- Email: [email protected]
Human STAT1 gain-of-function iPSC line from a patient suffering from chronic mucocutaneous candidiasis
Stem Cell Research 43 (2020) 101713
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Single Cell Line
Human STAT1 gain-of-function iPSC line from a patient suffering from chronic mucocutaneous candidiasis
T
⁎
Kathrin Haakea,b, , Tim Wüstefelda,b, Sylvia Merkertb,c, Doreen Lüttgea,b, Gudrun Göhringd, ⁎ Bernd Auberd, Ulrich Baumanne, Nico Lachmanna,b, a
JRG Translational Hematology of Congenital Diseases, Institute of Experimental Hematology, Hannover Medical School, 30625 Hannover, Germany REBIRTH-Cluster of Excellence, Hannover Medical School, 30625 Hannover, Germany c Leibniz Research Laboratories for Biotechnology and Artificial Organs (LEBAO), Department of Cardiothoracic, Transplantation and Vascular Surgery (HTTG), Hannover Medical School, 30625, Hannover, Germany d Department of Human Genetics, Hannover Medical School, 30625 Hannover, Germany e Department of Paediatric Pulmonology, Allergology and Neonatology, Hannover Medical School, 30625 Hannover, Germany b
A B S T R A C T
Chronic mucocutaneous candidiasis (CMC) is a disease that is characterized by susceptibility to chronic or recurrent infections with Candida spp. due to mutations affecting mainly the IL-17 signaling of T-Cells. The most common etiologies of CMC are gain-of-function (GOF) mutations in the STAT1 gene. In this paper we report the generation of a hiPSC line from a patient suffering from CMC due to a heterozygous GOF STAT1 p.R274Q mutation which can be used for disease modeling purposes.
Resource Table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus
MHHi010-A STAT1_CMC_1 Hannover Medical School PD Dr. Nico Lachmann, [email protected] iPSC Human Age: 17 Sex: Male Ethnicity if known: Caucasian CD34+ cells derived from peripheral blood Clonal 3rd generation SIN-Lentiviral Reprogramming (OSKMIRES-dTomato) Congenital N/A Chronic mucocutaneous candidiasis STAT1, location 2q32.2, c.821G>A (Exon10) p.R274Q GOF N/A N/A
Method of modification Name of transgene or resistance Inducible/constitutive s- N/A ystem Date archived/stock date 17.06.2019
⁎
Cell line repository/bank https://hpscreg.eu/cell-line/MHHi010-A Ethical approval The Local Ethics Committee approved the study and informed consent was obtained from the patient (21272014).
1. Resource utility The established STAT1_CMC iPSC line enables the disease modelling of chronic mucocutaneous candidiasis (CMC) and can be used to gain deeper insights into STAT1 signaling and the disease mechanism of CMC. 2. Resource details Signal transducer and activator of transcription 1 (STAT1) is a major transcription factor that plays an important role in the signalling pathways of many interferons. As a result it is an important part of the immune response, especially to viral, mycobacterial and fungal infections. Gain-of-function (GOF) mutations in STAT1 are the most common etiology causing chronic mucocutaneous candidiasis (CMC), making up more than half of all cases. CMC is characterized by recurrent or chronic infections of the skin, nails and mucous membranes with Candida spp. While infections with Candida spp. are the defining feature, patients can also present with broad clinical manifestations, including bacterial, viral, mycobacterial and other invasive fungal infections, autoimmune
Corresponding authors. E-mail addresses: [email protected] (K. Haake), [email protected] (N. Lachmann).
https://doi.org/10.1016/j.scr.2020.101713 Received 30 September 2019; Received in revised form 18 December 2019; Accepted 14 January 2020 Available online 17 January 2020 1873-5061/ © 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 43 (2020) 101713
K. Haake, et al.
Fig. 1.
