- Email: [email protected]
Hydrolysis of the neonicotinoid insecticide thiacloprid by the N2-fixing bacterium Ensifer meliloti CGMCC 7333
International Biodeterioration & Biodegradation 93 (2014) 10e17
Contents lists available at ScienceDirect
International Biodeterioration & Biodegradation journal homepage: www.elsevier.com/locate/ibiod
Hydrolysis of the neonicotinoid insecticide thiacloprid by the N2-fixing bacterium Ensifer meliloti CGMCC 7333 Feng Ge, Ling-Yan Zhou, Ying Wang, Yuan Ma, Shan Zhai, Zhong-Hua Liu, Yi-Jun Dai*, Sheng Yuan Jiangsu Key Laboratory for Microbes and Functional Genomics, Jiangsu Engineering and Technology Research Center for Industrialization of Microbial Resources, College of Life Science, Nanjing Normal University, Nanjing 210023, People’s Republic of China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 November 2013 Received in revised form 15 April 2014 Accepted 5 May 2014 Available online
A thiacloprid (THI)-degrading bacterium CGMCC 7333 was isolated from soil and identified as the N2fixing bacterium Ensifer meliloti. The major metabolite was identified as THI amide derived from the cyano moiety by hydrolysis of THI, using liquid chromatography-mass spectrometry and nuclear magnetic resonance analysis. En. meliloti CGMCC 7333 degraded 86.8% of 200 mg/L THI in 60 h with a half-life of 20.9 h and 90.9% of the reduced THI was converted to THI amide. CGMCC 7333 can convert THI to THI amide in the soil. Hydrolysis of THI by En. meliloti CGMCC 7333 is mediated by a nitrile hydratase (NHase) and the NHase gene cluster codes a cobalt-type NHase composed of an a-subunit, b-subunit, and accessory protein with lengths of 213, 219, and 128 amino acids, respectively. Whole cells of Escherichia coli Rosetta overexpressing NHase degraded 80.7% of THI (0.63 mmol/L) in 10 min and formed 0.58 mmol/L of THI amide, and the half-life of THI degradation was 5.2 min. The purified NHase degraded 80.6% of THI (0.70 mmol/L) and formed 0.60 mmol/L of THI amide in 5 min with a molar conversion rate of 85.7%, and the half-life of THI degradation was 6.9 min. Ó 2014 Elsevier Ltd. All rights reserved.
Keywords: Biodegradation Ensifer meliloti Nitrile hydratase Thiacloprid Thiacloprid amide
1. Introduction Neonicotinoids are a class of N-heterocyclic insecticides that function primarily as systemic compounds that are absorbed and translocated by plants to control sucking insect pests. These compounds are the newest class of synthetic insecticides produced during the past two decades and the biggest selling insecticide class worldwide (Jeschke et al., 2011). Thiacloprid (THI), (Z)-[3-[(6chloro-3-pyridinyl)methyl]-2-thiazolidinylidene]cyanamide, was developed by Bayer Cropscience in 2000 to control a variety of sucking and chewing insects, primarily aphids and whiteflies. THI has a favorable environmental profile with good margins of safety for birds, fish species, and many beneficial arthropods. Its safety profile for bees also allows its application during the blossoming period of bee-attracting crops (Jeschke et al., 2011). The metabolism of THI in plants and mammals shows that it is converted to the 4-hydroxy, olefin, and sulfoxide metabolites and, in addition, the cleavage or hydrolysis of the cyanoguanidine moiety gives the descyano or N-carbamoylimine derivatives,
* Corresponding author. Tel.: þ86 25 85891731; fax: þ86 25 85891067. E-mail address: [email protected] (Y.-J. Dai). http://dx.doi.org/10.1016/j.ibiod.2014.05.001 0964-8305/Ó 2014 Elsevier Ltd. All rights reserved.
