ß3, E. SERCA2a, F. PLB, G. SERCA2a/PLB ratio, H. Cx43. Control—healthy mice (n = 4), MI + 21—mice with myocardial infarction 21 days after left coronary artery ligation (n = 5). Values are given as means ± SD; *p b 0.05, **p b 0.01, ***p b 0.001. HPRT—hypoxanthine guanine phosphoribosyl transferase; TPT1—tumor protein, translationally-controlled 1 NPPB—natriuretic peptide B; CTGF—connective tissue growth factor; GATA4—GATA binding protein 4; TGF-ß3—tumor growth factor ß3; Cx43—connexin 43; SERCA2a—ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2; PLB—phospholamban.

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

3.5. NT-proBNP levels and LVFAC correlation

717

NT-proBNP levels corresponded well with left heart ventricle remodeling. Linear regression analysis revealed that NT-proBNP level and LVFAC index measured in the short axis negatively correlated before (p = 0.0095, R2 = 0.845) and after (p = 0.0097, R2 = 0.8433) cell transplantation (Fig. 8).

0.0400) as well as PLB/SERCA2a ratio (p = 0.0286) was significantly altered among animals with transplanted SkMCs. There were no changes found in CTGF, PLB, Cx43 and TGF-ß3 gene expression between groups under study (Fig. 11). Changes in gene expression at different time points comparing the effect of transplanted cells in all of the animals used in the study are shown in Fig. 12.

3.6. Gene expression analysis

3.7. Western blot analysis

Reaction efficiency and correlation coefficient for every selected gene are listed in the supplementary data (Supplementary Table 3). We performed gene expression analysis in the left heart ventricle of healthy mice and 21 days after MI induction. We found significant changes in NPPB (p b 0.0001), CTGF (p = 0.0317) and GATA4 (p = 0.0056) gene expression, while SERCA2a, TGF-ß3, Cx43 and PLB gene expression remained stable. The value of PLB/SERCA2a ratio was also unaffected (Fig. 9). Gene expression of NPPB (p = 0.0053), SERCA2a (p = 0.0171), CTGF (p = 0.0343), GATA4 (p = 0.0498) and PLB (p = 0.0081) in most of the studied ones was significantly changed five days after SkMC transplantations. PLB/SERCA2a ratio was also significantly altered (p = 0.0428) (Fig. 10). There were no changes found in TGF-ß3 as well as Cx43 expression. Gene expression analysis after 70 days from induced myocardial infarction (and 42 days after myoblast intervention) was performed to evaluate long-term effect of administrated cells. The expression level of NPPB gene (p = 0.0186), GATA4 (p = 0.0420), SERCA2a (p =

Western blot analysis was performed on protein extracts obtained from mice heart before MI induction (n = 2), 21 days after surgery (n = 2) and 5 days after myoblast (n = 2) or 0.9% NaCl injection (n = 2) (Fig. 13). We were able to confirm that after MI induction, there is a strong induction of CTGF protein product as well as decrease of PLB protein expression. After performing myoblast transplantation, PLB protein expression is lower in MI + 33 (Mb) group than in MI + 33 (0.9% NaCl), which can suggest better calcium cycling. 4. Discussion The aim of this study was to evaluate the impact of cell therapy using SkMCs in myocardial infarction resulting in left heart ventricle remodeling. PCR reaction confirming the presence of human DNA strongly suggests that some of transplanted myoblasts successfully survived intramyocardial injection and resided in the heart muscle until 42 days after cell implantation. This result is consistent with previous

