Human ribosomal protein L37a: cloning of the cDNA and analysis of differential gene expression in tissues and cell lines

Gene, 132 (1993) 285-289 0 1993 Elsevier Science Publishers B.V. All rights reserved. 0378-I 119/93/$06.00

285

GENE 07333

Human ribosomal protein L37a: cloning of the cDNA and analysis of differential gene expression in tissues and cell lines (Large ribosomal subunit protein; molecular cloning; neuroblastoma zinc finger)

cells; polymerase chain reaction; intron-less;

Deba P. Saha, Padma S. Tirumalai, Louis A. Scala and Richard D. Hotiells Department of Biochemistry and Molecular Biology, VMDNJ-New

Jersey Medical School, and Graduate School of Biomedical Sciences, Newark,

NJ 07103, USA

Received by W.M. Holmes: 10 April 1993; Accepted: 19 May 1993; Received at publishers: 15 June 1993

SUMMARY

A cDNA corresponding to human ribosomal protein L37a (hL37a) was obtained by screening a SHSYSY neuroblastoma library. The full-length cDNA contained 366 nucleotides (nt) in addition to a poly(A) tail. The pyrimidinerich sequence, CTTTCT, that is common to many ribosomal protein-encoding cDNAs was present at the 5’ terminus. The nt sequence displayed 85% identity with rat L37a (rL37a) cDNA. The predicted protein contains 92 amino acids with a M, of 10 277, is highly basic, and has 100% sequence identity with rL37a. A putative zinc-finger domain is present in the central region of the protein. Human lymphocytes and several human cell lines express hL37a mRNA at significantly higher levels than the rat cell lines and rat tissues tested. The hL37a gene does not contain introns.

INTRODUCTION

The mammalian ribosome is a macromolecular assembly consisting of four rRNA transcripts and 70-80 different r-proteins that serves a vital role in the biosynthesis of proteins (reviewed in Wool et al., 1990). The biogenesis of functional r-subunits is complex in that gene products synthesized by RNA polymerases I, II, and III are required and transport among multiple intracellular compartments is involved. Transcription of the r-proteinencoding gene in the nucleoplasm is followed by export Correspondence to: Dr. R.D. Howells, Department of Biochemistry and

Molecular Biology, UMD-New Jersey Medical School, 185 South Orange Avenue, Newark, NJ 07103, USA. Tel. (201) 982-5652; Fax (201) 982-5594; e-mail: [email protected] Abbreviations: aa, amino acid(s); bp, base pair(s); hL37a, human L37a; kb, kilobase or 1000 bp; L37a, r-protein L37a; nt, nucleotide(s); r-, ribosomal; rL37a, rat L37a; L37a, gene (DNA) encoding L37a; oligo, oligodeoxyribonucleotide; ORF, open reading frame; Pn, penicillin G; PCR, polymerase chain reaction; Sm, streptomycin sulfate; u, unit(s); VTR, untranslated region; Xaa, any aa.

of the r-protein mRNA to the cytoplasm, translation into the r-proteins, nucleolar translocation of the r-proteins, association with nascent rRNA precursors, processing of rRNA, assembly of the small and large r-subunits, followed by export to the cytoplasm. Ribosome biogenesis fluctuates in response to the cellular demand, and the stoichiometric ratio of r-protein and rRNA is coordinately controlled by a variety of mechanisms, including transcriptional, post-transcriptional and translational regulation (Mager, 1988). Knowledge of the aa sequences of all of the r-proteins will be required in order to have a thorough understanding of the structure and function of eukaryotic ribosomes. The primary structures of human r-proteins are accumulating rapidly; to date, eleven human proteins from each r-subunit have been sequenced. In the present study, a cDNA encoding the human large subunit-associated r-protein L37a was isolated as a chimeric insert that had been ligated to a novel cDNA (M. Shahrestanifar, D.P.S., L.A.S. and R.D.H., submitted) with partial homology to members of the G protein-linked receptor superfamily in

286

the course of screening a human neuroblastoma cell line (SHSYSY) cDNA library for the novel cDNA. In this report, the full-length hL37a sequence was determined and expression of L37a mRNA was examined by Northern blot analysis in several human and rat cell lines, human lymphocytes, and in selected rat tissues. The presence of introns within the human L37a gene was also evaluated.