respectively (Casida, 2011). Investigation of the metabolism of THI in the soil revealed that it is mainly hydrolyzed to the N-carbamoylimine derivative, (Z)-[3-[(6-chloro-3-pyridinyl)methyl]-2thiazolidinylidene]urea (THI amide), with about 70% of THI converted to THI amide (Krohn, 2001). Microbial metabolism of THI in pure culture indicated that the bacterium Stenotrophomonas maltophilia CGMCC 1.1788 is able to degrade THI via hydroxylation in the thiazolidine ring to form the metabolite 4-hydroxy THI (Zhao et al., 2009); the yeast Rhodotorula mucilaginosa strain IM-2 and the bacterium Variovorax boronicumulans strain CGMCC 4969 degrade THI to the THI amide with a molar conversion rate of 69% and 98%, respectively (Dai et al., 2010; Zhang et al., 2012). The soil and microbial metabolism of THI to THI amide with a high molar conversion rate implies that the hydrolysis of THI to produce THI amide is the major pathway of degradation of THI in the soil, and this biotransformation is mainly caused by soil microbes (Liu et al., 2011). Therefore, investigation of the mechanism of microbial hydrolysis of THI to the amide metabolite will help to enhance our understanding of the environmental fate of the cyano groupcontaining neonicotinoid insecticide THI. The nitrile (cyano)-converting bacteria are currently applied to the industrial production of amide compounds, such as the transformation of acrylnitrile to acrylamide and 3-cyanopyridine to
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
nicotinamide by the three generations of bacteria Rhodococcus sp. N-774, Pseudomonas chlororaphis B23, and Rhodococcus rhodochrous J1 (Banerjee et al., 2002). The corresponding nitrile-converting enzymes, nitrile hydratases (NHase, EC 4.2.1.84), have also been extensively explored and are well understood (Nagasawa et al., 1993; Cameron et al., 2005). In pesticide chemistry, the cyano group embedded in the pesticide molecular structure can enhance its toxic effects on the central nervous system of pest insects and, therefore, many cyano group-containing pesticides have been developed and are widely used in modern agriculture (Lopez et al., 2005). The biodegradations of some cyano moiety-containing pesticides have been studied (Feng et al., 2007; Nielsen et al., 2007); however their corresponding enzymatic mechanisms have rarely been elucidated (Zhang et al., 2012). In a previous study, an NHase coding gene from V. boronicumulans CGMCC 4969 was cloned and expressed in Escherichia coli BL21 (DE3). Whole cells of Es. coli BL21 overexpressing NHase could transform THI to the major metabolite THI amide. The above results first proved that NHase is responsible for the degradation of cyano group-containing neonicotinoid pesticides (Zhang et al., 2012). To further study the enzymatic mechanism of hydrolysis of cyano group-containing pesticides, we continued to isolate THI-degrading bacteria and explore its degradation mechanism. In the present study, a THIhydrolyzing bacterium with a more rapid THI degradation rate than V. boronicumulans CGMCC 4969 was isolated, and the kinetics of THI degradation, the metabolite formed and its THI degradation in soil by the isolate were studied in detail. Furthermore, the NHase gene cluster was cloned and expressed in Es. coli Rosetta and the corresponding NHase of the present isolate was bioinformatically compared with that from V. boronicumulans CGMCC 4969. The present study will help to elucidate the mechanism of enzymatic THI degradation. 2. Materials and methods 2.1. Chemicals THI was provided by Professor Jueping Ni of the Jiangsu Pesticide Research Institute, Nanjing, China (>98% purity). Methanol and acetonitrile for HPLC analysis were HPLC grade and were purchased from Merck KGaA (Darmstadt, Germany). All other reagents were of analytical grade and purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). 2.2. Media The enrichment medium was mineral salt (MS) broth (pH 7.5) of the following composition: 10.0 g glucose, 1.36 g KH2PO4, 2.13 g Na2HPO4 and 0.50 g MgSO4$7H2O in 1.0 L deionized water. The LuriaeBertani (LB) medium (pH 7.2) contained 10.0 g peptone, 5.0 g yeast extract, and 10.0 g NaCl in 1.0 L deionized water and was used for the isolation and purification of bacteria. Nitrogen-free base (NFb) medium (pH 7.0) was used to examine the nitrogen-fixing ability of the isolated microorganisms and contained 1.20 g KH2PO4, 0.80 g K2HPO4, 5.0 g glucose, 0.20 g MgSO4$7H2O, 0.20 g NaCl, 0.02 g CaCl2$2H2O, 0.002 g FeSO4$7H2O, and 2.0 mL solution of inorganic salts in 1.0 L deionized water. 2.3. Isolation and identification of microbes from soil samples Rhizosphere soils from around leguminous plants were collected for microbe isolation from Cangzhou in Hebai Province and Suzhou and Nanjing in Jiangsu Province, China. The method for the sampling of rhizosphere soil was referenced by Barillot et al. (2013). Each soil sample (2.0 g) was added to a 100-mL flask