Fig. 10. The short-term effect of transplanted cells on gene expression. Left heart ventricles isolated 5 days after myoblast administration and 33 days after left coronary artery ligation. The expression of selected genes was normalized to two housekeeping genes (HPRT, TPT1). A. NPPB gene, B. CTGF, C. GATA4, D. TGF-ß3, E. SERCA2a, F. PLB, G. SERCA2a/PLB ratio, H. Cx43. MI + 33 (Mb)—animals that were injected with cell suspension (n = 6); MI + 33 (0.9% NaCl)—animals that were injected with physiological saline solution (n = 6). Values are means ± SD; *p b 0.05, **p b 0.01. HPRT—hypoxanthine guanine phosphoribosyl transferase; TPT1—tumor protein, translationally-controlled 1 NPPB—natriuretic peptide B; CTGF—connective tissue growth factor; GATA4—GATA binding protein 4; TGF-ß3—tumor growth factor ß3; Cx43—connexin 43; SERCA2a—ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2; PLB—phospholamban.

718

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

experiments where administered cells were found in histological sections of heart specimens after performing immunohistochemical staining [34] or identifying GFP protein after viral SkMC transduction [35]. It is, however, impossible to define what proportion of injected cells resided permanently in the heart muscle. Results from the other groups suggest that the majority of cells can be lost just a few minutes after transplantation, but the remaining ones go through several cell divisions and differentiate into myocytes [36]. The echocardiographic examination showed no significant differences in left ventricle function between groups before, and after cell transplantation. Data suggest, however, progressive impairment of left ventricle, which is aggravated among animals receiving 0.9% NaCl solution. It is also worth mentioning, that there was a large variability in changes of LVFAC (%) index among animals, moreover the small group samples may account for the absence of significant differences. Furthermore, it has been previously proven, that the efficacy of heart improvement on global level is dependent on the amount of injected cells [37]. Hence by increasing the number of injected cells we could have potentially had a more uniform effect on enhancement of heart muscle hemodynamics. NT-proBNP level is a prognostic factor used widely in everyday clinic in patients after MI. It has been proven that this biomarker level depends on the degree of left ventricle remodeling and is generally lower among patients with unaltered ejection fraction (EF) [38]. To date, there has been no clear evaluation of the suitability of measuring NT-proBNP level in a mouse model of myocardial infarction, and

evaluating the efficacy of any cellular therapy in an animal model. Previous studies in which predictive properties of B-type natriuretic peptide were used, were based on measurement of BNP itself, which has a much shorter half-life compared to the N-terminal part of the hormone and thus does not constitute a good monitoring biomarker. In our experiment, we were able to prove that NT-proBNP level increases 21 days after MI in murine model and that the level of this biomarker was significantly lower in mice that received SkMC suspensions. Furthermore, the expression analysis of NPPB gene showed statistically significant increase in NPPB mRNA amount 21 days after MI, which is consistent with previous studies — Gidh-Jain and co-workers proved that the amount of mRNA for NPPB gene increases 21 days but not 3 days after MI [39]. The main factor for releasing BNP protein from the heart is volume overload, which triggers expression of GATA4 transcription factor thereby increasing biosynthesis of the natriuretic peptide. Decreased expression of GATA4 and no major changes in geometry of the heart suggest that the decline of NT-proBNP in blood after myoblast injection is – at least partially – a result of paracrine effect of biomolecules released from the SkMCs. This hypothesis was proven by Formigli et al. who have shown that SkMCs are able to modulate response to MI by secreting pro-angiogenic and anti-fibrotic factors [40]. Changes in GATA4 and NPPB gene expression after MI can be associated with activation of the so-called fetal gene program. It is clearly visible in GATA4 gene expression (Fig. 12C). It is worth noting that GATA4 is not the only transcription factor for BNP expression since the NPPB gene

Fig. 11. The long-term effect of transplanted cells on gene expression 42 days after myoblast/physiological saline intervention and 70 days after left coronary artery ligation. The expression of selected genes was normalized to two housekeeping genes (HPRT, TPT1). A. NPPB gene, B. CTGF, C. GATA4, D. TGF-ß3, E. SERCA2a, F. PLB, G. SERCA2a/PLB ratio, H. Cx43. MI + 70 (Mb)—animals that were injected with myoblast suspension (n = 4); MI + 70 (0.9% NaCl)—animals that were treated with physiological saline solution (n = 5). Values are given as means ± SD; *p b 0.05. HPRT—hypoxanthine guanine phosphoribosyl transferase; TPT1—tumor protein, translationally-controlled 1 NPPB—natriuretic peptide B; CTGF—connective tissue growth factor; GATA4—GATA binding protein 4; TGF-ß3—tumor growth factor ß3; Cx43—connexin 43; SERCA2a—ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2; PLB—phospholamban.

