Hybridization Between Subspecies of Largemouth Bass

CHAPTER 4

Hybridization Between Subspecies of Largemouth Bass Contents 4.1 Growth and Morphological Differences Among Northern and Florida Subspecies of Largemouth Bass and Their Hybrids 4.1.1 Materials and Methods 4.1.2 Results and Analysis 4.2 Low Temperature Tolerance and Oxygen Consumption Rates of the Northern Subspecies and Florida Subspecies of Largemouth Bass, and Their Hybrid Offspring 4.2.1 Materials and Methods 4.2.2 Results and Analysis 4.3 Genetic Structure of the Northern and Florida Subspecies of Largemouth Bass and Their Hybrids 4.3.1 Materials and Methods 4.3.2 Results and Analyses References

133 134 136

147 148 150 156 157 159 164

4.1 GROWTH AND MORPHOLOGICAL DIFFERENCES AMONG NORTHERN AND FLORIDA SUBSPECIES OF LARGEMOUTH BASS AND THEIR HYBRIDS Cultivating species with superior performance is a major goal of the aquaculture industry. As one of the important methods for fish breeding, hybridization can effectively transfer good parental traits and increase the genetic variation of offspring, which can help the offspring to achieve heterosis (Lou, 1993). A large number of fish hybridization studies performed in China and other countries have indicated that hybridization can have positive effects by increasing the growth rate and resistance of offspring (Hulata, 2001; Lou, 2007). In this chapter, we describe the hybridization of the Northern subspecies of largemouth bass (Micropterus salmoides salmoides) and the Florida subspecies (M. salmoides floridanus) to

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass DOI: https://doi.org/10.1016/B978-0-12-816473-0.00004-9 Copyright © 2019 China Science Publishing & Media Ltd. Published by Elsevier Inc.

133

134

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

evaluate the growth performance of the hybrids and their parents. We combined traditional morphological measurements, including countable and framework parameters, and multivariate analysis to analyze the morphological differences among the Northern and Florida subspecies of largemouth bass as well as their hybrids in order to provide basic data to facilitate the crossbreeding of largemouth bass.

4.1.1 Materials and Methods 4.1.1.1 Experimental Materials The Northern and Florida subspecies of largemouth bass were obtained from the Tropical & Subtropical Fish Genetic Breeding Center in Pearl River Fisheries Research Institute, CAFS (China), where the former was the local breeding species and the latter was introduced from the United States in 2009 by our laboratory. In March 2010, 20 gonadal welldeveloped parental fish weighing 0.5
0.6 kg were selected from each of the two subspecies groups at an age of 1 year. According to conventional breeding methods for largemouth bass (Bai et al., 2009), we obtained four experimental groups, i.e., inbred Northern subspecies population (N), inbred Florida subspecies population (F), Northern subspeciesQ 3 Florida subspeciesRpopulation (direct cross hybrid for short: NF), and Florida subspeciesQ 3 Northern subspeciesRpopulation (reverse cross hybrid for short: FN), for growth comparisons and morphological measurements. The coded wire tag (CWT) used for labeling was purchased from Northwest Marine Technology, Inc. (USA). 4.1.1.2 Growth Comparisons Comparative aquaculture experiments were performed at the Tropical & Subtropical Fish Genetic Breeding Center in the Pearl River Fisheries Research Institute. Growth comparisons were only conducted using the Northern species and the two hybrid offspring populations. We selected 250 fish fry with a body weight of about 15.0 g from each of these three groups in July 2010. All of the fish were labeled with CWT and placed in a 667 m2 pond for cultivation. The aquaculture methods and daily management were conducted as reported previously (Bai et al., 2009). The fish were measured once every 4
6 weeks. The experiments ran from July 2010 to January 2011. The formulae used to calculate the growth analysis are as follows:

Hybridization Between Subspecies of Largemouth Bass

135


ðw2
w1Þ Absolute growth rate g=day 5 ðt2
t1Þ
ðlnw2
lnw1Þ Instantaneous growth rate %=day 5 3 100%; ðt2
t1Þ where w1 and w2 represent the body weights at time t1 and t2, respectively. 4.1.1.3 Measurement of Morphological Characteristics Samples of the Northern subspecies, two hybrids, and Florida subspecies with the same age were collected to obtain morphological and framework data measurements after the growth comparison experiments. The morphological data comprised countable and measurable characteristics. Eleven countable characteristics were used, i.e., counts of dorsal fin rays, pectoral fin rays, pelvic fin rays, anal fin rays, caudal fin rays, lateral line scales, scales above lateral line, scales below lateral line, vertebrae, ribs, and gill rakers. Twelve measurable characteristics were used, i.e., body weight, total length, body length, body height, body width, head length, snout length, eye diameter, interorbital distance, caudal peduncle length, caudal peduncle height, and body length before anus. Body weight was measured using an electronic balance (precision: 0.1 g) and length characteristics, e.g., body length, were measured with a rule and caliper (precision: 0.1 mm). The framework measurements were obtained using the methods described by Li (1998), which includes 24 traits. The framework is shown in Fig. 4.1.

Figure 4.1 Schematic measurement of largemouth bass framework. (1) Rearmost end of mandibular; (2) front end of snout; (3) origin of pelvic fin; (4) rearmost end of forehead maxilla; (5) origin of anal fin; (6) origin of dorsal fin; (7) end of anal fin; (8) end of first dorsal fin; (9) origin of abdomen caudal fin; (10) end of dorsal fin; (11) origin of dorsal caudal fin.

136

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

4.1.1.4 Data Analysis of Countable Characteristics Variance analysis of each countable characteristic was performed using SPSS 17.0. Significance tests of differences among populations were conducted using the least significant differences (LSD) test. A hybrid index (HI) for largemouth bass was calculated for countable data (Witkowski and Blachutad, 1980; Cricelli and Dupont, 1988): HI 5 100 3 (Hi 2 Mi1)/(Mi2 2 Mi1), where Hi is the hybrid average, Mi1 is the average of the female parent, and Mi2 is the average of the male parent. If HI was 45
55, the trait was an intermediate characteristic; if HI , 45, the trait was a maternal characteristic; if HI . 55, the trait was a paternal characteristic; and if HI . 100 or HI , 0, the trait was a transgressive segregated characteristic. 4.1.1.5 Measurable Characteristics and Framework Data Analysis To eliminate the effects of differences in fish size on the measurable characteristics and framework parameters, the former were converted into morphometric characteristics and the latter were compared with the body length for correction. Excluding body weight, 11 measurable characteristics were compared, i.e., total length/body length, body length/body height, body length/body width, body length/head length, body length/ caudal peduncle length, body length/caudal peduncle height, body length/body length before anus, caudal peduncle length/caudal peduncle height, head length/snout length, body length/eye diameter, and head length/interorbital distance. These 11 ratios were used in the LSD significance tests and to calculate the HI for hybrid offspring. The 11 ratios and 24 framework data were combined to give a total of 35 measures, which were subjected to cluster analysis, discriminant analysis, and principal components analysis by SPSS 17.0 after taking the natural logarithms.

4.1.2 Results and Analysis 4.1.2.1 Growth Comparison The growth comparison test was performed over a period of 174 days. The results of the growth comparisons for the Northern subspecies of largemouth bass and two hybrid offspring are shown in Table 4.1, and the relationship between body weight and age is shown in Fig. 4.2. According to Table 4.1 and Fig. 4.2, during 90
152 days of age, there was little difference among the three test populations. After 152 days of age, the growth rate of the Northern subspecies of largemouth bass was

Hybridization Between Subspecies of Largemouth Bass

137

Table 4.1 Growth rates for the Northern subspecies and two hybrids of largemouth bass at different stages Population Absolute growth rate Instantaneous growth rate

N NF FN

152 day

189 day

264 day

152 day

189 day

264 day

1.36 1.38 1.38

1.48 1.18 1.01

1.9 1.6 1.5

1.2262 0.7297 0.32

1.3538 0.6451 0.311

1.2917 0.5662 0.3042

Weight (g)

400

N

350

NF

300

FN

250 200 150 100 50 0 90

152 189 Time (day)

264

Figure 4.2 Relationship between body weight (g) for the Northern subspecies and two hybrids of largemouth bass and days of age (day).

obviously faster than that of the two hybrids, and the three populations all grew fastest at 189
264 days of age. 4.1.2.2 Countable Characteristics The sample sizes used for morphological measurement, as well as the ranges of body length and weight for the four groups, i.e., Northern subspecies, Florida subspecies, and direct and reverse cross hybrids, are listed in Table 4.2. There were no differences in the numbers of pelvic fin rays, anal fin spines, gill rakers, and vertebrae among all three groups, i.e., five, three, eight, and 32, respectively (Table 4.3). Chi-square analysis was used to compare the eight remaining countable characteristics (Table 4.4), which indicated that seven of these countable characteristics differed significantly between the direct cross offspring (NF) and parent fish (N) (P , 0.05), excluding the number of ribs. The differences in these seven