11
containing 18 mL sterilized MS broth, and then 5 mL of the mixture was inoculated into a 500-mL flask containing 200 mL MS broth with 200 mg/L of THI. The culture was incubated at 30 C on a rotary shaker at 220 rpm. The culture broth was sampled every week and the residual THI was determined by HPLC analysis. Samples with the ability to degrade THI were diluted and spread on LB plates to isolate and purify the microbes. The 16S rRNA gene was amplified by colony polymerase chain reaction (PCR) and sequenced by Sangon Biotech Co., Ltd. (Shanghai, China) (Zhang et al., 2012). The accession number of the 16S rRNA gene of the THI degrading bacterium named as SCL3-10 in the Genbank database is KF304576. 2.4. N2-fixation test The identified isolates were inoculated onto plates containing NFb agar to examine their N2-fixing ability. The plates were incubated at 28 C for 7e14 d, and bacterial growth was observed as qualitative evidence of atmospheric nitrogen fixation (Sgroy et al., 2009). Ensifer adhaerens CGMCC 6315 and Es. coli K12 DH10B were used as positive and negative controls, respectively (Zhou et al., 2013). 2.5. Biodegradation of THI by resting cells and preparation of metabolites To evaluate the ability of resting cells to biotransform THI, bacteria were pre-cultivated in LB broth with 0.1 mmol/L CoCl2 in an incubator shaker for 24 h and then harvested by centrifugation at 6000 g for 5 min. Next, the cell sediments obtained were washed with 0.2 mol/L sodium phosphate buffer (pH 7.5) and then resuspended in 10 mL of the same buffer with 200 mg/L THI added. These cell suspensions were used for resting cell transformations of THI. Meanwhile, the above resting cells transformation broth excluding substrate THI or cells was used as a control. The transformations were conducted under the above cultivation conditions for the indicated times. The samples were centrifuged at 10,000 g for 10 min to remove the residual cells and the supernatant was collected, filtered, and diluted to a volume appropriate for analysis of the substrates and metabolites by HPLC. To prepare the metabolite, the biotransformation by the isolate was conducted in a 5-L fermenter (Auzone Bio-equipment, Shanghai, China). A single colony of the isolate was inoculated to a 1-L flask containing 300 mL of LB broth and cultivated in a rotary shaker at 220 rpm and 30 C for 24 h. Then, the culture broth was poured into the fermenter containing 3.0 L LB broth for cultivation. During cultivation, the fermenter was constantly aerated with filtered sterile air at a flow rate of 3 L/min and stirred at 300 rpm and 30 C. After cultivation for 16 h, the cells were harvested from the fermentation broth at 6000 g for 20 min and suspended in 3.0 L of the above phosphate buffer with 0.60 g THI in the fermenter for transformation. Following transformation for 60 h, the cell residues were removed by centrifugation of the mixture at 6000 g for 20 min. The supernatant was extracted twice with equal volumes of ethyl acetate. The organic fraction was dehydrated with anhydrous sodium sulfate, after which the organic phase was filtered using an organic membrane (0.22-mm pore size) and then concentrated. The product crystals were washed with acetonitrile to eliminate the remaining THI until a purity of greater than 98% was observed upon HPLC analysis, after which the purified metabolite was dried under vacuum. 2.6. Biodegradation of THI in the soil by the isolate The physicochemical properties of the test soil were pH 6.6, 4.5 g/kg organic matter, 14.4% clay, 81.9% sand, and 3.7% silt by
12
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
mass. For soil biodegradation experiments, 10.0 g sterilized dry soil samples were spread uniformly in 10-cm diameter Petri dishes. 200 mg/L of THI stock solution sterilized by filtration was added to a final THI concentration of 20 mg/kg soil. Bacteria pre-cultured in LB broth for 16 h were collected and re-suspended in 20 mmol/L sterilized phosphate buffer (pH 7.0), and then 1 mL of the suspension was inoculated into the soil samples at 109 bacterial colony-forming units/g soil. An additional 1 mL of sterilized, deionized water was added to each Petri dish. The dishes were incubated in an incubator at 28 C in darkness and 80% humidity. To examine the THI degradation, each soil sample was transferred to a 100-mL flask and 15 mL acetonitrile were added. The Erlenmeyer flask was sealed and placed in a rotary shaker at 220 rpm and equilibrated for 2 h. The extract was centrifuged at 10,000 g for 15 min and filtered prior to quantification by HPLC analysis. 