Human xanthine dehydrogenase cDNA sequence and protein in an atypical case of type I xanthinuria in comparison with normal subjects

Clinica Chimica Acta 304 (2001) 153–158 www.elsevier.com / locate / clinchim

Short communication

Human xanthine dehydrogenase cDNA sequence and protein in an atypical case of type I xanthinuria in comparison with normal subjects a,

a

b

a

b

Tetsuya Yamamoto *, Yuji Moriwaki , Yuichi Shibutani , Kiyoshi Matsui , Taro Ueo , Sumio Takahashi a , Zenta Tsutsumi a , Toshikazu Hada a a

Third Department of Internal Medicine, Hyogo College of Medicine, Mukogawa-cho 1 -1, Nishinomiya, Hyogo 663 -8501, Japan b Department of Internal Medicine, Division of Endocrinology, Nishi-Kobe Medical Center, Nishi-Kobe, Japan Received 29 August 2000; received in revised form 9 November 2000; accepted 20 November 2000

Abstract To investigate the properties of xanthine dehydrogenase / xanthine oxidase (XDH / XO) deficiency in a patient with atypical type I xanthinuria, as indicated by oxypurine data, a cDNA sequence encoding XDH, XDH / XO immunoblot analysis and a competitive PCR assay were performed, and the results were compared with those of normal subjects. The xanthine dehydrogenase cDNA sequence of the patient was consistent with the controls, while immunologically reactive 150 kD XDH / XO protein was not present in the xanthinuric duodenal mucosa, unlike the control duodenal mucosa. In addition, a decrease in XDH / XO messenger RNA was found by competitive PCR. These results suggest that atypical type I xanthinuria is due to a decrease in messenger RNA of XDH / XO. Furthermore, it was considered that this decrease could explain the normal plasma level and near normal urinary excretion of hypoxanthine seen in this case of xanthinuria, though XDH / XO activity and protein were not detected spectrophotometrically and immunologically, respectively.  2001 Elsevier Science B.V. All rights reserved. Keywords: Hypouricemia; Oxypurines; Xanthinuria; Xanthine dehydrogenase cDNA; Xanthine oxidase deficiency

1. Introduction Xanthine dehydrogenase / xanthine oxidase (XDH / XO, EC 1.1.1.204) is a molybdenum iron-sulphur

Abbreviations: cDNA, complementary deoxyribonucleic acid; kDa, kiloDalton; Mr molecular weight ratio; mRNA, messenger ribonucleic acid; PCR, polymerase chain reaction; XDH, xanthine dehydrogenase; XO, xanthine oxidase *Corresponding author. Tel.: 181-798-456-472; fax: 181-798456-474. E-mail address: [email protected] (T. Yamamoto).

flavin hydroxylase that oxidizes a variety of purines and pterins, such as hypoxanthine to uric acid via xanthine, allopurinol (a xanthine oxidase inhibitor) to oxypurinol, and pyrazinamide (an antituberculous agent) to 5-hydroxypyrazinamide [1,2]. It is an abundant enzyme in the liver and intestine. In previous studies [3–5], the cloning of cDNA encoding XDH has been performed in rats, mice, and humans, while the chromosomal location of the XDH gene has been demonstrated in humans [5,6]. The cDNA encoding XDH has an open-reading frame of 3999 nucleotides and encodes a protein of

0009-8981 / 01 / $ – see front matter  2001 Elsevier Science B.V. All rights reserved. PII: S0009-8981( 00 )00413-7

