- Email: [email protected]
MAPK signaling pathway
International Immunopharmacology xxx (xxxx) xxxx
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Hydrogen sulfide inhibits cigarette smoke-induced inflammation and injury in alveolar epithelial cells by suppressing PHD2/HIF-1α/MAPK signaling pathway Ruijuan Guana,1, Jian Wanga,1, Defu Lia,b,1, Ziying Lia, Hanwei Liua, Mingjing Dinga,c, Zhou Caia, ⁎ Xue Lianga,b, Qian Yanga, Zhen Longa, Lingzhu Chena, Wei Liua, Dejun Sunc, Hongwei Yaoa, , ⁎ Wenju Lua, a
State Key Laboratory of Respiratory Diseases, Guangdong Key Laboratory of Vascular Diseases, National Clinical Research Center for Respiratory Disease, Guangzhou Institute of Respiratory Health, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, China The Fifth Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, China c Departments of Respiratory and Critical Diseases, Inner Mongolia Autonomous Region People's Hospital, Hohhot, China b
ARTICLE INFO
ABSTRACT
Keywords: Hydrogen sulfide COPD Alveolar epithelial cell Prolyl hydroxylase Hypoxia inducible factor-1α MAPK signaling
Chronic obstructive pulmonary fibrosis (COPD) is a chronic and fatal lung disease with few treatment options. Sodium hydrosulfide (NaHS), a donor of hydrogen sulfide (H2S), was found to alleviate cigarette smoke (CS)induced emphysema in mice, however, the underlying mechanisms have not yet been clarified. In this study, we investigated its effects on COPD in a CS-induced mouse model in vivo and in cigarette smoke extract (CSE)stimulated alveolar epithelial A549 cells in vitro. The results showed that NaHS not only relieved emphysema, but also improved pulmonary function in CS-exposed mice. NaHS significantly increased the expressions of tight junction proteins (i.e., ZO-1, Occludin and claudin-1), and reduced apoptosis and secretion of pro-inflammatory cytokines (i.e., TNF-α, IL-6 and IL-1β) in CS-exposed mouse lungs and CSE-incubated A549 cells, indicating H2S inhibits CS-induced inflammation, injury and apoptosis in alveolar epithelial cells. NaHS also upregulated prolyl hydroxylase (PHD)2, and suppressed hypoxia-inducible factor (HIF)-1α expression in vivo and in vitro, suggesting H2S inhibits CS-induced activation of PHD2/HIF-1α axis. Moreover, NaHS inhibited CS-induced phosphorylation of ERK, JNK and p38 MAPK in vivo and in vitro, and treatment with their inhibitors reversed CSE-induced ZO-1 expression and inflammation in A549 cells. These results suggest that NaHS may prevent emphysema via the suppression of PHD2/HIF-1α/MAPK signaling pathway, and subsequently inhibition of inflammation, epithelial cell injury and apoptosis, and may be a novel strategy for the treatment of COPD.
1. Introduction Chronic obstructive pulmonary fibrosis (COPD) is one of the leading causes of death and morbidity around the world. It affects up to 50% of all long-term smokers and cigarette smoking is considered as the major agent that drives the development and progression of this disease. Cigarette smoke (CS) affects the entire respiratory epithelium and promotes emphysema through the destruction of alveolar walls [1]. Current therapies including corticosteroids and bronchodilators can improve symptoms, particularly the breathlessness and exercise tolerance, but their effects are limited, and no treatments have been
demonstrated to reduce disease progression [2]. To treat COPD in a more targeted and efficacious manner, new strategies are urgently required. Emphysema, a primary component of COPD, is characterized by the enlargement of airspaces and the loss of alveolar wall structures [3]. The inflammatory responses in COPD lung tissues is believed to be correlated with emphysema that worsen with disease progression [4]. Accumulating evidence also indicates that the epithelial cell injury is involved in the loss of alveolar wall cells in the patients with emphysema [5]. The alveolar epithelial cells, located in the interface between the external environment and lung parenchyma, can protect the sub-
Corresponding authors at: State Key Lab of Respiratory Diseases, Guangdong Key Laboratory of Vascular Diseases, National Clinical Research Center for Respiratory Disease, Guangzhou Institute of Respiratory Health, The First Affiliated Hospital, Guangzhou Medical University, Guangzhou, China (H. Yao; W. Lu). E-mail addresses: [email protected] (H. Yao), [email protected] (W. Lu). 1 These authors contributed equally to this work. ⁎
https://doi.org/10.1016/j.intimp.2019.105979 Received 14 June 2019; Received in revised form 28 September 2019; Accepted 13 October 2019 1567-5769/ © 2019 Published by Elsevier B.V.
Please cite this article as: Ruijuan Guan, et al., International Immunopharmacology, https://doi.org/10.1016/j.intimp.2019.105979
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
epithelial tissue from harmful stimuli [6]. In response to reiterative smoke exposure, decreases in several epithelial tight junction proteins and increases in epithelial cell apoptosis have been observed in the lung [7,8], further suggesting the potential role of alveolar epithelial cell injury and apoptosis in COPD development. Hydrogen sulfide (H2S), a gaseous molecule, has been proposed as a novel endogenous gasotransmitter identified after nitric oxide and carbon monoxide [9]. It has been demonstrated to play a critical role in a variety of physiological and pathological processes [10]. Studies have shown that H2S can exert anti-inflammatory [11], anti-oxidative stress [12], anti-cancer [13] and anti-diabetic [14] activities. Recent studies have reported that supplementation of H2S could protect against CSinduced emphysema in mice [12], and reduce nicotine-induced endoplasmic reticulum stress and apoptosis in 16HBE cells [15]. However, the mechanisms underlying the protection of H2S against emphysema are poorly understood. The present study was designed to investigate whether H2S protects against emphysema via its effects on inflammation responses, intercellular junctions and apoptosis of alveolar epithelial cells by suppressing PHD2/HIF-1α/MAPK signaling pathway.
Each CS exposure lasted about 2 h with interval time between two CS exposures more than 4 h. During CS exposure, the concentrations of particle matters and smoke gases in the chamber were monitored, which included total particle 741.4 ± 36.83 mg/m3, particulate matter with particle size below 10 µm 31.37 ± 3.23 mg/m3, O2 concentration > 20%, CO2 4000–5000 ppm, CO 500–800 ppm, NO 18–22 ppm and SO2 14–18 ppm. The control animals were exposed to room air for 12 weeks. The sterile saline or NaHS (40 mg/kg, 30 min per session, twice per day) was given daily by atomization inhalation 30 min before exposed to CS. This dosage was chosen based on our previous report showing that inhalation of NaHS in total dose of 80 mg/kg daily has beneficial effects on NO2-induced emphysema in rodents [16]. After all the mice were killed, lungs were harvested for following experiments.
2. Materials and methods
2.4. Lung pathological analysis
2.1. Chemicals and reagents
Left lungs were fixed in 10% buffered formalin for 48 h and embedded in paraffin. Then the lung tissues were cut into 3-μm-thick slices and stained with hematoxylin and eosin (H&E).
2.3. Lung function test Mice were anesthetized with 1% pentobarbital sodium (50 mg/kg i.p.) and the lung function test was then performed according to the descriptions by Liang et al. [17].
NaHS was purchased from Sigma-Aldrich (St Louis, MO, USA), and the cigarettes were purchased from Guangdong Tobacco Industry Co., Ltd. (Guangzhou, China). The TRIzol Reagent was purchased from ambion (Life Technologies, CA, USA). The PrimeScript RT reagent Kit with gDNA Eraser was obtained from Takara Bio Inc. (Takara, Shiga, Japan), and the SsoFast EvaGreen Supermix was obtained from Bio-Rad Laboratories, Inc. (CA, USA). The primary antibodies described in this study include: anti-Bcl-2, anti-Bax and anti-β-actin polyclonal antibodies were purchased from Proteintech (Chicago, IL, USA); anti-1β, anti-Claudin-1, anti-HIF-1α, anti-PHD2, anti-Cleaved caspase 3, anti-pJNK, anti-JNK, anti-p-ERK, anti-ERK, anti-p-P38 and anti-P38 antibodies were purchased from Cell Signaling Technology (CA, USA); antiZO-1 monoclonal antibody was purchased from Thermo Fisher Scientific (Boston, MA, USA); anti-Occludin antibodies and the HRPlabeled Goat Anti-Rabbit/Mouse IgG (H + L) were purchased from Abcam Biotechnology (Cambridge, MA, USA). ERK inhibitor (PD98059) were obtained from Selleck Chemicals (Houston, TX, USA). JNK inhibitor (SP600125) and P38 inhibitor (SB203580) were obtained from Absin (Shanghai, China). The poly-vinylidene fluoride (PVDF) membranes were purchased from Millipore Corporation (Billerica, MA, USA). ECL-Plus detection kit probed was purchased from Tanon Science & Technology Co., Ltd. (Shanghai, China). Other reagents were all purchased from GBCBIO Technologies Inc. (Guangzhou, China) unless otherwise indicated.
2.5. Enzyme-linked immunosorbent assay (ELISA) Lung tissues were prepared for ELISA. The concentration of tumor necrosis factor (TNF)-α, interleukin (IL)-6 and IL-1β was detected by ELISA following the manufacturer’s protocol (eBioscience Affymetrix, San Diego, CA, USA). 2.6. Immunohistochemistry Immunohistochemistry analysis was performed using a method described previously [18]. 2.7. Cell culture Human alveolar epithelial A549 cells were obtained from Cell Bank of the Chinese Academy of Sciences (Shanghai, China), and cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS), 100 KU/L penicillin and 100 mg/L streptomycin in a humidified incubator at 37 °C with 5% CO2 atmosphere. 2.8. Preparation of cigarette smoke extract (CSE) CSE was prepared by bubbling smoke from two cigarettes into 10 ml DMEM according to the method described by Li et al. [19].
2.2. Animals and treatments Adult male C57BL/6J mice, weighting 18–20 g, were obtained from Nanjing BioMedical Research Institute of Nanjing University (Nanjing, China), and housed in a room at controlled temperature of 25 °C with 12/12 light/dark cycle, where they were allowed free access to food and water all the times. The animal experimental protocols were approved by the Ethics Committee of the First Affiliated Hospital of Guangzhou Medical University. Mice were randomly allocated to one of the following three groups: (1) room air exposure plus atomization inhalation of sterile saline (control group); (2) CS exposure plus atomization inhalation of sterile saline (CS group); and (3) CS exposure plus atomization inhalation of NaHS (CS + NaHS group). For the CSinduced COPD mouse model, mice were placed in a 60 cm × 57 cm × 100 cm fume box and exposed to smoking generated from 9 filter-tipped cigarettes (Red Roses Label; tar: 13 mg/cigarette; nicotine: 1.3 mg/cigarette) twice a day, 6 days per week for 12 weeks.
2.9. Immunofluorescence staining The procedures for immunofluorescence staining were modified according to our previous report [20]. In brief, A549 cells were seeded on glass slides and treated as indicated for 48 h. The cells were incubated with a rabbit monoclonal antiserum against ZO-1 (1:100 dilution) for 48 h at 4 °C. The slides were subsequently incubated concurrently with a goat anti-rabbit IgG conjugated with Cy3, and fluorescence was detected by a Zeiss LSM 800 confocal laser system. 2.10. Quantitative real-time PCR (RT-PCR) Total RNA was extracted from lung tissues or A549 cells using TRIzol Reagent and reverse-transcribed into first-strand cDNA using the PrimeScript RT reagent Kit with gDNA Eraser. The mRNA levels of 2
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Table 1 Primers sets used for quantitative real-time PCR. Gene
Sense Primer(5′-3′)
Antisense Primer(5′-3′)
Mouse CRL Mouse CBS Mouse PMST Mouse TNF-α Mouse IL-6 Mouse IL-1β Mouse actin Human TNF-α Human IL-6 Human IL-1β 18S
GCTTGGAAAAAGCAGTGGCT AGCTGGAACCTGCTCCTTTT TGGTATCTGCTACCCAACGC CCCTCCTGGCCAACGGCATG CTGCAAGAGACTTCCATCCAG GCCTCGTGCTGTCGGACCCATAT CGTGCGTGACATCAAAGAGAAG CGGACACCATGGACAAGTTT GTGAGGAACAAGCCAGAGC ATGATGGCTTATTACAGTGGCAA GCAATTATTCCCCATGAACG
TCGTAATGGTGGCAGCAAGA GTTGGCTCTTGAGTCCCCTC CAGAGCTCGGAAAAGTTGCG TCGGGGCAGCCTTGTCCCTT AGTGGTATAGACAGGTCTGTTGG TCCTTTGAGGCCCAAGGCCACA CCAAGAAGGAAGGCTGGAAAA GAAAGCCTTGCAGAGGTCAG TACATTTGCCGAAGAGCC GTCGGAGATTCGTAGCTGGA GGCCTCACTAAACCATCCAA
Fig. 1. NaHS reduced cigarette smoke (CS)-induced emphysema and pulmonary function decline in mice. (A) 12 weeks after CS inhalation, lung pathology was examined by H&E staining, and representative images of lung sections of mice from control group, CS group and CS+ NaHS group were shown respectively. (B) Mean linear intercept (MLI), representing the degree of emphysema was quantified by Image Pro Plus 6.0 software (6 mice per group). (C) Lung function parameter FEV50/ FVC among different groups was calculated (6 mice per group). Data are expressed as the mean ± SEM, **P < 0.01 compared with Control; #P < 0.05, ## P < 0.01 compared with CS only.
cystathionine β-synthase (CBS), cystathionine γ-lyase (CRL), 3-mercaptypyruvate sulfurtransferase (MPST), TNF-α, IL-6, and IL-1β were analyzed with an iCyler iQ Real-time PCR Detection System (Bio-Rad Laboratories Inc., USA) using SsoFast EvaGreen Supermix (Bio-Rad Laboratories, Inc., CA, USA) in a total volume of 15 μl. Relative levels of mRNA expression were normalized to β-actin or 18S expression for each gene. The primers used for gene expression studies are list in Table 1.
antibody (1:1000 dilution), rabbit anti-ZO-1 antibody (1:1000 dilution), rabbit anti-claudin-1 antibody (1:1000 dilution), rabbit anti-Occludin antibody (1:1000 dilution), rabbit anti-PHD2 antibody (1:1000 dilution), rabbit anti-HIF-1α antibody (1:1000 dilution), rabbit anti-Cleaved caspase 3 antibody (1:1000 dilution), rabbit anti-p-ERK antibody (1:2000 dilution), rabbit anti-ERK antibody (1:2000 dilution), rabbit anti-p-JNK antibody (1:1000 dilution), rabbit anti-JNK antibody (1:1000 dilution), rabbit anti-p-P38 antibody (1:1000 dilution), rabbit anti-P38 polyclonal antibody (1:1000 dilution), and mouse anti-β-actin polyclonal antibody (1:3000 dilution). HRP-labeled goat anti-rabbit (1:3000 dilution) and anti-mouse (1:3000 dilution) antibodies were used as the secondary antibodies. The membranes were probed using an ECL-Plus detection kit and then scanned with Tanon-5200 (Tanon Science & Technology Co., Ltd., Shanghai, China). The intensity analysis was analyzed by a densitometry system named Image J.