138

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

Table 4.2 Sample sizes used to obtain morphological measurement and ranges for body length and weight in the Northern subspecies, Florida subspecies, and direct and reverse cross hybrids Population

N F NF FN

Sample size

31 30 32 33

Body length (cm)

Body weight (g)

Range

Mean 6 standard deviation

Range

Mean 6 standard deviation

21.8
27.3 19.0
25.8 16.5
22.3 18.4
26.1

24.46 6 1.30 22.05 6 1.79 19.42 6 1.37 21.38 6 1.74

273.7
551.4 174.5
652.1 133.0
367.8 173.4
523.6

403.71 6 68.90 343.56 6 114.26 211.43 6 57.66 276.28 6 83.48

countable characteristics were all significant, except for the number of lateral line scales between NF and parent fish (F). Between the reverse cross offspring (FN) and F, the difference was not significant in only one characteristic, i.e., lateral line scales. After calculating the HI for the eight countable characteristics that differed between the direct and reverse cross hybrids, the results showed that the dorsal fin rays and number of lateral line scales were maternal characteristics in NF; pectoral fin rays, anal fin rays, caudal fin rays, ribs, scales above lateral line, and scales below lateral line were paternal characteristics in NF; and all of the other characteristics were paternal in FN except for two maternal characteristics, i.e., caudal fin rays and number of scales below the lateral line. The average HI indicated that the countable characteristics were all paternal in NF and FN. 4.1.2.3 Measurable Characteristics The ratios of the measurable characteristics and HI are shown in Table 4.5. Chi-square analysis showed that NF differed greatly from N only in the tail, but it differed greatly from F in the tail and head, while FN, N, and F all differed slightly in the tail and head. After calculating the HI for direct and reverse cross offspring, we found that total length/ body length, body length/body height, body length/body width, head length/snout length, and head length/inter or bital distance were all maternal in NF; body length/head length, body length/caudal peduncle length, body length/caudal peduncle height, body length/body length before anus, caudal peduncle length/caudal peduncle height, and head length/eye diameter were all paternal in NF; body length/caudal peduncle height, caudal peduncle length/caudal peduncle height, and head length/snout were all maternal in FN; total length/body length, body

Table 4.3 Countable characteristics for the Northern subspecies, Florida subspecies of largemouth bass, and their hybrid offspring Characteristic N F NF HI FN

Dorsal fin spines Dorsal fin rays Pectoral fin rays Pelvic fin rays Anal fin spines Anal fin rays Caudal fin rays Ribs Lateral line scale Scales above lateral line Scales below lateral line Gill rakers Vertebrae Average

8
10 (9.00 6 0.25) 14
15 (14.61 6 0.50) 13
15 (13.77 6 0.50) 5 3 11
15 (11.87 6 0.72) 28
35 (31.58 6 1.62) 15.00 (15.00 6 0.00) 59
68 (65.03 6 2.27) 7
8 (7.61 6 0.50) 15
19 (16.97 6 0.84) 8 32

9 15
16 (15.07 6 0.25) 14
16 (14.80 6 0.49) 5 3 12
13 (12.03 6 0.18) 28
35 (31.77 6 1.89) 14.00 (14.00 6 0.00) 68
75 (70.63 6 1.87) 7
9 (7.73 6 0.52) 16
18 (16.83 6 0.60) 8 32

8
10 (9.00 6 0.25) 14
17 (14.81 6 0.69) 14
15 (14.59 6 0.50) 5 3 11
13 (11.97 6 0.54) 29
36 (32.81 6 1.45) 14
15 (14.16 6 0.37) 60
73 (65.69 6 3.04) 7
8 (7.34 6 0.48) 13
17 (16.19 6 0.74) 8 32

/ 4 80 / / 63 647 84 12 225 557 / / 209

9 13
15 (14.58 6 0.66) 10
16 (14.21 6 1.22) 5 3 10
14 (11.70 6 0.69) 30
35 (32.30 6 1.40) 14
15 (14.61 6 0.50) 61
73 (66.00 6 2.32) 7
9 (7.33 6 0.54) 14
18 (16.61 6 0.93) 8 32

HI

/ 106 57 / / 206 2 278 61 189 333 -157 / / 64.63

140

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

Table 4.4 Chi-square values for the countable characteristics of the Northern subspecies, Florida subspecies of largemouth bass, and their hybrid offspring Characteristic N
F N
NF N
FN F
NF F
FN NF
FN

Dorsal fin rays Pectoral fin rays Anal fin rays Caudal fin rays Ribs Lateral line scales Scales above lateral line Scales below lateral line

54.92

59.73

33.97

88.07

100.62

90.31

33.10

17.43

71.38

38.74

93.48

90.35

119.66

81.57

110.06

71.26

143.59

102.62

19.31

39.14

32.00

32.65

23.48

36.29

0.02 29.49

1.29 37.49

22.56 62.34

43.61 17.36

8.40 22.00

3.46 36.35

35.54

28.67

30.22

54.89

26.00

73.52

64.66

80.33

70.25

47.29

64.86

82.97

 indicates P , 0.05, i.e., a significant difference;  indicates P , 0.01, i.e., a highly significant difference.

length/body height, body length/body width, head length/eye diameter, and head length/interorbital distance were all paternal in FN; while body length/head length, body length/caudal peduncle length, and body length/body length before anus were close to the ideal intermediate values. The average HIs indicated that NF was maternal and that FN was paternal based on the measurable characteristics. 4.1.2.4 Cluster Analysis The clustering chart for the morphological ratio parameters of the four groups, i.e., Northern subspecies, Florida subspecies of largemouth bass, and their hybrid offspring, is shown in Fig. 4.3. According to this figure, the four groups could be clearly divided into two clades, where the two subspecies clustered in one clade and the two hybrids clustered in another. These results indicate that the degree of divergence increased between the hybrid offspring and the two parents. 4.1.2.5 Principal Components Analysis Principal components analysis was performed using the measurable characteristics and framework data obtained from the four largemouth bass populations and six principal components were obtained, where the

Table 4.5 Measurable characteristics for the Northern and Florida subspecies of largemouth bass, and their hybrid offspring Ratio N F NF HI FN

Length/body length Body length/body height Body length/body width Body length/head length Body length/caudal peduncle length Body length/caudal peduncle height Body length/body length before anus Caudal peduncle length/caudal peduncle height Head length/snout length Head length/eye diameter Head length/interorbital distance Average

1.20 6 0.04 3.10 6 0.19 5.69 6 0.52 3.31 6 0.21 4.61 6 0.38 8.10 6 0.60 1.67 6 0.07 1.76 6 0.14 4.09 6 0.21 6.25 6 0.39 3.69 6 0.17

1.25 6 0.02 3.04 6 0.22 5.51 6 0.45 3.07 6 0.13 5.23 6 0.36 7.89 6 0.31 1.61 6 0.03 1.52 6 012 3.76 6 0.19 6.30 6 0.47 4.55 6 0.16

1.21 6 0.02 3.14 6 0.19 5.90 6 0.45 3.10 6 0.14 4.98 6 0.34 7.94 6 0.34 1.63 6 0.05 1.60 6 0.13 4.12 6 0.26 6.36 6 0.36 3.80 6 0.02

20 2 66 2 116 88 60 76 67 67 29 220 13 38.18

1.20 6 0.02 3.12 6 0.23 5.78 6 0.39 3.21 6 0.10 4.95 6 0.59 7.89 6 0.63 1.64 6 0.05 1.61 6 0.21 3.66 6 0.36 6.46 6 0.56 3.89 6 0.35

HI

100 133 150 54 45 0 50 38 23 320 77 87.63

142

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

0

5

10

15

20

25

Direct cross offspring Reverse cross offspring Northern subspecies Florida subspecies

Figure 4.3 Morphological clustering chart for the Northern subspecies and Florida subspecies of largemouth bass, and their hybrid offspring.

integrated indicators for three populations are shown in Table 4.6. The cumulative contribution rate for the six principal components reached 82.97%, where the first three contributed most, i.e., 54.90%, 11.21%, and 5.33%, respectively, and their cumulative contribution was 71.44%. The first three principal components explained the majority of the total variation in the population. Further analysis was performed using the factor loading matrix of the principal components, which showed that the load values for component 1 in all the framework data were larger than 0.5, which mainly reflected the changes in fish shape. The loading values were large (loading value .0.3) for component 2 with respect to several ratios, i.e., body length/body height, body length/body width, body length/ head length, body length/caudal peduncle length, body length/body length before anus, and caudal peduncle length/caudal peduncle height, which mainly reflected morphological changes in the fish head, dorsal, and tail regions. Component 3 had high loadings for the total length/ body length, body length/body height, body length/body width, body length/caudal peduncle length, and head length/eye diameter, which mainly reflected morphological changes in the fish head, dorsal, and tail regions. Thus, we can conclude that the morphological differences in the four populations were attributable mainly to differences in the fish head, dorsal, and tail regions. A three-dimensional figure was drawn using principal components 1, 2, and 3, as shown in Fig. 4.4. There was no overlapping area between the Northern subspecies population and the Florida subspecies population and they were completely separated, but there was a small amount of overlap between the two hybrid offspring populations and the two parent populations, although the majority could be separated.