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

719

Fig. 12. Changes in gene expression after induced MI and SkMCs/0.9% NaCl intervention. A. NPPB gene, B. CTGF, C. GATA4, D. TGF-ß3, E. SERCA2a, F. PLB, G. SERCA2a/PLB ratio, H. Cx43. Control—healthy animals, MI + 21—animals terminated 21 days after MI, MI + 33—animals that were subjected to cell therapy and euthanized 33 days after MI and 5 days after myoblast/physiological saline intervention. MI + 70—animals that were subjected to myoblast therapy and euthanized 70 days after MI and 42 days after cell/physiological saline intervention. Values are given as means ± SD. HPRT—hypoxanthine guanine phosphoribosyl transferase; TPT1—tumor protein, translationally-controlled 1 NPPB—natriuretic peptide B; CTGF—connective tissue growth factor; GATA4—GATA binding protein 4; TGF-ß3—tumor growth factor ß3; Cx43—connexin 43; SERCA2a—ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2; PLB—phospholamban.

promoter contains M-CAT, shear stress-responsive element (SSRE), AP1/Cre-like and other elements [41], of which the expression of the latter one is increased after MI induction [42]. One of the most severe consequences of MI is reduced myocardial contractility caused by impaired calcium cycling. SERCA2a is SR ion channel responsible for calcium uptake after contraction. SERCA2a expression level was not changed 21 days after MI, although it is accepted, that the amount of SERCA2a channels after MI decreases [29]. Some researchers report however, that the expression of SERCA2a is dependent on the time point after MI and the analyzed part of the infarcted heart [43] and there are examples where SERCA2a expression was not altered after MI [44,45]. In our experiments, we observed that the decline in SERCA2a expression occurred 33 days after coronary left artery ligation and the decrease was more pronounced among animals receiving 0.9% NaCl solution. This status was maintained until 70 days after MI. Higher relative expression of SERCA2a after SkMCs injection may be – at least partially – explained by lower expression of NPPB [28] after cell intervention. There are also indicators, that relationship between NPPB gene and SERCA2a is dependent on GATA4 transcription factor [46]. SERCA2a channel activity is regulated by PLB. Dephosphorylated PLB acts as a SERCA2a inhibitor, decreasing its affinity to calcium ions, while phosphorylation of the protein increases SERCA2a pump activity. Similar to the SERCA2a gene, the expression profile of PLB after MI is somewhat unclear. Yue and co-workers found that the expression of PLB has been changed 24 h after MI, but the amount of protein does not differ compared to that of healthy animals until 6 weeks after MI [44]. Xu et al. on the other hand documented, that the expression of PLB differs in viable and scar tissue after MI [47]. In the experiment performed on human heart muscle, the expression level of PLB was decreased after MI [48]. Finally, some researchers argue that potential changes in PLB

inhibitory role are consequences rather of increased dephosphorylation and not gene expression per se [49]. It is clear, however, that inhibition of PLB improves heart function after MI or cardiac hypertrophy [50]. In our experiments, the amount of PLB mRNA did not change 21 and 70 days after MI, however protein product decreased after 33 days due to myoblast intervention. Many groups argue that in fact the PLB/ SERCA2a ratio is a better way to describe calcium transient in the heart muscle [51,52] as it correlates with contraction and relaxation in Langendorff-perfused hearts. In our study, we were able to prove – despite baffling results from PLB gene expression analysis – that the PLB/SERCA2a ratio was advantageously altered after SkMC injection and that this improvement was even more pronounced in the long term. Both CTGF and TGF-ß3 are involved in heart fibrosis regulation after MI. It has been proven before that these two proteins act synergistically

Fig. 13. Detection of selected proteins in heart tissue samples at different time points. Protein products corresponded to genes selected and time intervals as in Figs. 9–12.