EXPERIMENTAL

AND DISCUSSION

cDNA Human SHSYSY neuroblastoma cells (Ross et al., 1983) were kindly provided by Dr. June Biedler, Sloan Kettering Memorial Institute. Cells were cultured in a humidified atmosphere with 5% COZ at 37°C in 75 cm* flasks (Corning) using RPM1 1640 medium containing 10% fetal calf serum/250 u Pm250 ug Sm (all per ml). Cells were grown to sub-confluent levels (approximately 5 x lo7 cells per flask) prior to extraction. Rat C6 glioma cells, rat Ros 17/24 osteosarcoma cells, and human Molt4 T cell lymphocytic leukemia cells were cultured under the same conditions as neuroblastoma cells. For human lymphocyte isolation, 20 ml of blood was drawn from a human subject, cells were washed with phosphatebuffered saline, and lymphocytes were isolated in a Ficoll gradient according to the protocol suggested by the manufacturer (Pharmacia/LKB). Total RNA was extracted from cell cultures and male Sprague-Dawley rat (Taconic) tissues using the acidguanidium isothiocyanate-phenol-chloroform method (Chomczynski and Sacchi, 1987). Poly(A)+RNA was isolated from total RNA by oligo(dT)-cellulose chromatography (Aviv and Leder, 1972). During the course of a project that was designed to identify and characterize novel G protein-linked receptors using PCR methodology, a SHSYSY cDNA library was screened with 300-bp PCR product with receptor homology. Primary screening of approximately 100 000 plaques yielded a single positive clone that was found to contain a 1.5-kb insert. Upon further analysis, it was realized that the positive insert arose from a cloning artefact and was derived from two cDNA fragments that had ligated to each other via EcoRI linkers. The hybrid cDNAs were subcloned separately in pBluescript and sequence analysis indicated that one of the fragments encoded a novel human protein (M. Shahrestanifar, D.P.S., L.A.S. and R.D.H., submitted) while the other was the human homologue of the rat r-protein L37a (Tanaka et al., 1989). The hL37a cDNA was about 100 bp shorter than the rat L37a cDNA. In order to obtain a full-length clone, an oligo was synthesized containing 21 nt complementary (a) Isolation and sequencing of hL37a

to the 3’ terminus of hL37a cDNA and a BamHI the 5’ end (5’-CGCrestriction site at GGATCCTTTACATAAATTAACCCATTTATTATAG) and was used as a primer for reverse transcription of SHSYSY poly(A)+mRNA. The first strand cDNA was tailed at the 3’ end with dATP (50 PM) and terminal transferase (15 u, BRL) for 1 h at 37°C and then subjected to PCR using the 3’ hL37a oligo and oligo(dT) as primers. The reaction mixture contained 10 mM TrissHCl (pH 8.3)/50 mM KCl/2 mM MgCl,/200 uM each of dATP, dCTP, dGTP, and TTP/2.5 u of Taq polymerase (Perkin Elmer Cetus) and 0.2 uM of each PCR primer. The cycling program was as follows: 94°C for 30 s, 50°C for 30 s and 72°C for 1 min for 35 cycles, followed by a 10 min extension of prematurely terminated sequences at 72°C. The PCR product (about 400 bp) was directly ligated to pCR II (Invitrogen) and sequenced. The entire nt sequence of hL37a cDNA is shown in Fig. 1. The full-length clone is 366-bp long excluding the poly(A) tail and starts at a C residue. Many r-protein transcripts initiate at C residues that are within polypyrimidine tracts that are flanked by G+C-rich sequences (Mager, 1988). The six pyrimidine residues, CTTTCC, that were present at the 5’ end are characteristic of r-protein cDNAs (Wool et al., 1990) and have been implicated in translational regulation (Levy et al., 1991). A G+C sequence was present two nt upstream of the