Table 4.6 Loading matrix for the principal components of the four largemouth bass populations and the rates of contribution to the total variance Ratios Principal components Ratios Principal components

Total length/body length Body length/body height Body length/body width Body length/head length Body length/caudal peduncle length Body length/caudal peduncle height Body length/body length before anus Caudal peduncle length/caudal peduncle height Head length/snout length Head length/eye diameter Head length/interorbital distance C1
2/total length C2
4/total length C4
6/total length C6
8/total length C8
10/total length C10
11/total length C11
9/total length

1

2

3

0.201 2 0.471 2 0.430 0.107 2 0.178 2 0.042 2 0.044 0.105 0.091 0.006 0.014 0.864 0.528 0.902 0.862 0.860 0.847 0.936

2 0.658 0.458 0.389 0.663 2 0.654 0.608 0.653 0.794 0.282 0.047 2 0.578 2 0.195 2 0.368 2 0.057 0.122 0.172 0.111 0.053

0.432 0.417 0.452 2 0.427 2 0.007 0.550 0.013 0.299 0.184 0.103 0.533 0.183 0.126 0.167 0.012 2 0.028 0.201 2 0.016

C9
7/total length C7
5/total length C5
3/total length C3
1/total length C4
1/total length C6
3/total length C8
5/total length C10
7/total length C2
3/total length C6
1/total length C4
3/total length C8
3/total length C6
5/total length C10
5/total length C8
7/total length C11
7/total length C10
9/total length Contribution rate

1

2

3

0.719 0.742 0.779 0.752 0.929 0.967 0.974 0.926 0.931 0.978 0.964 0.972 0.948 0.928 0.935 0.883 0.915 54.9

0.136 0.211 0.152 0.126 0.004 2 0.128 2 0.035 2 0.034 2 0.138 0.003 2 0.097 2 0.022 0.029 0.007 0.088 2 0.006 0.159 11.21

0.250 2 0.090 2 0.252 2 0.083 0.034 2 0.056 2 0.087 2 0.026 0.118 2 0.026 0.051 2 0.096 2 0.107 0.037 2 0.130 0.262 2 0.008 5.33

144

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

M.s. salmoides M.s. floridanus

4.00000

M.s. salmoides

×M.s. floridanus

M.s. floridanus

×M.s. salmoides

Factor2

2.00000

0.00000

–2.00000

–4.00000

000 –6.00 000 –4.00 000 –2.00 00 0.000 00 2.000 00 4.000 3.00000

2.00000 1.00000

0.00000 –1.00000

–2.00000 –3.00000

Factor1

Factor3

Figure 4.4 Three-dimensional plot based on the principal components analysis of the four largemouth bass populations.

4.1.2.6 Discriminant Analysis The 11 parameters that contributed the most were subjected to discriminant analysis. These parameters comprised the total length/body length, head length/snout length, head length/interorbital distance, D2
4, D4
6, D3
5, D1
4, D3
6, D1
6, D7
11, and D9
10, respectively, which were indicated by C1
C11, respectively. To determine the group assignments of fish, the corrected data measurements were substituted into the equation and the largest function value indicated the population to which the fish belonged. The Bayesian discriminant equations were established as follows. Northern subspecies: Y1 5 3496:682C1 1 692:507C2 1 1267:656C3
433:971C4
826:245V5 1 192:661C6
164:821C7
1128:399C8 1 3093:024C9
185:123C10 1 149:703C11
1231:358 Florida subspecies: Y2 5 4001:170C1 1 644:406C2 1 1417:690C3
255:006C4
542:880C5 1 115:709C6
311:967C7
968:845C8 1 2786:414C9
91:569C10 1 38:710C11
1326:474

Hybridization Between Subspecies of Largemouth Bass

145

Direct cross hybrid offspring (Northern subspeciesQ 3 Florida subspeciesR): Y3 5 3503:698C1 1 700:878C2 1 1262:584C3
355:557C4
834:575C5 1 144:567C6
214:796C7
1012:395C8 1 2992:039C9
125:173C10 1 73:932C11
1189:613 Reverse cross hybrid offspring (Florida subspeciesQ 3 Northern subspeciesR): Y4 5 3451:419C1 1 635:203C2 1 1285:565C3
386:524C4
950:231C5 1 210:935C6
232:781C7
1191:915C8 1 3291:234C9
307:054C10 1 197:822C11
1192:641 In order to verify the practical suitability of the equations above, predictive analysis and statistical evaluations were conducted using the fish from the experiments according to the discriminant equations and the results are shown in Table 4.7. According to the first part of the table, four fish from N were incorrectly assigned to NF and the discrimination accuracy was 87.1%, one fish from FN was incorrectly assigned to N and the accuracy was 97.0%, and the discrimination accuracy was 100% for both F and NF. The second part of the table shows the cross-validation results, which are fundamentally the same as those obtained using the method above, thereby indicating that the discriminant function was relatively stable. Many studies have addressed the hybridization of largemouth bass species, but the divergence between hybrid offspring may be advantageous Table 4.7 Discriminant results obtained for the Northern subspecies and Florida subspecies of largemouth bass, and their hybrid offspring Item N F NF FN Total number

General discriminant

Total Cross-validation

Total

N F NF FN N F NF FN

27 0 0 1 27 26 0 1 1 26

0 30 0 0 30 0 30 0 0 30

4 0 32 0 32 4 0 31 0 31

0 0 0 32 31 1 0 0 32 32

31 30 32 33 126 31 30 32 33 126

146

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

in terms of their growth performance. Indeed, most previous experimental results demonstrated that the Northern subspecies of largemouth bass exhibited the best growth at an age of 1 year, followed by the hybrids, and then the Florida subspecies (Williamson and Carmichael, 1990; Philipp and Whitt, 1991; Zolczynski and Davies, 1976). Growth data were not obtained from the Florida subspecies, but the result of our experiment indicated that the Northern subspecies exhibited better growth than the hybrids. By contrast, a previous study suggested that a hybrid of Florida subspeciesQ 3 Northern subspeciesRgrew better than the two parents (Kleinsasser et al., 1990). This difference may be related to the culture environment and methods employed, as well as the different growth stages of fish. For example, the growth rate difference between the Northern subspecies and two hybrid offspring was small before 152 days of age, but it increased after 152 days of age. It was reported that the growth rate of the Northern subspecies of largemouth bass was faster than that of the Florida subspecies before 3 years, but this pattern reversed at 4
5 years (Johnson and Graham, 1978). Some studies have also indicated that the growth rate of hybrids (Florida subspeciesQ 3 Northern subspeciesR) was obviously faster than that of the Northern subspecies after 2 years (Kleinsasser et al., 1990). Therefore, we suggest that analyses of different growth stages may be the main explanation for the different results obtained in these studies. The first morphological study of largemouth bass was performed by Bailey and Hubbs (1949) in the 1940s based on the Northern subspecies and Florida subspecies, which detected obvious differences in the number of lateral line scale and ribs between the two subspecies, i.e., 59
65 and 69
73 lateral line scales, and 15 and 14 pairs of ribs, respectively. Later studies showed that there were no differences in the numbers of pectoral fin rays, pelvic fin rays, anal fin rays, scales above the lateral line, scales below the lateral line, ribs, and other characteristics in the two subspecies (Richard, 1975; Li and Yang, 2001). However, it has been suggested that there may be differences in the number of ribs and lateral line scales in hybrid offspring. The present study showed that the number of ribs and lateral line scales in the hybrid offspring ranged between those found in the two parents, but there were no obvious differences in the other main countable characteristics. Therefore, it was difficult to distinguish the hybrid offspring from the parents based only on the countable characteristics. Multivariate analysis by combining traditional countable characteristics and framework parameters has achieved excellent results in recent years (Gu et al., 2008; Matondo et al., 2008). Thus,

Hybridization Between Subspecies of Largemouth Bass

147

cluster analysis can detect differences and relationships among classified objects (Li et al., 2000). The morphological differences among different populations can be summarized using principal components analysis (Wang et al., 2008b). Any sample for classification can be assigned to one population using a discriminant function and corresponding measurement indicators (Ma et al., 2008). In the present study, we found that the cumulative contribution rate of the six principal components was 82.97% according to multivariate analysis of the countable characteristics and framework data. It is generally considered that if the cumulative contribution rate of the components exceeds 80%
85%, then the result are satisfactory (Zhang, 2002). The six principal components accounted for the majority of the total population variance, thereby indicating that several mutually independent factors could be used to summarize the morphological differences between the two subspecies of largemouth bass and the two hybrid populations. In the discriminant analysis, the 11 parameters that contributed most were selected from the countable and framework data, and a discriminant equation was established, which achieved 100% discrimination for the Florida subspecies and direct cross hybrid, 97% for the reverse cross hybrid, and 87.1% for the Northern subspecies. Thus, the discrimination rate was high for the fish in each population. In addition, both the principal components analysis and discriminant analysis demonstrated that the morphological differences among the four populations were mainly in the head and tail regions, which was consistent with the results obtained by chi-square analysis. Therefore, the head and tail regions of largemouth bass are the positions with relatively high variation. The results of this study provide basic data related to growth and the morphological identification of the Northern subspecies and Florida subspecies of largemouth bass, and their hybrid offspring, as well as contributing to the aquaculture and management of largemouth bass in practical production.