2.11. Western blot Lung samples and A549 cells were homogenized in RIPA lysis buffer (GBCBIO Technologies Inc., Guangzhou, China) with protease inhibitor (Roche), and total protein concentration was measured by bicinchoninic acid (BCA). Total protein (30–50 µg) was loaded into each lane onto 10% SDS-polyacrylamide gels. Electrophoresis was performed before the proteins were transferred to the PVDF membranes, which were blocked with 5% non-fat milk, washed in Tris-buffered saline containing 0.1% Tween-20 (TBST), and incubated with primary antibody overnight at 4 °C. The primary antibodies used were as follows: Rabbit anti-IL-1β
2.12. Data analysis Data are presented as mean ± standard error of the mean (SEM), statistical significance was performed using One-way analysis of 3
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
variance (ANOVA). The differences between two groups were compared using Student’s t test. A two-sided P value less than 0.05 (P < 0.05) were considered to be significant.
these tight junction proteins was significantly restored by NaHS treatment, implying that H2S can mitigate CS-induced epithelial cell injury by altering epithelial cell-cell junction (Fig. 4A, B). CS-induced injury might activate mitochondrial intrinsic pathway of apoptosis, which was demonstrated by immunohistochemistry in COPD lungs [5]. Our results also showed that treatment with NaHS significantly suppressed CS-induced cell apoptosis in CS-exposed mice, as indicated by reduced expression of pro-apoptotic proteins including Bax and Cleaved caspase 3, and increased anti-apoptotic protein Bcl-2 (Fig. 4C, D). These data indicate that NaHS protects epithelial cells from injury and apoptosis in CS-exposed mice, subsequently leading to attenuation of emphysema.
3. Results 3.1. NaHS prevented emphysema and pulmonary function decline in CSexposed mice. The effects of NaHS on CS-induced COPD were analyzed. As shown in Fig. 1A, B, the mean linear intercept (MLI) in the lungs of mice exposed to CS for 12 weeks are much larger than those exposed to normal room air. NaHS markedly decreased the increase of MLI in the lungs, indicating that NaHS significantly inhibited CS-induced emphysema. Further, we examined the changes in pulmonary function after NaHS treatment. Interestingly, the pulmonary function of NaHS-treated mice was also significantly improved, as demonstrated by increased FEV50/ FVC, when compared with CS-treated mice (Fig. 1C). Moreover, mice exposed to CS showed decreased expression of cystathionine β-synthase (CBS), cystathionine γ-lyase (CRL) and 3-mercaptypyruvate sulfurtransferase (MPST) (Fig. 2), critical enzymes in the generation of H2S, which was dramatically restored by NaHS treatment, indicating NaHS significantly attenuates CS-induced emphysema, which is associated with restoration of enzymes generating H2S in mouse lungs.
3.4. NaHS decreased CSE-induced upregulation of TNF-α, IL-6 and IL-1β in alveolar epithelial A549 cells. We further analyzed the effects of NaHS on CSE-induced inflammation response in human alveolar epithelial A549 cells. Therefore, the levels of pro-inflammatory cytokines, including TNF-α, IL-6 and IL-1β, were examined using RT-PCR. The data showed that the mRNA levels of TNF-α, IL-6 and IL-1β were significantly elevated in the CSE-treated A549 cells and this elevation was significantly inhibited by NaHS treatment (Fig. 5). 3.5. NaHS inhibited CSE-induced cell injury and apoptosis in human alveolar epithelial A549 cells.
3.2. NaHS reduced CS-induced upregulation of inflammatory cytokines in the mouse lungs.
We also assessed whether NaHS inhibits CSE-induced alveolar epithelial cell injury and apoptosis in A549 cells. Similar to our in vivo observations, the results showed that CSE significantly downregulated the expression of tight junction proteins including ZO-1 and Claudin-1, when compared with control cells. Nevertheless, NaHS treatment enhanced the expression of ZO-1 and Claudin-1, when compared with CSE alone treated cells (Fig. 6). Our results also showed that treatment with NaHS significantly suppressed CSE-induced epithelial cell apoptosis in A549 cells, as demonstrated by reduced Cleaved caspase 3 protein levels (Fig. 6A, B).
We explored the detailed anti-emphysematous mechanisms of NaHS. Inflammation is known to participate in the pathogenesis of emphysema [21], and inflammatory cytokines such as TNF-α, IL-6 and IL-1β have been reported to play critical roles in the pathogenesis of COPD. We therefore determined the TNF-α, IL-6 and IL-1β content in the lungs from CS-exposed mice. As shown in Fig. 3A-F, 12 weeks after CS inhalation, the mRNA and protein levels of TNF-α, IL-6 and IL-1β in the lungs were significantly elevated when compared with the Control group, as demonstrated by RT-PCR and ELISA assays. Whereas treatment with NaHS inhibited the CS-induced upregulation of pulmonary TNF-α, IL-6 and IL-1β. Likewise, Western blot analysis of lungs also showed that the protein level of IL-1β was significantly decreased by NaHS treatment (Fig. 3G). Moreover, our immunohistochemistry studies demonstrated that the IL-6- and IL-1β-positive cells were also decreased by NaHS treatment (Fig. 3H). These data provide evidence that the protective role of NaHS may involve the inhibition of inflammation.
3.6. NaHS inhibited CS-induced activation of PHD2/HIF-1α signaling in mouse lungs and in alveolar epithelial A549 cells Given the established role of NaHS in alleviating inflammation and alveolar epithelial cells injury, we next explored the underlying mechanisms. Western blot showed that the protein levels of hypoxia-inducible factor (HIF)-1α were dramatically increased, suggesting the activation of HIF-1α signaling in COPD. Whereas treatment with NaHS significantly decreased the CS-induced upregulation of HIF-1α protein (Fig. 7A, B). Coincidentally, the enhancement of HIF-1α expression induced by CSE in alveolar epithelial A549 cells was also markedly suppressed by NaHS treatment in a dose-dependent manner (Fig. 7C, D). Meanwhile, treatment with NaHS also increased the protein level of
3.3. NaHS protected alveolar epithelial cells from injury and apoptosis in CS-exposed mouse lungs. Western blot analysis showed that mice repetitive exposed to CS had a reduction in ZO-1, Occludin and Claudin-1 levels. This reduction in
Fig. 2. Effects of NaHS on CRL, CBS and MPST levels in the CS-induced COPD mouse lungs. 12 weeks after CS inhalation, mouse lung tissues were homogenized, and the mRNA levels of CRL (A), CBS (B) and MPST (C) in the lung tissues were analyzed by Quantitative real-time PCR (RT-PCR) (6 mice per group). Data are expressed as the mean ± SEM, **P < 0.01 compared with Control; ##P < 0.01 compared with CS only. 4
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 3. Effects of NaHS on CS-induced pulmonary inflammatory cytokines. 12 weeks after CS inhalation, lung tissues were collected. (A–C) The mRNA levels of TNFα, IL-6 and IL-1β in the lung tissues were analyzed by Quantitative real-time PCR (RT-PCR) (6 mice per group). (D–F) The protein levels of TNF-α, IL-6 and IL-1β in the lung tissues were analyzed by ELISA (6 mice per group). (G) The relative IL-1β protein level in the lung tissues was analyzed by Western blot (6 mice per group). (H) Immunohistochemical staining of IL-6- and IL-1β-positive cells in the lungs (6 mice per group). Data are presented as the mean ± SEM, **P < 0.01 compared with Control; ##P < 0.01 compared with CS only.
3.8. Inhibition of ERK, JNK and p38 MAPK pathways reversed the CSEinduced inflammation and cell injury in A549 cells
prolyl hydroxylase (PHD)2, an oxygen sensor that regulates the stability of HIF-1α, in vivo (Fig. 7A, B) and in vitro (Fig. 7C, D). The results demonstrated that the protective effect of NaHS in CS-induced COPD was, at least in part, via the regulation of the PHD2/HIF-1α signaling pathway.
We first investigated the effects of ERK, JNK or p38 MAPK inhibitor on CSE-induced pro-inflammatory signaling. To test this hypothesis, we screened ERK inhibitor PD98059, JNK inhibitor SP600125 or P38 inhibitor SB203580 in CSE-stimulated epithelial A549 cells. We found that PD98059, SP600125 or SB203580 significantly suppressed the CSE-induced upregulation of TNF-α, IL-6 and IL-1β levels in A549 cells (Fig. 9A–C). We also investigated the effects of ERK, JNK or p38 MAPK inhibitor on CSE-mediated epithelial cell injury in vitro. We found that PD98059, SP600125 or SB203580 attenuated CSE-induced reduction in ZO-1 levels (Fig. 9D, E). These results suggest that cigarette smoke exposure induced inflammation and alveolar epithelial cell injury are partially mediated by ERK/JNK/p38 MAPK activation.
3.7. NaHS inhibited CS-induced ERK/JNK/p38 MAPK activation in mouse lungs and in alveolar epithelial A549 cells The activation of ERK/JNK/p38 MARK has been well-defined in COPD. We therefore investigated whether NaHS affected the activation of ERK, JNK and P38. Western blot analysis showed that CS exposure increased phosphorylated ERK, JNK and P38 levels in the mouse lungs. While treatment with NaHS markedly repressed the CS-induced phosphorylation of ERK, JNK and p38 MAPK, as compared to control group (Fig. 8A, B). This finding was also validated in CSE-stimulated A549 cells (Fig. 8C–J), revealing that NaHS effectively antagonized CS-induced activation of ERK/JNK/p38 MAPK signaling.
4. Discussion COPD, one of the most fatal events globally, may result in respiratory failure with disease development and progression [22]. 5
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 4. Effects of NaHS on the epithelial cell injury and apoptosis in the mice with pulmonary emphysema. 12 weeks after CS inhalation, lung tissues were collected. (A) Western blot was used to analyze the protein levels of ZO-1, Occludin, and Claudin-1 in the lung tissues. (B) Densitometric analysis of ZO-1, Occludin, and Claudin-1 in the immunoblots using β-actin as the internal reference (6 mice per group). (C) Western blot was used to analyze the protein levels of Bax, Bcl-2, and Cl. Caspase 3 in the lung tissues. (D) Densitometric analysis of Bax, Bcl-2, and Cleaved caspase 3 in the immunoblots using β-actin as the internal reference (6 mice per group). Data are presented as the mean ± SEM, **P < 0.01 compared with Control; ##P < 0.01 compared with CS only.
Currently, there are no clinically effective medications for COPD. In the respiratory tract, H2S has been reported to play a protective role in COPD [12,15,23]. In the current study, we showed that in addition to inhibition of emphysematous airspace enlargement, H2S donor NaHS significantly inhibited CS-induced lung function decline in mice. Our results showed three possible mechanisms whereby H2S exerts its antiemphysematous effect: (1) NaHS inhibited CS-induced upregulation of inflammatory cytokines; (2) NaHS reduced CS-induced epithelial cell injury and apoptosis; (3) NaHS suppressed epithelial cell injury by increasing epithelial cell-cell adhesion. We also identified that the protect effect of H2S was linked to the suppression of PHD2/HIF-1α/MAPK signaling pathway. COPD encompasses a battery of clinical syndromes, most noticeably pulmonary emphysema and chronic inflammation [5]. Emphysema, a principal component of COPD, is defined by permanent destructive enlargement of airspaces distal to the terminal bronchioles, contributing to chronic airflow obstruction [21]. The airflow limitation is usually progressive and not fully reversible, which eventually leads to respiratory failure [8]. Thus, lung transplantation is the only effective option for end-stage COPD. However, H2S, a novel endogenous gasotransmitter, has been reported to reduce emphysema [12], yet its underlying mechanism remains largely elusive. In order to better determine the mechanisms of H2S operating in emphysema, establishment
of animal models of COPD is critically essential. Environmental exposure, mainly cigarette smoking, is the primary factor of COPD development [24]. The animal model used in this study was also the CSinduced mouse model, a well-established model of COPD [3]. Our results showed that chronic CS exposure induced significant COPD, as indicated by the decreased lung function and increased emphysema. These results suggested that we had successfully built a COPD mouse model. Consistent with the previous report [12], we observed a remarkable improvement of emphysema in the CS-exposed mice after NaHS treatment. NaHS was well tolerated by the mice as illuminated by no perceptible toxicity. Pulmonary function parameter FEV1/FVC is clinically predicted to classify the severity of this disease [8]. In the current study, we found that the CS-induced reduction in FEV50/FVC was significantly upregulated by NaHS, indicating H2S also improves the lung function in COPD mouse model. Moreover, H2S is generated endogenously in mammalian cells from L-cysteine by CRL and CBS and MPST [25]. We found that all of them exist in the mouse lung tissue. CS exposure decreased the mRNA levels of CRL, CBS and MPST in the lungs, suggesting endogenous H2S plays a critical role in maintaining the normal physiological function. Whereas treatment with NaHS significantly prevents the CS-induced reduction in the mRNA levels of CRL, CBS and MPST, indicating NaHS elevated the capacity for H2S synthesis.