therapy helped to regain control of his symptoms. Identification of a STAT1 GOF mutation at age of 17 years confirmed the CMC diagnosis. We reprogrammed isolated CD34+ cells using a 3rd generation SIN lentiviral vector containing OCT4, SOX2, KLF4 and c-MYC coupled to a dTomato via an IRES. After successful reprogramming single clones were established. MHHi010-A showed typical embryonic stem cell like morphology and stained positive for alkaline phosphatase activity (Fig. 1A, scale bars 200 µm). Upregulation of common pluripotency markers could also been seen via flow cytometry (Fig. 1B) and immunocytochemistry (Fig. 1C, scale bars 200 µm). A normal karyotype was confirmed via R-banding (Fig. 1D) and the mutation of the patient (heterozygous STAT1 c.821G>A) was confirmed in the iPSC line using Sanger Sequencing (Fig. 1E). The iPSC line was also tested for mycoplasma and was found negative (Fig. 1G) as compared to a positive (PC) and negative control (NC). STR analysis of the iPSC line has been performed, but because of unavailability of the parent sample, STR analysis of parental DNA has not been submitted. Three germ layer
diseases, aneurysms and tumors (Okada et al., 2016). The mutations mainly affect the Interleukin-17 (IL-17) signaling of T-Cells via the impairment of the dephosphorylation of STAT1. This leads to a hyperphosphorylation of STAT1 Tyr701 in response to IFN-γ, IFN-α/β and IL-27 stimulation which was shown to repress the differentiation of IL17 producing T cells through mechanisms that are not yet completely understood (Liu et al., 2011). We received peripheral blood from a patient suffering from CMC due to a heterozygous STAT1 GOF mutation (STAT1 c.821G>A, p.R274Q). The patient presented at the age of 4 years with chronic fungal infections of the mucous membranes and the skin, including onychomycosis and scalp infection. He had also developed chronic productive bronchitis. As diagnosis of CMC was established, he was commenced on fluconazole and amoxicillin which controlled his symptoms most of the time during childhood and adolescence. At 17 years he again started to have chronic productive cough and was found to have specific antibody deficiency. Immunoglobulin replacement 2
Stem Cell Research 43 (2020) 101713
K. Haake, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis (Immunocytochemistry) Quantitative analysis (Flow cytometry) Karyotype (R-banding) and resolution STR analysis
normal Assess staining/expression of pluripotency markers, positive for: OCT4, NANOG, TRA-1-60, Alkaline Phosphatase TRA-1-60: ≥ 95% SSEA-4: ≥ 95% 46XX, Resolution min 300 bands STR profile for 16 specific sites tested, all matched
Fig. 1 Panel A Fig. 1 Panel A/C
PCR analysis Southern Blot Mycoplasma Embryoid body formation HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping
Heterozygous mutation N/A negative spontaneous in vitro differentiation: endoderm (AFP,), mesoderm (DESMIN, ACTN2/NKX2.5), ectoderm (TUBB3, PAX6) N/A N/A
HLA tissue typing
N/A
Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Fig. 1 Panel B Fig. 1 Panel D Available with the author Fig. 1 Panel E N/A Fig. 1 Panel G Fig. 1 Panel F
PBS containing 10% FCS for 15 min at RT. Incubation with primary antibodies was performed for 1 h RT in PBS with 10% FCS and incubation with secondary antibodies for 30 min RT in PBS with 10% FCS. DAPI nuclear staining was performed 30 min before imaging at a dilution of 1:5000 (stock 10 mg/ml). Cells were analyzed with an Olympus IX71 using the CellSense software. Antibodies are listed in Table 2.
differentiation confirmed pluripotency status further. Spontaneous in vitro differentiation in embryoid bodies showed cells from endoderm (AFP), ectoderm (TUBB3 and PAX6) and mesoderm (DESMIN and ACTN2/NKX2.5) being present (Fig. 1F, scale bars 100 µm). 3. Materials and methods 3.1. Reprogramming
3.4. Alkaline phosphatase staining For the reprogramming peripheral blood from the patient was obtained and peripheral blood mononuclear cells (PBMCs) were isolated. For this the blood was diluted 1:2 and carefully layered on Biocoll for density gradient centrifugation. After PBMCs were collected and washed, CD34+ cells were isolated from the PBMCs using the CD34 MicroBead Kit from Miltenyi Biotec (Cat#130-046-702) following the manufacturer's instructions. Cells were then cultured in StemSpan SFEM (Stem Cell Technologies, Cat# 09650) supplemented with 100 ng/ml SCF, 50 ng/ml TPO, 100 ng/ml FLT3 (StemSpan STF) for 48 h. For reprogramming a 3rd generation SIN lentiviral vector containing OSKM coupled to a dTomato via an IRES was used (Warlich et al., 2011). 200.000 cells were reprogrammed in the same medium using an MOI of 10 and were placed in a reaction tube on a 360° vertical multifunction rotator (PTR-35, Grant Bio) at 2 rpm for 6 h to ensure continuous mixing with the viral particles. Afterwards cells were plated on a suspension plate in a humidified chamber at 37 °C with 5% CO2. After 1d 2 mM valproic acid was added to the cells and after 2d 1 ml StemSpan STF was added. After 5 days cells were transferred on mouse embryonic fibroblasts (MEFs) and medium was gradually changed to hiPSC medium (see below). Single colonies were picked to establish subclones.