4.2 LOW TEMPERATURE TOLERANCE AND OXYGEN CONSUMPTION RATES OF THE NORTHERN SUBSPECIES AND FLORIDA SUBSPECIES OF LARGEMOUTH BASS, AND THEIR HYBRID OFFSPRING Water temperature and dissolved oxygen are important environment factors that affect the growth and metabolism of fish, as well as their activity (Elliott, 1995). The water temperature affects many physical and chemical factors in water, as well as directly affecting the physiological activities of fish (Wu et al., 2010), including significant effects on their population

148

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

structure and geographic distribution. Oxygen participates directly in most metabolic activities and the oxygen consumption rate can influence fish metabolism, physiology, and the living conditions directly or indirectly (Fan et al., 2009). The suffocation point is the important parameter for studying the dissolved oxygen requirements and low oxygen tolerance in fish (Sun et al., 2010). Measuring low temperature tolerance in fish and their respiratory physiology are important for studying fish physiology and practical aquaculture transportation. Thus, we performed a hybridization experiment using the domestic cultured Northern subspecies (M. salmoides salmoides) and the introduced Florida subspecies (M. salmoides floridanus) to explore the differences between hybrids and parents in terms of their low temperature tolerance, oxygen consumption rate, and suffocation point characteristics in order to provide basic data to facilitate the crossbreeding of largemouth bass.

4.2.1 Materials and Methods 4.2.1.1 Experimental Materials For the experiments, the Northern subspecies of largemouth bass (N), Florida subspecies (F), Northern subspeciesQ 3 Florida subspeciesR (direct cross hybrid for short: NF), and Florida subspeciesQ 3 Northern subspeciesR (reverse cross hybrid for short: FN) were all obtained from the Tropical & Subtropical Fish Genetic Breeding Center at the Pearl River Fisheries Research Institute (China). The specifications of the fish used for lethal tests at low temperature are shown in Table 4.8, and for measuring the oxygen consumption rate and suffocation point, the fish weighed 15
19 g. The Northern subspecies was bred locally and the Table 4.8 Weight and body length ranges of the fish used in the lethal low temperature test Group

Northern subspecies Florida subspecies Direct cross hybrid Reverse cross hybrid

Body weight (g)

Body length (mm)

0.90 6 0.02

Temperature (°C) Start

First death

Half death

All death

4.19 6 0.13

20.0

3.8 6 0.06

3.1 6 0.17

3.0 6 0.15

0.43 6 0.07

3.64 6 0.27

20.0

5.2 6 0.12

5.0 6 0.21

4.7 6 0.06

0.25 6 0.02

2.91 6 0.21

20.0

5.1 6 0.06

4.8 6 0.06

3.5 6 0.12

0.45 6 0.02

3.47 6 0.11

20.0

4.8 6 0.21

4.2 6 0.17

3.1 6 0.15

Hybridization Between Subspecies of Largemouth Bass

149

Florida subspecies was introduced from the United States (country of origin) in 2009 by the Pearl River Fisheries Research Institute. 4.2.1.2 Lethal Test at Low Temperature The experiment was performed in an SPX-430 intelligent biochemical incubator. Before the experiment, juveniles from the four populations were domesticated in aerated water for 1 week, where the water temperature was maintained at 20 6 0.5˚C. During the experiment, the fish were fed surimi once a day, where the excrement was removed before feeding and any residues were removed after feeding, and about 10% of the total water volume was changed daily. The fish were fasted for 24 h and moved to a glass sink measuring 30 cm 3 20 cm 3 17 cm. The sink contained tap water at 20 6 0.5˚C after aeration. Two parallel groups were specified for each experimental population with 20 fishes in each. The cooling rate was set at 1˚C/2 h and the cooling process was continued until all of the fish died. The water was not changed and no food was provided during the experiment, but aeration was maintained. The water temperature was measured using a mercury thermometer with a precision of 0.1˚C. The condition of each fish was observed once every 30 min and the number of deaths at each temperature was recorded. The standard definition of death was based on Stauffer et al. (1988). 4.2.1.3 Measurement of the Oxygen Consumption Rate The oxygen consumption rate was measured using an enclosed flowingtest device. The specific design was based on Chen and Shi (1955), and the volume of the respiratory chamber was 18 L. The water was used in the experiment after aeration and the average oxygen content was 7.586 mg/L. Ten fish were included in each group. Before the experiment, each fish was placed in the respiratory chamber to adapt for 2
3 h. The experiment was started after steady breathing was observed and the flow velocity was controlled at about 30 L/h. The dissolved oxygen and the flow velocity of water in and out of the respiratory chamber were measured every 2 h. Each measurement was sampled twice and averaged over 24 h. After obtaining the measurements, the fish were used in the next test to measure the suffocation point. Dissolved oxygen was measured by Winkler iodimetry (Chen et al., 2000).

150

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

4.2.1.4 Measurement of the Suffocation Point In this experiment, a 10 L jar was used as the respiratory chamber, which was placed in a biochemical incubator at 25˚C. The water was sampled before placing the fish into the respiratory chamber and the dissolved oxygen was measured. Liquid paraffin was used to close the water surface immediately after placing the fish in the water. The dissolved oxygen level was then measured at the time of death for one fish, for half the fish, and for all of the fish. The dissolved oxygen level when half of the fish died was set as the suffocation point. For the 10 fish in each group, parallel samples were taken twice at each time point and the average value was obtained. 4.2.1.5 Data Analysis Linear interpolation was used to calculate the semilethal temperature for each experimental group. The data were processed using Excel 2007 and significance differences were analyzed with SPSS 17.0. Calculation of dissolved oxygen ðCO2 Þ:CO2 5 C 3 V 3 8 3 1000=100 (4.1) In the formula above, CO2 is the concentration of dissolved oxygen in water (mg/L), C is the concentration of sodium thiosulfate standard solution (mol/L), and V is the amount of sodium thiosulfate standard solution used (mL). OC 5 ðI 2 OÞ 3 V =W

(4.2)

In the formula above, OC is the oxygen consumption rate (mg/g h), I and O are the amounts of dissolved oxygen (mg/L), V is the flow in unit time (L/h), and W is the weight of each fish (g).

4.2.2 Results and Analysis 4.2.2.1 Low Temperature Tolerance The lethal low temperature experiment showed that the activity of each fish group was normal before the temperature dropped to 7˚C, but as the temperature declined subsequently, the fish swam slowly and exhibited delayed responses. When the temperature dropped to 6.7˚C, the Florida subspecies dropped to the bottom first. When the temperature dropped to 5.3˚C, the reverse cross hybrid offspring lost balance and dropped to the bottom. The temperatures for unbalancing in the other two groups were between those of the Florida subspecies and the reverse cross hybrid.

Hybridization Between Subspecies of Largemouth Bass

151

Northern subspecies

25

Florida subspecies Direct cross hybrid

Death rate (%)

20

Reverse cross hybrid

15

10

5

0 0

1

1.5

2

2.5

3

3.5

4

4.5

5

5.5

Temperature (ºC)

Figure 4.5 Death rate for the low temperature lethal experiments using the Northern subspecies, Florida subspecies, and their hybrids.

