- Email: [email protected]
Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles
Biochemical and Biophysical Research Communications xxx (2016) 1e8
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles Salma Teimoori a, Watee Seesuay a, Surasak Jittavisutthikul a, Urai Chaisri b, Nitat Sookrung c, Jaslan Densumite a, d, Nawannaporn Saelim a, Monrat Chulanetra a, Santi Maneewatch e, Wanpen Chaicumpa a, * a
Center of Research Excellence on Therapeutic Proteins and Antibody Engineering, Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 10700, Thailand Department of Tropical Pathology, Faculty of Tropical Medicine, Mahidol University, Bangkok, 10400, Thailand c Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 10700, Thailand d Graduate Program in Immunology, Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 10700, Thailand e Department of Tropical Molecular Biology and Genetics, Faculty of Tropical Medicine, Mahidol University, Bangkok, 10400, Thailand b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 August 2016 Accepted 12 September 2016 Available online xxx
A direct acting anti-Ebola agent is needed. VP40, a conserved protein across Ebolavirus (EBOV) species has several pivotal roles in the virus life cycle. Inhibition of VP40 functions would lessen the virion integrity and interfere with the viral assembly, budding, and spread. In this study, cell penetrable human scFvs (HuscFvs) that bound to EBOV VP40 were produced by phage display technology. Gene sequences coding for VP40-bound-HuscFvs were subcloned from phagemids into protein expression plasmids downstream to a gene of cell penetrating peptide, i.e., nonaarginine (R9). By electron microscopy, transbodies from three clones effectively inhibited egress of the Ebola virus-like particles from human hepatic cells transduced with pseudo-typed-Lentivirus particles carrying EBOV VP40 and GP genes. Computerized simulation indicated that the effective HuscFvs bound to multiple basic residues in the cationic patch of VP40 C-terminal domain which are important in membrane-binding for viral matrix assembly and virus budding. The transbodies bound also to VP40 N-terminal domain and L domain peptide encompassed the PTAPPEY (WW binding) motif, suggesting that they might confer VP40 function inhibition through additional mechanism(s). The generated transbodies are worthwhile tested with authentic EBOV before developing to direct acting anti-Ebola agent for preclinical and clinical trials. © 2016 Published by Elsevier Inc.
Keywords: Cell penetrating antibody (transbody) Ebola virus Human scFv Scanning electron microscopy Virus-like particles VP40
1. Introduction Ebolavirus (EBOV) causes a highly contagious zoonotic disease, Ebola viral disease (EVD), in humans and other primates. Although natural outbreak of the EVD is still limited to Africa, rapid and convenient ways of people communication, high viral transmissibility, and high mortality rate have made the EVD a serious global health threat. Currently, there is no effective direct acting anti-EBOV drug. EVD patients received only palliative therapy. VP40, the most abundant protein in the EBOV particle acquires different structural rearrangements in the infected cells and plays
* Corresponding author. Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, 2 Wanglung Road, Bangkok, 10700, Thailand. E-mail address: [email protected] (W. Chaicumpa).
several pivotal activities in the viral life cycle [1,2]. Crystallographic study revealed that VP40 molecule contains two differently folded domains, i.e., N-terminal (NTD) and C- terminal (CTD), connected by a flexible linker [3]. In cytoplasm, VP40 forms homodimers through NTD hydrophobic interface contact: L117 of one monomer is inserted into a hydrophobic pocket formed by H61, A55, M116, and F108 of another [2]. A motif (7PTAPPEY13) in the VP40 NTD late (L) domain interacts with some cellular proteins that have type IWW-domain including mammalian ubiquitin ligase (Nedd4/Rsp5), Tsg101, and Vps4 [4e6]. The protein-protein interaction causes translocation of the VP40 dimers to the plasma membrane (PM) [2,7]. Upon arrival at the PM, VP40 uses a CTD cationic patch (K221, K224, K225, K270, K274 and K275) to latch with the negatively charged-lipid bilayers and polymerizes to generate a multilayered, filamentous matrix where viral assembly and budding take place [2,7,8]. In the infected cells, VP40 forms octameric ring with specific
http://dx.doi.org/10.1016/j.bbrc.2016.09.052 0006-291X/© 2016 Published by Elsevier Inc.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
2
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
RNA binding property [9]. VP40 expression in mammalian cells generates virus-like particles (VLPs) that are morphologically indistinguishable from the infectious EBOV [10,11]. Co-expression of VP40 and GP improved the VLP formation [12]. VP40 is an attractive target of direct acting anti-EBOV agents [5,13] as interference with the protein's activities should lead to virion weakening, inhibition of EBOV assembly and budding, and hence reduction of the viral load. In this study, cell penetrable human scFvs (transbodies) that interacted with the membrane lipidbinding sites of the VP40 CTD and inhibited egress of the Ebola VLPs were produced. This is the first report on human antibodies that target intracellular EBOV VP40.
2. Materials and methods 2.1. Preparations of VP40 proteins/peptides Consensus sequences coding for full-length Zaire EBOV VP40 (326 residues), truncated NTD (residues G44-T195; DNTD), and CTD (residues P196-L326) in pET23aþ were synthesized (GenScript). The recombinant plasmids were put separately into BL21 (DE3) E. coli. Transformed bacteria were cultured in LB-A broth containing 0.5 mM IPTG. Recombinant 6 His tag-proteins were purified from the respective E. coli homogenates using affinity beads (Clontech) and verified by mass spectrometry. A VP40 peptide (M1-S24) encompassed WW-binding motif
[7PTAPPEY13] in the VP40 L domain [4] was synthesized (>97% purity; 1st BASE, Malaysia).
2.2. Preparation of cell penetrable HuscFvs (transbodies) to VP40 Phage clones displaying VP40-bound HuscFvs were selected from a HuscFv phage display library [14] by phage-panning using rVP40 as antigen [15]. The rVP40-bound phages were put in HB2151 E. coli. Phage-transformed bacterial colonies were screened for HuscFv genes (huscfvs) by direct colony PCR using pCANTAB5E phagemid specific primers [14]. The huscfv-positive clones were grown in 2 YT-AG broths containing 0.05 mM IPTG. Soluble HuscFvs in the bacterial lysates were tested for binding to rVP40 by indirect ELISA. Genes coding the rVP40 bound-HuscFvs were sequenced, deduced, and canonical CDRs and FRs of all sequences were determined (International Immunogenetics Information System). To produce transbodies, huscfvs were linked to DNA coding for R9 using ligase independent cloning (LIC) method (Thermo Fisher). The huscfvs in pCANTAB5E were amplified by using Q5 DNA polymerase and primers: forward-R9-scfv-LIC:50 -GTTGGGAATTGCAACGTCGCCGTCGCTCGCCGTCGCCGTCGCCGTGCGGC CCAGCCCGGCC-30 and reverse-E-tag-LIC: 50 -GGAGATGGGAAGTCATTAACGCGGTTCCAGCGGATCC-3’. The amplified R9-huscfvs-E-tag DNAs were cloned into pLATE52® downstream of T7 promoter, 6 His tag, and T7 tag. Recombinant huscfv-pLATE52 were put into Rosetta™ 2 (DE3) E. coli (Novagen) and the bacteria
Fig. 1. Recombinant VP40, rDNTD, and rCTD and R9-HuscFvs. (A) Stained SDS-PAGE-separated rVP40. M, protein marker; 1, homogenate of VP40-pET21aþ transformed-BL21 (DE3) E. coli; 2, purified E. coli inclusion body; 3, purified, refolded rVP40. (B) M, protein marker; 1 and 2, purified rDNTD and rCTD, respectively. (C) Amplicons of huscfvs (~1000 bp) in phage-transformed-HB2151 E. coli. M, DNA marker; 1e36, huscfv amplicons of representative E. coli clones. (D) Indirect ELISA for binding of HuscFvs in lysates of E. coli clones to rVP40, control BSA, and HB (lysate of original HB2151 E. coli). (E) Western blotting: SDS-PAGE-separated-rVP40 probed with R9-HuscFvs. M, protein standard; 1, rVP40 blot probed with PAb (positive control); 2e5, VP40 blots probed with R9-HuscFv 8, -23, and 119, and control R9-HuscFv, respectively. Numbers at the left of (A), (B), and (E), protein masses in kDa; numbers at the left of (C), DNA sizes in bp.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
3
Table 1 Binding of the R9-HuscFvs to L domain peptide, recombinant DN-terminal (I) domain, and recombinant C-terminal (M) domain of EBOV VP40. HuscFv
Indirect ELISA OD405nm against Peptide of N-tail (L domain) (M1-S24)
8 23 119
0.08 0.10 0.10
a
Recombinant DN-terminal (I) domain (G44-T195)
Recombinant C-terminal (M) domain (P196-L326)
0.77 0.79 0.74
0.88 0.94 0.92
L, late; I, interactive; M, membrane-binding. a OD405nm after subtracting background signal.