2.7. HPLC, liquid chromatography-mass spectrometry (LC-MS), and nuclear magnetic resonance (NMR) analyses An Agilent 1200 HPLC system equipped with an HC-C18 column (4.6 250 mm, 5 mm particle size, Agilent Technologies, Santa Clara, CA) was employed for analysis of THI and its metabolite. Elution was conducted at a flow rate of 1 mL/min in a mobile phase that contained water and acetonitrile as well as 0.01% acetic acid (water: acetonitrile, 65:35). The signal was monitored at a wavelength of 242 nm using an Agilent G1314A UV detector. LC-MS was conducted using an Agilent LC-MS system equipped with an electrospray ion source that was operated in the positive ion mode. 13C and 1H NMR spectra of the metabolite were obtained in DMSO-d6 using a Bruker AV-400 spectrometer (Switzerland) operating at 100 and 400 MHz, respectively. Chemical shifts were referenced against internal tetramethylsilane. NMR techniques, heteronuclear multiple bond correlation (HMBC) and heteronuclear single-quantum correlation spectroscopy (HSQC), were used to assign proton and carbon atom chemical shifts (d). 2.8. Cloning the NHase gene from the strain SCL3-10, insertion of recombinant NHase genes into pET28a plasmid The total genomic DNA from the isolate was extracted using a MiniBEST bacterial genomic DNA extraction Kit (TaKaRa, Dalian, China). The primers (Table 1) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The PCR conditions were as reported in our previous studies (Zhang et al., 2012). The PCR product was cloned into the pMD18-T vector (TaKaRa, code: D101A) and sequenced. The primers NHCOII-f and NHCOII-r, designed by alignment of the nucleotides of NHase genes from the genus Ensifer in the Genbank database, were used for cloning the NHase a-subunit gene. Then Table 1 PCR primers used in this study. Primer
Sequence (50 e30 )
Restriction site
NHCoII-f NHCoII-r NHCoIII-f NHCoIII-r NHCOIV-f NHCOIV-r NHCOV-f NHCOV-r NHCOVI-f NHCOVI-r
CCATCACCACGACAACCACC CCCAGGGATAGCAGGAGCA ACGCTGTGCTCCTGCTATCC GCCATTGCGGGTTCTCG CTGTAGAGGAGCCAGGAATG CCAGGGATAGCAGGAGCA GAGACCCCGCAATGG TGCTTCAACGCAGAG GCTAGCATGTCCGAGC ATCATCATGGGC AAGCTTACGCAGA GGATCATTCGCGAG
NheI HindIII
All primers were purchased form Sangon Bio Co., Ltd (Shanghai, China). Restriction sites are in underling.
the new primers NHCOIII-f and NHCOIII-r were used for cloning the genes downstream of the NHase a-subunit and upstream of the bsubunit. The primers NHCOIV-f and NHCOIV-r were designed for cloning the gene upstream of the a-subunit. The primers NHCOV-f and NHCOV-r were designed for cloning the gene downstream of the b-subunit and the full length NHase activator gene. The nucleotide sequence analysis and multiple sequence alignments were performed by the software DNAMAN version 6.0 (Lynnon Biosoft, Quebec, Canada) and the BLAST program in the GenBank database. The strategy for cloning the NHase coding gene from En. meliloti CGMCC 7333 is shown in Fig. 1. To construct the expression plasmid vector, primers NHCOVI-f and NHCOVI-r with the NheI restriction enzyme site and the HindIII restriction enzyme site, respectively, were used for amplification of the NHase gene cluster involving the a- and b-subunits and activator genes (Fig. 1), and PrimeSTAR HS DNA Polymerase (Takara Code: DR010A) was used for PCR amplification. Appropriately amplified DNA fragments, excised by restriction digestion with NheI/HindIII restriction enzymes, were cloned between the same restriction sites of the appropriate expression vector pET28a. Ligations were performed according to the manufacturer’s (TaKaRa) protocols. 2.9. Expression and purification of recombinant NHase in Es. coli Rosetta (DE3) Preparation of Es. coli Rosetta (DE3) competent cells and calcium chloride transformation were conducted according to the method of Yang et al. (2010). Overexpression of the recombinant NHase in Es. coli Rostta (DE3) and purification of the NHase by His-tag affinity chromatography followed the method described by Rzeznicka et al. (2010). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out according to the method of Yang et al. (2010). A standard molecular weight protein mixture was used as the reference. Gels were stained for protein detection with Coomassie Brilliant Blue. To analyze enzyme solubility, the cell pellets were resuspended in 0.2 culture volumes of 0.2 mol/L phosphate buffer and disrupted by sonication (10 s) for 3 min at 4 C. A total protein sample was collected from the cell suspension after sonication, and a soluble protein sample was collected from the supernatant after the insoluble debris were pelleted by centrifugation at 12,000 g for 20 min. NHase activity was determined using HPLC analysis and one unit (U) of NHase activity was defined as the amount of enzyme that catalyzed the formation of 1 mmol of THI amide in 1 min. 2.10. Half-life of THI degradation Half-life values for THI degradation were determined by plotting ln (I/Io) against time using the equation ln (I/Io) ¼ kt, where Io and I represent the initial and residual concentrations. The half-life was calculated as follows:
Fig. 1. Strategy for cloning and expression of the NHase coding gene from En. meliloti CGMCC 7333.