For staining of alkaline phosphatase activity, the AP-Kit von StemGent (#00-0009) was used according to the manufacturer's instructions. 3.5. Flow cytometry analysis For flow cytometry assessment of pluripotency markers, cells were treated with TripLE Express (Thermo Fisher # 12605028) for 1-2 min and then defined trypsin inhibitor (Gibco # R007100) was added. Around 106 cells were stained with 1 µl of specific antibody or corresponding amount of isotype for 45 min at 4 °C. After washing cells with PBS, data was acquired at a Cytoflex S (Beckman Coulter) and analyzed using FlowJo 10. 3.6. Spontaneous in vitro differentiation hiPSCs were detached from feeder cells using Collagenase IV, and seeded into ultra-low attachment plates (Corning Inc.) for 7 days in differentiation medium (80% IMDM supplemented with 20% FCS, 1% NEAA, 1 mM L-Glutamine, 0.1 mM β-mercaptoethanol). Formed embryoid bodies were plated in the same differentiation medium onto gelatin-coated cell culture plates for another 14 days before analysis.
3.2. Cell culture conditions hiPSCs were cultured as colonies on MEFs in knockout-DMEM supplemented with 20% knockout serum replacement, 1 mM L-glutamine, 0.1 mM β-mercaptoethanol, 1% nonessential amino acid stock (Invitrogen) and 10 ng/ml b-FGF (supplied by the Institute for Technical Chemistry, Leibniz University Hannover, Germany). Cells were split using Collagenase IV (Gibco #17104019) every 7-10 days in a ratio of 1:20 – 1:50 and cultured in an incubator at 37 °C with 5% CO2.
3.7. Karyotype analysis For Karyotyping, cells were trypsinized and metaphases were prepared according to standard procedures. Fluorescence R-banding using chromomycin A3 and methyl green was performed as described in detail earlier (Schlegelberger et al., 1999). At least 20 metaphase spreads were analyzed and evaluation was carried out at a minimum level of 300 bands. Chromosomes were classified according to the International System for Human Cytogenetic Nomenclature.
3.3. Immunostaining 3.8. Validation of mutation Cells were seeded on a MEF layer on 12-wells and fixed with 4% PFA at room temperature (RT) for 15 min. Cells were then permeabilized with 0,2% Triton-X solution for 15 min at RT and blocked with
gDNA was isolated using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma) according to the manufacturer's instructions. 3
Stem Cell Research 43 (2020) 101713
K. Haake, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Pluripotency Markers
FACS Markers Differentiation Markers
Antibody mouse anti-OCT4 (IgG2b)
Dilution 1:400
Company Cat # and RRID Santa-Cruz Biotechnology Cat# sc-5279 RRID: AB_628051 Santa-Cruz Biotechnology Cat# sc-293121 RRID: AB_2665475 Millipore Cat#: MAB4360 RRID: AB_2119183 Millipore Cat#: MAB4304 RRID: AB_177629 Biolegend Cat# 330609, RRID: AB_1279447 Bioscience Cat# 560126, RRID: AB_1645491 R&D Systems Cat# MAB1368, RRID: AB_357658 ARP American Research Products Cat# 03-10519, RRID: AB_1541098 Millipore Cat# 05-559, RRID: AB_309804 Santa Cruz Biotechnology Cat# sc-14033
mouse anti-NANOG (IgG1)
1:100
mouse anti-TRA-1-60 (IgM)
1:100
mouse anti-SSEA-4 (IgG3)
1:300
mouse mouse mouse mouse
anti-TRA-1-60 (IgM) anti-SSEA-4 (IgG3) anti-AFP (IgG1) anti-DESMIN (IgG1)
1:100 1:100 1:300 1:20
mouse anti-TUBB3 (IgG2a) rabbit anti-NKX2.5
1:400 1:200
mouse anti-ACTN2
1:800
rabbit anti-PAX6
1:300
Alexa Fluor 546 Donkey anti-Mouse IgG (H+L)
1:400
Alexa Fluor 488 goat anti-mouse IgM
1:400
Alexa Fluor 488-AffiniPure Donkey anti-Mouse IgG Alexa Fluor 488-AffiniPure Donkey anti-Mouse IgM Alexa Fluor 488-AffiniPure Donkey anti-Goat IgG Cy™3-AffiniPure Donkey anti-Mouse IgG