720

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721

[53], however, TGF-ß proteins are much more pleiotropic biomolecules as they regulate not only fibrosis but also inflammatory response. In our study, CTGF gene expression increased 21 days after MI and mostly among animals from MI + 33 (0.9% NaCl) group while the expression level of TGF-ß3 remained unaltered. This suggests that administered SkMCs may have a role in modulating fibrosis through inhibiting CTGF expression. It is, however, unclear what the mechanism is of this regulation. TGF-ß3 is one of the activators of CTGF gene expression, but its mRNA amount did not change between studied groups. Moreover, we did not find any correlation between CTGF and TGF-ß3 gene expression (data not shown). A possible explanation for increased level of CTGF protein could be volume overload revealed to be co-associated with GATA4 and NPPB up-regulation, as CTGF is strongly expressed in mechanically challenged organs [54]. It cannot be however excluded that increase of CTGF mRNA 70 days after MI could be associated with left ventricle hypertrophy as was shown before [55]. It should also be noted, that the standard deviations found both for TGF-ß3 and CTGF genes have been quite high, which suggests that the transcription profile of these genes is characterized by high variability among individuals. One of the potential disadvantages of using SkMCs in regenerative therapy of infarcted hearts is the fact, that those cells do not express connexin 43 and therefore cannot couple with host cardiomyocytes. This in turn can cause arrhythmias [56] after transplantation. On the other hand, expression of Cx43 negatively correlates with infarct size probably due to higher spread of injury signals [57]. We found however, that the expression of Cx43 in our model was not significantly changed after SkMC transplantation and generally followed the same pattern as that in controls (sham intervention). 5. Conclusions In our study we were able to prove that SkMC intervention in a postinfarcted heart affects expression of genes associated with left ventricle remodeling. To our knowledge, this is the first scientific report showing that the transplantation of SkMCs could change the expression profile of genes in myocardial tissue and SkMCs can be not only the source of contractile cells but also can modulate genetic response in the myocardium after MI on molecular level. Although, we were not able to prove the global improvement of the heart muscle using echocardiographic examination, we believe that identification of potential mechanisms involved in changes of gene expression profile could perhaps contribute to development of new therapies for MI and to prevent left heart ventricle remodeling. Conflict of interest All Authors declare that there is no conflict of interest in this manuscript. Acknowledgments This work was supported by Projects from National Centre for Research and Development, Poland, Grant no NNR13006506, from National Science Centre, grant No. 2012/07/N/NZ3/01687 and from National Science Centre, grant No. 2014/13/B/NZ3/04646. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.ijcard.2015.09.115. References [1] A.S. Go, D. Mozaffarian, V.L. Roger, E.J. Benjamin, J.D. Berry, W.B. Borden, et al., Heart Disease and Stroke Statistics—2013 Update: A Report From the American Heart Association, 127, Lippincott Williams & Wilkins 2013, pp. e6–e245.