were grown at 37 C overnight on LB agar plates containing 100 mg/ ml of ampicillin and 34 mg/ml of chloramphenicol. Colonies positive for R9-huscfv plasmids were grown under 1 mM IPTG induction for 3 h. The E-tagged-R9-HuscFvs were purified from the E. coli homogenates by using affinity resin. 2.3. Mouse polyclonal antibody to rVP40 Siriraj Animal Ethic Committee, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand (SI-ACUP 011/ 2559) approved the experiment. Ten adult BALB/c mice were individually immunized intraperitoneally with rVP40 (10 mg) mixed with alum (Pierce). Three booster doses of 20 mg rVP40 were given at 14 day-intervals. Mice were bled on day 7 post-last booster. Polyclonal IgG (PAb) was extracted from the immune sera by 50% saturated ammonium sulfate precipitation. 2.4. Indirect ELISA ELISA wells coated individually with 1 mg rVP40, rDNTD, rCTD, or
PTAPPEY peptide were incubated at 37 C, 1 h with antibody preparations. Controls, either original HB2151 E. coli lysate (HB) or control antibody and PBS (blank) were included. All wells were then washed with PBST, added sequentially with rabbit anti-E tag or mouse anti-6 His (Abcam), horseradish-peroxidase (HRP) conjugated-anti-isotype (Southern Biotech), and ABTS (KPL) with incubation and washing between the steps. OD405nm was determined against blank. 2.5. Western blot analysis (WB) SDS-PAGE-separated rVP40 was blotted onto a nitrocellulose membrane, blocked with 5% skim milk and air-dried. The membrane was cut vertically into strips and incubated with antibody or appropriate controls. Rabbit anti-E tag (Abcam), alkaline phosphatase conjugated-goat anti-rabbit immunoglobulin (Southern Biotech), and BCIP/NBT (KPL) were used for revealing the antigenantibody reactive bands. 2.6. Generation of pseudo-typed Lentivirus particles carrying EBOV VP40 and GP RNAs Complementary DNA coding for Zaire EBOV VP40-IRES-GP was synthesized (GenScript) and subcloned into pLVX-Puro vector backbone to generate pLVX-Puro-ZVP40-IRES-ZGP. HEK293 cells grown in 100 mm-cell culture dish (5 106 cells/well) were cotransfected with 7 mg/ml pLVX-Puro-ZVP40-IRES-ZGP and integrase deficient-Lenti-X HTX packaging mix using Xfect transfection solution. After 48 h of incubation at 37 C, 5% CO2 atmosphere, the pseudo-typed Lentivirus particles carrying EBOV VP40 and GP RNAs that budded-out from the cells were observed by using scanning electron microscopy (SEM). The remaining portion of the preparation was centrifuged gently and the viral particles in the supernatant were titrated with Lenti-X GoStix provided in the Lenti-X Lentiviral expression kit. 2.7. VP40 neutralization assay
Fig. 2. SEM of Ebola VLPs budded from Huh7 cells co-transfected with pLVX-PuroZVP40-IRES-ZGP and Lenti-X™ Lentiviral Expression System.
Huh7 cells maintained in serum supplemented-DMEM in a Transwell plate (2 105 cells/well) were added with pseudo-typed Lentivirus particles carrying EBOV VP40 and GP RNAs (MOI 0.5). The plate was centrifuged to facilitate the viral entry (spinoculation) at 1400 g, 30 C, 1 h. Culture supernatants were removed; the cells were replenished with fresh medium containing 40 mg of individual VP40 bound-R9-HuscFvs (tests) or control R9-HuscFv (background inhibition control). Transduced cells in medium only and non-transduced cells were included. The plate was kept in 37 C, 5% CO2 incubator for 48 h. Culture supernatants were collected, treated separately with M-per mammalian protein extraction reagent, and amounts of VP40 were determined by sandwich ELISA. The cells in the Transwells were subjected to SEM for determining VLP budding.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
4
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
Fig. 3. (A) SEM of Ebola VLPs budded from Huh7 cells transduced with Lentiviral particles carrying EBOV VP40-GP genes after treating with medium, control R9-HuscFv, and VP40specific R9-HuscFvs (8, 23, and 119). Upper panels: 1000; lower panels: 5000. (B) Sandwich ELISA OD405nm for determining VP40 in culture supernatants of variously treatedtransduced cells. N, non-transduced cells.*, different significantly at p < 0.05; NS, not different significantly.
2.8. Sandwich ELISA One hundred ml of M-per reagent treated-culture fluids were added to ELISA wells pre-coated individually with 1 mg of mouse anti-VP40 PAb and incubated at 37 C, 1 h. After washing with PBST, 10 mg of purified E-tagged-VP40-bound HuscFv were added to appropriate wells and incubated at 37 C, 1 h. Wells were washed and added sequentially with rabbit anti-E tag, HRP conjugated-goat anti-rabbit immunoglobulin, and ABTS with incubation and washing between the steps. The OD405nm was recorded. The sandwich ELISA precision was determined by testing individual samples 20 times and percent coefficient of variation was calculated. 2.9. Scanning electron microscopy (SEM) Cells transduced with pseudo-typed Lentivirus particles carrying the EBOV VP40 and GP genes that received treatment with R9-HuscFvs and controls were fixed in 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) containing 5% glucose at 4 C. They were then washed, dehydrated in ethanol gradients, and dried (critical point drying, Hitachi HCP-2, Japan). The dried samples were placed
in aluminum stubs, coated with gold particles (an ion coater, Emitech K 500, UK), and observed under a scanning electron microscope (JEOL, Model JSM-6610LV, Japan) at 5 kV accelerating potential. 2.10. Determination of VP40-presumptive residues bound by HuscFvs Computerized simulation was performed for predicting VP40 residues that formed interface contact with the HuscFvs. VP40 structure (4LDB) was used. However, in the case that the HuscFvs happened to dock on some residues located in the unstructured region of the 4LDB, complete VP40 sequence was subjected for 3D structure modeling by the I-TASSER server [16,17]. Amino acid sequences coding for HuscFvs were modeled also by the I-TASSER server. After improving the physical quality of the I-TASSER predicted 3D models using Mod-Refiner algorithm, the low freeenergy conformations were further refined by full-atomic simulations using Fragment Guide Molecular Dynamics Simulation (FGMD) [18,19]. The FG-MD as a molecular dynamics-based algorithm for atomic-level protein structure modification refined the protein
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
5
Table 2 Presumptive residues and regions of the VP40 that formed contact interface with HuscFvs. Modeled VP40
HuscFv8
Interactive bond(s)
Amino acid
Motif
Amino acid(s)
Domain(s)
Q103 K104 T105 Y106 P143 D144 D193 T195 K221 K224 K274
NTD NTD NTD NTD NTD NTD NTD/CTD linker NTD/CTD linker CTD basic patch CTD basic patch CTD basic patch
N28 N28 Y32 R101 F100 R101 W102 R101 Y52/D54/W102 W33/D57 D54/D55
VH-CDR1 VH-CDR1 VH-CDR1 VH-CDR3 VH-CDR3 VH-CDR3 VH-CDR3 VH-CDR3 VH-CDR2/VH-CDR2/VH-CDR3 VH-CDR1/VH-CDR2 VH-CDR2/VH-CDR2/VH-CDR3
Modeled VP40
HuscFv23
Interactive bond(s)
Amino acid
Motif
Amino acid(s)
Domain(s)
P66 K221 K224 T272 G273 K274
NTD CTD basic patch CTD basic patch CTD CTD CTD basic patch
Y54 P106 S195/G209 S173 Y235 D111/Y175
VH-CDR2 VH-CDR3 VL-CDR2/VL-FR3 VL-CDR1 VL-CDR3 VH-CDR3/VLCDR1
Amino acid
Motif
Amino acid(s)
Domain(s)
G67 T197 G198 S199 K221 G223 K224 N227 K274 K275
NTD NTD/CTD linker NTD/CTD linker NTD/CTD linker CTD basic patch CTD CTD basic patch CTD CTD basic patch CTD basic patch
G26/T28 K192 K192 D170 P102 Y107 S52/D57 T104 T30/N31 G54
VH-CDR1/VH-CDR1 VL-CDR2 VL-CDR2 VL-CDR1 VH-CDR3 VH-CDR3 VH-CDR2/VH-CDR2 VH-CDR3 VH-CDR1/VH-CDR1 VH-CDR2
Modeled VP40
HuscFv119
3D models to be closer to their native structures. Also by using the FG-MD, the steric clash was avoided and the hydrogen binding network was improved. The refined HuscFvs models and the VP40 model/structure were docked according to the PIPER Fast Fourier Transform-based program. The antibody mode of ClusPro 2.0 antibody-protein docking was used [20]. The largest cluster size with minimal local energy and protein conformation near to native state was subjected further for antibody-protein interaction simulation (Molecular Dynamics program). Pymol software (PyMOL Molecular Graphics System, Version 1.3r1 edu, Schrodinger, LLC) was used for building and visualizing the intermolecular interaction. 2.11. Statistical analysis Means and standard deviations of tests and controls were compared (unpaired t-test). P < 0.05 was significantly different.
H-bond H-bond H-bond H-bond CH-p Salt bridge/H-bond H-bond H-bond H-bond/H-bond/Cation-p CH-P/Salt bridge H-bond/Salt bridge
CH-P H-bond H-bond/H-bond H-bond H-bond Salt bridge/H-bond Interactive bond(s)
H-bond/H-bond H-bond H-bond H-bond Van de Waals H-bond H-bond/Salt bridge H-bond H-bond/H-bond H-bond
in Fig. 1C. Lysates of 6 phage-transformed-E. coli clones (6, 8, 23, 61, 89, and 119) gave significant indirect ELISA signals to rVP40 above the controls (HB and BSA) (Fig. 1D). After sequencing, nucleotide sequences of all clones contained complete sequences coding for VH and VL domains with linker nucleotides in between. The R9HuscFv6, R9-HuscFv8, R9-HuscFv23, R9-HuscFv61, R9-HuscFV89 and R9-HuscFV119 were expressed, purified and refolded from the inclusion bodies of the respective plasmid-transformed Rosetta2 E. coli clones and were retested for rVP40 binding by WB. R9HuscFv 8, -23, and 119 bound to the rVP40 (Fig. 1E), indicating the proper protein refolding. R9-HuscFvs of other clones did not bind to the VP40 (data not shown). The VP40 L domain peptide, rDNTD, and rCTD were used as antigens in indirect ELISA for testing the region(s) of VP40 bound by individual R9-HuscFvs. As shown in Table 1, R9-HuscFv 8, 23, and 119 bound to the rDNTD and the rCTD. Also, they gave ELISA signal to the L domain peptide. 3.3. Ebola VLPs
3. Results 3.1. Recombinant VP40, DNTD, and CTD
Fig. 2 illustrates Ebola VLPs budded out from the cells cotransfected with pLVX-Puro-ZVP40-IRES-ZGP and Lenti-X™ Lentiviral Expression System.