1:200
Cy™3-AffiniPure Donkey anti-Goat IgG
1:200
Cy™3-AffiniPure Fab Fragment Donkey antiRabbit IgG Cy™3-AffiniPure Fab Fragment Donkey antiRabbit IgG
1:200
Target STAT1 (425bp)
Forward/Reverse primer (5′-3′) Fwd GCCATGTGGAACTATGTGTC Rev CACCTATTAAACCCTTGTAAATC CGCCTGAGTAGTACGTWCGC YGCCTGRGTAGTACATTCGC CGCCTGAGTAGTATGCTCGC GCGGTGTGTACAARMCCCGA TGGTGCAYGGTTGTCGTCAG GAACGTATTCACCGCRRCATA GAACGTATTCACCGYAGCGTA CGCCTGAGTAGTATGCTCGC GAACGTATTCACCGCRACATG
RRID: AB_650281
Secondary antibodies
Sigma-Aldrich Cat# A7811 RRID: AB_476766 BioLegend Cat# 901301 RRID: AB_2565003 Invitrogen Cat# A10036 RRID: AB_2534012 Invitrogen Cat# A21042 RRID: AB_2535711 Jackson ImmunoResearch RRID:AB_2341099 Jackson ImmunoResearch RRID:AB_2340844 Jackson ImmunoResearch RRID:AB_2336933 Jackson ImmunoResearch RRID:AB_2315777 Jackson ImmunoResearch RRID:AB_2340411 Jackson ImmunoResearch RRID:AB_2340606 Jackson ImmunoResearch RRID:AB_2340606
1:200 1:200 1:200
1:200
Labs Cat# 715-545-151, Labs Cat# 715-545-020, Labs Cat# 705-545-147, Labs Cat# 715-165-151, Labs Cat# 705-165-003, Labs Cat# 711-167-003, Labs Cat# 711-167-003,
Primers Mutation Analysis Mycoplasma test
Outer Xe 49 MycoA Outer Xe 50 MycoA Outer Xe 51 MycoA Outer Xe 52 MycoA Inner Xe 53 MycoA Inner Xe 54 MycoA Inner Xe 55 MycoA Inner Xe 56 MycoA Inner Xe 57 MycoA
control (NC) cells were used as a comparison.
Mutation containing fragment in exon 10 was amplified via PCR with the following parameters: 2 min 94 °C initial denaturation, {30 s 94 °C denaturation, 30 s 58 °C annealing, 30 s 72 °C} for 35 cycles, 7 min 72 °C, hold 4 °C. Primers are listed in Table 2.
Declaration of competing Interest None.
3.9. Mycoplasma test Acknowledgments Cells were tested for mycoplasma contamination via a nested PCR. First gDNA was isolated via ethanol precipitation. Outer PCR was run with the following parameters: 10 min 90 °C initial denaturation, 30 s 94 °C denaturation, 30s 67 °C annealing, 1 min 72 °C for 30 cycles, 10 min 72 °C, hold 4 °C. Inner PCR was run with the following parameters: 10 min 90 °C initial denaturation, {30 s 94 °C denaturation, 30 s 63 °C annealing, 1 min 72 °C} for 30 cycles, 10 min 72 °C, hold 4 °C. PCR product was run on a 1% agarose gel, positive bands were expected at 310-330 bp. Primers are listed in Table 2. Positive (PC) and negative
The authors of this manuscript were supported by grants from the Deutsche Forschungsgemeinschaft: Cluster of Excellence REBIRTH (Exc 62/3) and the grant LA3680/2-1. NL is further supported by the Else Kröner-Fresenius-Stiftung (EKFS): 2015_92 (NL) and the Federal Ministry of Education and Research: 01EK1602A. KH is supported by a scholarship from the Hannover Biomedical Research School, REBIRTH PhD program Regenerative Sciences. TW received a scholarship from the Hannover Biomedical Research School and the MD-stipend of the 4
Stem Cell Research 43 (2020) 101713
K. Haake, et al.
German Centre for Infection Research (DZIF).
Immunol. 5, e114. Liu, L, et al., 2011. Gain-of-function human STAT1 mutations impair IL-17 immunity and underlie chronic mucocutaneous candidiasis. J. Exp. Med. 208, 1635–1648. Warlich, E, et al., 2011. Lentiviral vector design and imaging approaches to visualize the early stages of cellular reprogramming. Mol. Ther. 19, 782–789. Schlegelberger, B, et al., 1999. Diagnostic Cytogenetics. Springer, Berlin Heidelberg, pp. 151–185. https://doi.org/10.1007/978-3-642-59918-7_9.
References Okada, S., Puel, A., Casanova, J.-L., Kobayashi, M., 2016. Chronic mucocutaneous candidiasis disease associated with inborn errors of IL-17 immunity. Clin. Transl.