c AAG K

RTG

M

ATG M

AF,G AGA I$

R AAG ACA

K

T

R

CGA R

GCT R

c GTG

GCT

T GGC

v

R

G

A GCT GTC A v

A G ACG GTA AK TV K

GAC

CAG

TAG

D

Q

ACGCTCCTCT

c GGG ATC G I

TGG W

GGT G

T CAC H

TGT C

GGT G

TCC S

TGC

180

C

60

c

G

T TCC GCC s A

AA

C GGTTAAT

T GTG V

T

GCC

TGG

ACG

TAC

AAT

RCC

ACT

A

w

T

Y

N

T

T

ATC I

AGA R

AGA R

CTG L

AAG K

-~----c ACTCTTTGAG

T

GC

ACATCACTGG

AC GAG TTG E L

T GC CCTATAATAA

s

225 75

G AAA K

270 90

RTG

322

‘KC

92 CAC TTATGT(A65)

400

Fig. I. Nucleotide sequence of hL37a cDNA and predicted aa sequence. The complete human sequence is compared with the rat sequence; nt that differ are displayed above the corresponding nt of the human sequence. Numbering of aa begins at the Met start codon; the S-UTR is assigned negative numbers. The polypyrimidine tract at the 5’ terminus is underlined. The putative zinc-finger motif is indicated, with relevant aa underlined. The site of a hexanucleotide insertion in the 3’UTR of the human sequence is indicated by an overhead dashed line. The polyadenylation signal is doubly underlined. The sequence has been deposited with GenBank, accession number L22154.

287

AUG start codon, in common with other r-proteins (Mariottini and Amaldi, 1990). The context of the start codon fits the consensus sequence for eukaryotes well (Kozak, 1991). The polyadenylation signal, AATAAA, is present 15 bp upstream of the poly(A) tail. The predicted protein contains 92 aa with an M, of 10277. L37a is highly basic with a net positive charge of + 19, and lacks proline. The cDNA sequence of rat L37a was reported recently (Tanaka et al., 1989). L37a is not homologous to any other r-protein at the nt or aa level. There are 48 nt substitutions in the human transcript in comparison with the rat (85% sequence identity) and the human cDNA contains a six nt insertion in the 3’ UTR. The nt substitutions in the ORF do not change the aa sequence; hL37a is identical in aa sequence to its rat counterpart. The 100% sequence identity between the human and rat proteins suggests that L37a serves a vital role in the functioning of the ribosome and that mutations in the aa sequence are not well tolerated. A domain similar to a zinc finger (Berg, 1990) of the form Cys-Xaa,_Cys-Xaa,,-His-CysXaa,-Cys, exists in the central region of the protein. The intriguing possibility that L37a binds zinc ions and that this domain is an RNA binding site is currently under investigation. Similar putative zinc-finger motifs have been found in the human UbAs2 r-protein and related rproteins from other species that are synthesized as fusion proteins with ubiquitin (see Baker and Board, 1991 and references therein). (b) Steady-state expression of L37a mRNA in rat tissues, human lymphocytes and in human and rat cell lines The distribution of L37a mRNA in rat brain, heart, testis, kidney, epididymis, lung and spleen was examined using Northern blot analysis (Fig. 2). L37a mRNA was found in all tissues examined, as expected, however, when normalized to the level of 18s rRNA, the spleen had the most abundant levels, and the testis the least. The differential distribution is presumably a reflection of the protein synthetic requirements, and hence ribosome abundance, of the various tissues. These data also indicate, however, that the ratio of two ribosomal components, i.e., L37u mRNA and 18s rRNA, is not rigidly held constant in rat tissues. L37u expression was also examined in several human and rat cell lines as well as in normal human lymphocytes (Fig. 3). As shown in Fig. 3, the level of expression of hL37u mRNA in the human neuroblastoma and Molt-4 cells was equivalent and not significantly different from that in normal human lymphocytes but was 20 to 30-fold higher than the level in the rat cell lines. Although the reason for this observation is not clear, it is doubtful that it is due to the use of a heterologous (human) probe to detect rat mRNA in that the L37u mRNAs exhibit 85% sequence identity.