Death appeared first in the Florida subspecies group when the temperature dropped to 5.2˚C, and last in the Northern subspecies at a temperature of 3.8˚C. The death temperatures for the two hybrids were between those of the two parents. The semilethal temperature was highest for the Florida subspecies at 5.0˚C and lowest for the Northern subspecies at 3.1˚C. The semilethal temperatures for the two hybrids were between those of the two parents (Fig. 4.5). During the experiment, the mortality was similar in each parallel group repeated at the same temperature. One-way analysis of variance was applied to the semilethal low temperatures for the four populations, which showed that there were significant (P , 0.05) or highly significant (P , 0.01) differences among groups, thereby suggesting that there were significant differences in the semilethal low temperatures of the four populations. Table 4.8 was converted into mortality rates and a diagram of mortality versus temperature was drawn (Fig. 4.5). 4.2.2.2 Measurement of the Oxygen Consumption Rate In this experiment, we simulated changes in the water temperature between day and night under natural conditions. The thermostat was not set and the water temperature during the test process was 24
27˚C. The fish in the four largemouth bass test groups had similar weights. The oxygen consumption rates during the day and night for the four groups are shown in Table 4.9. The average oxygen consumption rate was highest in

Table 4.9 Oxygen consumption rates for the Northern subspecies of largemouth bass and the Florida subspecies, and their hybrids Species

Northern subspecies Florida subspecies Direct cross hybrid Reverse cross hybrid

Average weight (g)

Oxygen consumption rate (mg/g/h) 5:30

7:30

9:30

11:30

13:30

15:30

17:30

19:30

21:30

23:30

1:30

3:30

Average oxygen consumption rate (mg/g/h)

16.46 6 1.68

0.07

0.18

0.07

0.10

0.18

0.18

0.18

0.18

0.21

0.18

0.07

0.13

0.1368

18.27 6 1.67

0.18

0.18

0.21

0.23

0.18

0.17

0.22

0.29

0.18

0.17

0.14

0.05

0.1811

16.19 6 1.75

0.20

0.16

0.16

0.10

0.23

0.21

0.18

0.18

0.14

0.14

0.16

0.17

0.1681

17.13 6 2.45

0.11

0.14

0.17

0.17

0.15

0.24

0.14

0.14

0.11

0.10

0.10

0.12

0.1388

Hybridization Between Subspecies of Largemouth Bass

153

Oxygen consumption rate (mg/g h)

Northern subspecies

0.35

Florida subspecies

0.3

Direct cross hybrid

0.25

Reverse cross hybrid

0.2 0.15 0.1 0.05 0 5:30 7:30 9:30 11:30 13:30 15:30 17:30 19:30 21:30 23:30 1:30 3:30 5:30 Time (h)

Figure 4.6 Changes in the oxygen consumption rates by the largemouth bass Northern subspecies, Florida subspecies, and their hybrids in the day and night.

the Florida subspecies and direct cross offspring, but lowest in the Northern subspecies, and there was no obvious difference between the Northern subspecies and the reverse cross offspring. The variations (Fig. 4.6) in the oxygen consumption rates for the four groups during the day and night were drawn. The peak oxygen consumption rates for both the Northern subspecies and Florida subspecies occurred in the evening at 19:30
21:30, whereas those of the hybrids occurred in the afternoon at 13:30
15:30. The highest and lowest peak oxygen consumption rates of the Florida subspecies were the greatest in the four groups at 0.29 and 0.05 mg/g/h. We calculated the average oxygen consumption rates for each population in the day and night, where the day was considered to be 7:00
19:00 and the night was 19:00
7:00. The average oxygen consumption rates for the Northern subspecies in the day and night were 0.15 and 0.14 mg/g/h, respectively, 0.20 and 0.18 mg/g/h for the Florida subspecies, 0.17 and 0.16 mg/g/h for the direct cross hybrid, and 0.17 and 0.11 mg/g/h for the reverse cross hybrid. 4.2.2.3 Suffocation Point The results of the suffocation point experiment are shown in Table 4.10. Among the four test groups, the suffocation point was highest in the Florida subspecies at 0.4 mg/L, lowest in the Northern subspecies at 0.33 mg/L, and intermediate between the two subspecies in the two hybrids. Analysis of variance showed that there were no significant differences in the suffocation points among the four groups (P . 0.05).

Table 4.10 Suffocation points of the Northern subspecies of largemouth bass, Florida subspecies, and their hybrids Species Average weight (g) Dissolved oxygen (mg/L)

Northern subspecies Florida subspecies Direct cross hybrid Reverse cross hybrid

16.46 6 1.68 18.27 6 1.67 16.19 6 1.75 17.13 6 2.45

Original value

Floating head value

First death

Half dead

All dead

7.45 6 0.07 6.53 6 0.06 7.68 6 0.07 7.06 6 0.06

0.78 6 0.07 0.77 6 0.03 0.58 6 0.05 0.65 6 0.06

0.39 6 0.03 0.48 6 0.03 0.58 6 0.02 0.39 6 0.01

0.33 6 0.03 0.40 6 0.01 0.38 6 0.01 0.34 6 0.02

0.22 6 0.01 0.38 6 0.01 0.34 6 0.04 0.27 6 0.02

Hybridization Between Subspecies of Largemouth Bass

155

In the suffocation experiment, as the dissolved oxygen content of the respiratory chamber decreased, the fish first exhibited restlessness, before swimming up and down, and then floating with their heads up. As the dissolved oxygen content of the water declined significantly, several individuals lost balance, laid at the bottom, and their respiratory rate obviously slowed down. The fish struggled before death and their bodies appeared to be stiff after death. The four different experimental populations had similar behavioral characteristics during the suffocation experiment. Temperature is one of the most important environmental factors that affect growth and reproduction in fish. The lethal low temperature range plays a decisive role in the low temperature tolerance of fish and their capacity to adapt to the environment (Jiang et al., 2010). Understanding the low temperature tolerance of fish is very important for their introduction and culture. Measurements of the low temperature tolerance of the Northern subspecies and Florida subspecies of largemouth bass showed that there was a significant difference in the semilethal low temperature between the two groups (P , 0.05), i.e., 3.1 6 0.17 and 5.0 6 0.21˚C, respectively. Carmichael et al. (1988) used a slow cooling method at a cooling rate of 1˚C/day and also showed that the low temperature tolerance of the Northern subspecies was greater than that of the Florida subspecies. The results obtained in these experiments were similar and the difference between the two subspecies is due to their different native environments. The Northern subspecies is mainly distributed in cool freshwater rivers and lakes in northern America, whereas the Florida subspecies live in the warm southernmost region of Florida in the United States. Compared with other freshwater cultured fish that belong to the same order in Perciformes, the lethal low temperature of largemouth bass is lower than that of Oreochromis niloticus (Wang et al., 2011a) and Oxyeleotris marmorata (Wang, 2011), but similar to that of Siniperca chuatsi and Channa argus (Wang, 2000). Largemouth bass is relatively tolerant of low temperatures. Cossins and Bowler (1987) suggested that the range of adaptive temperatures in animals is directly proportional to their adaptability to temperature change. Therefore, the culture of the Northern subspecies of largemouth bass is also suitable for northern China. Regular variations in the oxygen consumption rate of fish during the day and night have been reported many times (Wang et al., 2011b; Gu et al., 2006; Xu et al., 2011). Changes in the oxygen consumption rate

156

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

can reflect the activities of fish in their natural environment (Clausen, 1936), where the oxygen consumption rate is high when fish are feeding or conducting other activities. Fig. 4.8 shows that the oxygen consumption rates of the juveniles in the four groups fluctuated significantly during the day and night. In general, it is considered that variations in the fish oxygen consumption rate between day and night can be divided into three groups: greater in the day than at night (Wang et al., 2010), greater at night than in the day (Fan et al., 2009), and not significantly different (Gu et al., 2010). Our results showed that there was no significant difference in the average oxygen consumption rate in the day and night among the four groups, and thus they belonged to the third type, i.e., similar oxygen consumption rates in the day and night. This is consistent with the habit of the largemouth bass of foraging during the night (Cofer, 1993). The average oxygen consumption rates of the two hybrids were higher than that of the Northern subspecies according to our comparisons of the rates in the day and night among the four largemouth bass populations. Thus, the two hybrid offspring populations might not have achieved hybrid vigor for anoxia tolerance. Williamson and Carmichael (1990) and Carmichael et al. (1988) measured the oxygen consumption rates in four populations of the Northern subspecies, Florida subspecies, and their two hybrids, where all results showed that the tolerance of anoxia was high in the Northern subspecies, which was similar to the results obtained in the present study. Chinese aquaculture of largemouth bass is limited to the Northern subspecies and feeding is recommended in the periods with a higher oxygen consumption rate according to the oxygen consumption rate graph for the Northern subspecies. Based on comprehensive analysis, we consider that feeding at 7:30, 13:30, and 18:30 would be most consistent with the respiratory physiological rhythm, thereby improving the utilization of feed, with more feed in the evening (about 1/3 of the total feed in the daytime).

4.3 GENETIC STRUCTURE OF THE NORTHERN AND FLORIDA SUBSPECIES OF LARGEMOUTH BASS AND THEIR HYBRIDS In the previous two sections, we described the growth traits, low temperature tolerance, and oxygen consumption rates of the Northern subspecies of largemouth bass (M. salmoides salmoides), Florida subspecies (M. salmoides floridanus), and their hybrid offspring. In order to further understand the genetic mechanism of hybridization between Northern

Hybridization Between Subspecies of Largemouth Bass

157

subspecies and Florida subspecies, and to provide a theoretical basis for largemouth bass crossbreeding, we analyzed the genetic structure of the Northern subspecies, Florida subspecies, and their two hybrids using microsatellite markers.