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
t1=2 ¼ ðln 2Þ=k; where t1/2 is the half-life and k is the apparent elimination constant. In all cases, the first order equation provided a satisfactory fit for the data (r > 0.9), providing the basis for the half-life calculation (Zhang et al., 2012). 3. Results 3.1. Isolation and identification of THI-degrading microbes Among the MS broths that had been inoculated with different soil extracts, the sample inoculated with the soil extract from Cangzhou, Hebei Province, demonstrated the highest THIdegrading capacity by HPLC analysis. A total of 80 pure isolates were isolated in LB agar and tested for THI-degrading ability. Among them, 4 strains were able to degrade THI and the strain SCL3-10 displayed the highest THI degradation. Nucleotide BLAST (BLASTn) analysis and phylogenic tree analysis of the 16S rRNA gene sequences indicated that SCL3-10 was clustered with En. meliloti strain LMTR32 (AY196963) (Fig. 2). En. meliloti SCL3-10 was deposited in the China General Microbiological Culture Collection Center (CGMCC) (Beijing, China) under the accession number CGMCC 7333. En. meliloti (formerly Sinorhizobium meliloti) is a bacterium with a unique N2-fixing root-nodule symbiosis (Kuiper et al., 2004) and therefore its N2-fixing ability was confirmed in a standard NFb agar plate. Cells of En. meliloti CGMCC 7333 and the positive control En. adhaerens CGMCC 6315 grew on NFb agar, whereas those of the negative control Es. coli DH10B did not. These results confirmed that En. meliloti CGMCC 7333 is an atmospheric N2-fixing bacterium.
13
THI amide. LC-MS analysis (Fig. 3A) indicated that the metabolite displayed a protonated ion (M) at m/z 270 and a sodiated adduct (MeH þ Na) at m/z 292, a fragment ion (MeNH2CO) at m/z 227, and an unknown fragment ion at m/z 253. The mass of the metabolite was enhanced by the addition of a water molecule when compared to the substrate THI (M) at m/z 252. There are 11 protons in the 1H NMR spectrum of the THI metabolite, which is 2 protons more than in the substrate THI. The two new protons (d 6.30 and 6.54) have no correlation with the carbon atoms according to HMBC and HSQC analysis. Therefore, they are assigned as protons of the amide moiety. There are 10 carbon atoms in the 13C NMR spectrum, which is the same number as in the spectrum of the parent THI, but the chemical shift of the carbon atom of the cyano group was not observed and a new chemical shift (d 163.6) appeared in the metabolite, which is assigned as the carbon atom of the amide moiety. Based on mass and NMR analysis, the metabolite produced in the biotransformation of THI by En. meliloti CGMCC 7333 is identified as THI amide.
3.2. Identification of the metabolite formed by biotransformation of THI by En. meliloti CGMCC 7333 Biotransformation of THI by resting cells of En. meliloti CGMCC 7333 resulted in the formation of a polar metabolite with an HPLC retention time of 4.95 min, and no comparable peak was observed upon analysis of the controls excluding the cells (Fig. 3B) or the substrate THI (Fig. 3C) or both the cells and substrate THI (Fig. 3D). The polar metabolite has the same retention time as the standard
Fig. 2. Neighbor-joining phylogenetic tree of strain SCL3-10, other members of the genus Ensifer, and representatives of some other taxa based on 16S rRNA gene sequence comparisons. Bootstrap percentages from 1000 replicates are shown at nodes. The sequence of Rhizobium leguminosarum was used as the outgroup. Bar, 0.5% sequence divergence.