Fig. 1A and 1B show SDS-PAGE-separated-rVP40 and rDNTD and rCTD purified from transformed BL21 (DE3) E. coli homogenates, respectively.
3.4. Inhibition of VLP egress by transbodies to VP40
3.2. Cell penetrating HuscFvs to VP40 Representative huscfv amplicons (~1000 bp) from HB2151 E. coli clones that were infected with the VP40-bound phages are shown
Numerous VLPs budded out from Huh7 cells transduced with the pseudo-typed Lentivirus particles carrying the EBOV VP40-GP RNAs that were maintained in the medium alone (Fig. 3A, medium) and in the medium containing control R9-HuscFv (Fig. 3A, control). There were far fewer VLPs from transduced cells treated
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
6
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
Fig. 4. Computerized interface contact between VP40 (pink area on light brown VP40 3D structure) and HuScFvs (green). (A) HuscFv8, (B) HuscFV23, and (C) HuscFv119. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
with R9-HuscFv8, R9-HuscFv23, and R9-HuscFv119 (Fig. 3A, 8, 23, and 119). Fig. 3B shows VP40 amounts in the cultured fluids of the transduced-Huh7 cells treated with R9-HuscFvs and controls. The most VP40 amount was contained in culture supernatants of transduced cells in medium alone. Culture supernatants of the transduced cells treated with R9-HuscFv8, R9-HuscFv23 and R9HuscFv119 had the least VP40 amounts and significantly less than the two controls (p < 0.05). 3.5. Predicted VP40 residues and regions bound by HuscFvs Table 2 and Fig. 4 give details on VP40 residues and regions that formed interface contact with the HuscFvs. The HuscFv8, HuscFv23, and HuscFv119 docked on several residues of the CTD cationic patch that are important for membrane-binding of the VP40
dimers, i.e., K221, K224, and K274 for HuscFv8 and HuscFv23 and K221, K224, K274, and K275 for HuscFv119. These antibodies also interacted with some NTD residues. The putative amino acids of the three HuscFvs involved in the interaction with the VP40 were all insilico mutated to alanines. After the mutations, different docking results were obtained. The mutated HuscFvs did not bind to the same residues of the VP40 as the parental antibodies, notably the CTD basic patch important for the VP40 latching on the plasma membrane (Supplementary Table 1 and Supplementary Fig. 1). Although the HuscFvs of clones 8, 23, and 119 bound similarly to the VP40 CTD basic patch and NTD, their CDRs, especially CDRs 2 and 3 are highly diverse and only one residue (D57) of VH-CDR2 of HuscFv8 and HuscFv119 are identically bound by salt bridge to K224 of the VP40. Supplementary Tables 2 and 3 show percent identity of FRs and CDRs of all three HuscFvs.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
4. Discussion Attempts have been made to prevent and treat EBOV infection [5,13]. Small molecular inhibitors and antibodies prevented EBOV binding to cellular receptors [21e25]. EBOV infection was reduced after inhibiting host cellular kinases [26,27]. Non-human primates were protected against lethal Zaire EBOV infections by antisense phosphorodiamidate morpholino oligomers specific to VP24, VP35 and L polymerase [28,29] and nucleoside analogue [30]. Lipid encapsulated-siRNA targeting EBOV polymerase, VP24, and VP35 protected macaques against EBOV lethal challenge [31]. However, none of the mentioned protocols showed robust protective/therapeutic efficacy. Antibodies used previously in the passive immunization against the EVD were conventional four-chain antibodies or Fab fragments that targeted the virus GP protein. They functioned extracellularly and are inaccessible to the intracellular viral proteins. Human antibodies that are readily accessible to the intracellular targets should be more appropriate and safe for postexposure treatment of virus infections. In this study, human transbodies in the form of R9-linked human scFvs that target EBOV VP40 were produced and tested for their ability to inhibit the Ebola VLP budding. Targeting virus assembly, morphogenesis, and egress by inhibitors is a feasible therapeutic approach. N-terminal domain of Tsg101 (ubiquitin-conjugating enzyme) which bound PTAP motif of HIV-1 late domain (p6) blocked the viral budding [32]. Inhibitors of influenza virus neuraminidase block the late stage of the viral life cycle and are in clinical use [33]. For EVD, antibodies that interfere with VP40 functions would halt or slow down the virus budding and spread which would allow more time for the host immune system to operate and control the infection [5]. In this study, Huh7 cells transduced with pseudo-typed Lentivirus particles carrying EBOV VP40 and GP genes efficiently produced Ebola VLPs that morphologically resemble the infectious EBOV which verified the previous notion. The experiments using VLPs that mimic the authentic EBOV budding process can be performed conveniently under BSL-2 condition. By SEM, the R9HuscFvs effectively inhibited the VLP budding from the Huh7 cells transduced with the pseudo-typed Lentivirus particles carrying EBOV VP40 and GP genes. In addition to the VLPs, distinct monomeric VP40 can be secreted also from the cells [34]. The finding that culture supernatants (treated with M-per protein extraction reagent to extract VP40 from the VLPs; hence the sample contained secreted- and VLP-derived VP40) of the specific transbody-treated cells contained less amounts of VP40 than controls indicating that the transbodies interfered with the VLP budding and perhaps also the VP40 secretion. In order to gain some insight into the molecular mechanisms of the R9-HuscFv-mediated inhibitions of the VLP budding, the regions of the VP40 bound by the HuscFvs were determined by means of indirect ELISA using rDNTD and rCTD as well as late (L) domain peptide. Moreover, presumptive residues of the VP40 that formed contact interface with the HuscFvs were determined by computerized simulation. The HuscFvs were found to interact with several lysine residues of the highly conserved CTD cationic patch important for plasma membrane (PM)-binding of the dimeric VP40. Previous data demonstrated that the VLP budding was abrogated when the positive charge in the positions 224, 225, 274 and 275 were changed to neutral or negative charges [2]. Thus, the effectiveness of the R9HuscFvs on the VLP budding inhibition observed in this study should be (at least partly, if not solely) attributable to interference with the PM-binding of the VP40 dimers, a prerequisite step for subsequent viral matrix assembly and membrane curvature generation mediated by adjacent CTD hydrophobic loop formed by L203, I237, M241, M305 and I307 [8,35]. The computerized results were conformed to the indirect ELISA results on the CTD binding.