-28s -18s

1234567 Fig. 2. Northern blot analysis of L37a mRNA expression in rat tissues. Total RNA was extracted from male Sprague-Dawley rat (Taconic) tissues using the acid-guanidium isothiocyanate-phenol-chloroform method (Chomczynski and Sacchi, 1987). and relative levels of L37a mRNA and 18s rRNA were determined by Northern blot analysis as previously described (Yin et al., 1992; Rao and Howells, 1992). Total RNA (10 pg per lane) was separated on IO mM methylmercury hydroxide/1.2% agarose gels, and then transferred to Duralon (Stratagene) membranes. Following hybridization with the random primed 3zPlabelled hL37a probe (see Rao and Howells, 1992, for conditions), blots were rehybridized with a probe for 18s rRNA to control for differences in loading and transfer. Following RNAs were analyzed: lanes: 1, brain; 2, spleen; 3, heart; 4, testis; 5, kidney; 6, lung; 7, epididymis. The position of 28s and 18s rRNA are indicated. This experiment was repeated three times with similar results.

(c) PCR analysis for the presence of introns within the human L37a gene PCRs were performed with genomic DNA isolated from SHSYSY neuroblastoma cells and a plasmid containing L37u cDNA, using an 18-mer primer corresponding to the 5’ terminus and the 37-mer primer described previously from the 3’ terminus of hL37u cDNA. The same PCR conditions were used as descibed earlier. As shown in Fig. 4, a DNA fragment of approximately 400 bp was amplified from genomic DNA that comigrated with amplified products from the hL37u cDNA plasmid template, indicating that the hL37u gene lacks introns. No larger DNA fragments were visible in the gel, and when the amplified products were subjected to Southern blot analysis, only the 400-bp bands visible in the gel shown in Fig. 4 hybridized with the L37u probe (data not shown). Given the propensity for r-protein genes to have multiple pseudogene counterparts (Wool et al., 1990) we cannot totally rule out the possibility that a single active hL37u gene contains large introns (for

288

-28s -18s

-18s 123456 Fig. 3. Northern blot analysis of L37a mRNA expression in human and rat cell lines and human lymphocytes. Relative levels of L37a mRNA and 18s rRNA were determined as described in the legend to Fig. 2: lanes: 1, human SHSYSY neuroblastoma cells; 2, rat Cs glioma cells; 3, human Molt4 T cell lymphocytic leukemia cells; 4, rat Morris 7777 hepatoma cells; 5, rat Ros osteosarcoma cells; 6, normal human lymphocytes. The position of 28s and 18s rRNA are indicated. This blot was repeated three times with similar results.

example, spanning > 10 kb) which would be difficult to amplify with PCR, and that the amplified DNA represents more abundant processed pseudogenes. It is worth noting, however, that human r-genes that have been characterized to date, for example, the S14, L7a and S30 genes, were found to span 5.9, 3.2 and 1.9 kb, respectively (Rhoads et al., 1986; Colombo et al., 1991; Kas et al., 1992), which would not pose a problem for the PCR analysis. Other examples of intronless r-protein-encoding genes have been found. Although most of the yeast r-genes contain introns, those encoding L3, L16, S33 and S24 lack introns (Mager, 1988). It will be necessary to ascribe a functional role for L37a in the protein translational machinery. In addition, it will be of interest to clone and sequence the hL37a gene in order to verify the lack of introns, to study the regulation of the gene at the transcriptional and translational levels, to delineate the nucleolar translocation signal within L37a protein, to study the metal binding capacity of the putative zinc-finger domain, and to determine if L37a binds directly to rRNA.

1234 Fig. 4. Lack of introns within the human L37a gene as determined by PCR analysis, Human genomic DNA obtained from SHSYSY neuroblastoma cells and, for comparison, the hL37a cDNA-containing plasmid, were amplified by PCR with primers complementary to the 5’ and 3’ ends of hL37a cDNA. The PCR reaction mixture contained 10 mM Tris*HCI (pH 8.3)/50 mM KCl/2 mM MgClJ200 uM each of dATP, dCTP, dGTP, and TTP/2.5 u of Taq polymerase (Perkin Elmer Cetus)/O.Z uM of each PCR primer. The cycling program was as follows: 94°C for 30 s, 50°C for 30 s and 72°C for 1min for 35 cycles, followed by a 10 min extension of prematurely terminated sequences at 72°C. Aliquots of the PCR reactions were analyzed by electrophoresis on a 1.5% agarose gel and visualized by ethidium bromide staining. Lanes: 1, HindIII-digested h DNA marker; 2, PCR products from genomic DNA, 3, PCR products from hL37u cDNA plasmid; 4, HaeIII-digested +X174 DNA marker. This experiment was repeated three times with the same result.