[2] E. Dirkx, P.A. da Costa Martins, L.J. De Windt, Regulation of fetal gene expression in heart failure, Biochim. Biophys. Acta 1832 (2013) 2414–2424. [3] J.N. Cohn, R. Ferrari, N. Sharpe, Cardiac remodeling—concepts and clinical implications: a consensus paper from an international forum on cardiac remodeling. Behalf of an International Forum on Cardiac Remodeling, J. Am. Coll. Cardiol. 35 (2000) 569–582. [4] K. Dickstein, P.E. Vardas, A. Auricchio, J.C. Daubert, C. Linde, et al., Focused Update of ESC Guidelines on device therapy in heart failure: an update of the 2008 ESC Guidelines for the diagnosis and treatment of acute and chronic heart failure and the 2007 ESC guidelines for cardiac and resynchronization therapy. Developed with the special contribution of the Heart Failure Association and the European Heart Rhythm Association, Eur. Heart J. 31 (2010) (2010) 2677–2687. [5] E.G. Nabel, E. Braunwald, A tale of coronary artery disease and myocardial infarction, N. Engl. J. Med. 366 (2012) 54–63. [6] M.R. Law, H.C. Watt, N.J. Wald, The underlying risk of death after myocardial infarction in the absence of treatment, Arch. Intern. Med. 162 (2002) 2405–2410. [7] W. Liu, Y. Wen, P. Bi, X. Lai, X.S. Liu, et al., Hypoxia promotes satellite cell self-renewal and enhances the efficiency of myoblast transplantation, Development 139 (2012) 2857–2865. [8] A. Ciecierska, K. Chodkowska, T. Motyl, T. Sadkowski, Myogenic cells applications in regeneration of post-infarction cardiac tissue, J. Physiol. Pharmacol. 64 (2013) 401–408. [9] P. Menasché, O. Alfieri, S. Janssens, W. McKenna, H. Reichenspurner, L. Trinquart, J.T. Vilquin, J.P. Marolleau, B. Seymour, J. Larghero, S. Lake, G. Chatellier, S. Solomon, M. Desnos, A.A. Hagège, The Myoblast Autologous Grafting in Ischemic Cardiomyopathy (MAGIC) trial: first randomized placebo-controlled study of myoblast transplantation, Circulation 117 (2008) 1189–1200. [10] J. Brickwedel, H. Gulbins, H. Reichenspurner, Long-term follow-up after autologous skeletal myoblast transplantation in ischaemic heart disease, Interact. Cardiovasc. Thorac. Surg. 18 (2014) 61–66. [11] P.C. Smits, R.J. van Geuns, D. Poldermans, M. Bountioukos, E.E. Onderwater, C.H. Lee, A.P. Maat, P.W. Serruys, Catheter-based intramyocardial injection of autologous skeletal myoblasts as a primary treatment of ischemic heart failure: clinical experience with six-month follow-up, J. Am. Coll. Cardiol. 42 (2003) 2063–2069. [12] T. Siminiak, R. Kalawski, D. Fiszer, O. Jerzykowska, J. Rzeźniczak, N. Rozwadowska, M. Kurpisz, Autologous skeletal myoblast transplantation for the treatment of postinfarction myocardial injury: phase I clinical study with 12 months of followup, Am. Heart J. 148 (2004) 531–537. [13] F.D. Pagani, H. DerSimonian, A. Zawadzka, K. Wetzel, A.S. Edge, D.B. Jacoby, J.H. Dinsmore, S. Wright, T.H. Aretz, H.J. Eisen, K.D. Aaronson, Autologous skeletal myoblasts transplanted to ischemia-damaged myocardium in humans. Histological analysis of cell survival and differentiation, J. Am. Coll. Cardiol. 