7
Besides, the R9-HuscFvs bound also to the VP40 NTD and the late domain PTAPPEY peptide (WW-binding motif) suggesting that their specific epitopes are conformational (formed by residues of different VP40 regions that are spatially juxtaposed upon protein folding) and the antibodies might exert the VP40 inhibitory activity through additional mechanism(s). In conclusions, human transbodies produced in this study effectively inhibited egress of Ebola VLPs from mammalian cells. Computerized simulation predicted that the antibodies interacted with residues crucial for latching of dimeric VP40 on plasma membrane, the prerequisite step for subsequent viral matrix assembly, membrane curvature formation, and progeny virus budding. Although molecular mechanism(s) awaits detailed laboratory investigation, the transbodies are worthwhile tested further against the authentic EBOV before developing to a direct acting anti-Ebola agent for preclinical and clinical trials. Conflict of interests The authors declare no conflict of interest. Acknowledgements The work was supported by Faculty of Medicine Siriraj Hospital, Mahidol University (R015834001) and NSTDA Chair Professor grant (P-1450624) funded by the Crown Property Bureau. Thanks are due to Professors Drs. Udom Kachintorn, Sansanee Chaiyaroj, Prasit Watanapa, and Ruengpung Sutthent for encouragements; Dr. Thawornchai Limjindaporn for providing the Huh7 cells. Monrat Chulanetra and Nitat Sookrung are MRG and RSA scholars of the Thailand Research Fund, respectively. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.09.052. References [1] J. Timmins, R.W.H. Ruigrok, W. Weissenhorn, Structural studies on the Ebola virus matrix protein VP40 indicate that matrix proteins of enveloped RNA viruses are analogues but not homologues, FEMS Microbiol. Lett. 23 (2004) 179e186. [2] Z.A. Bomholdt, T. Noda, D.M. Abelson, P. Halfmann, M.R. Wood, Y. Kawaoka, E.O. Saphire, Structural rearrangement of Ebola virus VP40 begets multiple functions in the virus life cycle, Cell 154 (2013) 763e774. [3] A. Dessen, V. Volchkov, O. Dolnik, H.D. Klenk, W. Weissenhorn, Crystal structure of the matrix protein VP40 from Ebola virus, EMBO J. 19 (2000) 4228e4236. [4] R.N. Harty, M.E. Brown, G. Wang, J. Huibregtse, F.P. Hayes, A PPxY motif within the VP40 protein of Ebola virus interacts physically and functionally with a ubiquitin ligase: implications for filovirus budding, Proc. Nat. Acad. Sci. U.S.A. 97 (2000) 13871e13876. [5] R.N. Harty, No exit: targeting the budding process to inhibit filovirus replication, Antivir. Res. 81 (2009) 189e197. [6] J. Timmins, G. Schoehn, S. Ricard-Blum, S. Scianimanico, T. Vernet, R.W. Ruigrok, W. Weissenhorn, Ebola virus matrix protein VP40 interaction with human cellular factor Tsg101 and Nedd4, J. Mol. Biol. 326 (2003), 493452. [7] R.W. Ruigrok, G. Schoehn, A. Dessen, E. Forest, V.E. Volchkov, O. Dolnik, H.D. Klenk, W. Weissenhorn, Structural characterization and membrane binding properties of the matrix protein VP40 of Ebola virus, J. Mol. Biol. 300 (2000) 103e112. [8] E. Adu-Gyamfi, S.P. Soni, Y. Xue, M.A. Digma, E. Gratton, R.V. Stahelin, The Ebola virus matrix protein penetrates into the plasma membrane: a key step in viral protein 40 (VP40) oligomerization and viral egress, J. Biol. Chem. 288 (2013) 5779e5789. [9] F.X. Gomis-Rueth, A. Dessen, J. Timmins, A. Bracher, L. Kolesnikowa, S. Becker, H.D. Klenk W. Weissenhorn, The matrix protein VP40 from Ebola virus octamerizes into pore-like structures with specific RNA binding properties, Structure 11 (2003) 423e433. [10] K.L. Warfield, C.M. Bosio, B.C. Welcher, E.M. Deal, M. Mohammadzadeh, A. Schmaljohn, M.J. Aman, S. Bavari, Ebola virus-like particles protect from
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
8
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
[11] [12]
[13] [14]
[15]
[16] [17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
lethal Ebola virus infection, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 15889e15894. R.F. Johnson, P. Bell, R.N. Harty, Effect of Ebola virus proteins GP, NP and VP35 on VP40 VLP morphology, Virol. J. 3 (2006) 31. T. Noda, H. Sagara, E. Suzuki, A. Takeda, H. Kida, Y. Kawaoka, Ebola virus VP40 drives the formation of virus-like filamentous particles along with GP, J. Virol. 76 (2002) 4855e4865. R.V. Stahelin, Could the Ebola virus matrix protein VP40 be a drug target? Exp. Opin. Ther. Target 18 (2014) 115e120. K. Kulkeaw, Y. Sakolvaree, P. Srimanote, P. Tongtawe, S. Maneewatch, N. Sookrung, A. Tungtrongchitr, P. Tapchaisri, H. Kurazono, W. Chaicumpa, Human monoclonal ScFv neutralize lethal Thai cobra, Naja kaouthia, neurotoxin, J. Proteomics 72 (2009) 270e282. K. Glab-ampai, A.A. Malik, M. Chulantera, J. Thanongsaksrikul, K. Thueng-in, P. Srimanote, P. Tongtawe, W. Chaicumpa, Inhibition of HCV replication by humanized-single domain transbodies to NS4B, Biochem. Biophys. Res. Com. 476 (2016) 654e664. Y. Zhang, I-TASSER server for protein 3D structure prediction, BMC Bioinform. 9 (2008), http://dx.doi.org/10.1186/1471-2105-9-40. A. Roy, A. Kucukural, Y. Zhang, I-TASSER: a unified platform for automated protein structure and function prediction, Nat. Protoc. 5 (2010) 725e738. D. Xu, Y. Zhang, Improving the physical realism and structural accuracy of protein models by a two-step atomic-level energy minimization, Biophys. J. 101 (2011) 2525e2534. J. Zhang, Y. Liang, Y. Zhang, Atomic-level protein structure refinement using fragment-guided molecular dynamics conformation sampling, Structure 19 (2011) 1784e1795. D. Kozakov, D. Beglov, T. Bohnuud, S.E. Mottarella, B. Xia, R. David, D.R. Hall, S. Vajda, How good is automated protein docking? Prot. Struct. Funct. Bioinform 81 (2013) 2159e2166. M. Cote, J. Misasi, T. Ren, A. Bruchez, K. Kyungae Lee, C.M. Filone, L. Hensley, Q. Qi Li, D. Ory, K. Chandran, J. Cunningham, Small molecular inhibitors reveal Niemann-Pick C1 is essential for Ebola virus infection, Nature 77 (2011) 344e348. X. Qiu, J.B. Alimont, P.L. Melito, L.F. Fernando, U. Stroher, S.M. Jones, Characterization of Zaire Ebolavirus glycoprotein-specific-monoclonal antibodies, Clin. Immunol. 141 (2011) 218e227. X. Qiu, L. Fernando, L. Melito, J. Audet, H. Feldmann, G. Kobinger, J.B. Alimonti, S.M. Jones, Ebola GP-specific monoclonal antibodies protect mice and Guineapigs from lethal Ebola virus infection, PLoS Negl. Trop. Dis. 6 (2012) e1575. X. Qiu, G. Wong, J. Audet, A. Bello, L. Fernando, J.B. Alimonti, H. FaustherBovendo, H. Wei, J. Aviles, E. Hiatt, A. Johnson, J. Morton, K. Swope, O. Bohorov, N. Bohorova, C. Goodman, D. Kim, M.H. Pauly, J. Velasco, J. Pettitt, G.G. Olinger, K. Whaley, B. Xu, J.E. Strong, L. Zeitlin, G.P. Kobinger, Reversion of
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33] [34]
[35]
advanced Ebola virus disease in nonhuman primates with ZMapp, Nature 100 (2014), http://dx.doi.org/10.1038/nature13777. J. Pettitt, L. Zeitlin, H. Kim do, C. Working, J.C. Johnson, O. Bohorov, B. Bratcher, E. Hiatt, S.D. Hume, A.K. Johnson, J. Morton, M.H. Pauly, K.J. Whaley, M.F. Ingram, F.A. Zovanyi, M. Heinrich, A. Piper, J. Zelko, G.G. Olinger, Therapeutic intervention of Ebola virus infection in rhesus macaques with the MB003 monoclonal antibody cocktail, Sci. Transl. Med. 5 (2013) 199ra113, http:// dx.doi.org/10.1126/scitranslmed.3006608. M. Garcia, A. Cooper, W. Shi, Productive replication of Ebola virus is regulated by the c-Abl1 tyrosine kinase, Sci. Trans. Med. 4 (2012), http://dx.doi.org/ 10.1126/scitranslmed.3003500, 123 (123ra24). A.A. Kolokolstov, S. Adkhikary, J. Garver, L. Johnson, R.A. Davey, E.M. Vela, Inhibition of Lassa virus and Ebola virus infection in host cells treated with the kinase inhibitors genistein and tyrophostin, Arch. Virol. 157 (2012) 121e127. K.L. Warfield, D.L. Swenson, G.G. Olinger, D.K. Nichols, W.D. Pratt, R. Blouch, D.A. Stein, M.J. Aman, P.L. Iversen, S. Bavari, Gene-specific countermeasures against Ebola virus based on antisense phosphorodiamidate morpholino oligomers, PLoS Pathog. 2 (2006) e1, http://dx.doi.org/10.1371/ journal.ppat.0020001. T.K. Warren, K.L. Warfield, J. Wells, D.L. Swenson, K.S. Donner, S.A. Van Tongeren, N.L. Garza, L. Dong, D.V. Mourich, S. Crumley, D.K. Nichols, P.L. Iversen, S. Bavari, Advanced antisense therapies for post exposure protection against lethal filovirus infections, Nat. Med. 16 (2010) 991e994. T.K. Warren, J. Well, R.G. Panchal, K.S. Stuthman, N.L. Garza, S.A. Van Tongeren, L. Dong, C.J. Retterer, B.P. Eaton, G. Pegoraro, S. Honnold, S. Bantia, P. Kotian, X. Chen, B.R. Taubenheim, L.S. Welch, D.M. Minning, Y.S. Babu, W.P. Sheridan, S. Bavari, Protection against filovirus diseases by a novel broadspectrum nucleoside analogue BCX4430, Nature 508 (2014) 402e405. T.W. Geisbert, A.C.H. Lee, M. Robbins, J.B. Geisbert, A.N. Honko, V. Sood, J.C. Johnson, S. de Jong, I. Tavakoli, A. Judge, L. Hensley, I. MacLachlan, Postexposure protection of non-human primates against a lethal Ebola virus challenge with RNA interference: a proof-of-concept study, Lancet 375 (2010) 1896e1905. D.G. Demirov, A. Ono, J.M. Orenstein, E.O. Freed, Overexpression of the Nterminal domain of Tsg101 inhibits HIV-1 budding by blocking late domain function, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 955e960. E. Krol, M. Rychlowska, B. Szewczyk, Antiviralscurrent trend in fighting influenza, Acta Biochim. Pol. 61 (2014) 495e504. O. Reynold, S.P. Reid, A. Page, M. Mateo, N. Alazard-Dany, H. Raoul, C.F. Basler, V.E. Volchkov, Unconventional secretion of Ebola virus matrix protein VP40, J. Infect. Dis. 204 (Suppl. 3) (2011) S833eS839. S.P. Soni, E. Adu-Gyamfi, S.S. Yong, C.S. Jee, R.V. Stahelin, Ebola virus matrix protein deeply penetrates the plasma membrane: an important step in viral egress, Biophys. J. 104 (2013) 1940e1949.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles Salma Teimoori a, Watee Seesuay a, Surasak Jittavisutthikul a, Urai Chaisri b, Nitat Sookrung c, Jaslan Densumite a, d, Nawannaporn Saelim a, Monrat Chulanetra a, Santi Maneewatch e, Wanpen Chaicumpa a, * a
Center of Research Excellence on Therapeutic Proteins and Antibody Engineering, Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 10700, Thailand Department of Tropical Pathology, Faculty of Tropical Medicine, Mahidol University, Bangkok, 10400, Thailand c Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 10700, Thailand d Graduate Program in Immunology, Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 10700, Thailand e Department of Tropical Molecular Biology and Genetics, Faculty of Tropical Medicine, Mahidol University, Bangkok, 10400, Thailand b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 August 2016 Accepted 12 September 2016 Available online xxx
A direct acting anti-Ebola agent is needed. VP40, a conserved protein across Ebolavirus (EBOV) species has several pivotal roles in the virus life cycle. Inhibition of VP40 functions would lessen the virion integrity and interfere with the viral assembly, budding, and spread. In this study, cell penetrable human scFvs (HuscFvs) that bound to EBOV VP40 were produced by phage display technology. Gene sequences coding for VP40-bound-HuscFvs were subcloned from phagemids into protein expression plasmids downstream to a gene of cell penetrating peptide, i.e., nonaarginine (R9). By electron microscopy, transbodies from three clones effectively inhibited egress of the Ebola virus-like particles from human hepatic cells transduced with pseudo-typed-Lentivirus particles carrying EBOV VP40 and GP genes. Computerized simulation indicated that the effective HuscFvs bound to multiple basic residues in the cationic patch of VP40 C-terminal domain which are important in membrane-binding for viral matrix assembly and virus budding. The transbodies bound also to VP40 N-terminal domain and L domain peptide encompassed the PTAPPEY (WW binding) motif, suggesting that they might confer VP40 function inhibition through additional mechanism(s). The generated transbodies are worthwhile tested with authentic EBOV before developing to direct acting anti-Ebola agent for preclinical and clinical trials. © 2016 Published by Elsevier Inc.