5
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab Resource: Single Cell Line
Human STAT1 gain-of-function iPSC line from a patient suffering from chronic mucocutaneous candidiasis
T
⁎
Kathrin Haakea,b, , Tim Wüstefelda,b, Sylvia Merkertb,c, Doreen Lüttgea,b, Gudrun Göhringd, ⁎ Bernd Auberd, Ulrich Baumanne, Nico Lachmanna,b, a
JRG Translational Hematology of Congenital Diseases, Institute of Experimental Hematology, Hannover Medical School, 30625 Hannover, Germany REBIRTH-Cluster of Excellence, Hannover Medical School, 30625 Hannover, Germany c Leibniz Research Laboratories for Biotechnology and Artificial Organs (LEBAO), Department of Cardiothoracic, Transplantation and Vascular Surgery (HTTG), Hannover Medical School, 30625, Hannover, Germany d Department of Human Genetics, Hannover Medical School, 30625 Hannover, Germany e Department of Paediatric Pulmonology, Allergology and Neonatology, Hannover Medical School, 30625 Hannover, Germany b
A B S T R A C T
Chronic mucocutaneous candidiasis (CMC) is a disease that is characterized by susceptibility to chronic or recurrent infections with Candida spp. due to mutations affecting mainly the IL-17 signaling of T-Cells. The most common etiologies of CMC are gain-of-function (GOF) mutations in the STAT1 gene. In this paper we report the generation of a hiPSC line from a patient suffering from CMC due to a heterozygous GOF STAT1 p.R274Q mutation which can be used for disease modeling purposes.
Resource Table
Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info
Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus
MHHi010-A STAT1_CMC_1 Hannover Medical School PD Dr. Nico Lachmann, [email protected] iPSC Human Age: 17 Sex: Male Ethnicity if known: Caucasian CD34+ cells derived from peripheral blood Clonal 3rd generation SIN-Lentiviral Reprogramming (OSKMIRES-dTomato) Congenital N/A Chronic mucocutaneous candidiasis STAT1, location 2q32.2, c.821G>A (Exon10) p.R274Q GOF N/A N/A
Method of modification Name of transgene or resistance Inducible/constitutive s- N/A ystem Date archived/stock date 17.06.2019
⁎
Cell line repository/bank https://hpscreg.eu/cell-line/MHHi010-A Ethical approval The Local Ethics Committee approved the study and informed consent was obtained from the patient (21272014).
1. Resource utility The established STAT1_CMC iPSC line enables the disease modelling of chronic mucocutaneous candidiasis (CMC) and can be used to gain deeper insights into STAT1 signaling and the disease mechanism of CMC. 2. Resource details Signal transducer and activator of transcription 1 (STAT1) is a major transcription factor that plays an important role in the signalling pathways of many interferons. As a result it is an important part of the immune response, especially to viral, mycobacterial and fungal infections. Gain-of-function (GOF) mutations in STAT1 are the most common etiology causing chronic mucocutaneous candidiasis (CMC), making up more than half of all cases. CMC is characterized by recurrent or chronic infections of the skin, nails and mucous membranes with Candida spp. While infections with Candida spp. are the defining feature, patients can also present with broad clinical manifestations, including bacterial, viral, mycobacterial and other invasive fungal infections, autoimmune
Corresponding authors. E-mail addresses: [email protected] (K. Haake), [email protected] (N. Lachmann).
https://doi.org/10.1016/j.scr.2020.101713 Received 30 September 2019; Received in revised form 18 December 2019; Accepted 14 January 2020 Available online 17 January 2020 1873-5061/ © 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 43 (2020) 101713
K. Haake, et al.
Fig. 1.