41 (2003) 879–888. [14] R. Sirmenis, A. Kraniauskas, R. Jarašienė, D. Baltriukienė, A. Kalvelytė, V. Bukelskienė, Recovery of infarcted myocardium in an in vivo experiment, Medicina (Kaunas) 47 (2011) 607–615. [15] C.D. Kan, H.L. Lee, Y.J. Yang, Cell transplantation for myocardial injury: a preliminary comparative study, Cytotherapy 12 (2010) 692–700. [16] M. Khan, V.K. Kutala, D.S. Vikram, S. Wisel, S.M. Chacko, M.L. Kuppusamy, I.K. Mohan, J.L. Zweier, P. Kwiatkowski, P. Kuppusamy, Skeletal myoblasts transplanted in the ischemic myocardium enhance in situ oxygenation and recovery of contractile function, Am. J. Physiol. Heart Circ. Physiol. 293 (2007) H2129–H2139. [17] T.J. Kolanowski, N. Rozwadowska, A. Malcher, E. Szymczyk, J.D. Kasprzak, T. Mietkiewski, M. Kurpisz, In vitro and in vivo characteristics of connexin 43-modified human skeletal myoblasts as candidates for prospective stem cell therapy for the failing heart, Int. J. Cardiol. 173 (2014) 55–64. [18] M. Jain, H. DerSimonian, D.A. Brenner, S. Ngoy, P. Teller, A.S. Edge, A. Zawadzka, K. Wetzel, D.B. Sawyer, W.S. Colucci, C.S. Apstein, R. Liao, Cell therapy attenuates deleterious ventricular remodeling and improves cardiac performance after myocardial infarction, Circulation 103 (2001) 1920–1927. [19] P. Kinnunen, O. Vuolteenaho, H. Ruskoaho, Mechanisms of atrial and brain natriuretic peptide release from rat ventricular myocardium: effect of stretching, Endocrinology 132 (1993) 1961–1970. [20] H.K. Gaggin, J.L. Jr Januzzi, Biomarkers and diagnostics in heart failure, Biochim. Biophys. Acta 1832 (2013) 2442–2450. [21] J.L. Januzzi, R. Troughton, Are serial BNP measurements useful in heart failure management?: serial natriuretic peptide measurements are useful in heart failure management, Circulation 127 (2013) 500–508. [22] C.J. Taylor, A.K. Roalfe, R. Iles, F.D.R. Hobbs, The potential role of NT-proBNP in screening for and predicting prognosis in heart failure: a survival analysis, BMJ Open 4 (2014), e004675. [23] J.L. Januzzi Jr., The role of natriuretic peptide testing in guiding chronic heart failure management: review of available data and recommendations for use, Arch. Cardiovasc. Dis. 105 (2012) 40–50. [24] R. Grybauskiene, D. Karciauskaite, J. Brazdzionyte, J. Janenaite, Z. Bertasiene, P. Grybauskas, Brain natriuretic peptide and other cardiac markers predicting left ventricular remodeling and function two years after myocardial infarction, Medicina (Kaunas) 43 (2007) 708–715. [25] R. Taléns-Visconti, M. Rivera Otero, M.J. Sancho-Tello, F.G. de Burgos, L. MartínezDolz, B. Sevilla, V. Climent, R. Cortés, A. Salvador, F. Sogorb, V. Miro, R. Valero, J.L. Perez-Boscá, V. Bertomeu, M. Portolés, R. Payá, Left ventricular cavity area reflects N-terminal pro-brain natriuretic peptide plasma levels in heart failure, Eur. J. Echocardiogr. 7 (2006) 45–52. [26] I. Kishimoto, K. Rossi, D.L. Garbers, A genetic model provides evidence that the receptor for atrial natriuretic peptide (guanylyl cyclase-A) inhibits cardiac ventricular myocyte hypertrophy, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 2703–2706.