Fig. 5. Effects of NaHS on the CSE-induced production of inflammatory cytokines in alveolar epithelial A549 cells. A549 cells were cultured with and without 3% CSE and/or 100, 200, or 400 μM NaHS for 48 h. The mRNA levels of TNF-α (A), IL-6 (B), and IL-1β (C) in the A549 cells were analyzed by Quantitative real-time PCR (RTPCR). Data are presented as the mean ± SEM, **P < 0.01 compared with control [3% CSE (-) and NaHS (-)]; #P < 0.05, ##P < 0.01 compared with 3% CSE only. 6
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 6. Effects of NaHS on the CSE-induced cell injury and apoptosis in alveolar epithelial A549 cells. A549 cells were cultured with and without 3% CSE and/or 100, 200, or 400 μM NaHS for 48 h. (A, B) The cell samples were collected to determine the protein levels of ZO-1, Claudin-1 and Cl. Caspase 3 by Western blot. (C) Immunofluorescence staining for ZO-1 was performed on alveolar epithelial A549 cells treated with and without 3% CSE and/or 400 μM NaHS for 48 h. Data are presented as the mean ± SEM, **P < 0.01 compared with control [3% CSE (-) and NaHS (-)]; #P < 0.05, ##P < 0.01 compared with 3% CSE only.
Inflammation, especially exaggerated type 1 inflammation, plays a critical role in the pathology of emphysema [26]. Studies showed that inflammation with infiltrating macrophages, neutrophils and lymphocytes, is widely seen throughout the lungs from patients with COPD, and their numbers increase with increasing severity [1]. Progressing inflammation damages the alveolar attachment [27], and is identified
to be causally correlated with emphysema development and pathologic alterations in the lungs that worsen with disease progression [5]. It has been shown that CS directly or indirectly induces chronic inflammation by releasing inflammatory cytokines such as TNF-α, IL-6 and IL-1β, which has been demonstrated to be significantly increased in COPD animals and patients in numerous studies including ours [17,28,29].
Fig. 7. Effects of NaHS on PHD2 and HIF-1α expressions in vivo and in vitro. (A, B) 12 weeks after CS inhalation, lung tissues were collected. Western blot was used to analyze the protein levels of PHD2 and HIF-1α in the lung tissues. Data are presented as the mean ± SEM, **P < 0.01 compared with Control; ##P < 0.01 compared with CS only. (C, D) A549 cells were cultured with and without 3% CSE and/or 100, 200, or 400 μM NaHS for 48 h. The cell samples were collected to determine the protein levels of PHD2 and HIF-1α by Western blot. Data are presented as the mean ± SEM, *P < 0.05, **P < 0.01 compared with control [3% CSE (-) and NaHS (-)]; #P < 0.05, ##P < 0.01 compared with 3% CSE only. 7
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 8. Effects of NaHS on the CS-activated MAPK signaling in vivo and in vitro. (A) 12 weeks after CS inhalation, lung tissues were collected. Western blot was used to analyze the protein levels of p-ERK, p-JNK, and p-P38 in the lung tissues. Results are representative of different experiments. (B) Scanning densitometry of western blot on different lung samples was analyzed quantitatively. Expression of p-ERK, p-JNK and p-P38 was normalized to ERK, JNK, and P38 levels, respectively. Data are presented as the mean ± SEM, **P < 0.01 compared with Control; #P < 0.05, ##P < 0.01 compared with CS only. (C) Western blot analysis for p-ERK, p-JNK, and p-P38 expression in A549 cells treated with NaHS or vehicle in response to 3% CSE treatment for 0, 5 min, 15 min, 30 min, 60 min, and 120 min. (D–F) Quantified protein levels of the above genes are shown. Data are presented as the mean ± SEM, *P < 0.05. (G) A549 cells were cultured with and without 3% CSE and/or 100, 200, or 400 μM NaHS for 48 h. Western blot was used to analyze the phosphorylation levels of ERK, JNK and p38 MAPK. Results are representative of different experiments. (H-J) Scanning densitometry of western blot on different samples was analyzed quantitatively. Expression of p-ERK, p-JNK and p-P38 was normalized to ERK, JNK, and P38 levels, respectively. Data are presented as the mean ± SEM, **P < 0.01 compared with control [3% CSE (-) and NaHS (-)]; #P < 0.05 compared with 3% CSE only.
Their levels are directly proportional to the post-bronchodilator FEV1 percentage [29]. On the other hand, these inflammatory cytokines released from epithelial cells by CS, in turn, recruit inflammatory cells into the lung and thus further amplifies chronic inflammation.
Therefore, these cytokines were chosen to evaluate the anti-emphysema action of H2S. Consistent with these findings, our result showed that the levels of TNF-α, IL-6 and IL-1β were not only significantly increased in the lungs of CS-exposed mice, but also in the CSE-stimulated alveolar 8
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 9. Effects of MAPK inhibitors on ZO-1 expression and inflammation responses in CSE-stimulated A549 cells. A549 cells were cultured with ERK inhibitor (PD98059), JNK inhibitor (SP600125), or P38 inhibitor (SB203580) in the absence and presence of 3% CSE for 48 h. The mRNA levels of TNF-α (A), IL-6 (B), and IL1β (C) in the A549 cells were analyzed by RT-PCR. (D, E) The protein level of ZO-1 was detected using Western blot. Data are presented as the mean ± SEM, ** P < 0.01 compared with control [3% CSE (-), PD98059 (-), SP600125 (-) and SB203580 (-)]; #P < 0.05 compared with 3% CSE only.
epithelial A549 cells. Nevertheless, administration of NaHS to CS-exposed mice or CES-stimulated A549 cells reduced all the productions. These data showed that H2S may exert its anti-inflammatory effect via the inhibition of production of TNF-α, IL-6 and IL-1β. The lung is unique in that alveolar epithelial cells are continually exposed to external environment, and acts as a barrier that protects subepithelial tissues from noxious substance [6]. Tight junctions, or zonula occludens, join neighboring cells together to form this barrier. They function in the maintenance of cell polarity and blocking the movement of transmembrane proteins between the apical and the basolateral cell surfaces. Tight junctions consist of claudin and occludin proteins that join the junctions to the cytoskeleton [30]. Zonula occluden protein ZO1 is required for tight junction formation and function, which links junctional transmembrane proteins such as occludin and claudin to the actin cytoskeleton [31]. The tight junctions and zonula occludens are intracellular junctional structures that mediate adhesion between epithelial cells and are required for epithelial cell function [32]. While in response to chronic smoke exposure, the epithelial cell was badly injured as indicated by decreases in several tight junction and zonula occluden proteins [6,33]. Consistent with these findings, our results showed that the expressions of claudin-1, occludin-1 and ZO-1 are all significantly decreased in the lungs of CS-exposed mice, and treatment with NaHS inhibited the reduced expressions of claudin-1, occludin-1 and ZO-1, implying the protective role of H2S in epithelial injury. This finding was also validated in CSE-stimulated alveolar epithelial A549 cells, which is similar to a previous study that H2S protects the colon from the epithelial damage [34]. The above findings established that H2S ameliorates CS-induced COPD by modulating epithelial cell function. Studies showed that the CS-induced injury might activate mitochondrial intrinsic pathway of apoptosis in COPD lungs [35]. The apoptosis response due to ongoing cellular injury is a critical element in the COPD pathogenesis [36]. Some evidences suggested that alveolar epithelial apoptosis was increased in emphysematous lung tissue, in association with an increase in Bax and activated subunits of caspase 3, and a decrease in the anti-apoptotic protein Bcl-2 [3]. In this study, we
demonstrated that treatment with NaHS significantly inhibited cell apoptosis in CSE-primed alveolar A549 cells, which is in agreement with previous observation on the activity of NaHS in pulmonary artery endothelial cells [12]. Consistently, this finding was also verified in CSinduced COPD mice, as examined by reduced Bax and Cleaved Caspase 3 levels and increased Bcl-2 expression in NaHS-treated mouse lungs. These data indicate that loss of epithelial cell maintenance factors contribute to the specific pathogenesis of emphysema, and H2S exerts its anti-emphysematous activity, partially, by inhibiting alveolar epithelial cell apoptosis. The mechanism by which NaHS represses inflammation and alveolar epithelial cell injury remains obscure. HIF-1α, a critical oxygen sensor that belongs to the basic helix-loop-helix transcription factors, is highly increased in the lungs of COPD and correlates with inflammation and structural changes of the alveolar and bronchial epithelium in the development of COPD [37,38]. For instance, HIF-1α deficient in myeloid cells caused nearly complete suppression of inflammatory response [39]; HIF-1α knock-down also exacerbates the CSE-induced phenotypic shift in lung epithelial cells [38]. Hence, we hypothesized that NaHS can exert its anti-emphysematous effects via inactivation of HIF-1α in our COPD mouse model. As expected, the results showed that the CSinduced upregulation of HIF-1α in the lungs was significantly inhibited by NaHS. This finding was also validated in CSE-primed A549 cells, which is similar to a previous study that GYY4137, another H2S donor, suppressed HIF-1α expression in HepG2 and Bel7402 cells [40]. PHD2, acting as an oxygen sensor, can regulate the stability or degradation of HIF-1α in an oxygen-dependent manner [41]. In normoxia, PHD2 hydroxylates the proline residues of HIF-1α, facilitating hydrogen bonding with the Von Hippel Lindau protein (pVHL) which promotes HIF-1α degradation by the 26S proteasome. Under hypoxia conditions, PHD2 fails to initiate this reaction due to a shortage of O2 and, therefore, HIF1α is stabilized [41,42]. This explains why HIF-1α is increased in COPD, a condition of pathological hypoxia due to airflow limitation and alveolar destruction. We also examined the alteration of PHD2 levels, and found that the CS-induced downregulation of PHD2 in vivo and the CSE-induced downregulation of PHD2 in vitro were both increased by 9
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
NaHS treatment. Additionally, HIF-1α plays an important role in a variety of pathophysiologies, including angiogenesis, apoptosis, epithelial-mesenchymal transition, leading to vascular remodeling, fibrosis, and pulmonary hypertension [43], all of which are comorbidities of COPD [44–46]. Therefore, reduced activation of HIF-1α may be beneficial for protection of NaHS against the development of COPD and its associated comorbidities. HIF-1α protein synthesis can be mediated by a variety of inflammation mediators, through interaction with their cognate receptor tyrosine kinase, resulting in activation of mitogen-activated protein kinases (MAPKs) pathways [42]. It has been reported that exposure to CS caused the activation of MAPKs pathways, including c-Jun, Jun D, ERK and p38 in the primary human lung epithelial cells [47], and MAPK signaling play critical roles in regulating COPD-associated phenotypes, including inflammation and emphysema [48]. We, therefore, focused our further studies on MAPK signaling. Our present study showed that the phosphorylation of ERK, JNK and p38 MAPK was significantly increased in CSE-primed A549 cells, revealing that MAPK signaling were activated in alveolar epithelial cells. However, the increase of phosphorylated ERK, JNK and p38 MAPK was significantly suppressed by NaHS. Coincidentally, this finding was also verified in CS-induced COPD in mice, as measured by decreased levels of phosphorylated ERK, JNK and p38 MAPK in NaHS-treated lungs. Furthermore, treatment with PD98059 (ERK inhibitor), SP 600125 (JNK inhibitor) or SB 203580 (p38 MAPK) inhibitor respectively inhibited CSEinduced upregulation of pro-inflammatory cytokines and downregulation of ZO-1. Taken all together, these results suggested that suppression of MAPK signaling contributed to the suppression effect of NaHS on CS-induced inflammation and alveolar epithelial cell injury. In conclusion, we demonstrated that H2S inhibited CS-induced activation of PHD2/HIF-1α/MAPK signaling and subsequently inhibited inflammation, epithelial cell injury and apoptosis, thereby attenuating CS-induced emphysema and improving pulmonary function in mice.
Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.intimp.2019.105979. References [1] P.J. Barnes, Alveolar macrophages in chronic obstructive pulmonary disease (COPD), Cell Mol. Biol. (Noisy-le-grand) 50 Online Pub (2004) L627-37. [2] W. MacNee, Accelerated lung aging: a novel pathogenic mechanism of chronic obstructive pulmonary disease (COPD), Biochem. Soc. Trans. 37 (Pt 4) (2009) 819–823, https://doi.org/10.1042/BST0370819. [3] K.F. Chung, I.M. Adcock, Multifaceted mechanisms in COPD: inflammation, immunity, and tissue repair and destruction, Eur. Respir. J. 31 (6) (2008) 1334–1356, https://doi.org/10.1183/09031936.00018908. [4] D.P. Singh, G. Kaur, P. Bagam, R. Pinkston, S. Batra, Membrane microdomains regulate NLRP10- and NLRP12-dependent signalling in A549 cells challenged with cigarette smoke extract, Arch. Toxicol. 92 (5) (2018) 1767–1783, https://doi.org/ 10.1007/s00204-018-2185-0. [5] M.J. Kang, G.S. Shadel, A mitochondrial perspective of chronic obstructive pulmonary disease pathogenesis, Tuberc. Respir. Dis. (Seoul) 79 (4) (2016) 207–213, https://doi.org/10.4046/trd.2016.79.4.207. [6] K. Nishida, K.A. Brune, N. Putcha, P. Mandke, W.K. O'Neal, D. Shade, et al., Cigarette smoke disrupts monolayer integrity by altering epithelial cell-cell adhesion and cortical tension, Am. J. Physiol. Lung Cell Mol. Physiol. 313 (3) (2017) L581–L591, https://doi.org/10.1152/ajplung.00074.2017. [7] A.J. Thorley, T.D. Tetley, Pulmonary epithelium, cigarette smoke, and chronic obstructive pulmonary disease, Int. J. Chron. Obstruct. Pulmon Dis. 2 (4) (2007) 409–428. [8] J.C. Hogg, W. Timens, The pathology of chronic obstructive pulmonary disease, Annu. Rev. Pathol. 4 (2009) 435–459, https://doi.org/10.1146/annurev.pathol.4. 110807.092145. [9] X. Zhou, G. An, J. Chen, Hydrogen sulfide improves left ventricular function in smoking rats via regulation of apoptosis and autophagy, Apoptosis 19 (6) (2014) 998–1005, https://doi.org/10.1007/s10495-014-0978-z. [10] L. Miao, X. Shen, M. Whiteman, H. Xin, Y. Shen, X. Xin, et al., Hydrogen sulfide mitigates myocardial infarction via promotion of mitochondrial biogenesis-dependent M2 polarization of macrophages, Antioxid Redox Signal 25 (5) (2016) 268–281, https://doi.org/10.1089/ars.2015.6577. [11] Y. Sun, K. Wang, M.X. Li, W. He, J.R. Chang, C.C. Liao, et al., Metabolic changes of H2S in smokers and patients of COPD which might involve in inflammation, oxidative stress and steroid sensitivity, Sci. Rep. 5 (2015) 14971, https://doi.org/10. 1038/srep14971. [12] W. Han, Z. Dong, C. Dimitropoulou, Y. Su, Hydrogen sulfide ameliorates tobacco smoke-induced oxidative stress and emphysema in mice, Antioxid Redox Signal. 15 (8) (2011) 2121–2134, https://doi.org/10.1089/ars.2010.3821. [13] S.S. Wang, Y.H. Chen, N. Chen, L.J. Wang, D.X. Chen, H.L. Weng, et al., Hydrogen sulfide promotes autophagy of hepatocellular carcinoma cells through the PI3K/ Akt/mTOR signaling pathway, e2688, Cell Death Dis. 8 (3) (2017), https://doi.org/ 10.1038/cddis.2017.18. [14] R. Xue, D.D. Hao, J.P. Sun, W.W. Li, M.M. Zhao, X.H. Li, et al., Hydrogen sulfide treatment promotes glucose uptake by increasing insulin receptor sensitivity and ameliorates kidney lesions in type 2 diabetes, Antioxid Redox Signal. 19 (1) (2013) 5–23, https://doi.org/10.1089/ars.2012.5024. [15] F. Lin, C. Liao, Y. Sun, J. Zhang, W. Lu, Y. Bai, et al., Hydrogen sulfide inhibits cigarette smoke-induced endoplasmic reticulum stress and apoptosis in bronchial epithelial cells, Front. Pharmacol. 8 (2017) 675, https://doi.org/10.3389/fphar. 2017.00675. [16] Z. Zhang, J. Wang, G. Xu, M. Ding, F. Liu, L. Yuan, et al., Inhalation of sodium hydrosulfide (NaHS) alleviates NO2-induced pulmonary function and hematological impairment in rats, 116650, Life Sci. 1 (2019), https://doi.org/10.1016/j.lfs. 2019.116650. [17] X. Liang, J. Wang, R. Guan, L. Zhao, D. Li, Z. Long, et al., Limax extract ameliorates cigarette smoke-induced chronic obstructive pulmonary disease in mice, Int, Immunopharmacol. 54 (2018) 210–220, https://doi.org/10.1016/j.intimp.2017. 11.004. [18] R. Guan, X. Wang, X. Zhao, N. Song, J. Zhu, J. Wang, et al., Emodin ameliorates bleomycin-induced pulmonary fibrosis in rats by suppressing epithelial-mesenchymal transition and fibroblast activation, Sci. Rep. 6 (2016) 35696, https://doi.org/ 10.1038/srep35696. [19] F.F. Li, J. Shen, H.J. Shen, X. Zhang, R. Cao, Y. Zhang, et al., Shp2 plays an important role in acute cigarette smoke-mediated lung inflammation, J. Immunol. 189 (6) (2012) 3159–3167, https://doi.org/10.4049/jimmunol.1200197. [20] R. Guan, X. Zhao, X. Wang, N. Song, Y. Guo, X. Yan, et al., Emodin alleviates bleomycin-induced pulmonary fibrosis in rats, Toxicol. Lett. 262 (2016) 161–172, https://doi.org/10.1016/j.toxlet.2016.10.004. [21] N. Yokohori, K. Aoshiba, A. Nagai, Increased levels of cell death and proliferation in alveolar wall cells in patients with pulmonary emphysema, Chest 125 (2) (2004) 626–632. [22] P.M. Calverley, J.A. Anderson, B. Celli, G.T. Ferguson, C. Jenkins, P.W. Jones, et al., Salmeterol and fluticasone propionate and survival in chronic obstructive pulmonary disease, N Engl. J. Med. 356 (8) (2007) 775–789, https://doi.org/10.1056/ NEJMoa063070. [23] N. Bazhanov, M. Ansar, T. Ivanciuc, R.P. Garofalo, A. Casola, Hydrogen sulfide: a
Acknowledgements This work was supported by grants from the National Key R&D Program of China (2016YFC0903700), the 973 Key Scheme of China (2015CB553406), the National Natural Science Foundation of China (81520108001, 81770043, 81800072, 81560013 and 81220108001), China Postdoctoral Science Foundation (2017M612637, 2018T110860), Guangzhou Science and Technology Programs for Science Study (201607020030 and 201804010052), Guangdong Province Universities and Colleges Key Grant for Innovative Research (cxzd1142), Guangzhou Department of Education (1201620007, 13C08, 12A001S, and 1201630095), Project of State Key Laboratory of Respiratory Disease (SKLRD-QN-201706, SKLRD-QN-201917 and SKLRD-OP-201808), the Local Innovative and Research Teams Project of Guangdong Pearl River Talents Program (2017BT01S155), the Major Science and Technology Projects of Inner Mongolia Autonomous Region and Guangdong Province Universities and Colleges Pearl River Scholar Funded Scheme (2014, for WL). Author contributions WL, HY, RG and JW conceived the project and designed experiments. RG wrote the manuscript. JW, DL, HY, DS and ZL edited the manuscript. RG, DL, ZL, HL, QY, MD, ZhL, WL and CZ performed the experiments. RG, ZL, and XL conducted data analysis. All authors have read and approved the final manuscript. Declaration of Competing Interest The authors have declared that there is no conflict of interest. 10
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
[24] [25]
[26] [27] [28] [29]
[30] [31] [32] [33]
[34] [35] [36]
novel player in airway development, pathophysiology of respiratory diseases, and antiviral defenses, Am. J. Respir Cell Mol. Biol. 57 (4) (2017) 403–410, https://doi. org/10.1165/rcmb.2017-0114TR. J.C. Hogg, F. Chu, S. Utokaparch, R. Woods, W.M. Elliott, L. Buzatu, et al., The nature of small-airway obstruction in chronic obstructive pulmonary disease, N Engl. J. Med. 250 (26) (2004) 2645–2653 doi:10.1056/NEJMoa032158. D. Xu, H. Jin, J. Wen, J. Chen, D. Chen, N. Cai, et al., Hydrogen sulfide protects against endoplasmic reticulum stress and mitochondrial injury in nucleus pulposus cells and ameliorates intervertebral disc degeneration, Pharmacol. Res. 117 (2017) 357–369, https://doi.org/10.1016/j.phrs.2017.01.005. S.H. Lee, S. Goswami, A. Grudo, L.Z. Song, V. Bandi, S. Goodnight-White, et al., Antielastin autoimmunity in tobacco smoking-induced emphysema, Nat. Med. 13 (5) (2007) 567–569, https://doi.org/10.1038/nm1583. M. Szilasi, T. Dolinay, Z. Nemes, J. Strausz, Pathology of chronic obstructive pulmonary disease, Pathol. Oncol. Res. 12 (1) (2006) 52–60 https://doi.org/ PAOR.2006.12.1.0052. K. Xu, X. Li, Risk factors for depression in patients with chronic obstructive pulmonary disease, Med. Sci. Monit. 24 (2018) 1417–1423. S. Singh, S.K. Verma, S. Kumar, M.K. Ahmad, A. Nischal, S.K. Singh, et al., Correlation of severity of chronic obstructive pulmonary disease with potential biomarkers, Immunol. Lett. 196 (2018) 1–10, https://doi.org/10.1016/j.imlet. 2018.01.004. G. Moreno-Bueno, F. Portillo, A. Cano, Transcriptional regulation of cell polarity in EMT and cancer, Oncogene 27 (55) (2008) 6958–6969, https://doi.org/10.1038/ onc.2008.346. P. Polakis, The oncogenic activation of beta-catenin, Curr. Opin Genet Dev. 9 (1) (1999) 15–21. K. Shin, V.C. Fogg, B. Margolis, Tight junctions and cell polarity, Annu. Rev. Cell Dev. Biol. 22 (2006) 207–235, https://doi.org/10.1146/annurev.cellbio.22. 010305.104219. H. Bai, Q. Zhu, A. Surcel, T. Luo, Y. Ren, B. Guan, et al., Yes-associated protein impacts adherens junction assembly through regulating actin cytoskeleton organization, Am. J. Physiol. Gastrointest. Liver Physiol. 311 (3) (2016) G396–G411, https://doi.org/10.1152/ajpgi.00027.2016. B. Li, C. Lee, Z. Martin, X. Li, Y. Koike, A. Hock, et al., Intestinal epithelial injury induced by maternal separation is protected by hydrogen sulfide, J. Pediatr. Surg. 52 (1) (2017) 40–44, https://doi.org/10.1016/j.jpedsurg.2016.10.013. K. Imai, B.A. Mercer, L.L. Schulman, J.R. Sonett, J.M. D'Armiento, Correlation of lung surface area to apoptosis and proliferation in human emphysema, Eur. Respir. J. 25 (2) (2005) 250–258, https://doi.org/10.1183/09031936.05.00023704. R.M. Tuder, T. Yoshida, W. Arap, R. Pasqualini, Petrache I. State of the art. Cellular and molecular mechanisms of alveolar destruction in emphysema: an evolutionary perspective, Proc. Am. Thorac. Soc. 6 (3) (2006) 503–510, https://doi.org/10. 1513/pats.200603-054MS.
[37] R. Guan, J. Wang, Z. Li, M. Ding, D. Li, G. Xu, et al., Sodium Tanshinone IIA Sulfonate Decreases Cigarette Smoke-Induced Inflammation and Oxidative Stress via Blocking the Activation of MAPK/HIF-1alpha Signaling Pathway, Front. Pharmacol. 9 (2018) 263, https://doi.org/10.3389/fphar.2018.00263. [38] I.M. Eurlings, N.L. Reynaert, T. van den Beucken, H.R. Gosker, C.C. de Theije, F.M. Verhamme, et al., Cigarette smoke extract induces a phenotypic shift in epithelial cells; involvement of HIF1alpha in mesenchymal transition, e107757, Plos One 9 (10) (2014), https://doi.org/10.1371/journal.pone.0107757. [39] T. Cramer, Y. Yamanishi, B.E. Clausen, I. Forster, R. Pawlinski, N. Mackman, et al., HIF-1alpha is essential for myeloid cell-mediated inflammation, Cell 112 (5) (2003) 645–657. [40] S. Lu, Y. Gao, X. Huang, X. Wang, GYY4137, a hydrogen sulfide (H(2)S) donor, shows potent anti-hepatocellular carcinoma activity through blocking the STAT3 pathway, Int. J. Oncol. 44 (4) (2014) 1259–1267, https://doi.org/10.3892/ijo. 2014.2305. [41] C. Yang, Y. Xu, H. Zhou, L. Yang, S. Yu, Y. Gao, et al., Tetramethylpyrazine protects CoCl2-induced apoptosis in human umbilical vein endothelial cells by regulating the PHD2/HIF/1alpha-VEGF pathway, Mol. Med. Rep. 13 (2) (2016) 1287–1296, https://doi.org/10.3892/mmr.2015.4679. [42] N. Olson, A. van der Vliet, Interactions between nitric oxide and hypoxia-inducible factor signaling pathways in inflammatory disease, Nitric Oxide 25 (2) (2011) 125–137, https://doi.org/10.1016/j.niox.2010.12.010. [43] L.A. Shimoda, G.L. Semenza, HIF and the lung: role of hypoxia-inducible factors in pulmonary development and disease, Am. J. Respir. Crit. Care Med. 183 (2) (2011) 152–156, https://doi.org/10.1164/rccm.201009-1393PP. [44] W. Chen, J. Thomas, M. Sadatsafavi, J.M. FitzGerald, Risk of cardiovascular comorbidity in patients with chronic obstructive pulmonary disease: a systematic review and meta-analysis, Lancet Respir. Med. 3 (8) (2015) 631–639, https://doi. org/10.1016/S2213-2600(15)00241-6. [45] P. Sakornsakolpat, D. Prokopenko, M. Lamontagne, N.F. Reeve, A.L. Guyatt, V.E. Jackson, et al., Genetic landscape of chronic obstructive pulmonary disease identifies heterogeneous cell-type and phenotype associations, Nat. Genet. 51 (3) (2019) 494–505, https://doi.org/10.1038/s41588-018-0342-2. [46] P.J. Barnes, Small airway fibrosis in COPD, Int. J. Biochem. Cell Biol. 116 (2019) 105598, , https://doi.org/10.1016/j.biocel.2019.105598. [47] H. Maunders, S. Patwardhan, J. Phillips, A. Clack, A. Richter, Human bronchial epithelial cell transcriptome: gene expression changes following acute exposure to whole cigarette smoke in vitro, Am. J. Physiol. Lung Cell Mol. Physiol. 292 (5) (2007) L1248–L1256, https://doi.org/10.1152/ajplung.00290.2006. [48] X. Zhou, D. Gu, G. Hou, Erythromycin attenuates metalloprotease/anti-metalloprotease imbalance in cigarette smoke-induced emphysema in rats via the mitogenactivated protein kinase/nuclear factor-kappaB activation pathway, Mol. Med. Rep. 15 (5) (2017) 2983–2990, https://doi.org/10.3892/mmr.2017.6416.