154

T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 – 158

1333 amino acids with a calculated Mr of 146 604 in humans. A deficiency of XDH, xanthinuria, is classified into two groups, type I and II [1,2,7]. Patients with type I xanthinuria lack XDH / XO activity, but possesses aldehyde oxidase activity, suggesting a defect of the XDH protein, while patients with type II xanthinuria lack both XDH / XO and aldehyde oxidase activities [1,2,7], suggesting a defect in the sulfuration of desulfo molybdenum. Patients with type I xanthinuria can convert allopurinol to oxypurinol and pyrazinamide to 5-hydroxypyrazinamide, since they lack XDH / XO activity but possess aldehyde oxidase activity. In type I xanthinuria, the molybdenum cofactor is normal, since aldehyde oxidase activity is present. Recently, two kinds of mutations in the human XDH gene have been reported to be responsible for classical type I xanthinuria [8], which cause no production of XDH protein. We incidentally found a case of atypical type I xanthinuria, in whom the plasma concentration of hypoxanthine was within the normal range and urinary excretion was near normal after fasting. Therefore, to investigate whether a mutation of XDH is present in xanthinuria, and if so, whether it causes the disappearance of XDH / XO activity, we sequenced the cDNA encoding XDH from our patient. In addition, since the sequence of cDNA encoding XDH in humans was found to be different in part in three recent studies [5,9,10], we also sequenced the same from normal subjects. To further investigate whether xanthinuria is produced by a defect in messenger RNA and / or in the XDH protein synthesis, a competitive PCR assay and an immunoblot analysis were performed, respectively.

2. Materials and methods

2.1. Patients and specimens After informed consent was obtained from the xanthinuric patient and five healthy subjects, duodenal mucosa specimens from each were biopsied using a gastrointestinal fiberscope. After fasting, the plasma concentrations and urinary excretion of both uric acid and oxypurines were normal in the healthy subjects. In the patient, plasma uric acid was 5.9 mmol / l, plasma hypoxanthine was 2.6 mmol / l (refer-

ence range, 1.1–3.0), plasma xanthine was 11.2 mmol / l (reference range, 0.7–1.2), urinary hypoxanthine excretion was 6.1 mmol / h (reference range, 4–5.7), urinary xanthine excretion was 72.4 mmol / h (reference range, 3.5–4.6), and urinary uric acid excretion was below the limits of detection. Although the plasma concentration of hypoxanthine was within a normal range and the urinary excretion of hypoxanthine was near normal after fasting, 2 h after taking food containing 75 mg purine, these values rose to 10 mmol / l and 40.0 mmol / h, respectively. The XDH / XO activity of the patient’s duodenal mucosa was below the limits of detection. Further, this patient was diagnosed as having type I xanthinuria by allopurinol and pyrazinamide loading tests, which have been described previously [1,2]. These results together suggested a subtype of type I xanthinuria, since the plasma concentration of hypoxanthine was within a normal range and the urinary excretion of hypoxanthine was near normal after fasting.

2.2. Determination of hypoxanthine, xanthine, and uric acid The concentrations of hypoxanthine, xanthine and uric acid were measured as described previously [1,2].

2.3. Direct sequencing of cDNA and competitive PCR RNA was obtained from duodenal mucosa by the chloroform–phenol extraction method and cDNA was then reverse transcribed from the total RNA of the obtained materials. The primers for PCR are shown in Table 1 and were used under the following conditions. cDNA was denatured at 948C for 5 min, followed by 30 cycles of denaturation at 948C for 30 s, annealing at 608C for 30 s, and extension at 728C for 1 min, with a final extension step of 7 min. The PCR was carried out in a volume of 25 ml containing 50 mmol / l KCl, 10 mmol / l Tris–HCl (pH 8.8), 1.5 mmol / l MgCl 2 , 0.1% Triton X-100, 200 mmol / l each of dATP, dCTP, dGTP, dTTP, 0.1 mg of cDNA, 10 pmol of each primer, and 1.5 U of Taq polymerase in a DNA thermal cycler (Perkin-Elmer Cetus). Amplified DNA products were sequenced by

T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 – 158

155

Table 1 Primers for XDH mRNA RT-PCR Primer

Sequence (59 to 39)

Position

Amplified product (bp)

XDH1-F XDHA2 XDH2F XDHYR XDH3F XDH4R XDH5F XDH5R XDH6F XDH6R XDH7F XDH7R XDH8IF XDH8IR GAGXDH9F XDH10R XDH11F XDH11R XDH12F XDH13R XDH14IF XDH14IR XDH15F XDH15R XDH16F XDH16R XDH17F XDHichidaR