4.3.1 Materials and Methods 4.3.1.1 Experimental Materials The parental fish of the Northern subspecies and Florida subspecies of largemouth bass used in this experiment were obtained from the Tropical & Subtropical Fish Genetic Breeding Center at the Pearl River Fisheries Research Institute, where the Northern subspecies is a local breed and the Florida subspecies was introduced from Florida (USA) in 2009. In March 2010, 20 gonadal well-developed parental fishes weighing 0.5
0.6 kg were selected from each of the two subspecies groups at an age of 1 year, which were then injected with LHR-A2 and DOM to initiate artificial spawning. Five female fish of the Northern subspecies, five male fish of the Florida subspecies, six male fish of the Northern subspecies, and five female fish of the Florida subspecies were selected for hybridization, and the two groups were placed in two cement ponds to allow natural reproduction. After reproduction, the partial caudal fins of the 11 parental fish from the Northern subspecies (N) and 10 from the Florida subspecies (F) were cut with scissors and fixed in 95% ethanol. At 3 months of age, the partial caudal fins were collected from 36 fish in each hybrid group and fixed in 95% ethanol. For simplicity, we denote the hybrid offspring of the Northern subspecies Q 3 Florida subspecies R as NF, and that of the Florida subspecies Q 3 Northern subspecies R as FN. 4.3.1.2 Extraction of Genomic DNA from Parents and Offspring Genomic DNA was extracted using a genomic DNA extraction kit from TianGen Biotech Co. Ltd (Beijing), according to the manufacturer’s instructions. The quality of the DNA was confirmed by agarose gel electrophoresis at 8 mg/mL (0.8%). The optical densities at 260 nm (OD260) and OD280 were measured using a UV spectrophotometer. Some DNA samples were retained and adjusted to 50 ng/μL, before storing at 220˚C until use. 4.3.1.3 Microsatellite Primers We employed 18 pairs of largemouth bass microsatellite primers (Table 4.11), where nine pairs were determined by our laboratory using

158

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

Table 4.11 Sequences and amplification temperatures for the 18 primers pairs Locus Primer sequence Annealing temperature (°C)

Jzl31 Jzl48 Jzl60 Jzl68 Jzl72 Jzl83 Jzl84 Jzl85 Jzl131 Lar7 Lma120 Mdo6 Mdo7 Msal21 MiSaTPW76 MiSaTPW117 MiSaTPW165 MiSaTPW184

F:TGGACTGAGGCTACAGCAGA; R:CCAAGAGAGTCCCAAATGGA F:TCGACGATCAATGGACTGAA; R:TCTGGACAACACAGGTGAGG F:AGTTAACCCGCTTTGTGCTG; R:GAAGGCGAAGAAGGGAGAGT F:AGGCACCGTCTTCTCTTCA; R:CATTGTGGGTGCATTCTCC F:AGGGTTCATGTTCATGGTAG; R:ACACAGTGGCAAATGGAGGT F:TGTGGCAAAGACTGAGTGGA; R:ATTTCTCAACGTGCCAGGTC F:GAAAACAGCCTCGGGTGTAA; R:CACTTGTTGCTGCGTCTGTT F:GGGGCTCACTCACTGTGTTT; R:GTGCGCAGACAGCTAGACAG F:CAAATGCCCGGTCCACAATAAC; R:GTATTTGAGCCGGATGATAAGTG F: GTGCTAATAAAGGCTACTGTC; R:TGTTCCCTTAATTGTTTTGA F:TGTCCACCCAAACTTAAGCC; R:TAAGCCCATTCCCAATTCTCC F:TGAAATGTACGCCAGAGCAG; R:TGTGTGGGTGTTTATGTGGG F:GTCACTCCCATCATGCTCCT; R:TCAAACGCACCTTCACTGAC F:CACTGTAAATGGCACCTGTGG; R:GTTGTCAAGTCGTAGTCCGC F:ACACAGTGTCAGTTCTGCA; R:GTGAATACCTCAGCAAGCAT F:TGTGAAAGGCACAACACAGCCTGC; R:ATCGACCTGCAGACCAGCAACACT F:GTTCGCATCTGAATGCATGTGGTG; R:TGAAGGTATTAGCCTCAGCCTACA F:TTGTATACCAAGTGACCTGTGG;R: GGGAGTGCATCTTTCTGAAGTGCC

60 55 60 58 58 55 55 56 55 47 54 55 53 58 48 55 55 47

the magnetic beads enrichment method (Liang et al., 2008) and the other nine pairs were described previously (Lutz-Carrillo et al., 2006). All of the primers were synthesized by Sangon Biotech Co. Ltd (Shanghai).

Hybridization Between Subspecies of Largemouth Bass

159

4.3.1.4 PCR Amplification and Product Detection The PCR reaction system comprised a total volume of 20 μL, which contained 50 ng genomic DNA, 10 3 buffer 2 μL, MgCL2 (25 mmol/L) 0.8 μL, 4 3 dNTP(10 μmol/L) 0.3 μL, each upstream/downstream primer (10 mol/L), and Taq enzyme 1U. The PCR reaction procedure comprised pre-denaturation at 94˚C for 4 min, followed by 30 cycles of denaturation at 94˚C for 30 s, annealing (temperature based on the primer) for 30 s, and extension at 72˚C for 30 s, before a final extension at 72˚C for 7 min. The PCR product was separated on a 10% nondenaturing polyacrylamide gel and stained with silver nitrate. 4.3.1.5 Statistical Analysis The allele number (Na), effective allele number (Ne), observed heterozygosity (Ho), expected heterozygosity (He), χ2 test or Hardy
Weinberg equilibrium, genetic differentiation index F-statistic (FST), and Nei’s standard genetic distance (Ds) (Nei, 1978) for the microsatellite loci were statistically analyzed using Popgene32 (Version 1.31). Based on the methods described by Botstein et al. (1980), the polymorphic information content (PIC) was calculated for each microsatellite locus. Cluster analysis was performed with MEGA 4.0 using the UPGMA method to analyze genetic relationships.

4.3.2 Results and Analyses 4.3.2.1 Amplification Results for Microsatellites The 18 pairs of microsatellite primers used in this experiment amplified the corresponding bands in all of the DNA samples (Fig. 4.7). Among the 93 individual parents and hybrids, for each microsatellite primer, the allele number was 2
8, the average allele number was 5.00, the average effective allele number was 3.55, and the amplified fragment size was 131
268 bp.

Figure 4.7 Amplification results obtained for individuals from the Northern subspecies, Florida subspecies, and two hybrids using primer Lar7. 1
11: N; 12
21: F; 22
33: FN; 33
45: NF; M: Marker.

160

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

The allele number and effective allele number at each locus for the Northern subspecies parents, Florida subspecies parents, and their hybrids are shown in Table 4.12. 87 alleles at 18 loci amplified in the parental largemouth bass, whereas 81 alleles were amplified in the hybrids. The specific bands among subspecies were amplified at loci Jzl48, Jzl68, Jzl84, MiSaTPW76, Msal21, Mdo6, and Mdo7 in the Northern subspecies and Florida subspecies used in this experiment. Two genotypes (215/219 and 219/219 bp) were amplified in the Northern subspecies using primer Jzl48, which were monomorphic in the Florida subspecies (203 bp), and two genotypes in the hybrids (203/ 215 and 203/219 bp). Monomorphism was detected in both the Northern subspecies and Florida subspecies using the primer Mdo7 with bands of 165 and 174 bp, respectively, whereas two genotypes were amplified in the hybrids (165/174 and174/182 bp), where one band of 182 bp was nonamphiphilic. 4.3.2.2 Analysis of Genetic Diversity The PICs of only four loci, i.e., Msal21, MiSaTPW184, Jzl131, and Mdo6, among the 18 loci were less than 0.5, which indicates moderate or low polymorphism, whereas the others were all highly polymorphic, thereby suggesting that the polymorphism of the selected microsatellite primers was good so they can be used for genetic diversity analysis. The effective allele number, observed heterozygosity, expected heterozygosity, and PICs, which reflect the population genetic diversity, were calculated based on the allele frequency at each locus, and the average ranges were 2.4981
3.1997, 0.5556
0.8488, 0.5248
0.6389, and 0.4506
0.5706, respectively. The average effective allele number, average expected heterozygosity, and average PICs were highest for the hybrid FN, with values of 3.1997, 0.6389, and 0.5706, respectively. However, the average observed heterozygosity was highest for the hybrid NF with 0.8488. Analysis of these indexes suggested that the genetic diversity of the hybrid FN was highest, followed by NF and F, and lowest in N. The χ2 test of the Hardy
Weinberg equilibrium was performed for each locus in each combination, where the results showed that five loci from N, seven loci from F, all of the loci except Msal21 (0.2267) and M184 (0.1290) from NF, and all of the loci from FN deviated from equilibrium (P . 0.05).