Keywords: Cell penetrating antibody (transbody) Ebola virus Human scFv Scanning electron microscopy Virus-like particles VP40
1. Introduction Ebolavirus (EBOV) causes a highly contagious zoonotic disease, Ebola viral disease (EVD), in humans and other primates. Although natural outbreak of the EVD is still limited to Africa, rapid and convenient ways of people communication, high viral transmissibility, and high mortality rate have made the EVD a serious global health threat. Currently, there is no effective direct acting anti-EBOV drug. EVD patients received only palliative therapy. VP40, the most abundant protein in the EBOV particle acquires different structural rearrangements in the infected cells and plays
* Corresponding author. Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, 2 Wanglung Road, Bangkok, 10700, Thailand. E-mail address: [email protected] (W. Chaicumpa).
several pivotal activities in the viral life cycle [1,2]. Crystallographic study revealed that VP40 molecule contains two differently folded domains, i.e., N-terminal (NTD) and C- terminal (CTD), connected by a flexible linker [3]. In cytoplasm, VP40 forms homodimers through NTD hydrophobic interface contact: L117 of one monomer is inserted into a hydrophobic pocket formed by H61, A55, M116, and F108 of another [2]. A motif (7PTAPPEY13) in the VP40 NTD late (L) domain interacts with some cellular proteins that have type IWW-domain including mammalian ubiquitin ligase (Nedd4/Rsp5), Tsg101, and Vps4 [4e6]. The protein-protein interaction causes translocation of the VP40 dimers to the plasma membrane (PM) [2,7]. Upon arrival at the PM, VP40 uses a CTD cationic patch (K221, K224, K225, K270, K274 and K275) to latch with the negatively charged-lipid bilayers and polymerizes to generate a multilayered, filamentous matrix where viral assembly and budding take place [2,7,8]. In the infected cells, VP40 forms octameric ring with specific
http://dx.doi.org/10.1016/j.bbrc.2016.09.052 0006-291X/© 2016 Published by Elsevier Inc.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
2
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
RNA binding property [9]. VP40 expression in mammalian cells generates virus-like particles (VLPs) that are morphologically indistinguishable from the infectious EBOV [10,11]. Co-expression of VP40 and GP improved the VLP formation [12]. VP40 is an attractive target of direct acting anti-EBOV agents [5,13] as interference with the protein's activities should lead to virion weakening, inhibition of EBOV assembly and budding, and hence reduction of the viral load. In this study, cell penetrable human scFvs (transbodies) that interacted with the membrane lipidbinding sites of the VP40 CTD and inhibited egress of the Ebola VLPs were produced. This is the first report on human antibodies that target intracellular EBOV VP40.
2. Materials and methods 2.1. Preparations of VP40 proteins/peptides Consensus sequences coding for full-length Zaire EBOV VP40 (326 residues), truncated NTD (residues G44-T195; DNTD), and CTD (residues P196-L326) in pET23aþ were synthesized (GenScript). The recombinant plasmids were put separately into BL21 (DE3) E. coli. Transformed bacteria were cultured in LB-A broth containing 0.5 mM IPTG. Recombinant 6 His tag-proteins were purified from the respective E. coli homogenates using affinity beads (Clontech) and verified by mass spectrometry. A VP40 peptide (M1-S24) encompassed WW-binding motif
[7PTAPPEY13] in the VP40 L domain [4] was synthesized (>97% purity; 1st BASE, Malaysia).
2.2. Preparation of cell penetrable HuscFvs (transbodies) to VP40 Phage clones displaying VP40-bound HuscFvs were selected from a HuscFv phage display library [14] by phage-panning using rVP40 as antigen [15]. The rVP40-bound phages were put in HB2151 E. coli. Phage-transformed bacterial colonies were screened for HuscFv genes (huscfvs) by direct colony PCR using pCANTAB5E phagemid specific primers [14]. The huscfv-positive clones were grown in 2 YT-AG broths containing 0.05 mM IPTG. Soluble HuscFvs in the bacterial lysates were tested for binding to rVP40 by indirect ELISA. Genes coding the rVP40 bound-HuscFvs were sequenced, deduced, and canonical CDRs and FRs of all sequences were determined (International Immunogenetics Information System). To produce transbodies, huscfvs were linked to DNA coding for R9 using ligase independent cloning (LIC) method (Thermo Fisher). The huscfvs in pCANTAB5E were amplified by using Q5 DNA polymerase and primers: forward-R9-scfv-LIC:50 -GTTGGGAATTGCAACGTCGCCGTCGCTCGCCGTCGCCGTCGCCGTGCGGC CCAGCCCGGCC-30 and reverse-E-tag-LIC: 50 -GGAGATGGGAAGTCATTAACGCGGTTCCAGCGGATCC-3’. The amplified R9-huscfvs-E-tag DNAs were cloned into pLATE52® downstream of T7 promoter, 6 His tag, and T7 tag. Recombinant huscfv-pLATE52 were put into Rosetta™ 2 (DE3) E. coli (Novagen) and the bacteria
Fig. 1. Recombinant VP40, rDNTD, and rCTD and R9-HuscFvs. (A) Stained SDS-PAGE-separated rVP40. M, protein marker; 1, homogenate of VP40-pET21aþ transformed-BL21 (DE3) E. coli; 2, purified E. coli inclusion body; 3, purified, refolded rVP40. (B) M, protein marker; 1 and 2, purified rDNTD and rCTD, respectively. (C) Amplicons of huscfvs (~1000 bp) in phage-transformed-HB2151 E. coli. M, DNA marker; 1e36, huscfv amplicons of representative E. coli clones. (D) Indirect ELISA for binding of HuscFvs in lysates of E. coli clones to rVP40, control BSA, and HB (lysate of original HB2151 E. coli). (E) Western blotting: SDS-PAGE-separated-rVP40 probed with R9-HuscFvs. M, protein standard; 1, rVP40 blot probed with PAb (positive control); 2e5, VP40 blots probed with R9-HuscFv 8, -23, and 119, and control R9-HuscFv, respectively. Numbers at the left of (A), (B), and (E), protein masses in kDa; numbers at the left of (C), DNA sizes in bp.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
3
Table 1 Binding of the R9-HuscFvs to L domain peptide, recombinant DN-terminal (I) domain, and recombinant C-terminal (M) domain of EBOV VP40. HuscFv
Indirect ELISA OD405nm against Peptide of N-tail (L domain) (M1-S24)
8 23 119
0.08 0.10 0.10
a
Recombinant DN-terminal (I) domain (G44-T195)
Recombinant C-terminal (M) domain (P196-L326)
0.77 0.79 0.74
0.88 0.94 0.92
L, late; I, interactive; M, membrane-binding. a OD405nm after subtracting background signal.