B. Wiernicki et al. / International Journal of Cardiology 202 (2016) 710–721 [27] R.S. Scotland, M. Cohen, P. Foster, M. Lovell, A. Mathur, A. Ahluwalia, A.J. Hobbs, Ctype natriuretic peptide inhibits leukocyte recruitment and platelet–leukocyte interactions via suppression of P-selectin expression, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 14452–14457. [28] J. Thireau, S. Karam, J. Fauconnier, S. Roberge, C. Cassan, O. Cazorla, F. Aimond, A. Lacampagne, D. Babuty, S. Richard, Functional evidence for an active role of B-type natriuretic peptide in cardiac remodelling and pro-arrhythmogenicity, Cardiovasc. Res. 95 (2012) 59–68. [29] M. Periasamy, P. Bhupathy, G.J. Babu, Regulation of sarcoplasmic reticulum Ca2+ ATPase pump expression and its relevance to cardiac muscle physiology and pathology, Cardiovasc. Res. 77 (2008) 265–273. [30] A. Leask, Potential therapeutic targets for cardiac fibrosis: TGFbeta, angiotensin, endothelin, CCN2, and PDGF, partners in fibroblast activation, Circ. Res. 106 (2010) 1675–1680. [31] M. Dobaczewski, W. Chen, N.G. Frangogiannis, Transforming growth factor (TGF)-β signaling in cardiac remodeling, J. Mol. Cell. Cardiol. 51 (2011) 600–606. [32] N. Rozwadowska, D. Fiszer, T. Siminiak, R. Kalawski, M. Kurpisz, Evaluation of in vitro culture of human myoblasts for tissue auto transplants to the post-infarcted heart, Pol. Heart J. 57 (2002) 233–237. [33] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F. Speleman, Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes, Genome Biol. 3 (2002), RESEARCH0034. [34] W. Zhuang, L. Li, G. Lin, Z. Deng, Autologous myoblasts transplantation improves heart function after myocardiac infarction, J. Cent. South. Univ. Med. Sci. 36 (2011) 286–293. [35] B. Leobon, I. Garcin, P. Menasche, J.T. Vilquin, E. Audinat, S. Charpak, Myoblasts transplanted into rat infarcted myocardium are functionally isolated from their host, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 7808–7811. [36] C. Guo, H.Kh. Haider, W.S. Shim, R.S. Tan, L. Ye, S. Jiang, P.K. Law, P. Wong, E.K. Sim, Myoblast-based cardiac repair: xenomyoblast versus allomyoblast transplantation, J. Thorac. Cardiovasc. Surg. 134 (2007) 1332–1339. [37] B. Pouzet, J.T. Vilquin, A.A. Hagège, M. Scorsin, E. Messas, M. Fiszman, K. Schwartz, P. Menasché, Factors affecting functional outcome after autologous skeletal myoblast transplantation, Ann. Thorac. Surg. 71 (2001) 844–850. [38] T. Hole, C. Hall, T. Skaerpe, N-terminal proatrial natriuretic peptide predicts twoyear remodelling in patients with acute transmural myocardial infarction, Eur. Heart J. 25 (2004) 416–423. [39] M. Gidh-Jain, B. Huang, P. Jain, G. Gick, N. El-Sherif, Alterations in cardiac gene expression during ventricular remodeling following experimental myocardial infarction, J. Mol. Cell. Cardiol. 30 (1998) 627–637. [40] L. Formigli, A.M. Perna, E. Meacci, L. Cinci, M. Margheri, S. Nistri, A. Tani, J. Silvertown, G. Orlandini, C. Porciani, S. Zecchi-Orlandini, J. Medin, D. Bani, Paracrine effects of transplanted myoblasts and relaxin on post-infarction heart remodelling, J. Cell. Mol. Med. 11 (2007) 1087–1100. [41] K. Kuwahara, K. Nakao, Regulation and significance of atrial and brain natriuretic peptides as cardiac hormones, Endocr. J. 57 (2010) 555–565. [42] M. Yoshiyama, T. Omura, K. Takeuchi, S. Kim, K. Shimada, H. Yamagishi, M. Teragaki, K. Akioka, H. Iwao, J. Yoshikawa, Angiotensin blockade inhibits increased JNKs, AP-1 and NF- kappa B DNA-binding activities in myocardial infarcted rats, J. Mol. Cell. Cardiol. 33 (2001) 799–810.