therapy helped to regain control of his symptoms. Identification of a STAT1 GOF mutation at age of 17 years confirmed the CMC diagnosis. We reprogrammed isolated CD34+ cells using a 3rd generation SIN lentiviral vector containing OCT4, SOX2, KLF4 and c-MYC coupled to a dTomato via an IRES. After successful reprogramming single clones were established. MHHi010-A showed typical embryonic stem cell like morphology and stained positive for alkaline phosphatase activity (Fig. 1A, scale bars 200 µm). Upregulation of common pluripotency markers could also been seen via flow cytometry (Fig. 1B) and immunocytochemistry (Fig. 1C, scale bars 200 µm). A normal karyotype was confirmed via R-banding (Fig. 1D) and the mutation of the patient (heterozygous STAT1 c.821G>A) was confirmed in the iPSC line using Sanger Sequencing (Fig. 1E). The iPSC line was also tested for mycoplasma and was found negative (Fig. 1G) as compared to a positive (PC) and negative control (NC). STR analysis of the iPSC line has been performed, but because of unavailability of the parent sample, STR analysis of parental DNA has not been submitted. Three germ layer
diseases, aneurysms and tumors (Okada et al., 2016). The mutations mainly affect the Interleukin-17 (IL-17) signaling of T-Cells via the impairment of the dephosphorylation of STAT1. This leads to a hyperphosphorylation of STAT1 Tyr701 in response to IFN-γ, IFN-α/β and IL-27 stimulation which was shown to repress the differentiation of IL17 producing T cells through mechanisms that are not yet completely understood (Liu et al., 2011). We received peripheral blood from a patient suffering from CMC due to a heterozygous STAT1 GOF mutation (STAT1 c.821G>A, p.R274Q). The patient presented at the age of 4 years with chronic fungal infections of the mucous membranes and the skin, including onychomycosis and scalp infection. He had also developed chronic productive bronchitis. As diagnosis of CMC was established, he was commenced on fluconazole and amoxicillin which controlled his symptoms most of the time during childhood and adolescence. At 17 years he again started to have chronic productive cough and was found to have specific antibody deficiency. Immunoglobulin replacement 2
Stem Cell Research 43 (2020) 101713
K. Haake, et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis (Immunocytochemistry) Quantitative analysis (Flow cytometry) Karyotype (R-banding) and resolution STR analysis
normal Assess staining/expression of pluripotency markers, positive for: OCT4, NANOG, TRA-1-60, Alkaline Phosphatase TRA-1-60: ≥ 95% SSEA-4: ≥ 95% 46XX, Resolution min 300 bands STR profile for 16 specific sites tested, all matched
Fig. 1 Panel A Fig. 1 Panel A/C
PCR analysis Southern Blot Mycoplasma Embryoid body formation HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping
Heterozygous mutation N/A negative spontaneous in vitro differentiation: endoderm (AFP,), mesoderm (DESMIN, ACTN2/NKX2.5), ectoderm (TUBB3, PAX6) N/A N/A
HLA tissue typing
N/A
Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
Fig. 1 Panel B Fig. 1 Panel D Available with the author Fig. 1 Panel E N/A Fig. 1 Panel G Fig. 1 Panel F
PBS containing 10% FCS for 15 min at RT. Incubation with primary antibodies was performed for 1 h RT in PBS with 10% FCS and incubation with secondary antibodies for 30 min RT in PBS with 10% FCS. DAPI nuclear staining was performed 30 min before imaging at a dilution of 1:5000 (stock 10 mg/ml). Cells were analyzed with an Olympus IX71 using the CellSense software. Antibodies are listed in Table 2.
differentiation confirmed pluripotency status further. Spontaneous in vitro differentiation in embryoid bodies showed cells from endoderm (AFP), ectoderm (TUBB3 and PAX6) and mesoderm (DESMIN and ACTN2/NKX2.5) being present (Fig. 1F, scale bars 100 µm). 3. Materials and methods 3.1. Reprogramming
3.4. Alkaline phosphatase staining For the reprogramming peripheral blood from the patient was obtained and peripheral blood mononuclear cells (PBMCs) were isolated. For this the blood was diluted 1:2 and carefully layered on Biocoll for density gradient centrifugation. After PBMCs were collected and washed, CD34+ cells were isolated from the PBMCs using the CD34 MicroBead Kit from Miltenyi Biotec (Cat#130-046-702) following the manufacturer's instructions. Cells were then cultured in StemSpan SFEM (Stem Cell Technologies, Cat# 09650) supplemented with 100 ng/ml SCF, 50 ng/ml TPO, 100 ng/ml FLT3 (StemSpan STF) for 48 h. For reprogramming a 3rd generation SIN lentiviral vector containing OSKM coupled to a dTomato via an IRES was used (Warlich et al., 2011). 200.000 cells were reprogrammed in the same medium using an MOI of 10 and were placed in a reaction tube on a 360° vertical multifunction rotator (PTR-35, Grant Bio) at 2 rpm for 6 h to ensure continuous mixing with the viral particles. Afterwards cells were plated on a suspension plate in a humidified chamber at 37 °C with 5% CO2. After 1d 2 mM valproic acid was added to the cells and after 2d 1 ml StemSpan STF was added. After 5 days cells were transferred on mouse embryonic fibroblasts (MEFs) and medium was gradually changed to hiPSC medium (see below). Single colonies were picked to establish subclones.