Fig. 3. HPLC of the biotransformation of THI by resting cells of En. meliloti CGMCC 7333 and the LC-MS spectrum of the metabolite. A, transformation broth with inoculation of bacterium and additional THI at amount of 0.79 mmol/L; B, transformation broth without bacterium inoculation; C, transformation broth without additional THI; D, transformation broth without bacterium inoculation and additional THI. The cell density at wavelength of 600 nm was 5. The sample for HPLC was diluted 5 times.
14
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
3.3. THI biodegradation by En. meliloti CGMCC 7333 in the pure culture broth and the soil
Table 2 Degradation of THI by En. meliloti CGMCC 7333 in soil. Time (d)
Time-course analysis of the hydration of THI by the resting cells of En. meliloti CGMCC 7333 (Fig. 4) indicated that the quantity of THI declined from 0.76 mmol/L to 0.10 mmol/L in 60 h. The degradation ratio and half-life were calculated as 86.8% and 20.9 h, respectively. The quantity of THI amide had increased by 0.60 mmol/L, which was equivalent to a mole transformation ratio of 90.9%. As shown in Table 2, in soil inoculated with En. meliloti CGMCC 7333 and incubated for 9 d, THI was reduced from the initial 19.01 mg/kg soil to 16.03 mg/kg soil and the degradation rate was 15.7%. In control soil lacking bacterial inoculation, THI was slightly degraded. In experimental soil with inoculation of the bacteria, 2.41 mg/kg soil of metabolite THI amide were formed, while only 0.36 mg THI amide/kg soil was formed in control soil. These results showed that inoculation of En. meliloti CGMCC 7333 into the soil accelerated THI degradation and THI amide formation. 3.4. Cloning the NHase gene cluster from En. meliloti CGMCC 7333 and bioinformatical analysis of the putative proteins By using the four pairs of primers NHCOII, NHCOIII, NHCOIV, and NHCOV, DNA fragments of lengths 329 bp, 851 bp, 382 bp, and 496 bp were cloned and then assembled to form a DNA fragment of 1762 bp (Fig. 1). This 1762-bp DNA consists of a full NHase gene cluster with length of 1671 bp. The NHase gene cluster is composed of an a-subunit gene of 642 bp and a b-subunit gene of 660 bp and an accessory protein gene of 387 bp. The accession numbers of the NHase a-, b-subunit, and accessory protein coding genes from En. meliloti CGMCC 7333 are KF601242, KF601243, and KF601244, respectively, in the Genbank database. The a and b-subunit genes have a 4-bp overlapping sequence of “ATGA”, and the b-subunit and accessory protein genes have a 14-bp overlapping sequence of “TTGAACCCGCATAG”. The putative a-subunit (213 amino acids) (AHB33637), b-subunit (219 amino acids) (AHB33638), and accessory protein (128 amino acids) (AHB33639) have the highest identities of 99%, 99%, and 98% to the corresponding proteins from the newly determined genome of En. meliloti 4H41 with accession numbers of
Fig. 4. Time course of THI biodegradation by resting cells of En. meliloti CGMCC 7333. En. meliloti CGMCC 7333 was pre-cultured in LB broth containing 0.1 mmol/L CoCl2 for 24 h, collected, washed, and suspended into 0.2 mol/L phosphate buffer (pH 7.5) with 200 mg/L THI; OD600 value of resting cell suspensions was 5; conditions of the resting cell THI transformation described in Materials and Methods; Average values and standard deviations were calculated from three parallel cultures in three experiments (n ¼ 9).
Content (mg/kg soil) Bacterium inoculation THI
0 3 6 9
19.01 17.94 17.59 16.03
Control
THI amide
0.88 1.60 0.78 0.75
0.00 1.09 1.85 2.41
0.00 0.11 0.14 0.26
THI 18.66 18.47 18.60 18.38
THI amide
1.03 1.38 0.71 0.67
0.00 0.00 0.00 0.36
0.00 0.00 0.00 0.10
Soils were sterilized before use; initial THI concentration was 20 mg/kg soil; THI recovery was 95%; tested soils were inoculated with 109 CFU of En. meliloti CGMCC 7333/g of soil; Average values and standard deviations were calculated from three parallel cultures in three experiments (n ¼ 9).