were grown at 37 C overnight on LB agar plates containing 100 mg/ ml of ampicillin and 34 mg/ml of chloramphenicol. Colonies positive for R9-huscfv plasmids were grown under 1 mM IPTG induction for 3 h. The E-tagged-R9-HuscFvs were purified from the E. coli homogenates by using affinity resin. 2.3. Mouse polyclonal antibody to rVP40 Siriraj Animal Ethic Committee, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand (SI-ACUP 011/ 2559) approved the experiment. Ten adult BALB/c mice were individually immunized intraperitoneally with rVP40 (10 mg) mixed with alum (Pierce). Three booster doses of 20 mg rVP40 were given at 14 day-intervals. Mice were bled on day 7 post-last booster. Polyclonal IgG (PAb) was extracted from the immune sera by 50% saturated ammonium sulfate precipitation. 2.4. Indirect ELISA ELISA wells coated individually with 1 mg rVP40, rDNTD, rCTD, or
PTAPPEY peptide were incubated at 37 C, 1 h with antibody preparations. Controls, either original HB2151 E. coli lysate (HB) or control antibody and PBS (blank) were included. All wells were then washed with PBST, added sequentially with rabbit anti-E tag or mouse anti-6 His (Abcam), horseradish-peroxidase (HRP) conjugated-anti-isotype (Southern Biotech), and ABTS (KPL) with incubation and washing between the steps. OD405nm was determined against blank. 2.5. Western blot analysis (WB) SDS-PAGE-separated rVP40 was blotted onto a nitrocellulose membrane, blocked with 5% skim milk and air-dried. The membrane was cut vertically into strips and incubated with antibody or appropriate controls. Rabbit anti-E tag (Abcam), alkaline phosphatase conjugated-goat anti-rabbit immunoglobulin (Southern Biotech), and BCIP/NBT (KPL) were used for revealing the antigenantibody reactive bands. 2.6. Generation of pseudo-typed Lentivirus particles carrying EBOV VP40 and GP RNAs Complementary DNA coding for Zaire EBOV VP40-IRES-GP was synthesized (GenScript) and subcloned into pLVX-Puro vector backbone to generate pLVX-Puro-ZVP40-IRES-ZGP. HEK293 cells grown in 100 mm-cell culture dish (5 106 cells/well) were cotransfected with 7 mg/ml pLVX-Puro-ZVP40-IRES-ZGP and integrase deficient-Lenti-X HTX packaging mix using Xfect transfection solution. After 48 h of incubation at 37 C, 5% CO2 atmosphere, the pseudo-typed Lentivirus particles carrying EBOV VP40 and GP RNAs that budded-out from the cells were observed by using scanning electron microscopy (SEM). The remaining portion of the preparation was centrifuged gently and the viral particles in the supernatant were titrated with Lenti-X GoStix provided in the Lenti-X Lentiviral expression kit. 2.7. VP40 neutralization assay
Fig. 2. SEM of Ebola VLPs budded from Huh7 cells co-transfected with pLVX-PuroZVP40-IRES-ZGP and Lenti-X™ Lentiviral Expression System.
Huh7 cells maintained in serum supplemented-DMEM in a Transwell plate (2 105 cells/well) were added with pseudo-typed Lentivirus particles carrying EBOV VP40 and GP RNAs (MOI 0.5). The plate was centrifuged to facilitate the viral entry (spinoculation) at 1400 g, 30 C, 1 h. Culture supernatants were removed; the cells were replenished with fresh medium containing 40 mg of individual VP40 bound-R9-HuscFvs (tests) or control R9-HuscFv (background inhibition control). Transduced cells in medium only and non-transduced cells were included. The plate was kept in 37 C, 5% CO2 incubator for 48 h. Culture supernatants were collected, treated separately with M-per mammalian protein extraction reagent, and amounts of VP40 were determined by sandwich ELISA. The cells in the Transwells were subjected to SEM for determining VLP budding.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
4
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
Fig. 3. (A) SEM of Ebola VLPs budded from Huh7 cells transduced with Lentiviral particles carrying EBOV VP40-GP genes after treating with medium, control R9-HuscFv, and VP40specific R9-HuscFvs (8, 23, and 119). Upper panels: 1000; lower panels: 5000. (B) Sandwich ELISA OD405nm for determining VP40 in culture supernatants of variously treatedtransduced cells. N, non-transduced cells.*, different significantly at p < 0.05; NS, not different significantly.
2.8. Sandwich ELISA One hundred ml of M-per reagent treated-culture fluids were added to ELISA wells pre-coated individually with 1 mg of mouse anti-VP40 PAb and incubated at 37 C, 1 h. After washing with PBST, 10 mg of purified E-tagged-VP40-bound HuscFv were added to appropriate wells and incubated at 37 C, 1 h. Wells were washed and added sequentially with rabbit anti-E tag, HRP conjugated-goat anti-rabbit immunoglobulin, and ABTS with incubation and washing between the steps. The OD405nm was recorded. The sandwich ELISA precision was determined by testing individual samples 20 times and percent coefficient of variation was calculated. 2.9. Scanning electron microscopy (SEM) Cells transduced with pseudo-typed Lentivirus particles carrying the EBOV VP40 and GP genes that received treatment with R9-HuscFvs and controls were fixed in 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) containing 5% glucose at 4 C. They were then washed, dehydrated in ethanol gradients, and dried (critical point drying, Hitachi HCP-2, Japan). The dried samples were placed
in aluminum stubs, coated with gold particles (an ion coater, Emitech K 500, UK), and observed under a scanning electron microscope (JEOL, Model JSM-6610LV, Japan) at 5 kV accelerating potential. 2.10. Determination of VP40-presumptive residues bound by HuscFvs Computerized simulation was performed for predicting VP40 residues that formed interface contact with the HuscFvs. VP40 structure (4LDB) was used. However, in the case that the HuscFvs happened to dock on some residues located in the unstructured region of the 4LDB, complete VP40 sequence was subjected for 3D structure modeling by the I-TASSER server [16,17]. Amino acid sequences coding for HuscFvs were modeled also by the I-TASSER server. After improving the physical quality of the I-TASSER predicted 3D models using Mod-Refiner algorithm, the low freeenergy conformations were further refined by full-atomic simulations using Fragment Guide Molecular Dynamics Simulation (FGMD) [18,19]. The FG-MD as a molecular dynamics-based algorithm for atomic-level protein structure modification refined the protein
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
5
Table 2 Presumptive residues and regions of the VP40 that formed contact interface with HuscFvs. Modeled VP40
HuscFv8
Interactive bond(s)
Amino acid
Motif
Amino acid(s)
Domain(s)
Q103 K104 T105 Y106 P143 D144 D193 T195 K221 K224 K274
NTD NTD NTD NTD NTD NTD NTD/CTD linker NTD/CTD linker CTD basic patch CTD basic patch CTD basic patch
N28 N28 Y32 R101 F100 R101 W102 R101 Y52/D54/W102 W33/D57 D54/D55
VH-CDR1 VH-CDR1 VH-CDR1 VH-CDR3 VH-CDR3 VH-CDR3 VH-CDR3 VH-CDR3 VH-CDR2/VH-CDR2/VH-CDR3 VH-CDR1/VH-CDR2 VH-CDR2/VH-CDR2/VH-CDR3
Modeled VP40
HuscFv23
Interactive bond(s)
Amino acid
Motif
Amino acid(s)
Domain(s)
P66 K221 K224 T272 G273 K274
NTD CTD basic patch CTD basic patch CTD CTD CTD basic patch
Y54 P106 S195/G209 S173 Y235 D111/Y175
VH-CDR2 VH-CDR3 VL-CDR2/VL-FR3 VL-CDR1 VL-CDR3 VH-CDR3/VLCDR1
Amino acid
Motif
Amino acid(s)
Domain(s)
G67 T197 G198 S199 K221 G223 K224 N227 K274 K275
NTD NTD/CTD linker NTD/CTD linker NTD/CTD linker CTD basic patch CTD CTD basic patch CTD CTD basic patch CTD basic patch
G26/T28 K192 K192 D170 P102 Y107 S52/D57 T104 T30/N31 G54
VH-CDR1/VH-CDR1 VL-CDR2 VL-CDR2 VL-CDR1 VH-CDR3 VH-CDR3 VH-CDR2/VH-CDR2 VH-CDR3 VH-CDR1/VH-CDR1 VH-CDR2
Modeled VP40
HuscFv119
3D models to be closer to their native structures. Also by using the FG-MD, the steric clash was avoided and the hydrogen binding network was improved. The refined HuscFvs models and the VP40 model/structure were docked according to the PIPER Fast Fourier Transform-based program. The antibody mode of ClusPro 2.0 antibody-protein docking was used [20]. The largest cluster size with minimal local energy and protein conformation near to native state was subjected further for antibody-protein interaction simulation (Molecular Dynamics program). Pymol software (PyMOL Molecular Graphics System, Version 1.3r1 edu, Schrodinger, LLC) was used for building and visualizing the intermolecular interaction. 2.11. Statistical analysis Means and standard deviations of tests and controls were compared (unpaired t-test). P < 0.05 was significantly different.
H-bond H-bond H-bond H-bond CH-p Salt bridge/H-bond H-bond H-bond H-bond/H-bond/Cation-p CH-P/Salt bridge H-bond/Salt bridge
CH-P H-bond H-bond/H-bond H-bond H-bond Salt bridge/H-bond Interactive bond(s)
H-bond/H-bond H-bond H-bond H-bond Van de Waals H-bond H-bond/Salt bridge H-bond H-bond/H-bond H-bond
in Fig. 1C. Lysates of 6 phage-transformed-E. coli clones (6, 8, 23, 61, 89, and 119) gave significant indirect ELISA signals to rVP40 above the controls (HB and BSA) (Fig. 1D). After sequencing, nucleotide sequences of all clones contained complete sequences coding for VH and VL domains with linker nucleotides in between. The R9HuscFv6, R9-HuscFv8, R9-HuscFv23, R9-HuscFv61, R9-HuscFV89 and R9-HuscFV119 were expressed, purified and refolded from the inclusion bodies of the respective plasmid-transformed Rosetta2 E. coli clones and were retested for rVP40 binding by WB. R9HuscFv 8, -23, and 119 bound to the rVP40 (Fig. 1E), indicating the proper protein refolding. R9-HuscFvs of other clones did not bind to the VP40 (data not shown). The VP40 L domain peptide, rDNTD, and rCTD were used as antigens in indirect ELISA for testing the region(s) of VP40 bound by individual R9-HuscFvs. As shown in Table 1, R9-HuscFv 8, 23, and 119 bound to the rDNTD and the rCTD. Also, they gave ELISA signal to the L domain peptide. 3.3. Ebola VLPs
3. Results 3.1. Recombinant VP40, DNTD, and CTD
Fig. 2 illustrates Ebola VLPs budded out from the cells cotransfected with pLVX-Puro-ZVP40-IRES-ZGP and Lenti-X™ Lentiviral Expression System.