Table 4.12 Allele number, effective allele number, and PICs for the largemouth bass Northern subspecies, Florida subspecies, and their hybrids at 18 microsatellite loci Locus Northern subspecies Florida subspecies Direct cross hybrid offspring Reverse cross hybrid offspring

Jzl31 Jzl48 Jzl60 Jzl68 Jzl72 Jzl83 Jzl84 Jzl85 Jzl131 Lar7 Lma120 Mdo6 Mdo7 Msal21 MiSaTPW76 MiSaTPW117 MiSaTPW165 MiSaTPW184 Mean

Na

Ne

PIC

Na

Ne

PIC

Na

Ne

PIC

Na

Ne

PIC

3 2 6 3 5 5 4 2 2 4 3 3 1 1 3 4 4 2 3.1667

2.1416 1.7664 4.6538 2.5474 4.1724 4.1017 3.2267 1.1980 1.9836 3.2703 2.6593 1.3224 1.0000 1.0000 2.5474 3.4085 2.9877 1.4235 2.4981

0.4315 0.3397 0.7534 0.5244 0.7236 0.7184 0.6408 0.1516 0.3729 0.6368 0.5532 0.2284 0.0000 0.0000 0.5244 0.6555 0.6041 0.2532 0.4506

2 1 6 3 5 6 3 3 1 7 2 2 1 3 5 5 4 3 3.4444

2.0000 1.0000 5.5556 2.4691 4.1667 5.1282 2.4096 1.9417 1.0000 6.0606 1.7241 1.3423 1.0000 2.5316 3.8462 3.1250 2.4390 2.3810 2.7845

0.3750 0.0000 0.7947 0.5279 0.7224 0.7757 0.5434 0.4063 0.0000 0.8132 0.3318 0.2224 0.0000 0.5269 0.6965 0.6420 0.5039 0.4918 0.4652

4 3 5 4 6 4 4 4 3 6 3 2 3 3 4 3 4 2 3.7222

3.3402 2.6557 4.0627 3.2645 4.3056 3.2279 3.2852 2.6288 2.5019 4.4082 2.3226 2.0000 23715 1.7109 2.9026 1.9817 3.2645 1.4922 2.8737

0.6457 0.5525 0.7115 0.6377 0.7323 0.6360 0.6406 0.5458 0.5204 0.7435 0.4767 0.3750 0.4893 0.3688 0.5957 0.3972 0.6377 0.2754 0.5545

2 3 6 5 5 5 5 3 1 6 4 2 2 3 6 5 4 3 3.8889

2.0000 2.3330 5.0625 4.0819 4.5000 3.9938 3.8629 2.6557 1.0000 5.2153 3.0387 2.0000 2.0000 2.4804 4.0691 3.3019 3.8457 2.2717 3.1997

0.3750 0.4850 0.7750 0.7152 0.7425 0.7043 0.6970 0.5525 0.0000 0.7809 0.6100 0.3750 0.3750 0.5274 0.7222 0.6453 0.6917 0.4971 0.5706

PIC, polymorphism information content.

162

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

4.3.2.3 Analysis of Genetic Structure Among Populations The F-test was performed for the Northern subspecies, Florida subspecies, and their two hybrids (Table 4.13). The results showed that the genetic differentiation index (FST) was highest between the Northern subspecies and Florida subspecies (FST 5 0.2409), which indicated high differentiation, and the FST was lowest between the two hybrids (0.0678), which indicated moderate differentiation. By comparing the genetic differentiation indexes of the parents and hybrid offspring, we found that the FST values between both hybrids and the Northern subspecies were the lowest (0.0920 and 0.1026). We analyzed the genetic similarity and genetic distance between the two hybrids and their parents (Table 4.14). The genetic similarity was relatively high between both hybrids and the Northern subspecies. Based on the genetic distance between the parents and offspring, we constructed a phylogenetic tree for the hybrid offspring and their parents using the UPGMA method (Fig. 4.8). The two hybrids clustered together to form one branch and then clustered with the Northern subspecies as one branch, and finally these three clustered with the Florida subspecies. At present, fish hybridization involves three orders, seven families, and over 40 types of fish in total (Lou and Li, 2006). However, due to differences in the parental genetic backgrounds, the genetic hybridization methods employed are not the same, such as gynogenesis and androgenesis without parental sperm
ovum fusion (Wang et al., 2008a), partial parental genetic substances occurring in combination or exchange

Table 4.13 F-Statistics (FST) for the largemouth bass Northern subspecies, Florida subspecies, and their hybrids Northern Florida Direct hybrid subspecies subspecies offspring

Northern subspecies Florida subspecies Direct hybrid offspring Reverse hybrid offspring

0.2409 0.1026

0.1318

0.0920

0.0932

0.0680

Hybridization Between Subspecies of Largemouth Bass

163

Table 4.14 Genetic similarity and genetic distances for the largemouth bass Northern subspecies, Florida subspecies, and their hybrids Northern Florida Direct hybrid Reverse subspecies subspecies offspring hybrid offspring

Northern subspecies Florida subspecies Direct hybrid offspring Reverse hybrid offspring



1.0594

0.3467 

0.2893

0.2904

0.4647

0.3168

0.7488

0.6283

0.7479

0.7285



0.2784

0.7570 

Note: Numbers above the diagonal in the table indicate the similarity index among populations and the numbers below the diagonal indicate the relative genetic distance among populations.  indicates the diagonal.

Figure 4.8 UPGMA cluster analysis tree of the largemouth bass Northern subspecies, Florida subspecies, and their hybrids.

(Lou and Li, 2006), and real sperm
ovum fusion (Mi et al., 2010). In this study, we analyzed the bands for 18 microsatellite markers, which showed that all of the alleles of the hybrid offspring came from the parents except one nonparental band. The result is consistent with Mendelian inheritance, thereby indicating that the hybrids of largemouth bass subspecies are the product of sperm
ovum fusion, where this conclusion was supported by the phenotype of the hybrid offspring of the two parents. Wheat et al. (1974) conducted an interspecies cross experiment between largemouth bass and smallmouth bass (M. dolomieui) belonging to the same genus, where hybrid offspring were also obtained from sperm
ovum fusion. The occurrence of sperm
ovum fusion is attributed to the close genetic relationship between the two parents.

164

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

In this study, the genetic similarities and genetic distances of two hybrid offspring all demonstrated the existence of a close relationship between the hybrids and the Northern subspecies of largemouth bass. The coordination of the genetic distance between hybrid offspring and two parents has been reported frequently in hybridization experiments using other fish, e.g., the hybrid of Oncorhynchus mykissQ and Oncorhynchus masou masouR appeared to be genetically paternal (Zhang et al., 2009), and the hybrid of Yangtze River CtenopharyngodonQ 3 Zhujiang River CtenopharyngodonR had a closer genetic relationship to the female parent (Fu et al., 2010). Both the direct and reverse cross hybrid of Cyprinus carpio var. “wuyuanensi” and Cyprinus carpio mirror had a closer genetic relationship to Cyprinus carpio var. wuyuanensi (Chi et al., 2010). The contribution of genetic substances to offspring is not coordinated and it is assumed that the gene homozygosity differs between two parents, thereby increasing the probability that the genotype of a parent with higher genotype homozygosity can be measured. In this study, the genetic homozygosity of the Northern subspecies was higher than that of the Florida subspecies, and thus the probability of measuring the genotype of the Northern subspecies in the offspring was correspondingly higher than that in the Florida subspecies. However, some researchers have suggested that recombination and mutation, segregation distortion clustering of microsatellite markers near the centromere and heterochromatin in the hybridization process (Zhang et al., 2008), selective loss during developmental processes (Estoup et al., 2002), and other reasons may lead to imbalanced inheritance.

REFERENCES Bai, J., Li, S., Deng, G., et al., 2009. Aquaculture actuality and technology of Micropterus salmoides in China. Sci. Fish Farming (6), 12
16. Bailey R.M., Hubbs C.L. 1949. The black basses (Micropterus) of Florida, with description of a new species. University of Michigan Museum of Zoology Occasional Papers, 516: 1
40. Botstein, D., White, R.L., Skolnick, M., et al., 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 32, 314
331. Carmichael, G.J., Williamson, J.H., Woodward, C.A.C., et al., 1988. Communications: responses of northern, Florida, and hybrid largemouth bass to low temperature and low dissolved oxygen. Prog. Fish Cult. 50 (4), 225
231. Chen, J., Zang, W., Jin, S., et al., 2000. Water chemical experiment instruction. China Agriculture Press, Beijing. Chen, N., Shi, Q., 1955. Oxygen consumption of Ctenopharyngodon idellus, Hypophthalmichthys molitrix and Aristichthys nobilis. Acta Zool. Sin. 7 (1), 34
57.