721

[43] M. Yoshiyama, K. Takeuchi, A. Hanatani, S. Kim, T. Omura, I. Toda, M. Teragaki, K. Akioka, H. Iwao, J. Yoshikawa, Differences in expression of sarcoplasmic reticulum Ca2+-ATPase and Na +-Ca2 + exchanger genes between adjacent and remote noninfarcted myocardium after myocardial infarction, J. Mol. Cell. Cardiol. 29 (1997) 255–264. [44] P. Yue, C.S. Long, R. Austin, K.C. Chang, P.C. Simpson, B.M. Massie, Post-infarction heart failure in the rat is associated with distinct alterations in cardiac myocyte molecular phenotype, J. Mol. Cell. Cardiol. 30 (1998) 1615–1630. [45] G. Münch, B. Bölck, S. Hoischen, K. Brixius, W. Bloch, H. Reuter, R.H. Schwinger, Unchanged protein expression of sarcoplasmic reticulum Ca2+-ATPase, phospholamban, and calsequestrin in terminally failing human myocardium, J. Mol. Med. 76 (1998) 434–441. [46] R. Vlasblom, A. Muller, C.M. Beckers, G.P. van Nieuw Amerongen, M.J. Zuidwijk, C. van Hardeveld, W.J. Paulus, W.S. Simonides, RhoA-ROCK signaling is involved in contraction-mediated inhibition of SERCA2a expression in cardiomyocytes, Pflugers Arch. 458 (2009) 785–793. [47] Y.J. Xu, D. Chapman, I.M. Dixon, R. Sethi, X. Guo, N.S. Dhalla, Differential gene expression in infarct scar and viable myocardium from rat heart following coronary ligation, J. Cell. Mol. Med. 8 (2004) 85–92. [48] C.F. McTiernan, C.S. Frye, B.H. Lemster, E.A. Kinder, M.L. Ogletree-Hughes, C.S. Moravec, A.M. Feldman, The Human Phospholamban Gene: Structure and Expression, 31 (1999) 679–692. [49] S. Nattel, A. Maguy, S. Le Bouter, Y.H. Yeh, Arrhythmogenic ion-channel remodeling in the heart: heart failure, myocardial infarction, and atrial fibrillation, Physiol. Rev. 87 (2007) 425–456. [50] Y. Iwanaga, M. Hoshijima, Y. Gu, M. Iwatate, T. Dieterle, Y. Ikeda, M.O. Date, J. Chrast, M. Matsuzaki, K.L. Peterson, K.R. Chien, J. Ross Jr., Chronic phospholamban inhibition prevents progressive cardiac dysfunction and pathological remodeling after infarction in rats, J. Clin. Invest. 113 (2004) 727–736. [51] K.L. Koss, I.L. Grupp, E.G. Kranias, The relative phospholamban and SERCA2 ratio: a critical determinant of myocardial contractility, Basic Res. Cardiol. 92 (1997) 17–24. [52] A.D. Schmidt, E.G. Kranias, in: G. Hasenfuss, E. Marbán (Eds.),Genetic approaches to elucidate the regulatory role of phospholamban in the heart, 2, Steinkopff, Baltimore 2000, pp. 40–41. [53] A. Leask, TGFβ, cardiac fibroblasts, and the fibrotic response, Cardiovasc. Res. 74 (2007) 207–212. [54] I. Cicha, M. Goppelt-Struebe, Connective tissue growth factor: context-dependent functions and mechanisms of regulation, Biofactors 35 (2009) 200–208. [55] E.R. Chemaly, S. Kang, S. Zhang, L. McCollum, J. Chen, L. Bénard, K.R. Purushothaman, R.J. Hajjar, D. Lebeche, Differential patterns of replacement and reactive fibrosis in pressure and volume overload are related to the propensity for ischaemia and involve resistin, J. Physiol. 591 (2013) 5337–5355. [56] Y. Liu, H.F. Tse, The proarrhythmic risk of cell therapy for cardiovascular diseases, Expert. Rev. Cardiovasc. Ther. 9 (2011) 1593–1601 (Informa Healthcare London). [57] S. Kanno, A. Kovacs, K.A. Yamada, J.E. Saffitz, Connexin43 as a determinant of myocardial infarct size following coronary occlusion in mice, J. Am. Coll. Cardiol. 41 (2003) 681–686.