ACKNOWLEDGEMENTS

The authors wish to thank Dr. Elena Fiorica-Howells for comments on the manuscript. This work was supported by a grant from NIDA, DA 05819.

REFERENCES Aviv, H. and Leder, P.: Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose. Proc. Natl. Acad. Sci. USA 69 (1972) 1408-1411.

289 Baker, R.T. and Board, PG.: The human ubiquitin-52 amino acid fusion protein gene shares several structural features with mammalian ribosomal protein genes. Nucleic Acids Res. 19 (1991) 1035-1040. Berg, J.M.: Zinc fingers and other metal-binding domains. J. Biol. Chem. 265 (1990) 6513-6516. Chomczynski, P. and Sacchi, N.: Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162 (1987) 1566159. Colombo, P., Yon, J. and Fried, M.: The organization and expression of the human L7a ribosomal protein gene. Biochim. Biophys. Acta 1129 (1991) 93-95. Kas, K., Michiels, L. and Merregaert, J.: Genomic structure and expression of the human fau gene: encoding the ribosomal protein S30 fused to a ubiquitin-like protein. Biochem. Biophys. Res. Commun. 187 (1992) 927-933. Kozak, M.: Structural features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem. 266 (1991) 19867-19870. Levy, S., Avni, D., Hariharan, N., Perry, R.P. and Meyuhas, 0.: Oligopyrimidine tract at the 5’ end of mammalian ribosomal protein mRNAs is required for their translational control. Proc. Natl. Acad. Sci. USA 88 (1991) 3319-3323. Libert, F., Parmentier, M., Lefort, A., Dinsart, C., Van Sande, J., Maenhaut, C., Simons, M.-J., Dumont, J.E. and Vassart, G.: Selective amplification and cloning of four new members of the G protein-coupled receptor superfamily. Science 244 (1989) 569-572. Mager, W.H.: Control of ribosomal gene expression. Biochem. Biophys. Acta 949 (1988) 1-15.

Mariottini, P. and Amaldi, F.: The 5’ untranslated region of mRNA for ribosomal protein S19 is involved in its translational regulation during Xenopus development. Mol. Cell. Biol. 10 (1990) 816-822. Rao, S.M. and Howells, R.D.: Molecular cloning, sequence analysis and translation of proenkephalin mRNA from rat heart. Reg. Peptides 40 (1992) 397-408. Rhoads, D.D., Dixit, A. and Roufa, D.J.: Primary structure of human ribosomal protein S14 and the gene that encodes it. Mol. Cell. Biol. 6 (1986) 2774-2783. Ross, R.A., Spengler, B.A. and Biedler, J.L.: Coordinate morphological and biochemical interconversion of human neuroblastoma cells. J. Natl. Cancer Inst. 71 (1983) 741-749. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chaintermination inhibitors, Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Tanaka, T., Aoyama, Y., Chan, Y.-L. and Wool, LG.: The primary structure of rat ribosomal protein L37a. Eur. J. Biochem. 183 (1989) 15-18. Wool, LG., Endo, Y., Chan, Y. and Gluck, A.: Structure, function and evolution of mammalian ribosomes. In: Hill, W.E., Dahlberg, A., Garret, R.A., Moore, P.B., Schlessinger, D. and Warner, R.J. (Eds.), The Ribosome. Am: Sot. Microbial.. Washington, DC, 1990, pp. 203-214. Yin, J., Lee, J.A. and Howells, R.D.: Stimulation of c-fos and c-jun expression and down-regulation of proenkephalin gene expression in C6 glioma cells by endothelin-I. Mol. Brain Res. 14 (1992) 213-220.