Hybridization Between Subspecies of Largemouth Bass

165

Chi, X., Jia, Z., Li, C., et al., 2010. Analysis of genetic structure in obverse and inverse cross of purse red carp and German mirror carp by microsatellite markers. J. Dalian Fish. Univ. 25 (5), 450
455. Clausen, R.G., 1936. Oxygen consumption in freshwater fishes. Ecology 17 (2), 216
226. Cofer, L.M., 1993. Evaluation of a trophy bass length limit on Lake Fuqua, Oklahoma. Proc. Annu. Conf. Southeast. Assoc. Fish Wildl. Agencies 47, 702
710. Cossins, A., Bowler, K., 1987. Temperature biology of animals. Chapman & Hall, London, p. 337. Cricelli, A., Dupont, F., 1988. Biometrical and biological features of Alburnus alburnus 3 Rutilus rubilio natural hybrids from lake Mikri Prespa, northern Greece. J. Fish. Biol. 31 (6), 721
733. Elliott, J.A., 1995. A comparison of thermal polygons for British freshwater teleosts. Freshwater Forum 5, 178
184. Estoup, A., Jarne, P., Cornuet, J., 2002. Homoplasy and mutation model at microsatellite loci and their consequences for population genetics analysis. Mol. Ecol. 11 (9), 1591
1604. Fan, Z., Zhao, X., Qian, L., 2009. Determination of oxygen consumption rate and asphyxia point of Perca fluviatilus fry. J. Hydroecol. 30 (4), 129
132. Fu, J., Wang, R., Liu, F., et al., 2010. Microsatellite analysis of genetic variation in Yangtze River, Zhujiang River, and Yangtze River Q 3 Zhujiang River R groups of Ctenopharyngodon idella. J. Shanghai Fish. Univ. 19 (4), 433
439. Gu, R., Xu, G., Wen, H., et al., 2006. Studies on the oxygen consumption rate and asphyxiant point of Hemibarbus maculatus Bleeker. J. Shanghai Fish. Univ. 15 (1), 118
122. Gu, W., Zhang, Y., Zhang, H., et al., 2010. Studied on the oxygen consumption rate and suffocated point for the White Spotted Char. Chin. Agric. Sci. Bull. 26 (21), 427
431. Gu, Z., Jia, Y., Ye, J., et al., 2008. Studies on morphological characteristics and genetic analysis of the hybrid F1, Erythroculter ilishaeformis R 3 Megalobrama amblycephala Q. J. Fish. China 32 (4), 533
544. Hulata, G., 2001. Genetic manipulations in aquaculture: a review of stock improvement by classical and modern technologies. Genetica. 111, 155
173. Jiang, P., Bai, J., Fan, J., 2010. Comparative study on extreme temperature tolerance and asphyxiation point of red fluorescent protein transgenic and wild-type Tanichthys albonubes. J. Hydroecol. 3 (6), 92
95. Johnson, D.L., Graham, L.K., 1978. Growth, reproduction, and mortality factors affecting the management of largemouth and smallmouth bass. Am. Fish. Soc 112, 92
103. Kleinsasser, L.J., Willamson, J.H., Whiteside, B.G., 1990. Growth and catchability of northern, Florida, and F1 hybrid largemouth bass in Texas ponds. North Am. J. Fish. Manage. 10, 462
468. Li, S., 1998. Genetical characterization of major freshwater culture. Shanghai Science and Technology Press, Shanghai, pp. 3
10. Li, C., Wang, Z., Wang, W., 2000. Biostatistics. Science Press, Beijing. Li, Z., Yang, T., 2001. Studies on osteology of Micropterus salmoides (Lacepede) and Lates calcarifer (Bloch). Acta Zool. Sin. 47, 110
115. Liang, S., Sun, X., Bai, J., et al., 2008. Genetic analysis for cultured largemouth bass (Micropterus salmoides) in China with microsatellites. Acta Hydrob. Sin. 32 (5), 80
86. Lou, Y., 1993. Fish breeding. China Agriculture Press, Beijing. Lou, Y., 2007. Close hybridization of fish and its application in aquaculture. J. Fish. China 31 (4), 532
538.

166

Genetic Breeding and Molecular Marker-Assisted Selective Breeding of Largemouth Bass

Lou, Y., Li, X., 2006. Distant hybridization of fish and its application in aquaculture in China. J. Fish. Sci. China 13 (1), 151
158. Lutz-Carrillo, D.J., Nice, C.C., Bonner, T.H., et al., 2006. Admixture analysis of Florida largemouth bass and northern largemouth bass using microsatellite loci. Trans. Am. Fish. Soc. 135, 779
791. Ma, A., Wang, X., Lei, J., et al., 2008. Statistic morphology difference among four turbot (Scophthalmus maximus) populations. Oceanol. Limnol. Sin. 39 (1), 24
29. Matondo, B.N., Ocidio, M., Poncin, P., et al., 2008. Morphological recognition of artificial F1 hybrids between three common European cyprinid species: Rutilus rutilus, Blicca bjoerkna and Abramis brama. Acta Zool. Sin. 54 (1), 144
156. Mi, G., Zhao, J., Jia, Y., et al., 2010. Morphological and microsatellite analysis of Siniperca chautsi Q 3 Siniperca scherzeri R hybrid with their parents. J. Shanghai Fish. Univ. 19 (2), 145
150. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583
590. Philipp, D.P., Whitt, G.S., 1991. Survival and growth of northern, Florida, and reciprocal Fl hybrid largemouth bass in central Illinois. Trans. Am. Fish. Soc. 120, 58
64. H C. 1975 Richard, H. (Ed.), 1975. Black Bass Biology and Management. Sport Fishing Institute, Washington, DC. Stauffer, J.R., Boltz, S.E., Boltz, J.M., 1988. Cold shock susceptibility of blue tilapia from the Susquehanna River, Pennsylvania. North Am. J. Fish. Manage. 8, 329
332. Sun, B., Huang, H., Cao, W., et al., 2010. Studies on the oxygen consumption rate and asphyxiant point of Megalobrama pellegrini and Coreius guichcnoti. Acta Hydrob. Sin. 34 (1), 88
93. Wang, G., 2000. The biological characteristics and breeding technology of Channa argus. Freshwater Fish. 30 (6), 10
11. Wang, G., Li, J., Ou, Y., et al., 2010. Oxygen consumption and ammonia excretion of the juvenile Trachinoms ovatus. Chin. J. Zool. 45 (3), 116
121. Wang, X., Wang, Z., Xie, Z., et al., 2008a. Genetic analysis of the intergenus hybridization of Pseudosciaena crocea (Q) 3 Miichthys miiuy (R). J. Fish. China 32 (1), 51
57. Wang, X., Ma, A., Chen, C., et al., 2008b. Morphological variation in two wild populations of sevenband grouper (Epinephelus septemfasciatus). Oceanol. Limnol. Sin. 39 (6), 655
660. Wang, Y., 2011. Mixed culture of Takifugu obscurus and Oxyeleotris marmoratus. Sci. Fish Farming (9), 33
34. Wang, B., Li, S., Cai, W., et al., 2011a. Determination on the cold tolerance of NEW GIFT Nile tilapia, GILI tilapia and blackchin tilapia. J. Shanghai Fish. Univ. 20 (4), 499
503. Wang, X., Yu, W., Li, J., et al., 2011b. Oxygen consumption and asphyxial point in Asiatic brook lamprey Lampetra reissneri. J. Dalian Fish. Univ. 26 (2), 119
125. Wheat, T.E., Childers, W.F., Whitt, G.S., 1974. Biochemical genetics of hybrid sunfish: differential survival of heterozygotes. Biochem. Genet. 11 (3), 205
219. Williamson, J.H., Carmichael, G.J., 1990. An aquacultural evaluation of Florida, northern, and hybrid largemouth bass, Micropterus salmoides. Aquaculture 85 (1-4), 247
257. Witkowski, A., Blachutad, J., 1980. Natural hybrids Alburnus alburnus (L.) 3 Leucuscus and Biebrza. Acta Hydrob. 22 (4), 473
487. Wu, N., Li, W., Li, Z., et al., 2010. Preliminary study on tolerance of elver of 5 Anguilla species to ultimate water temperature. South China Fish. Sci. 6 (6), 14
19. Xu, G., Gu, R., Wei, B., 2011. Studies on oxygen consumption rate and asphyxiant point of Paracanthobrama guichenoti. J. Hydroecol. 32 (4), 110
114.

Hybridization Between Subspecies of Largemouth Bass

167

Zhang, W., 2002. SPSS11 statistical analysis course: advanced level. Beijing Hope Electronic Press, Beijing, pp. 190
202. Zhang, Y., Chen, Q., Wu, W., et al., 2008. Integration of centromeric regions on the rice molecular linkage map of SSR markers. J. Huazhong Agric. Univ. 27 (2), 167
171. Zhang, Y., Bai, Q., Jia, Z., et al., 2009. Microsatellite analysis of Oncorhynchus mykiss, Oncorhynchus masou masou and their hybrid offspring (Oncorhynchus mykiss Q 3 Oncorhynchus masou masou R). J. Fish. China 33 (2), 188
195. Zolczynski, J.R.S.J., Davies, W.D., 1976. Growth characteristics of the northern and Florida subspecies of largemouth bass and their hybrid, and a comparison of catchability between the subspecies. Trans. Am. Fish. Soc. 105, 240
243.