TTAGGAGTGAGGTACCTGGAG AGGATGCAGCCTCGTCTTGG GTCTGCAGAACAAGATCGTC CTGGTTCATGCAGCAATTTGG TGGAGGAGATTGAGAATGCC AAACCAGCGCAGCTGCTCCA AGCCTGGATCCCTGAGCTG AGGCCTGCTTGAATGCTGAG GCCAAGCTGACACTAGTGTC AAGTCCACCATGCCACCAGG CTTTGCTATGGTGGAATGGC ACCATGTCCTCCTCAGACTG GAACCTGGAAGACAAGTGTGG ACTCCCAGGAACATCATCAGC TGAGAGAATGAGCTGTCTCTCCG GCGGCCGGTCTTATATGCAG CACAGAACACCATGAAGACC CCGTGTTGGAGGGAAGGTTG GACAGTTGTGGCTCTTGAGG TGTTAGTGCTTGTCTCGCTG TGTACACAGATGGCTCTGTGC CAGACAAGCTCACTGTGTCCA CCGTCTATGCGGCTTGTCAG GAATAGTGTAGCTCCTCTAGG AATCGACTGCCTAACAGGAG AGCTCGAGCTGCACGGATGG TACAAGATCCCGGCATTTGGC TGTTCCTCCTGCTCCATGGAAG

244 to 224 281–300 179–198 529–549 407–426 992–1011 843–861 1254–1273 1108–1127 1501–1520 1360–1379 1702–1721 1590–1610 1912–1932 1801–1820 2447–2466 2300–2319 2712–2731 2565–2584 3192–3211 3071–3091 3368–3388 3269–3288 3624–3644 3492–3511 3833–3852 3682–3702 4044–4065

421

the dye-termination method using a DNA sequencing kit (Perkin-Elmer, Foster, CA, USA) with the same primers as for the PCR, and analyzed using an ABI PRISM 310 (Applied Biosystems, Foster, CA, USA). The RNA competitor to XDH cDNA was constructed using a Takara competitive DNA construction kit (Takara Biomedics, Osaka, Japan) and the competitive PCR was performed with various concentrations of the competitor, as described in the Protocols section of the kit.

2.4. Immunoblots of XDH /XO protein Using postmitochondrial supernatants from the samples, immunoblotting was performed as follows. XDH / XO was transferred electrophoretically from a 7.5% SDS–polyacrylamide gel to a PVDF membrane at 1 mA / cm 2 for 90 min, using Trans Blot SD

371 605 431 413 362 343 666 432 647 318 376 361 384

(Bio-Rad Laboratories, Hercules, CA, USA). After incubation with Block Ace (Dainippon Pharmaceuticals, Osaka) overnight at 48C, the PVDF membrane was washed with 50 mmol / l Tris-buffered saline (pH 7.4) (TBS) and then incubated for 3 h at room temperature with a 1:200 dilution of anti-human xanthine oxidase rabbit serum [11] in TBS containing 10% (v / v) Block Ace. The PVDF membrane was washed 3 times with TBS, 10 min per wash, and then incubated with a 1:500 dilution of a secondary antibody (biotinylated anti-rabbit IgG; Vector Laboratories, Burlingame, CA, USA) for 3 h at room temperature. Next, the PVDF membrane was washed 4 times with TBS and then incubated with avidin– biotin complex (Vectastain ABC Elite kit; Vector Laboratories). Finally, the XDH / XO peptide was visualized by incubation with 0.01% H 2 O 2 in TBS containing 0.05% diaminobenzidine.

156

T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 – 158

2.5. Enzyme activity The activity of XDH / XO was measured as described previously [12]. Briefly, the reaction mixtures contained 50 mmol / l phosphate buffer (pH 8.5), 20% cell or tissue homogenate, and 1 mmol / l NAD in a final volume of 200 ml. After preincubation for 5 min at 378C, the reaction was initiated by the addition of 100 ml of 1 mmol / l xanthine. After either 5 or 20 min, the reaction was stopped by the addition of 25 ml of 20% HClO 4 , followed by neutralization with 25 ml of 1 mol / l K 2 CO 3 . The solution was then passed through a 4A Chromatodisc (Kurabo, Osaka) for high-performance liquid chromatography (HPLC). The HPLC apparatus consisted of an LC-6A chromatograph (Shimadzu, Kyoto, Japan), an SPD-6AV UV-Vis spectrophotometric detector (Shimadzu, Kyoto, Japan), a C-R6A Chromatopac (Shimadzu, Kyoto, Japan), and a Wakosil 18C-200 column (Wako, Osaka, Japan). The mobile phase consisted of 20 mmol / l potassium phosphate buffer (pH 2.2), with a flow rate of 1 ml / min and absorbance at 254 nm. XDH / XO activities were expressed as nmol / min per mg protein.