WP_018095389.1, WP_018095388.1, WP_018095387.1, respectively. The putative a-subunit from En. meliloti CGMCC 7333 has only 63.7% identity to the a-subunit from V. boronicumulans CGMCC 4969 (accession number AER36563). Phylogenetic tree analysis further showed that Ensifer NHases (a-subunit) cluster in a branch independent from Variovorax NHase (Fig. 5). The a-subunit has a conserved motif composed of the amino acid sequence val-cys-thrleu-cys-ser-cys. The third amino acid is threonine, not serine, indicating that the CGMCC 7333 NHase is a cobalt-type NHase, not an iron-type NHase (Cameron et al., 2005). 3.5. Expression of the NHase in Es. coli Rosetta (DE3)and its degradation of THI In a previous study, we reported that NHase genes (a- and bsubunits) from V. boronicumulans CGMCC 4969 could be expressed in Es. coli BL21 (DE3) and the NHase over-expressed Es. coli degraded THI to THI amide; however only 40.8% of THI at an initial concentration of 20 mg/L was degraded in 24 h (Zhang et al., 2012). Co-expression of the downstream accessory protein gene may improve the NHase activity (Cameron et al., 2005), and there are rare Es. coli codons in NHase genes from En. meliloti CGMCC 7333. Therefore, the NHase gene cluster involving the a-subunit, b-subunit, and accessory protein genes was co-expressed in host Es. coli Rosetta (DE3), not BL21 (DE3). SDS-PAGE analysis indicated that the NHase was expressed in Es. coli Rosetta (DE3) pET28a-NHase (Fig. 6 lanes 1 and 3, respectively), whereas it was not in control experiments with Es. coli Rosetta (DE3) pET28a (lanes 2 and 4, respectively). The a-subunit with histag and b-subunit with predicted molecular weights of 27 and 24 kDa, respectively, are clearly observed in Fig. 6. The accessory protein gene of 14 kDa is not observed in lanes 1 and 3, whereas it could be observed in the purified NHase (lane 6, arrow III) and its quantity was comparatively lower than the a-subunit. Interestingly, the expressed En.
Fig. 5. Neighbor-joining phylogenetic tree of NHases. Bootstrap percentages from 1000 replicates shown at nodes; bar, 2% sequence divergence; Pseudomonas and Rhodococcus species selected from Blastp results in the GenBank database.
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
Fig. 6. SDS-PAGE of CGMCC 7333 NHase gene overexpressed in Es. coli Rosetta (DE3). Lane 1, soluble proteins of Es. coli Rosetta-pET28a harboring NHase genes; lane 2, soluble proteins of Es. coli Rosetta-pET28a lacking NHase genes; lane 3, total proteins of Es. coli Rosetta-pET28a harboring NHase genes; lane 4, total proteins of Es. coli RosettapET28a lacking NHase genes; lane M, standard protein markers (116.0, 66.2, 45.0, 35.0, 25.0, 18.4, and 14.4 kDa); lane 5, soluble proteins of overexpressed NHase in Es. coli Rosetta; lane 6, the purified NHase; lane 7, the proteins in the eluted solution of immobilized metal affinity chromatography after binding NHase. Arrows I, II and III represent the expressed a-subunit, b-subunit and accessory protein.