For staining of alkaline phosphatase activity, the AP-Kit von StemGent (#00-0009) was used according to the manufacturer's instructions. 3.5. Flow cytometry analysis For flow cytometry assessment of pluripotency markers, cells were treated with TripLE Express (Thermo Fisher # 12605028) for 1-2 min and then defined trypsin inhibitor (Gibco # R007100) was added. Around 106 cells were stained with 1 µl of specific antibody or corresponding amount of isotype for 45 min at 4 °C. After washing cells with PBS, data was acquired at a Cytoflex S (Beckman Coulter) and analyzed using FlowJo 10. 3.6. Spontaneous in vitro differentiation hiPSCs were detached from feeder cells using Collagenase IV, and seeded into ultra-low attachment plates (Corning Inc.) for 7 days in differentiation medium (80% IMDM supplemented with 20% FCS, 1% NEAA, 1 mM L-Glutamine, 0.1 mM β-mercaptoethanol). Formed embryoid bodies were plated in the same differentiation medium onto gelatin-coated cell culture plates for another 14 days before analysis.
3.2. Cell culture conditions hiPSCs were cultured as colonies on MEFs in knockout-DMEM supplemented with 20% knockout serum replacement, 1 mM L-glutamine, 0.1 mM β-mercaptoethanol, 1% nonessential amino acid stock (Invitrogen) and 10 ng/ml b-FGF (supplied by the Institute for Technical Chemistry, Leibniz University Hannover, Germany). Cells were split using Collagenase IV (Gibco #17104019) every 7-10 days in a ratio of 1:20 – 1:50 and cultured in an incubator at 37 °C with 5% CO2.
3.7. Karyotype analysis For Karyotyping, cells were trypsinized and metaphases were prepared according to standard procedures. Fluorescence R-banding using chromomycin A3 and methyl green was performed as described in detail earlier (Schlegelberger et al., 1999). At least 20 metaphase spreads were analyzed and evaluation was carried out at a minimum level of 300 bands. Chromosomes were classified according to the International System for Human Cytogenetic Nomenclature.
3.3. Immunostaining 3.8. Validation of mutation Cells were seeded on a MEF layer on 12-wells and fixed with 4% PFA at room temperature (RT) for 15 min. Cells were then permeabilized with 0,2% Triton-X solution for 15 min at RT and blocked with
gDNA was isolated using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma) according to the manufacturer's instructions. 3
Stem Cell Research 43 (2020) 101713
K. Haake, et al.
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Pluripotency Markers
FACS Markers Differentiation Markers
Antibody mouse anti-OCT4 (IgG2b)
Dilution 1:400
Company Cat # and RRID Santa-Cruz Biotechnology Cat# sc-5279 RRID: AB_628051 Santa-Cruz Biotechnology Cat# sc-293121 RRID: AB_2665475 Millipore Cat#: MAB4360 RRID: AB_2119183 Millipore Cat#: MAB4304 RRID: AB_177629 Biolegend Cat# 330609, RRID: AB_1279447 Bioscience Cat# 560126, RRID: AB_1645491 R&D Systems Cat# MAB1368, RRID: AB_357658 ARP American Research Products Cat# 03-10519, RRID: AB_1541098 Millipore Cat# 05-559, RRID: AB_309804 Santa Cruz Biotechnology Cat# sc-14033
mouse anti-NANOG (IgG1)
1:100
mouse anti-TRA-1-60 (IgM)
1:100
mouse anti-SSEA-4 (IgG3)
1:300
mouse mouse mouse mouse
anti-TRA-1-60 (IgM) anti-SSEA-4 (IgG3) anti-AFP (IgG1) anti-DESMIN (IgG1)
1:100 1:100 1:300 1:20
mouse anti-TUBB3 (IgG2a) rabbit anti-NKX2.5
1:400 1:200
mouse anti-ACTN2
1:800
rabbit anti-PAX6
1:300
Alexa Fluor 546 Donkey anti-Mouse IgG (H+L)
1:400
Alexa Fluor 488 goat anti-mouse IgM
1:400
Alexa Fluor 488-AffiniPure Donkey anti-Mouse IgG Alexa Fluor 488-AffiniPure Donkey anti-Mouse IgM Alexa Fluor 488-AffiniPure Donkey anti-Goat IgG Cy™3-AffiniPure Donkey anti-Mouse IgG