Fig. 1. XDH / XO cDNA PCR product after competitive PCR. RNA at 0.5 mg was added to the reaction mixture, and RT was performed as described in Section 2. After the addition of various concentrations of the competitor, PCR was performed for 28 cycles in the case of normal duodenal mucosa and 32 cycles for xanthinuric mucosa, using the primers L8IF and L8IR. N, normal duodenal mucosa; X, xanthinuric duodenal mucosa; o, no addition of competitor; 1, 10 copies of competitor; 2, 10 2 copies of competitor; 3, 10 3 copies of competitor; 4, 10 4 copies of competitor; 5, 10 5 copies of competitor; 6, 10 6 copies of competitor; IS, internal standard (competitor, 292 bases); XO, xanthine dehydrogenase / xanthine oxidase.

primers. Next PCR was performed for 32 cycles in the case of xanthinuric duodenal mucosa and 28 cycles in the case of normal duodenal mucosa after the addition of various concentrations of the competitor. The PCR products from the xanthinuric duodenal mucosa were between 10 and 10 2 copies, while those from the normal subject were 10 5 copies, indicating that the mRNA of XDH was decreased in the xanthinuric patient (Fig. 1).

3. Results

3.3. Immunoreactive XDH /XO protein 3.1. Sequence of XDH cDNA from duodenal mucosa of the patient and five normal subjects The XDH cDNA of the xanthinuric duodenal mucosa was different from XDH cDNA previously reported by Ichida et al. [5] at five points. At codons 191, 231, 374, 1150, and 1296, CAC (His), AGG (Arg), CTA (Leu), CGC (Arg), and CGG (Arg) were displaced to GTC (Leu), GGG (Gly), CTT (Leu), CCC (Pro), and CGG (Arg), respectively. However, the XDH cDNA sequences of the xanthinuric duodenal mucosa were identical to those of the duodenal mucosa from the five normal subjects.

3.2. PCR product obtained from XDH /XO mRNA The RNA samples from the xanthinuric and normal duodenal mucosa were adjusted to the same concentration in their respective RT reaction mixtures, and RT was performed using L8IF and L8IR

An immunoblot analysis was performed after electrophoresis, using the postmitochondrial supernatants from the xanthinuric and normal duodenal mucosa specimens. A 150-kDa band was found in the normal duodenal mucosa, but not in that from the xanthinuric patient, indicating that immunoreactive XDH / XO protein is not produced in this patient (Fig. 2).

4. Discussion Using RNA obtained from the duodenal mucosa of normal subjects, the present study had the same cDNA XDH sequence results as reported previously by Saksela et al. [10], however, they differed from those reported by Ichida et al. [5] at five separate points, resulting in three amino acid changes in the polypeptide. The differences at these positions may

T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 – 158

Fig. 2. Immunoblot of XDH / XO. Postmitochondrial supernatant (50 mg protein) obtained from duodenal mucosa was applied. N, normal duodenal mucosa; X, xanthinuric duodenal mucosa.

represent a genetic polymorphism, or could be ascribable to artifacts caused by reverse transcription or PCR amplification. The present study also demonstrated that the XDH cDNA sequence in an atypical xanthinuric patient was identical to that in normal subjects. However, the PCR product obtained from XDH cDNA indicated that XDH mRNA is reduced in xanthinuria, as compared with the duodenal mucosa from a normal subject. In addition, the 150kDa XDH protein was present in the controls, but not in the atypical type I xanthinuric patient. These results suggest that in xanthinuria, the promoter region of the XDH gene or the transcription of the XDH gene to mRNA may be disturbed, resulting in a decrease in XDH mRNA, and leading to neither protein nor XDH / XO activity. Xanthinuria is classified into two groups, type I and II [1,2,7]. In patients with type I, a defect of the XDH protein is suggested, while in type II, there appears to be a defect in the sulfuration of desulfo molybdenum is suggested. In fact, a recent study [8] of three patients with type I xanthinuria demonstrated that the immunologically reactive XDH / XO protein was not present with a mutation of XDH / XO cDNA. In contrast, in the present patient, our results regarding the XDH / XO gene and immunoreactive XDH / XO, including the plasma concentration and urinary excretion of purine bases, indicate that this