11
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Hydrogen sulfide inhibits cigarette smoke-induced inflammation and injury in alveolar epithelial cells by suppressing PHD2/HIF-1α/MAPK signaling pathway Ruijuan Guana,1, Jian Wanga,1, Defu Lia,b,1, Ziying Lia, Hanwei Liua, Mingjing Dinga,c, Zhou Caia, ⁎ Xue Lianga,b, Qian Yanga, Zhen Longa, Lingzhu Chena, Wei Liua, Dejun Sunc, Hongwei Yaoa, , ⁎ Wenju Lua, a
State Key Laboratory of Respiratory Diseases, Guangdong Key Laboratory of Vascular Diseases, National Clinical Research Center for Respiratory Disease, Guangzhou Institute of Respiratory Health, The First Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, China The Fifth Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, China c Departments of Respiratory and Critical Diseases, Inner Mongolia Autonomous Region People's Hospital, Hohhot, China b
ARTICLE INFO
ABSTRACT
Keywords: Hydrogen sulfide COPD Alveolar epithelial cell Prolyl hydroxylase Hypoxia inducible factor-1α MAPK signaling
Chronic obstructive pulmonary fibrosis (COPD) is a chronic and fatal lung disease with few treatment options. Sodium hydrosulfide (NaHS), a donor of hydrogen sulfide (H2S), was found to alleviate cigarette smoke (CS)induced emphysema in mice, however, the underlying mechanisms have not yet been clarified. In this study, we investigated its effects on COPD in a CS-induced mouse model in vivo and in cigarette smoke extract (CSE)stimulated alveolar epithelial A549 cells in vitro. The results showed that NaHS not only relieved emphysema, but also improved pulmonary function in CS-exposed mice. NaHS significantly increased the expressions of tight junction proteins (i.e., ZO-1, Occludin and claudin-1), and reduced apoptosis and secretion of pro-inflammatory cytokines (i.e., TNF-α, IL-6 and IL-1β) in CS-exposed mouse lungs and CSE-incubated A549 cells, indicating H2S inhibits CS-induced inflammation, injury and apoptosis in alveolar epithelial cells. NaHS also upregulated prolyl hydroxylase (PHD)2, and suppressed hypoxia-inducible factor (HIF)-1α expression in vivo and in vitro, suggesting H2S inhibits CS-induced activation of PHD2/HIF-1α axis. Moreover, NaHS inhibited CS-induced phosphorylation of ERK, JNK and p38 MAPK in vivo and in vitro, and treatment with their inhibitors reversed CSE-induced ZO-1 expression and inflammation in A549 cells. These results suggest that NaHS may prevent emphysema via the suppression of PHD2/HIF-1α/MAPK signaling pathway, and subsequently inhibition of inflammation, epithelial cell injury and apoptosis, and may be a novel strategy for the treatment of COPD.
1. Introduction Chronic obstructive pulmonary fibrosis (COPD) is one of the leading causes of death and morbidity around the world. It affects up to 50% of all long-term smokers and cigarette smoking is considered as the major agent that drives the development and progression of this disease. Cigarette smoke (CS) affects the entire respiratory epithelium and promotes emphysema through the destruction of alveolar walls [1]. Current therapies including corticosteroids and bronchodilators can improve symptoms, particularly the breathlessness and exercise tolerance, but their effects are limited, and no treatments have been
demonstrated to reduce disease progression [2]. To treat COPD in a more targeted and efficacious manner, new strategies are urgently required. Emphysema, a primary component of COPD, is characterized by the enlargement of airspaces and the loss of alveolar wall structures [3]. The inflammatory responses in COPD lung tissues is believed to be correlated with emphysema that worsen with disease progression [4]. Accumulating evidence also indicates that the epithelial cell injury is involved in the loss of alveolar wall cells in the patients with emphysema [5]. The alveolar epithelial cells, located in the interface between the external environment and lung parenchyma, can protect the sub-
Corresponding authors at: State Key Lab of Respiratory Diseases, Guangdong Key Laboratory of Vascular Diseases, National Clinical Research Center for Respiratory Disease, Guangzhou Institute of Respiratory Health, The First Affiliated Hospital, Guangzhou Medical University, Guangzhou, China (H. Yao; W. Lu). E-mail addresses: [email protected] (H. Yao), [email protected] (W. Lu). 1 These authors contributed equally to this work. ⁎
https://doi.org/10.1016/j.intimp.2019.105979 Received 14 June 2019; Received in revised form 28 September 2019; Accepted 13 October 2019 1567-5769/ © 2019 Published by Elsevier B.V.
Please cite this article as: Ruijuan Guan, et al., International Immunopharmacology, https://doi.org/10.1016/j.intimp.2019.105979
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
epithelial tissue from harmful stimuli [6]. In response to reiterative smoke exposure, decreases in several epithelial tight junction proteins and increases in epithelial cell apoptosis have been observed in the lung [7,8], further suggesting the potential role of alveolar epithelial cell injury and apoptosis in COPD development. Hydrogen sulfide (H2S), a gaseous molecule, has been proposed as a novel endogenous gasotransmitter identified after nitric oxide and carbon monoxide [9]. It has been demonstrated to play a critical role in a variety of physiological and pathological processes [10]. Studies have shown that H2S can exert anti-inflammatory [11], anti-oxidative stress [12], anti-cancer [13] and anti-diabetic [14] activities. Recent studies have reported that supplementation of H2S could protect against CSinduced emphysema in mice [12], and reduce nicotine-induced endoplasmic reticulum stress and apoptosis in 16HBE cells [15]. However, the mechanisms underlying the protection of H2S against emphysema are poorly understood. The present study was designed to investigate whether H2S protects against emphysema via its effects on inflammation responses, intercellular junctions and apoptosis of alveolar epithelial cells by suppressing PHD2/HIF-1α/MAPK signaling pathway.
Each CS exposure lasted about 2 h with interval time between two CS exposures more than 4 h. During CS exposure, the concentrations of particle matters and smoke gases in the chamber were monitored, which included total particle 741.4 ± 36.83 mg/m3, particulate matter with particle size below 10 µm 31.37 ± 3.23 mg/m3, O2 concentration > 20%, CO2 4000–5000 ppm, CO 500–800 ppm, NO 18–22 ppm and SO2 14–18 ppm. The control animals were exposed to room air for 12 weeks. The sterile saline or NaHS (40 mg/kg, 30 min per session, twice per day) was given daily by atomization inhalation 30 min before exposed to CS. This dosage was chosen based on our previous report showing that inhalation of NaHS in total dose of 80 mg/kg daily has beneficial effects on NO2-induced emphysema in rodents [16]. After all the mice were killed, lungs were harvested for following experiments.
2. Materials and methods
2.4. Lung pathological analysis
2.1. Chemicals and reagents
Left lungs were fixed in 10% buffered formalin for 48 h and embedded in paraffin. Then the lung tissues were cut into 3-μm-thick slices and stained with hematoxylin and eosin (H&E).
2.3. Lung function test Mice were anesthetized with 1% pentobarbital sodium (50 mg/kg i.p.) and the lung function test was then performed according to the descriptions by Liang et al. [17].
NaHS was purchased from Sigma-Aldrich (St Louis, MO, USA), and the cigarettes were purchased from Guangdong Tobacco Industry Co., Ltd. (Guangzhou, China). The TRIzol Reagent was purchased from ambion (Life Technologies, CA, USA). The PrimeScript RT reagent Kit with gDNA Eraser was obtained from Takara Bio Inc. (Takara, Shiga, Japan), and the SsoFast EvaGreen Supermix was obtained from Bio-Rad Laboratories, Inc. (CA, USA). The primary antibodies described in this study include: anti-Bcl-2, anti-Bax and anti-β-actin polyclonal antibodies were purchased from Proteintech (Chicago, IL, USA); anti-1β, anti-Claudin-1, anti-HIF-1α, anti-PHD2, anti-Cleaved caspase 3, anti-pJNK, anti-JNK, anti-p-ERK, anti-ERK, anti-p-P38 and anti-P38 antibodies were purchased from Cell Signaling Technology (CA, USA); antiZO-1 monoclonal antibody was purchased from Thermo Fisher Scientific (Boston, MA, USA); anti-Occludin antibodies and the HRPlabeled Goat Anti-Rabbit/Mouse IgG (H + L) were purchased from Abcam Biotechnology (Cambridge, MA, USA). ERK inhibitor (PD98059) were obtained from Selleck Chemicals (Houston, TX, USA). JNK inhibitor (SP600125) and P38 inhibitor (SB203580) were obtained from Absin (Shanghai, China). The poly-vinylidene fluoride (PVDF) membranes were purchased from Millipore Corporation (Billerica, MA, USA). ECL-Plus detection kit probed was purchased from Tanon Science & Technology Co., Ltd. (Shanghai, China). Other reagents were all purchased from GBCBIO Technologies Inc. (Guangzhou, China) unless otherwise indicated.
2.5. Enzyme-linked immunosorbent assay (ELISA) Lung tissues were prepared for ELISA. The concentration of tumor necrosis factor (TNF)-α, interleukin (IL)-6 and IL-1β was detected by ELISA following the manufacturer’s protocol (eBioscience Affymetrix, San Diego, CA, USA). 2.6. Immunohistochemistry Immunohistochemistry analysis was performed using a method described previously [18]. 2.7. Cell culture Human alveolar epithelial A549 cells were obtained from Cell Bank of the Chinese Academy of Sciences (Shanghai, China), and cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS), 100 KU/L penicillin and 100 mg/L streptomycin in a humidified incubator at 37 °C with 5% CO2 atmosphere. 2.8. Preparation of cigarette smoke extract (CSE) CSE was prepared by bubbling smoke from two cigarettes into 10 ml DMEM according to the method described by Li et al. [19].
2.2. Animals and treatments Adult male C57BL/6J mice, weighting 18–20 g, were obtained from Nanjing BioMedical Research Institute of Nanjing University (Nanjing, China), and housed in a room at controlled temperature of 25 °C with 12/12 light/dark cycle, where they were allowed free access to food and water all the times. The animal experimental protocols were approved by the Ethics Committee of the First Affiliated Hospital of Guangzhou Medical University. Mice were randomly allocated to one of the following three groups: (1) room air exposure plus atomization inhalation of sterile saline (control group); (2) CS exposure plus atomization inhalation of sterile saline (CS group); and (3) CS exposure plus atomization inhalation of NaHS (CS + NaHS group). For the CSinduced COPD mouse model, mice were placed in a 60 cm × 57 cm × 100 cm fume box and exposed to smoking generated from 9 filter-tipped cigarettes (Red Roses Label; tar: 13 mg/cigarette; nicotine: 1.3 mg/cigarette) twice a day, 6 days per week for 12 weeks.
2.9. Immunofluorescence staining The procedures for immunofluorescence staining were modified according to our previous report [20]. In brief, A549 cells were seeded on glass slides and treated as indicated for 48 h. The cells were incubated with a rabbit monoclonal antiserum against ZO-1 (1:100 dilution) for 48 h at 4 °C. The slides were subsequently incubated concurrently with a goat anti-rabbit IgG conjugated with Cy3, and fluorescence was detected by a Zeiss LSM 800 confocal laser system. 2.10. Quantitative real-time PCR (RT-PCR) Total RNA was extracted from lung tissues or A549 cells using TRIzol Reagent and reverse-transcribed into first-strand cDNA using the PrimeScript RT reagent Kit with gDNA Eraser. The mRNA levels of 2
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Table 1 Primers sets used for quantitative real-time PCR. Gene
Sense Primer(5′-3′)
Antisense Primer(5′-3′)
Mouse CRL Mouse CBS Mouse PMST Mouse TNF-α Mouse IL-6 Mouse IL-1β Mouse actin Human TNF-α Human IL-6 Human IL-1β 18S
GCTTGGAAAAAGCAGTGGCT AGCTGGAACCTGCTCCTTTT TGGTATCTGCTACCCAACGC CCCTCCTGGCCAACGGCATG CTGCAAGAGACTTCCATCCAG GCCTCGTGCTGTCGGACCCATAT CGTGCGTGACATCAAAGAGAAG CGGACACCATGGACAAGTTT GTGAGGAACAAGCCAGAGC ATGATGGCTTATTACAGTGGCAA GCAATTATTCCCCATGAACG
TCGTAATGGTGGCAGCAAGA GTTGGCTCTTGAGTCCCCTC CAGAGCTCGGAAAAGTTGCG TCGGGGCAGCCTTGTCCCTT AGTGGTATAGACAGGTCTGTTGG TCCTTTGAGGCCCAAGGCCACA CCAAGAAGGAAGGCTGGAAAA GAAAGCCTTGCAGAGGTCAG TACATTTGCCGAAGAGCC GTCGGAGATTCGTAGCTGGA GGCCTCACTAAACCATCCAA
Fig. 1. NaHS reduced cigarette smoke (CS)-induced emphysema and pulmonary function decline in mice. (A) 12 weeks after CS inhalation, lung pathology was examined by H&E staining, and representative images of lung sections of mice from control group, CS group and CS+ NaHS group were shown respectively. (B) Mean linear intercept (MLI), representing the degree of emphysema was quantified by Image Pro Plus 6.0 software (6 mice per group). (C) Lung function parameter FEV50/ FVC among different groups was calculated (6 mice per group). Data are expressed as the mean ± SEM, **P < 0.01 compared with Control; #P < 0.05, ## P < 0.01 compared with CS only.
cystathionine β-synthase (CBS), cystathionine γ-lyase (CRL), 3-mercaptypyruvate sulfurtransferase (MPST), TNF-α, IL-6, and IL-1β were analyzed with an iCyler iQ Real-time PCR Detection System (Bio-Rad Laboratories Inc., USA) using SsoFast EvaGreen Supermix (Bio-Rad Laboratories, Inc., CA, USA) in a total volume of 15 μl. Relative levels of mRNA expression were normalized to β-actin or 18S expression for each gene. The primers used for gene expression studies are list in Table 1.
antibody (1:1000 dilution), rabbit anti-ZO-1 antibody (1:1000 dilution), rabbit anti-claudin-1 antibody (1:1000 dilution), rabbit anti-Occludin antibody (1:1000 dilution), rabbit anti-PHD2 antibody (1:1000 dilution), rabbit anti-HIF-1α antibody (1:1000 dilution), rabbit anti-Cleaved caspase 3 antibody (1:1000 dilution), rabbit anti-p-ERK antibody (1:2000 dilution), rabbit anti-ERK antibody (1:2000 dilution), rabbit anti-p-JNK antibody (1:1000 dilution), rabbit anti-JNK antibody (1:1000 dilution), rabbit anti-p-P38 antibody (1:1000 dilution), rabbit anti-P38 polyclonal antibody (1:1000 dilution), and mouse anti-β-actin polyclonal antibody (1:3000 dilution). HRP-labeled goat anti-rabbit (1:3000 dilution) and anti-mouse (1:3000 dilution) antibodies were used as the secondary antibodies. The membranes were probed using an ECL-Plus detection kit and then scanned with Tanon-5200 (Tanon Science & Technology Co., Ltd., Shanghai, China). The intensity analysis was analyzed by a densitometry system named Image J.