Fig. 1A and 1B show SDS-PAGE-separated-rVP40 and rDNTD and rCTD purified from transformed BL21 (DE3) E. coli homogenates, respectively.
3.4. Inhibition of VLP egress by transbodies to VP40
3.2. Cell penetrating HuscFvs to VP40 Representative huscfv amplicons (~1000 bp) from HB2151 E. coli clones that were infected with the VP40-bound phages are shown
Numerous VLPs budded out from Huh7 cells transduced with the pseudo-typed Lentivirus particles carrying the EBOV VP40-GP RNAs that were maintained in the medium alone (Fig. 3A, medium) and in the medium containing control R9-HuscFv (Fig. 3A, control). There were far fewer VLPs from transduced cells treated
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
6
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
Fig. 4. Computerized interface contact between VP40 (pink area on light brown VP40 3D structure) and HuScFvs (green). (A) HuscFv8, (B) HuscFV23, and (C) HuscFv119. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
with R9-HuscFv8, R9-HuscFv23, and R9-HuscFv119 (Fig. 3A, 8, 23, and 119). Fig. 3B shows VP40 amounts in the cultured fluids of the transduced-Huh7 cells treated with R9-HuscFvs and controls. The most VP40 amount was contained in culture supernatants of transduced cells in medium alone. Culture supernatants of the transduced cells treated with R9-HuscFv8, R9-HuscFv23 and R9HuscFv119 had the least VP40 amounts and significantly less than the two controls (p < 0.05). 3.5. Predicted VP40 residues and regions bound by HuscFvs Table 2 and Fig. 4 give details on VP40 residues and regions that formed interface contact with the HuscFvs. The HuscFv8, HuscFv23, and HuscFv119 docked on several residues of the CTD cationic patch that are important for membrane-binding of the VP40
dimers, i.e., K221, K224, and K274 for HuscFv8 and HuscFv23 and K221, K224, K274, and K275 for HuscFv119. These antibodies also interacted with some NTD residues. The putative amino acids of the three HuscFvs involved in the interaction with the VP40 were all insilico mutated to alanines. After the mutations, different docking results were obtained. The mutated HuscFvs did not bind to the same residues of the VP40 as the parental antibodies, notably the CTD basic patch important for the VP40 latching on the plasma membrane (Supplementary Table 1 and Supplementary Fig. 1). Although the HuscFvs of clones 8, 23, and 119 bound similarly to the VP40 CTD basic patch and NTD, their CDRs, especially CDRs 2 and 3 are highly diverse and only one residue (D57) of VH-CDR2 of HuscFv8 and HuscFv119 are identically bound by salt bridge to K224 of the VP40. Supplementary Tables 2 and 3 show percent identity of FRs and CDRs of all three HuscFvs.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
4. Discussion Attempts have been made to prevent and treat EBOV infection [5,13]. Small molecular inhibitors and antibodies prevented EBOV binding to cellular receptors [21e25]. EBOV infection was reduced after inhibiting host cellular kinases [26,27]. Non-human primates were protected against lethal Zaire EBOV infections by antisense phosphorodiamidate morpholino oligomers specific to VP24, VP35 and L polymerase [28,29] and nucleoside analogue [30]. Lipid encapsulated-siRNA targeting EBOV polymerase, VP24, and VP35 protected macaques against EBOV lethal challenge [31]. However, none of the mentioned protocols showed robust protective/therapeutic efficacy. Antibodies used previously in the passive immunization against the EVD were conventional four-chain antibodies or Fab fragments that targeted the virus GP protein. They functioned extracellularly and are inaccessible to the intracellular viral proteins. Human antibodies that are readily accessible to the intracellular targets should be more appropriate and safe for postexposure treatment of virus infections. In this study, human transbodies in the form of R9-linked human scFvs that target EBOV VP40 were produced and tested for their ability to inhibit the Ebola VLP budding. Targeting virus assembly, morphogenesis, and egress by inhibitors is a feasible therapeutic approach. N-terminal domain of Tsg101 (ubiquitin-conjugating enzyme) which bound PTAP motif of HIV-1 late domain (p6) blocked the viral budding [32]. Inhibitors of influenza virus neuraminidase block the late stage of the viral life cycle and are in clinical use [33]. For EVD, antibodies that interfere with VP40 functions would halt or slow down the virus budding and spread which would allow more time for the host immune system to operate and control the infection [5]. In this study, Huh7 cells transduced with pseudo-typed Lentivirus particles carrying EBOV VP40 and GP genes efficiently produced Ebola VLPs that morphologically resemble the infectious EBOV which verified the previous notion. The experiments using VLPs that mimic the authentic EBOV budding process can be performed conveniently under BSL-2 condition. By SEM, the R9HuscFvs effectively inhibited the VLP budding from the Huh7 cells transduced with the pseudo-typed Lentivirus particles carrying EBOV VP40 and GP genes. In addition to the VLPs, distinct monomeric VP40 can be secreted also from the cells [34]. The finding that culture supernatants (treated with M-per protein extraction reagent to extract VP40 from the VLPs; hence the sample contained secreted- and VLP-derived VP40) of the specific transbody-treated cells contained less amounts of VP40 than controls indicating that the transbodies interfered with the VLP budding and perhaps also the VP40 secretion. In order to gain some insight into the molecular mechanisms of the R9-HuscFv-mediated inhibitions of the VLP budding, the regions of the VP40 bound by the HuscFvs were determined by means of indirect ELISA using rDNTD and rCTD as well as late (L) domain peptide. Moreover, presumptive residues of the VP40 that formed contact interface with the HuscFvs were determined by computerized simulation. The HuscFvs were found to interact with several lysine residues of the highly conserved CTD cationic patch important for plasma membrane (PM)-binding of the dimeric VP40. Previous data demonstrated that the VLP budding was abrogated when the positive charge in the positions 224, 225, 274 and 275 were changed to neutral or negative charges [2]. Thus, the effectiveness of the R9HuscFvs on the VLP budding inhibition observed in this study should be (at least partly, if not solely) attributable to interference with the PM-binding of the VP40 dimers, a prerequisite step for subsequent viral matrix assembly and membrane curvature generation mediated by adjacent CTD hydrophobic loop formed by L203, I237, M241, M305 and I307 [8,35]. The computerized results were conformed to the indirect ELISA results on the CTD binding.