1:200
Cy™3-AffiniPure Donkey anti-Goat IgG
1:200
Cy™3-AffiniPure Fab Fragment Donkey antiRabbit IgG Cy™3-AffiniPure Fab Fragment Donkey antiRabbit IgG
1:200
Target STAT1 (425bp)
Forward/Reverse primer (5′-3′) Fwd GCCATGTGGAACTATGTGTC Rev CACCTATTAAACCCTTGTAAATC CGCCTGAGTAGTACGTWCGC YGCCTGRGTAGTACATTCGC CGCCTGAGTAGTATGCTCGC GCGGTGTGTACAARMCCCGA TGGTGCAYGGTTGTCGTCAG GAACGTATTCACCGCRRCATA GAACGTATTCACCGYAGCGTA CGCCTGAGTAGTATGCTCGC GAACGTATTCACCGCRACATG
RRID: AB_650281
Secondary antibodies
Sigma-Aldrich Cat# A7811 RRID: AB_476766 BioLegend Cat# 901301 RRID: AB_2565003 Invitrogen Cat# A10036 RRID: AB_2534012 Invitrogen Cat# A21042 RRID: AB_2535711 Jackson ImmunoResearch RRID:AB_2341099 Jackson ImmunoResearch RRID:AB_2340844 Jackson ImmunoResearch RRID:AB_2336933 Jackson ImmunoResearch RRID:AB_2315777 Jackson ImmunoResearch RRID:AB_2340411 Jackson ImmunoResearch RRID:AB_2340606 Jackson ImmunoResearch RRID:AB_2340606
1:200 1:200 1:200
1:200
Labs Cat# 715-545-151, Labs Cat# 715-545-020, Labs Cat# 705-545-147, Labs Cat# 715-165-151, Labs Cat# 705-165-003, Labs Cat# 711-167-003, Labs Cat# 711-167-003,
Primers Mutation Analysis Mycoplasma test
Outer Xe 49 MycoA Outer Xe 50 MycoA Outer Xe 51 MycoA Outer Xe 52 MycoA Inner Xe 53 MycoA Inner Xe 54 MycoA Inner Xe 55 MycoA Inner Xe 56 MycoA Inner Xe 57 MycoA
control (NC) cells were used as a comparison.
Mutation containing fragment in exon 10 was amplified via PCR with the following parameters: 2 min 94 °C initial denaturation, {30 s 94 °C denaturation, 30 s 58 °C annealing, 30 s 72 °C} for 35 cycles, 7 min 72 °C, hold 4 °C. Primers are listed in Table 2.
Declaration of competing Interest None.
3.9. Mycoplasma test Acknowledgments Cells were tested for mycoplasma contamination via a nested PCR. First gDNA was isolated via ethanol precipitation. Outer PCR was run with the following parameters: 10 min 90 °C initial denaturation, 30 s 94 °C denaturation, 30s 67 °C annealing, 1 min 72 °C for 30 cycles, 10 min 72 °C, hold 4 °C. Inner PCR was run with the following parameters: 10 min 90 °C initial denaturation, {30 s 94 °C denaturation, 30 s 63 °C annealing, 1 min 72 °C} for 30 cycles, 10 min 72 °C, hold 4 °C. PCR product was run on a 1% agarose gel, positive bands were expected at 310-330 bp. Primers are listed in Table 2. Positive (PC) and negative
The authors of this manuscript were supported by grants from the Deutsche Forschungsgemeinschaft: Cluster of Excellence REBIRTH (Exc 62/3) and the grant LA3680/2-1. NL is further supported by the Else Kröner-Fresenius-Stiftung (EKFS): 2015_92 (NL) and the Federal Ministry of Education and Research: 01EK1602A. KH is supported by a scholarship from the Hannover Biomedical Research School, REBIRTH PhD program Regenerative Sciences. TW received a scholarship from the Hannover Biomedical Research School and the MD-stipend of the 4
Stem Cell Research 43 (2020) 101713
K. Haake, et al.
German Centre for Infection Research (DZIF).
Immunol. 5, e114. Liu, L, et al., 2011. Gain-of-function human STAT1 mutations impair IL-17 immunity and underlie chronic mucocutaneous candidiasis. J. Exp. Med. 208, 1635–1648. Warlich, E, et al., 2011. Lentiviral vector design and imaging approaches to visualize the early stages of cellular reprogramming. Mol. Ther. 19, 782–789. Schlegelberger, B, et al., 1999. Diagnostic Cytogenetics. Springer, Berlin Heidelberg, pp. 151–185. https://doi.org/10.1007/978-3-642-59918-7_9.
References Okada, S., Puel, A., Casanova, J.-L., Kobayashi, M., 2016. Chronic mucocutaneous candidiasis disease associated with inborn errors of IL-17 immunity. Clin. Transl.
5