2.11. Western blot Lung samples and A549 cells were homogenized in RIPA lysis buffer (GBCBIO Technologies Inc., Guangzhou, China) with protease inhibitor (Roche), and total protein concentration was measured by bicinchoninic acid (BCA). Total protein (30–50 µg) was loaded into each lane onto 10% SDS-polyacrylamide gels. Electrophoresis was performed before the proteins were transferred to the PVDF membranes, which were blocked with 5% non-fat milk, washed in Tris-buffered saline containing 0.1% Tween-20 (TBST), and incubated with primary antibody overnight at 4 °C. The primary antibodies used were as follows: Rabbit anti-IL-1β
2.12. Data analysis Data are presented as mean ± standard error of the mean (SEM), statistical significance was performed using One-way analysis of 3
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
variance (ANOVA). The differences between two groups were compared using Student’s t test. A two-sided P value less than 0.05 (P < 0.05) were considered to be significant.
these tight junction proteins was significantly restored by NaHS treatment, implying that H2S can mitigate CS-induced epithelial cell injury by altering epithelial cell-cell junction (Fig. 4A, B). CS-induced injury might activate mitochondrial intrinsic pathway of apoptosis, which was demonstrated by immunohistochemistry in COPD lungs [5]. Our results also showed that treatment with NaHS significantly suppressed CS-induced cell apoptosis in CS-exposed mice, as indicated by reduced expression of pro-apoptotic proteins including Bax and Cleaved caspase 3, and increased anti-apoptotic protein Bcl-2 (Fig. 4C, D). These data indicate that NaHS protects epithelial cells from injury and apoptosis in CS-exposed mice, subsequently leading to attenuation of emphysema.
3. Results 3.1. NaHS prevented emphysema and pulmonary function decline in CSexposed mice. The effects of NaHS on CS-induced COPD were analyzed. As shown in Fig. 1A, B, the mean linear intercept (MLI) in the lungs of mice exposed to CS for 12 weeks are much larger than those exposed to normal room air. NaHS markedly decreased the increase of MLI in the lungs, indicating that NaHS significantly inhibited CS-induced emphysema. Further, we examined the changes in pulmonary function after NaHS treatment. Interestingly, the pulmonary function of NaHS-treated mice was also significantly improved, as demonstrated by increased FEV50/ FVC, when compared with CS-treated mice (Fig. 1C). Moreover, mice exposed to CS showed decreased expression of cystathionine β-synthase (CBS), cystathionine γ-lyase (CRL) and 3-mercaptypyruvate sulfurtransferase (MPST) (Fig. 2), critical enzymes in the generation of H2S, which was dramatically restored by NaHS treatment, indicating NaHS significantly attenuates CS-induced emphysema, which is associated with restoration of enzymes generating H2S in mouse lungs.
3.4. NaHS decreased CSE-induced upregulation of TNF-α, IL-6 and IL-1β in alveolar epithelial A549 cells. We further analyzed the effects of NaHS on CSE-induced inflammation response in human alveolar epithelial A549 cells. Therefore, the levels of pro-inflammatory cytokines, including TNF-α, IL-6 and IL-1β, were examined using RT-PCR. The data showed that the mRNA levels of TNF-α, IL-6 and IL-1β were significantly elevated in the CSE-treated A549 cells and this elevation was significantly inhibited by NaHS treatment (Fig. 5). 3.5. NaHS inhibited CSE-induced cell injury and apoptosis in human alveolar epithelial A549 cells.
3.2. NaHS reduced CS-induced upregulation of inflammatory cytokines in the mouse lungs.
We also assessed whether NaHS inhibits CSE-induced alveolar epithelial cell injury and apoptosis in A549 cells. Similar to our in vivo observations, the results showed that CSE significantly downregulated the expression of tight junction proteins including ZO-1 and Claudin-1, when compared with control cells. Nevertheless, NaHS treatment enhanced the expression of ZO-1 and Claudin-1, when compared with CSE alone treated cells (Fig. 6). Our results also showed that treatment with NaHS significantly suppressed CSE-induced epithelial cell apoptosis in A549 cells, as demonstrated by reduced Cleaved caspase 3 protein levels (Fig. 6A, B).
We explored the detailed anti-emphysematous mechanisms of NaHS. Inflammation is known to participate in the pathogenesis of emphysema [21], and inflammatory cytokines such as TNF-α, IL-6 and IL-1β have been reported to play critical roles in the pathogenesis of COPD. We therefore determined the TNF-α, IL-6 and IL-1β content in the lungs from CS-exposed mice. As shown in Fig. 3A-F, 12 weeks after CS inhalation, the mRNA and protein levels of TNF-α, IL-6 and IL-1β in the lungs were significantly elevated when compared with the Control group, as demonstrated by RT-PCR and ELISA assays. Whereas treatment with NaHS inhibited the CS-induced upregulation of pulmonary TNF-α, IL-6 and IL-1β. Likewise, Western blot analysis of lungs also showed that the protein level of IL-1β was significantly decreased by NaHS treatment (Fig. 3G). Moreover, our immunohistochemistry studies demonstrated that the IL-6- and IL-1β-positive cells were also decreased by NaHS treatment (Fig. 3H). These data provide evidence that the protective role of NaHS may involve the inhibition of inflammation.
3.6. NaHS inhibited CS-induced activation of PHD2/HIF-1α signaling in mouse lungs and in alveolar epithelial A549 cells Given the established role of NaHS in alleviating inflammation and alveolar epithelial cells injury, we next explored the underlying mechanisms. Western blot showed that the protein levels of hypoxia-inducible factor (HIF)-1α were dramatically increased, suggesting the activation of HIF-1α signaling in COPD. Whereas treatment with NaHS significantly decreased the CS-induced upregulation of HIF-1α protein (Fig. 7A, B). Coincidentally, the enhancement of HIF-1α expression induced by CSE in alveolar epithelial A549 cells was also markedly suppressed by NaHS treatment in a dose-dependent manner (Fig. 7C, D). Meanwhile, treatment with NaHS also increased the protein level of
3.3. NaHS protected alveolar epithelial cells from injury and apoptosis in CS-exposed mouse lungs. Western blot analysis showed that mice repetitive exposed to CS had a reduction in ZO-1, Occludin and Claudin-1 levels. This reduction in
Fig. 2. Effects of NaHS on CRL, CBS and MPST levels in the CS-induced COPD mouse lungs. 12 weeks after CS inhalation, mouse lung tissues were homogenized, and the mRNA levels of CRL (A), CBS (B) and MPST (C) in the lung tissues were analyzed by Quantitative real-time PCR (RT-PCR) (6 mice per group). Data are expressed as the mean ± SEM, **P < 0.01 compared with Control; ##P < 0.01 compared with CS only. 4
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 3. Effects of NaHS on CS-induced pulmonary inflammatory cytokines. 12 weeks after CS inhalation, lung tissues were collected. (A–C) The mRNA levels of TNFα, IL-6 and IL-1β in the lung tissues were analyzed by Quantitative real-time PCR (RT-PCR) (6 mice per group). (D–F) The protein levels of TNF-α, IL-6 and IL-1β in the lung tissues were analyzed by ELISA (6 mice per group). (G) The relative IL-1β protein level in the lung tissues was analyzed by Western blot (6 mice per group). (H) Immunohistochemical staining of IL-6- and IL-1β-positive cells in the lungs (6 mice per group). Data are presented as the mean ± SEM, **P < 0.01 compared with Control; ##P < 0.01 compared with CS only.
3.8. Inhibition of ERK, JNK and p38 MAPK pathways reversed the CSEinduced inflammation and cell injury in A549 cells
prolyl hydroxylase (PHD)2, an oxygen sensor that regulates the stability of HIF-1α, in vivo (Fig. 7A, B) and in vitro (Fig. 7C, D). The results demonstrated that the protective effect of NaHS in CS-induced COPD was, at least in part, via the regulation of the PHD2/HIF-1α signaling pathway.
We first investigated the effects of ERK, JNK or p38 MAPK inhibitor on CSE-induced pro-inflammatory signaling. To test this hypothesis, we screened ERK inhibitor PD98059, JNK inhibitor SP600125 or P38 inhibitor SB203580 in CSE-stimulated epithelial A549 cells. We found that PD98059, SP600125 or SB203580 significantly suppressed the CSE-induced upregulation of TNF-α, IL-6 and IL-1β levels in A549 cells (Fig. 9A–C). We also investigated the effects of ERK, JNK or p38 MAPK inhibitor on CSE-mediated epithelial cell injury in vitro. We found that PD98059, SP600125 or SB203580 attenuated CSE-induced reduction in ZO-1 levels (Fig. 9D, E). These results suggest that cigarette smoke exposure induced inflammation and alveolar epithelial cell injury are partially mediated by ERK/JNK/p38 MAPK activation.
3.7. NaHS inhibited CS-induced ERK/JNK/p38 MAPK activation in mouse lungs and in alveolar epithelial A549 cells The activation of ERK/JNK/p38 MARK has been well-defined in COPD. We therefore investigated whether NaHS affected the activation of ERK, JNK and P38. Western blot analysis showed that CS exposure increased phosphorylated ERK, JNK and P38 levels in the mouse lungs. While treatment with NaHS markedly repressed the CS-induced phosphorylation of ERK, JNK and p38 MAPK, as compared to control group (Fig. 8A, B). This finding was also validated in CSE-stimulated A549 cells (Fig. 8C–J), revealing that NaHS effectively antagonized CS-induced activation of ERK/JNK/p38 MAPK signaling.
4. Discussion COPD, one of the most fatal events globally, may result in respiratory failure with disease development and progression [22]. 5
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 4. Effects of NaHS on the epithelial cell injury and apoptosis in the mice with pulmonary emphysema. 12 weeks after CS inhalation, lung tissues were collected. (A) Western blot was used to analyze the protein levels of ZO-1, Occludin, and Claudin-1 in the lung tissues. (B) Densitometric analysis of ZO-1, Occludin, and Claudin-1 in the immunoblots using β-actin as the internal reference (6 mice per group). (C) Western blot was used to analyze the protein levels of Bax, Bcl-2, and Cl. Caspase 3 in the lung tissues. (D) Densitometric analysis of Bax, Bcl-2, and Cleaved caspase 3 in the immunoblots using β-actin as the internal reference (6 mice per group). Data are presented as the mean ± SEM, **P < 0.01 compared with Control; ##P < 0.01 compared with CS only.
Currently, there are no clinically effective medications for COPD. In the respiratory tract, H2S has been reported to play a protective role in COPD [12,15,23]. In the current study, we showed that in addition to inhibition of emphysematous airspace enlargement, H2S donor NaHS significantly inhibited CS-induced lung function decline in mice. Our results showed three possible mechanisms whereby H2S exerts its antiemphysematous effect: (1) NaHS inhibited CS-induced upregulation of inflammatory cytokines; (2) NaHS reduced CS-induced epithelial cell injury and apoptosis; (3) NaHS suppressed epithelial cell injury by increasing epithelial cell-cell adhesion. We also identified that the protect effect of H2S was linked to the suppression of PHD2/HIF-1α/MAPK signaling pathway. COPD encompasses a battery of clinical syndromes, most noticeably pulmonary emphysema and chronic inflammation [5]. Emphysema, a principal component of COPD, is defined by permanent destructive enlargement of airspaces distal to the terminal bronchioles, contributing to chronic airflow obstruction [21]. The airflow limitation is usually progressive and not fully reversible, which eventually leads to respiratory failure [8]. Thus, lung transplantation is the only effective option for end-stage COPD. However, H2S, a novel endogenous gasotransmitter, has been reported to reduce emphysema [12], yet its underlying mechanism remains largely elusive. In order to better determine the mechanisms of H2S operating in emphysema, establishment
of animal models of COPD is critically essential. Environmental exposure, mainly cigarette smoking, is the primary factor of COPD development [24]. The animal model used in this study was also the CSinduced mouse model, a well-established model of COPD [3]. Our results showed that chronic CS exposure induced significant COPD, as indicated by the decreased lung function and increased emphysema. These results suggested that we had successfully built a COPD mouse model. Consistent with the previous report [12], we observed a remarkable improvement of emphysema in the CS-exposed mice after NaHS treatment. NaHS was well tolerated by the mice as illuminated by no perceptible toxicity. Pulmonary function parameter FEV1/FVC is clinically predicted to classify the severity of this disease [8]. In the current study, we found that the CS-induced reduction in FEV50/FVC was significantly upregulated by NaHS, indicating H2S also improves the lung function in COPD mouse model. Moreover, H2S is generated endogenously in mammalian cells from L-cysteine by CRL and CBS and MPST [25]. We found that all of them exist in the mouse lung tissue. CS exposure decreased the mRNA levels of CRL, CBS and MPST in the lungs, suggesting endogenous H2S plays a critical role in maintaining the normal physiological function. Whereas treatment with NaHS significantly prevents the CS-induced reduction in the mRNA levels of CRL, CBS and MPST, indicating NaHS elevated the capacity for H2S synthesis.