7
Besides, the R9-HuscFvs bound also to the VP40 NTD and the late domain PTAPPEY peptide (WW-binding motif) suggesting that their specific epitopes are conformational (formed by residues of different VP40 regions that are spatially juxtaposed upon protein folding) and the antibodies might exert the VP40 inhibitory activity through additional mechanism(s). In conclusions, human transbodies produced in this study effectively inhibited egress of Ebola VLPs from mammalian cells. Computerized simulation predicted that the antibodies interacted with residues crucial for latching of dimeric VP40 on plasma membrane, the prerequisite step for subsequent viral matrix assembly, membrane curvature formation, and progeny virus budding. Although molecular mechanism(s) awaits detailed laboratory investigation, the transbodies are worthwhile tested further against the authentic EBOV before developing to a direct acting anti-Ebola agent for preclinical and clinical trials. Conflict of interests The authors declare no conflict of interest. Acknowledgements The work was supported by Faculty of Medicine Siriraj Hospital, Mahidol University (R015834001) and NSTDA Chair Professor grant (P-1450624) funded by the Crown Property Bureau. Thanks are due to Professors Drs. Udom Kachintorn, Sansanee Chaiyaroj, Prasit Watanapa, and Ruengpung Sutthent for encouragements; Dr. Thawornchai Limjindaporn for providing the Huh7 cells. Monrat Chulanetra and Nitat Sookrung are MRG and RSA scholars of the Thailand Research Fund, respectively. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.09.052. References [1] J. Timmins, R.W.H. Ruigrok, W. Weissenhorn, Structural studies on the Ebola virus matrix protein VP40 indicate that matrix proteins of enveloped RNA viruses are analogues but not homologues, FEMS Microbiol. Lett. 23 (2004) 179e186. [2] Z.A. Bomholdt, T. Noda, D.M. Abelson, P. Halfmann, M.R. Wood, Y. Kawaoka, E.O. Saphire, Structural rearrangement of Ebola virus VP40 begets multiple functions in the virus life cycle, Cell 154 (2013) 763e774. [3] A. Dessen, V. Volchkov, O. Dolnik, H.D. Klenk, W. Weissenhorn, Crystal structure of the matrix protein VP40 from Ebola virus, EMBO J. 19 (2000) 4228e4236. [4] R.N. Harty, M.E. Brown, G. Wang, J. Huibregtse, F.P. Hayes, A PPxY motif within the VP40 protein of Ebola virus interacts physically and functionally with a ubiquitin ligase: implications for filovirus budding, Proc. Nat. Acad. Sci. U.S.A. 97 (2000) 13871e13876. [5] R.N. Harty, No exit: targeting the budding process to inhibit filovirus replication, Antivir. Res. 81 (2009) 189e197. [6] J. Timmins, G. Schoehn, S. Ricard-Blum, S. Scianimanico, T. Vernet, R.W. Ruigrok, W. Weissenhorn, Ebola virus matrix protein VP40 interaction with human cellular factor Tsg101 and Nedd4, J. Mol. Biol. 326 (2003), 493452. [7] R.W. Ruigrok, G. Schoehn, A. Dessen, E. Forest, V.E. Volchkov, O. Dolnik, H.D. Klenk, W. Weissenhorn, Structural characterization and membrane binding properties of the matrix protein VP40 of Ebola virus, J. Mol. Biol. 300 (2000) 103e112. [8] E. Adu-Gyamfi, S.P. Soni, Y. Xue, M.A. Digma, E. Gratton, R.V. Stahelin, The Ebola virus matrix protein penetrates into the plasma membrane: a key step in viral protein 40 (VP40) oligomerization and viral egress, J. Biol. Chem. 288 (2013) 5779e5789. [9] F.X. Gomis-Rueth, A. Dessen, J. Timmins, A. Bracher, L. Kolesnikowa, S. Becker, H.D. Klenk W. Weissenhorn, The matrix protein VP40 from Ebola virus octamerizes into pore-like structures with specific RNA binding properties, Structure 11 (2003) 423e433. [10] K.L. Warfield, C.M. Bosio, B.C. Welcher, E.M. Deal, M. Mohammadzadeh, A. Schmaljohn, M.J. Aman, S. Bavari, Ebola virus-like particles protect from
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052
8
S. Teimoori et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e8
[11] [12]
[13] [14]
[15]
[16] [17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
lethal Ebola virus infection, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 15889e15894. R.F. Johnson, P. Bell, R.N. Harty, Effect of Ebola virus proteins GP, NP and VP35 on VP40 VLP morphology, Virol. J. 3 (2006) 31. T. Noda, H. Sagara, E. Suzuki, A. Takeda, H. Kida, Y. Kawaoka, Ebola virus VP40 drives the formation of virus-like filamentous particles along with GP, J. Virol. 76 (2002) 4855e4865. R.V. Stahelin, Could the Ebola virus matrix protein VP40 be a drug target? Exp. Opin. Ther. Target 18 (2014) 115e120. K. Kulkeaw, Y. Sakolvaree, P. Srimanote, P. Tongtawe, S. Maneewatch, N. Sookrung, A. Tungtrongchitr, P. Tapchaisri, H. Kurazono, W. Chaicumpa, Human monoclonal ScFv neutralize lethal Thai cobra, Naja kaouthia, neurotoxin, J. Proteomics 72 (2009) 270e282. K. Glab-ampai, A.A. Malik, M. Chulantera, J. Thanongsaksrikul, K. Thueng-in, P. Srimanote, P. Tongtawe, W. Chaicumpa, Inhibition of HCV replication by humanized-single domain transbodies to NS4B, Biochem. Biophys. Res. Com. 476 (2016) 654e664. Y. Zhang, I-TASSER server for protein 3D structure prediction, BMC Bioinform. 9 (2008), http://dx.doi.org/10.1186/1471-2105-9-40. A. Roy, A. Kucukural, Y. Zhang, I-TASSER: a unified platform for automated protein structure and function prediction, Nat. Protoc. 5 (2010) 725e738. D. Xu, Y. Zhang, Improving the physical realism and structural accuracy of protein models by a two-step atomic-level energy minimization, Biophys. J. 101 (2011) 2525e2534. J. Zhang, Y. Liang, Y. Zhang, Atomic-level protein structure refinement using fragment-guided molecular dynamics conformation sampling, Structure 19 (2011) 1784e1795. D. Kozakov, D. Beglov, T. Bohnuud, S.E. Mottarella, B. Xia, R. David, D.R. Hall, S. Vajda, How good is automated protein docking? Prot. Struct. Funct. Bioinform 81 (2013) 2159e2166. M. Cote, J. Misasi, T. Ren, A. Bruchez, K. Kyungae Lee, C.M. Filone, L. Hensley, Q. Qi Li, D. Ory, K. Chandran, J. Cunningham, Small molecular inhibitors reveal Niemann-Pick C1 is essential for Ebola virus infection, Nature 77 (2011) 344e348. X. Qiu, J.B. Alimont, P.L. Melito, L.F. Fernando, U. Stroher, S.M. Jones, Characterization of Zaire Ebolavirus glycoprotein-specific-monoclonal antibodies, Clin. Immunol. 141 (2011) 218e227. X. Qiu, L. Fernando, L. Melito, J. Audet, H. Feldmann, G. Kobinger, J.B. Alimonti, S.M. Jones, Ebola GP-specific monoclonal antibodies protect mice and Guineapigs from lethal Ebola virus infection, PLoS Negl. Trop. Dis. 6 (2012) e1575. X. Qiu, G. Wong, J. Audet, A. Bello, L. Fernando, J.B. Alimonti, H. FaustherBovendo, H. Wei, J. Aviles, E. Hiatt, A. Johnson, J. Morton, K. Swope, O. Bohorov, N. Bohorova, C. Goodman, D. Kim, M.H. Pauly, J. Velasco, J. Pettitt, G.G. Olinger, K. Whaley, B. Xu, J.E. Strong, L. Zeitlin, G.P. Kobinger, Reversion of
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33] [34]
[35]
advanced Ebola virus disease in nonhuman primates with ZMapp, Nature 100 (2014), http://dx.doi.org/10.1038/nature13777. J. Pettitt, L. Zeitlin, H. Kim do, C. Working, J.C. Johnson, O. Bohorov, B. Bratcher, E. Hiatt, S.D. Hume, A.K. Johnson, J. Morton, M.H. Pauly, K.J. Whaley, M.F. Ingram, F.A. Zovanyi, M. Heinrich, A. Piper, J. Zelko, G.G. Olinger, Therapeutic intervention of Ebola virus infection in rhesus macaques with the MB003 monoclonal antibody cocktail, Sci. Transl. Med. 5 (2013) 199ra113, http:// dx.doi.org/10.1126/scitranslmed.3006608. M. Garcia, A. Cooper, W. Shi, Productive replication of Ebola virus is regulated by the c-Abl1 tyrosine kinase, Sci. Trans. Med. 4 (2012), http://dx.doi.org/ 10.1126/scitranslmed.3003500, 123 (123ra24). A.A. Kolokolstov, S. Adkhikary, J. Garver, L. Johnson, R.A. Davey, E.M. Vela, Inhibition of Lassa virus and Ebola virus infection in host cells treated with the kinase inhibitors genistein and tyrophostin, Arch. Virol. 157 (2012) 121e127. K.L. Warfield, D.L. Swenson, G.G. Olinger, D.K. Nichols, W.D. Pratt, R. Blouch, D.A. Stein, M.J. Aman, P.L. Iversen, S. Bavari, Gene-specific countermeasures against Ebola virus based on antisense phosphorodiamidate morpholino oligomers, PLoS Pathog. 2 (2006) e1, http://dx.doi.org/10.1371/ journal.ppat.0020001. T.K. Warren, K.L. Warfield, J. Wells, D.L. Swenson, K.S. Donner, S.A. Van Tongeren, N.L. Garza, L. Dong, D.V. Mourich, S. Crumley, D.K. Nichols, P.L. Iversen, S. Bavari, Advanced antisense therapies for post exposure protection against lethal filovirus infections, Nat. Med. 16 (2010) 991e994. T.K. Warren, J. Well, R.G. Panchal, K.S. Stuthman, N.L. Garza, S.A. Van Tongeren, L. Dong, C.J. Retterer, B.P. Eaton, G. Pegoraro, S. Honnold, S. Bantia, P. Kotian, X. Chen, B.R. Taubenheim, L.S. Welch, D.M. Minning, Y.S. Babu, W.P. Sheridan, S. Bavari, Protection against filovirus diseases by a novel broadspectrum nucleoside analogue BCX4430, Nature 508 (2014) 402e405. T.W. Geisbert, A.C.H. Lee, M. Robbins, J.B. Geisbert, A.N. Honko, V. Sood, J.C. Johnson, S. de Jong, I. Tavakoli, A. Judge, L. Hensley, I. MacLachlan, Postexposure protection of non-human primates against a lethal Ebola virus challenge with RNA interference: a proof-of-concept study, Lancet 375 (2010) 1896e1905. D.G. Demirov, A. Ono, J.M. Orenstein, E.O. Freed, Overexpression of the Nterminal domain of Tsg101 inhibits HIV-1 budding by blocking late domain function, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 955e960. E. Krol, M. Rychlowska, B. Szewczyk, Antiviralscurrent trend in fighting influenza, Acta Biochim. Pol. 61 (2014) 495e504. O. Reynold, S.P. Reid, A. Page, M. Mateo, N. Alazard-Dany, H. Raoul, C.F. Basler, V.E. Volchkov, Unconventional secretion of Ebola virus matrix protein VP40, J. Infect. Dis. 204 (Suppl. 3) (2011) S833eS839. S.P. Soni, E. Adu-Gyamfi, S.S. Yong, C.S. Jee, R.V. Stahelin, Ebola virus matrix protein deeply penetrates the plasma membrane: an important step in viral egress, Biophys. J. 104 (2013) 1940e1949.
Please cite this article in press as: S. Teimoori, et al., Human transbodies to VP40 inhibit cellular egress of Ebola virus-like particles, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.09.052