157

case of xanthinuria can be ascribable to a decrease in the mRNA of XDH without a mutation. XDH, having a lower Km for hypoxanthine than for xanthine, converts hypoxanthine to xanthine more than xanthine to uric acid. Although the present study did not demonstrate any activity or protein of XDH, small amounts of XDH will convert a greater amount of hypoxanthine to xanthine than xanthine to uric acid. Therefore, it is suggested that a decrease in the mRNA of XDH may explain the findings in atypical xanthinuric patients, who have normal plasma concentrations and near normal urinary excretion of hypoxanthine at rest. However, further investigation is needed, since an abnormality of the promoter region in the XDH gene or that of transcription of the XDH gene to mRNA may cause a decrease in mRNA of XDH leading to the absence of the immunologically reactive XDH / XO protein.

References [1] Yamamoto T, Higashino K, Kono N, Kawachi M, Nanahoshi M, Takahashi S, Suda M, Hada T. Metabolism of pyrazinamide and allopurinol in hereditary xanthine oxidase deficiency. Clin Chim Acta 1989;180:169–76. [2] Yamamoto T, Kario K, Suda M, Moriwaki Y, Takahashi S, Higashino K. A case of xanthinuria: a study on the metabolism of pyrazinamide and allopurinol. Jpn J Med 1991;30:430–4. [3] Amaya Y, Yamazaki K, Sato M, Noda K, Nishino T, Nishino T. Proteolytic conversion of xanthine dehydrogenase from the NAD-dependent type to the O 2 -dependent type. J Biol Chem 1990;65(2):14170–5. [4] Terao M, Cazzaniga G, Ghezzi P, Bianchi M, Falciani F, Perani P, Garattini E. Molecular cloning of a cDNA coding for mouse liver xanthine dehydrogenase. Biochem J 1992;183:863–70. [5] Ichida K, Amaya A, Noda K, Minoshima S, Hosoya T, Sakai O, Shimizu N, Nishino T. Cloning of the cDNA encoding human xanthine dehydrogenase (oxidase): structural analysis of the protein and chromosomal location of the gene. Gene 1993;133:279–84. [6] Xu P, Zhu XL, Huecksteadt TP, Brothman AR, Hoidal JR. Assignment of human xanthine dehydrogenase gene to chromosome 2P22. Genomics 1994;23:289–91. [7] Reiter S, Simmonds HA, Zollner N, Braun SL, Knedel M. Demonstration of a combined deficiency of xanthine oxidase and aldehyde oxidase in xanthinuric patients not forming oxypurinol. Clin Chim Acta 1990;187:221–34. [8] Ichida K, Amaya Y, Kamatani N, Nishino T, Hosoya T, Sakai O. Identification of two mutations in human xanthine dehydrogenase gene responsible for classical type I xanthinuria. J Clin Invest 1997;99:2391–7.

158

T. Yamamoto et al. / Clinica Chimica Acta 304 (2001) 153 – 158

[9] Xu P, Huecksteadt TP, Hoidal JR. Molecular cloning and characterization of the human xanthine dehydrogenasse gene (XDH). Genomics 1996;34:173–80. [10] Saksela M, Raivio KO. Cloning and expression in vitro of human xanthine dehydrogenase / oxidase. Biochem J 1996;315:235–9. [11] Moriwaki Y, Yamamoto T, Suda M, Nasako Y, Takahashi S, Agbedana OE, Hada T, Higashino K. Purification and immunohistochemical tissue localization of human xanthine oxidase. Biochim Biophys Acta 1993;1164:327–30.

[12] Moriwaki Y, Yamamoto T, Yamakita J, Takahashi S, Tsutsiumi Z, Higashino K. Effect of interferon-g on purine catabolic and salvage enzyme activities in rats. Biochim Biophys Acta 1999;1427:385–91.