Fig. 5. Effects of NaHS on the CSE-induced production of inflammatory cytokines in alveolar epithelial A549 cells. A549 cells were cultured with and without 3% CSE and/or 100, 200, or 400 μM NaHS for 48 h. The mRNA levels of TNF-α (A), IL-6 (B), and IL-1β (C) in the A549 cells were analyzed by Quantitative real-time PCR (RTPCR). Data are presented as the mean ± SEM, **P < 0.01 compared with control [3% CSE (-) and NaHS (-)]; #P < 0.05, ##P < 0.01 compared with 3% CSE only. 6
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 6. Effects of NaHS on the CSE-induced cell injury and apoptosis in alveolar epithelial A549 cells. A549 cells were cultured with and without 3% CSE and/or 100, 200, or 400 μM NaHS for 48 h. (A, B) The cell samples were collected to determine the protein levels of ZO-1, Claudin-1 and Cl. Caspase 3 by Western blot. (C) Immunofluorescence staining for ZO-1 was performed on alveolar epithelial A549 cells treated with and without 3% CSE and/or 400 μM NaHS for 48 h. Data are presented as the mean ± SEM, **P < 0.01 compared with control [3% CSE (-) and NaHS (-)]; #P < 0.05, ##P < 0.01 compared with 3% CSE only.
Inflammation, especially exaggerated type 1 inflammation, plays a critical role in the pathology of emphysema [26]. Studies showed that inflammation with infiltrating macrophages, neutrophils and lymphocytes, is widely seen throughout the lungs from patients with COPD, and their numbers increase with increasing severity [1]. Progressing inflammation damages the alveolar attachment [27], and is identified
to be causally correlated with emphysema development and pathologic alterations in the lungs that worsen with disease progression [5]. It has been shown that CS directly or indirectly induces chronic inflammation by releasing inflammatory cytokines such as TNF-α, IL-6 and IL-1β, which has been demonstrated to be significantly increased in COPD animals and patients in numerous studies including ours [17,28,29].
Fig. 7. Effects of NaHS on PHD2 and HIF-1α expressions in vivo and in vitro. (A, B) 12 weeks after CS inhalation, lung tissues were collected. Western blot was used to analyze the protein levels of PHD2 and HIF-1α in the lung tissues. Data are presented as the mean ± SEM, **P < 0.01 compared with Control; ##P < 0.01 compared with CS only. (C, D) A549 cells were cultured with and without 3% CSE and/or 100, 200, or 400 μM NaHS for 48 h. The cell samples were collected to determine the protein levels of PHD2 and HIF-1α by Western blot. Data are presented as the mean ± SEM, *P < 0.05, **P < 0.01 compared with control [3% CSE (-) and NaHS (-)]; #P < 0.05, ##P < 0.01 compared with 3% CSE only. 7
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 8. Effects of NaHS on the CS-activated MAPK signaling in vivo and in vitro. (A) 12 weeks after CS inhalation, lung tissues were collected. Western blot was used to analyze the protein levels of p-ERK, p-JNK, and p-P38 in the lung tissues. Results are representative of different experiments. (B) Scanning densitometry of western blot on different lung samples was analyzed quantitatively. Expression of p-ERK, p-JNK and p-P38 was normalized to ERK, JNK, and P38 levels, respectively. Data are presented as the mean ± SEM, **P < 0.01 compared with Control; #P < 0.05, ##P < 0.01 compared with CS only. (C) Western blot analysis for p-ERK, p-JNK, and p-P38 expression in A549 cells treated with NaHS or vehicle in response to 3% CSE treatment for 0, 5 min, 15 min, 30 min, 60 min, and 120 min. (D–F) Quantified protein levels of the above genes are shown. Data are presented as the mean ± SEM, *P < 0.05. (G) A549 cells were cultured with and without 3% CSE and/or 100, 200, or 400 μM NaHS for 48 h. Western blot was used to analyze the phosphorylation levels of ERK, JNK and p38 MAPK. Results are representative of different experiments. (H-J) Scanning densitometry of western blot on different samples was analyzed quantitatively. Expression of p-ERK, p-JNK and p-P38 was normalized to ERK, JNK, and P38 levels, respectively. Data are presented as the mean ± SEM, **P < 0.01 compared with control [3% CSE (-) and NaHS (-)]; #P < 0.05 compared with 3% CSE only.
Their levels are directly proportional to the post-bronchodilator FEV1 percentage [29]. On the other hand, these inflammatory cytokines released from epithelial cells by CS, in turn, recruit inflammatory cells into the lung and thus further amplifies chronic inflammation.
Therefore, these cytokines were chosen to evaluate the anti-emphysema action of H2S. Consistent with these findings, our result showed that the levels of TNF-α, IL-6 and IL-1β were not only significantly increased in the lungs of CS-exposed mice, but also in the CSE-stimulated alveolar 8
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
Fig. 9. Effects of MAPK inhibitors on ZO-1 expression and inflammation responses in CSE-stimulated A549 cells. A549 cells were cultured with ERK inhibitor (PD98059), JNK inhibitor (SP600125), or P38 inhibitor (SB203580) in the absence and presence of 3% CSE for 48 h. The mRNA levels of TNF-α (A), IL-6 (B), and IL1β (C) in the A549 cells were analyzed by RT-PCR. (D, E) The protein level of ZO-1 was detected using Western blot. Data are presented as the mean ± SEM, ** P < 0.01 compared with control [3% CSE (-), PD98059 (-), SP600125 (-) and SB203580 (-)]; #P < 0.05 compared with 3% CSE only.
epithelial A549 cells. Nevertheless, administration of NaHS to CS-exposed mice or CES-stimulated A549 cells reduced all the productions. These data showed that H2S may exert its anti-inflammatory effect via the inhibition of production of TNF-α, IL-6 and IL-1β. The lung is unique in that alveolar epithelial cells are continually exposed to external environment, and acts as a barrier that protects subepithelial tissues from noxious substance [6]. Tight junctions, or zonula occludens, join neighboring cells together to form this barrier. They function in the maintenance of cell polarity and blocking the movement of transmembrane proteins between the apical and the basolateral cell surfaces. Tight junctions consist of claudin and occludin proteins that join the junctions to the cytoskeleton [30]. Zonula occluden protein ZO1 is required for tight junction formation and function, which links junctional transmembrane proteins such as occludin and claudin to the actin cytoskeleton [31]. The tight junctions and zonula occludens are intracellular junctional structures that mediate adhesion between epithelial cells and are required for epithelial cell function [32]. While in response to chronic smoke exposure, the epithelial cell was badly injured as indicated by decreases in several tight junction and zonula occluden proteins [6,33]. Consistent with these findings, our results showed that the expressions of claudin-1, occludin-1 and ZO-1 are all significantly decreased in the lungs of CS-exposed mice, and treatment with NaHS inhibited the reduced expressions of claudin-1, occludin-1 and ZO-1, implying the protective role of H2S in epithelial injury. This finding was also validated in CSE-stimulated alveolar epithelial A549 cells, which is similar to a previous study that H2S protects the colon from the epithelial damage [34]. The above findings established that H2S ameliorates CS-induced COPD by modulating epithelial cell function. Studies showed that the CS-induced injury might activate mitochondrial intrinsic pathway of apoptosis in COPD lungs [35]. The apoptosis response due to ongoing cellular injury is a critical element in the COPD pathogenesis [36]. Some evidences suggested that alveolar epithelial apoptosis was increased in emphysematous lung tissue, in association with an increase in Bax and activated subunits of caspase 3, and a decrease in the anti-apoptotic protein Bcl-2 [3]. In this study, we
demonstrated that treatment with NaHS significantly inhibited cell apoptosis in CSE-primed alveolar A549 cells, which is in agreement with previous observation on the activity of NaHS in pulmonary artery endothelial cells [12]. Consistently, this finding was also verified in CSinduced COPD mice, as examined by reduced Bax and Cleaved Caspase 3 levels and increased Bcl-2 expression in NaHS-treated mouse lungs. These data indicate that loss of epithelial cell maintenance factors contribute to the specific pathogenesis of emphysema, and H2S exerts its anti-emphysematous activity, partially, by inhibiting alveolar epithelial cell apoptosis. The mechanism by which NaHS represses inflammation and alveolar epithelial cell injury remains obscure. HIF-1α, a critical oxygen sensor that belongs to the basic helix-loop-helix transcription factors, is highly increased in the lungs of COPD and correlates with inflammation and structural changes of the alveolar and bronchial epithelium in the development of COPD [37,38]. For instance, HIF-1α deficient in myeloid cells caused nearly complete suppression of inflammatory response [39]; HIF-1α knock-down also exacerbates the CSE-induced phenotypic shift in lung epithelial cells [38]. Hence, we hypothesized that NaHS can exert its anti-emphysematous effects via inactivation of HIF-1α in our COPD mouse model. As expected, the results showed that the CSinduced upregulation of HIF-1α in the lungs was significantly inhibited by NaHS. This finding was also validated in CSE-primed A549 cells, which is similar to a previous study that GYY4137, another H2S donor, suppressed HIF-1α expression in HepG2 and Bel7402 cells [40]. PHD2, acting as an oxygen sensor, can regulate the stability or degradation of HIF-1α in an oxygen-dependent manner [41]. In normoxia, PHD2 hydroxylates the proline residues of HIF-1α, facilitating hydrogen bonding with the Von Hippel Lindau protein (pVHL) which promotes HIF-1α degradation by the 26S proteasome. Under hypoxia conditions, PHD2 fails to initiate this reaction due to a shortage of O2 and, therefore, HIF1α is stabilized [41,42]. This explains why HIF-1α is increased in COPD, a condition of pathological hypoxia due to airflow limitation and alveolar destruction. We also examined the alteration of PHD2 levels, and found that the CS-induced downregulation of PHD2 in vivo and the CSE-induced downregulation of PHD2 in vitro were both increased by 9
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
NaHS treatment. Additionally, HIF-1α plays an important role in a variety of pathophysiologies, including angiogenesis, apoptosis, epithelial-mesenchymal transition, leading to vascular remodeling, fibrosis, and pulmonary hypertension [43], all of which are comorbidities of COPD [44–46]. Therefore, reduced activation of HIF-1α may be beneficial for protection of NaHS against the development of COPD and its associated comorbidities. HIF-1α protein synthesis can be mediated by a variety of inflammation mediators, through interaction with their cognate receptor tyrosine kinase, resulting in activation of mitogen-activated protein kinases (MAPKs) pathways [42]. It has been reported that exposure to CS caused the activation of MAPKs pathways, including c-Jun, Jun D, ERK and p38 in the primary human lung epithelial cells [47], and MAPK signaling play critical roles in regulating COPD-associated phenotypes, including inflammation and emphysema [48]. We, therefore, focused our further studies on MAPK signaling. Our present study showed that the phosphorylation of ERK, JNK and p38 MAPK was significantly increased in CSE-primed A549 cells, revealing that MAPK signaling were activated in alveolar epithelial cells. However, the increase of phosphorylated ERK, JNK and p38 MAPK was significantly suppressed by NaHS. Coincidentally, this finding was also verified in CS-induced COPD in mice, as measured by decreased levels of phosphorylated ERK, JNK and p38 MAPK in NaHS-treated lungs. Furthermore, treatment with PD98059 (ERK inhibitor), SP 600125 (JNK inhibitor) or SB 203580 (p38 MAPK) inhibitor respectively inhibited CSEinduced upregulation of pro-inflammatory cytokines and downregulation of ZO-1. Taken all together, these results suggested that suppression of MAPK signaling contributed to the suppression effect of NaHS on CS-induced inflammation and alveolar epithelial cell injury. In conclusion, we demonstrated that H2S inhibited CS-induced activation of PHD2/HIF-1α/MAPK signaling and subsequently inhibited inflammation, epithelial cell injury and apoptosis, thereby attenuating CS-induced emphysema and improving pulmonary function in mice.
Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.intimp.2019.105979. References [1] P.J. Barnes, Alveolar macrophages in chronic obstructive pulmonary disease (COPD), Cell Mol. Biol. (Noisy-le-grand) 50 Online Pub (2004) L627-37. [2] W. MacNee, Accelerated lung aging: a novel pathogenic mechanism of chronic obstructive pulmonary disease (COPD), Biochem. Soc. Trans. 37 (Pt 4) (2009) 819–823, https://doi.org/10.1042/BST0370819. [3] K.F. Chung, I.M. Adcock, Multifaceted mechanisms in COPD: inflammation, immunity, and tissue repair and destruction, Eur. Respir. J. 31 (6) (2008) 1334–1356, https://doi.org/10.1183/09031936.00018908. [4] D.P. Singh, G. Kaur, P. Bagam, R. Pinkston, S. Batra, Membrane microdomains regulate NLRP10- and NLRP12-dependent signalling in A549 cells challenged with cigarette smoke extract, Arch. Toxicol. 92 (5) (2018) 1767–1783, https://doi.org/ 10.1007/s00204-018-2185-0. [5] M.J. Kang, G.S. Shadel, A mitochondrial perspective of chronic obstructive pulmonary disease pathogenesis, Tuberc. Respir. Dis. (Seoul) 79 (4) (2016) 207–213, https://doi.org/10.4046/trd.2016.79.4.207. [6] K. Nishida, K.A. Brune, N. Putcha, P. Mandke, W.K. O'Neal, D. Shade, et al., Cigarette smoke disrupts monolayer integrity by altering epithelial cell-cell adhesion and cortical tension, Am. J. Physiol. Lung Cell Mol. Physiol. 313 (3) (2017) L581–L591, https://doi.org/10.1152/ajplung.00074.2017. [7] A.J. Thorley, T.D. Tetley, Pulmonary epithelium, cigarette smoke, and chronic obstructive pulmonary disease, Int. J. Chron. Obstruct. Pulmon Dis. 2 (4) (2007) 409–428. [8] J.C. Hogg, W. Timens, The pathology of chronic obstructive pulmonary disease, Annu. Rev. Pathol. 4 (2009) 435–459, https://doi.org/10.1146/annurev.pathol.4. 110807.092145. [9] X. Zhou, G. An, J. Chen, Hydrogen sulfide improves left ventricular function in smoking rats via regulation of apoptosis and autophagy, Apoptosis 19 (6) (2014) 998–1005, https://doi.org/10.1007/s10495-014-0978-z. [10] L. Miao, X. Shen, M. Whiteman, H. Xin, Y. Shen, X. Xin, et al., Hydrogen sulfide mitigates myocardial infarction via promotion of mitochondrial biogenesis-dependent M2 polarization of macrophages, Antioxid Redox Signal 25 (5) (2016) 268–281, https://doi.org/10.1089/ars.2015.6577. [11] Y. Sun, K. Wang, M.X. Li, W. He, J.R. Chang, C.C. Liao, et al., Metabolic changes of H2S in smokers and patients of COPD which might involve in inflammation, oxidative stress and steroid sensitivity, Sci. Rep. 5 (2015) 14971, https://doi.org/10. 1038/srep14971. [12] W. Han, Z. Dong, C. Dimitropoulou, Y. Su, Hydrogen sulfide ameliorates tobacco smoke-induced oxidative stress and emphysema in mice, Antioxid Redox Signal. 15 (8) (2011) 2121–2134, https://doi.org/10.1089/ars.2010.3821. [13] S.S. Wang, Y.H. Chen, N. Chen, L.J. Wang, D.X. Chen, H.L. Weng, et al., Hydrogen sulfide promotes autophagy of hepatocellular carcinoma cells through the PI3K/ Akt/mTOR signaling pathway, e2688, Cell Death Dis. 8 (3) (2017), https://doi.org/ 10.1038/cddis.2017.18. [14] R. Xue, D.D. Hao, J.P. Sun, W.W. Li, M.M. Zhao, X.H. Li, et al., Hydrogen sulfide treatment promotes glucose uptake by increasing insulin receptor sensitivity and ameliorates kidney lesions in type 2 diabetes, Antioxid Redox Signal. 19 (1) (2013) 5–23, https://doi.org/10.1089/ars.2012.5024. [15] F. Lin, C. Liao, Y. Sun, J. Zhang, W. Lu, Y. Bai, et al., Hydrogen sulfide inhibits cigarette smoke-induced endoplasmic reticulum stress and apoptosis in bronchial epithelial cells, Front. Pharmacol. 8 (2017) 675, https://doi.org/10.3389/fphar. 2017.00675. [16] Z. Zhang, J. Wang, G. Xu, M. Ding, F. Liu, L. Yuan, et al., Inhalation of sodium hydrosulfide (NaHS) alleviates NO2-induced pulmonary function and hematological impairment in rats, 116650, Life Sci. 1 (2019), https://doi.org/10.1016/j.lfs. 2019.116650. [17] X. Liang, J. Wang, R. Guan, L. Zhao, D. Li, Z. Long, et al., Limax extract ameliorates cigarette smoke-induced chronic obstructive pulmonary disease in mice, Int, Immunopharmacol. 54 (2018) 210–220, https://doi.org/10.1016/j.intimp.2017. 11.004. [18] R. Guan, X. Wang, X. Zhao, N. Song, J. Zhu, J. Wang, et al., Emodin ameliorates bleomycin-induced pulmonary fibrosis in rats by suppressing epithelial-mesenchymal transition and fibroblast activation, Sci. Rep. 6 (2016) 35696, https://doi.org/ 10.1038/srep35696. [19] F.F. Li, J. Shen, H.J. Shen, X. Zhang, R. Cao, Y. Zhang, et al., Shp2 plays an important role in acute cigarette smoke-mediated lung inflammation, J. Immunol. 189 (6) (2012) 3159–3167, https://doi.org/10.4049/jimmunol.1200197. [20] R. Guan, X. Zhao, X. Wang, N. Song, Y. Guo, X. Yan, et al., Emodin alleviates bleomycin-induced pulmonary fibrosis in rats, Toxicol. Lett. 262 (2016) 161–172, https://doi.org/10.1016/j.toxlet.2016.10.004. [21] N. Yokohori, K. Aoshiba, A. Nagai, Increased levels of cell death and proliferation in alveolar wall cells in patients with pulmonary emphysema, Chest 125 (2) (2004) 626–632. [22] P.M. Calverley, J.A. Anderson, B. Celli, G.T. Ferguson, C. Jenkins, P.W. Jones, et al., Salmeterol and fluticasone propionate and survival in chronic obstructive pulmonary disease, N Engl. J. Med. 356 (8) (2007) 775–789, https://doi.org/10.1056/ NEJMoa063070. [23] N. Bazhanov, M. Ansar, T. Ivanciuc, R.P. Garofalo, A. Casola, Hydrogen sulfide: a
Acknowledgements This work was supported by grants from the National Key R&D Program of China (2016YFC0903700), the 973 Key Scheme of China (2015CB553406), the National Natural Science Foundation of China (81520108001, 81770043, 81800072, 81560013 and 81220108001), China Postdoctoral Science Foundation (2017M612637, 2018T110860), Guangzhou Science and Technology Programs for Science Study (201607020030 and 201804010052), Guangdong Province Universities and Colleges Key Grant for Innovative Research (cxzd1142), Guangzhou Department of Education (1201620007, 13C08, 12A001S, and 1201630095), Project of State Key Laboratory of Respiratory Disease (SKLRD-QN-201706, SKLRD-QN-201917 and SKLRD-OP-201808), the Local Innovative and Research Teams Project of Guangdong Pearl River Talents Program (2017BT01S155), the Major Science and Technology Projects of Inner Mongolia Autonomous Region and Guangdong Province Universities and Colleges Pearl River Scholar Funded Scheme (2014, for WL). Author contributions WL, HY, RG and JW conceived the project and designed experiments. RG wrote the manuscript. JW, DL, HY, DS and ZL edited the manuscript. RG, DL, ZL, HL, QY, MD, ZhL, WL and CZ performed the experiments. RG, ZL, and XL conducted data analysis. All authors have read and approved the final manuscript. Declaration of Competing Interest The authors have declared that there is no conflict of interest. 10
International Immunopharmacology xxx (xxxx) xxxx
R. Guan, et al.
[24] [25]
[26] [27] [28] [29]
[30] [31] [32] [33]
[34] [35] [36]
novel player in airway development, pathophysiology of respiratory diseases, and antiviral defenses, Am. J. Respir Cell Mol. Biol. 57 (4) (2017) 403–410, https://doi. org/10.1165/rcmb.2017-0114TR. J.C. Hogg, F. Chu, S. Utokaparch, R. Woods, W.M. Elliott, L. Buzatu, et al., The nature of small-airway obstruction in chronic obstructive pulmonary disease, N Engl. J. Med. 250 (26) (2004) 2645–2653 doi:10.1056/NEJMoa032158. D. Xu, H. Jin, J. Wen, J. Chen, D. Chen, N. Cai, et al., Hydrogen sulfide protects against endoplasmic reticulum stress and mitochondrial injury in nucleus pulposus cells and ameliorates intervertebral disc degeneration, Pharmacol. Res. 117 (2017) 357–369, https://doi.org/10.1016/j.phrs.2017.01.005. S.H. Lee, S. Goswami, A. Grudo, L.Z. Song, V. Bandi, S. Goodnight-White, et al., Antielastin autoimmunity in tobacco smoking-induced emphysema, Nat. Med. 13 (5) (2007) 567–569, https://doi.org/10.1038/nm1583. M. Szilasi, T. Dolinay, Z. Nemes, J. Strausz, Pathology of chronic obstructive pulmonary disease, Pathol. Oncol. Res. 12 (1) (2006) 52–60 https://doi.org/ PAOR.2006.12.1.0052. K. Xu, X. Li, Risk factors for depression in patients with chronic obstructive pulmonary disease, Med. Sci. Monit. 24 (2018) 1417–1423. S. Singh, S.K. Verma, S. Kumar, M.K. Ahmad, A. Nischal, S.K. Singh, et al., Correlation of severity of chronic obstructive pulmonary disease with potential biomarkers, Immunol. Lett. 196 (2018) 1–10, https://doi.org/10.1016/j.imlet. 2018.01.004. G. Moreno-Bueno, F. Portillo, A. Cano, Transcriptional regulation of cell polarity in EMT and cancer, Oncogene 27 (55) (2008) 6958–6969, https://doi.org/10.1038/ onc.2008.346. P. Polakis, The oncogenic activation of beta-catenin, Curr. Opin Genet Dev. 9 (1) (1999) 15–21. K. Shin, V.C. Fogg, B. Margolis, Tight junctions and cell polarity, Annu. Rev. Cell Dev. Biol. 22 (2006) 207–235, https://doi.org/10.1146/annurev.cellbio.22. 010305.104219. H. Bai, Q. Zhu, A. Surcel, T. Luo, Y. Ren, B. Guan, et al., Yes-associated protein impacts adherens junction assembly through regulating actin cytoskeleton organization, Am. J. Physiol. Gastrointest. Liver Physiol. 311 (3) (2016) G396–G411, https://doi.org/10.1152/ajpgi.00027.2016. B. Li, C. Lee, Z. Martin, X. Li, Y. Koike, A. Hock, et al., Intestinal epithelial injury induced by maternal separation is protected by hydrogen sulfide, J. Pediatr. Surg. 52 (1) (2017) 40–44, https://doi.org/10.1016/j.jpedsurg.2016.10.013. K. Imai, B.A. Mercer, L.L. Schulman, J.R. Sonett, J.M. D'Armiento, Correlation of lung surface area to apoptosis and proliferation in human emphysema, Eur. Respir. J. 25 (2) (2005) 250–258, https://doi.org/10.1183/09031936.05.00023704. R.M. Tuder, T. Yoshida, W. Arap, R. Pasqualini, Petrache I. State of the art. Cellular and molecular mechanisms of alveolar destruction in emphysema: an evolutionary perspective, Proc. Am. Thorac. Soc. 6 (3) (2006) 503–510, https://doi.org/10. 1513/pats.200603-054MS.
[37] R. Guan, J. Wang, Z. Li, M. Ding, D. Li, G. Xu, et al., Sodium Tanshinone IIA Sulfonate Decreases Cigarette Smoke-Induced Inflammation and Oxidative Stress via Blocking the Activation of MAPK/HIF-1alpha Signaling Pathway, Front. Pharmacol. 9 (2018) 263, https://doi.org/10.3389/fphar.2018.00263. [38] I.M. Eurlings, N.L. Reynaert, T. van den Beucken, H.R. Gosker, C.C. de Theije, F.M. Verhamme, et al., Cigarette smoke extract induces a phenotypic shift in epithelial cells; involvement of HIF1alpha in mesenchymal transition, e107757, Plos One 9 (10) (2014), https://doi.org/10.1371/journal.pone.0107757. [39] T. Cramer, Y. Yamanishi, B.E. Clausen, I. Forster, R. Pawlinski, N. Mackman, et al., HIF-1alpha is essential for myeloid cell-mediated inflammation, Cell 112 (5) (2003) 645–657. [40] S. Lu, Y. Gao, X. Huang, X. Wang, GYY4137, a hydrogen sulfide (H(2)S) donor, shows potent anti-hepatocellular carcinoma activity through blocking the STAT3 pathway, Int. J. Oncol. 44 (4) (2014) 1259–1267, https://doi.org/10.3892/ijo. 2014.2305. [41] C. Yang, Y. Xu, H. Zhou, L. Yang, S. Yu, Y. Gao, et al., Tetramethylpyrazine protects CoCl2-induced apoptosis in human umbilical vein endothelial cells by regulating the PHD2/HIF/1alpha-VEGF pathway, Mol. Med. Rep. 13 (2) (2016) 1287–1296, https://doi.org/10.3892/mmr.2015.4679. [42] N. Olson, A. van der Vliet, Interactions between nitric oxide and hypoxia-inducible factor signaling pathways in inflammatory disease, Nitric Oxide 25 (2) (2011) 125–137, https://doi.org/10.1016/j.niox.2010.12.010. [43] L.A. Shimoda, G.L. Semenza, HIF and the lung: role of hypoxia-inducible factors in pulmonary development and disease, Am. J. Respir. Crit. Care Med. 183 (2) (2011) 152–156, https://doi.org/10.1164/rccm.201009-1393PP. [44] W. Chen, J. Thomas, M. Sadatsafavi, J.M. FitzGerald, Risk of cardiovascular comorbidity in patients with chronic obstructive pulmonary disease: a systematic review and meta-analysis, Lancet Respir. Med. 3 (8) (2015) 631–639, https://doi. org/10.1016/S2213-2600(15)00241-6. [45] P. Sakornsakolpat, D. Prokopenko, M. Lamontagne, N.F. Reeve, A.L. Guyatt, V.E. Jackson, et al., Genetic landscape of chronic obstructive pulmonary disease identifies heterogeneous cell-type and phenotype associations, Nat. Genet. 51 (3) (2019) 494–505, https://doi.org/10.1038/s41588-018-0342-2. [46] P.J. Barnes, Small airway fibrosis in COPD, Int. J. Biochem. Cell Biol. 116 (2019) 105598, , https://doi.org/10.1016/j.biocel.2019.105598. [47] H. Maunders, S. Patwardhan, J. Phillips, A. Clack, A. Richter, Human bronchial epithelial cell transcriptome: gene expression changes following acute exposure to whole cigarette smoke in vitro, Am. J. Physiol. Lung Cell Mol. Physiol. 292 (5) (2007) L1248–L1256, https://doi.org/10.1152/ajplung.00290.2006. [48] X. Zhou, D. Gu, G. Hou, Erythromycin attenuates metalloprotease/anti-metalloprotease imbalance in cigarette smoke-induced emphysema in rats via the mitogenactivated protein kinase/nuclear factor-kappaB activation pathway, Mol. Med. Rep. 15 (5) (2017) 2983–2990, https://doi.org/10.3892/mmr.2017.6416.
11