meliloti NHase is the main soluble protein (Fig. 6 lane 1), other than the major inclusion bodies of the expressed V. boronicumulans CGMCC 4969 NHase under the same overexpression conditions (Zhang et al., 2012). Transformation of THI by the resting cells of Es. coli Rosetta (DE3) pET28a-NHase with overexpression of NHase indicated that THI was converted to THI amide according to HPLC analysis, whereas cells without the recombinant NHase gene did not transform THI. After transformation for 10 min, the cells of Es. coli Rosetta (DE3) pET28a-NHase degraded 80.7% of THI (0.63 mmol/L) and formed 0.58 mmol/L of THI amide (Fig. 7A). The half-life of THI degradation was only 5.2 min. 3.6. Purification of NHase and its biotransformation of THI A six-His tag at the N-terminus end enabled purification of the recombinant NHase by immobilized metal affinity chromatography. The purified NHase was confirmed as electrophoretically pure by SDS-PAGE as shown in Fig. 6 (lane 6). HPLC analysis indicated that the purified NHase converted THI to THI amide, whereas the control without the recombinant NHase did not transform THI (Fig. 7B). The NHase degraded 80.6% of THI (0.70 mmol/L) and formed 0.60 mmol/L of THI amide in 5 min. The molar conversion rate was 85.7% and the half-life of THI degradation was 6.9 min (R ¼ 0.98). The specific enzyme activity for hydrolysis of THI to form THI amide was calculated as 1.37 U/mg proteins. The heterogeneous overexpression of the NHase gene and the purified NHase indicated that the major hydration pathway in the biotransformation of THI by En. meliloti CGMCC 7333 is mediated by a nitrile hydratase. The NHase gene cluster is composed of three genes corresponding to the a-subunit, b-subunit and accessory protein genes, and the protein expression system only labeled the N-terminus end of the a-subunit and the C-terminus end of the accessory protein with the His tag. Therefore, the majority of the b-subunit without His tag was eluted during the purification of the recombinant NHase by immobilized metal affinity chromatography (Fig. 6 lane 7). The purified NHase therefore lacks an adequate amount of the b-subunit to carry out catalysis and this leads to the specific enzyme activity for the transformation of THI to the amide metabolite being only 1.37 U/mg protein. Because the b-subunit is essential for NHase activity (Zhou et al., 2009), a small amount of b-subunit should be existed in the purified NHase, though it could not be clearly observed in SDS-PAGE (Fig. 6 lane 6).
15
Fig. 7. Time course of THI biodegradation by resting cells of Es. coli Rosetta pET28aNHase (A) and the purified NHase (B). Overexpression of NHase and resting cell THI transformation conditions described in Materials and Methods; OD600 of resting cell suspensions was 5. The enzyme concentration was 67.9 mg/mL in 0.2 mol/L phosphate buffer (pH 7.5) with the addition of 0.1 mmol/L CoCl2 and the reaction conditions were the same as for the resting cells transformation of THI. Average values and standard deviations were calculated from three parallel cultures in three experiments (n ¼ 9).
4. Discussion THI consists of three structural components involving a 6chloro-3-pyridinylmethyl moiety, a thiazolidine ring and a cyanoimine group, and metabolic pathway studies have revealed that it is readily biodegraded by metabolic attack at these three structural components. The proposed pathway of THI degradation in spinach, mice and soil is given in Fig. 8 (Khron, 2001; Casida, 2011). In the present study, En. meliloti CGMCC 7333 specifically hydrolyzed the cyanoimine group of THI to the amide metabolite and 90.9% of the reduced THI was converted to THI amide. Therefore the hydrolysis of THI to its amide metabolite is the major pathway of degradation of THI by En. meliloti CGMCC 7333 (Fig. 8). It has been proposed that THI amide is cleaved to THI imine or converted to THI sulfonic acid (M30) in soil, and microbial metabolism is the major pathway of degradation of THI in soil (Krohn, 2001). However, no other peaks were observed in the HPLC and LC-MS analyses of THI transformation by CGMCC 7333. Therefore, THI amide appears to be the final metabolite in the transformation of THI by CGMCC 7333, precluding further degradation to THI imine or M30 by CGMCC 7333. On the other hand, studies on interactions between enzymes and inhibitors and neonicotinoid insecticides have indicated that cytochrome P450 enzymes are involved in the hydroxylation of the THI thiazolidine ring to form 4-hydroxy THI. Cytochrome P450 enzymes are usually NAD(P)H-dependent oxidoreductases and require a utilizable substrate such as glucose or succinate as an electron donor to perform hydroxylation (Shi et al., 2009; Zhao et al., 2009). In the present study, Es. coli Rosetta (DE3) pET28aNHase overexpressing NHase and the purified NHase both hydrolyze THI to THI amide, which indicates that NHase is responsible for this biotransforamtion. NHase is a metalloenzyme with mononuclear iron or non-corrinoid cobalt in its active site and, therefore, iron or cobalt should be supplied during cell growth and the NHase induction period (Cameron et al., 2005). NHases have also been discovered in several genera of plantassociated bacteria and N2-fixing bacteria, such as Agrobacterium, Bradyrhizobium, Mesorhizobium, Rhizobium, Pseudomonas, and Variovorax. However, only NHase from Variovorax have been studied in detail (Velankar et al., 2010; Zhang et al., 2012). The genus Ensifer comprises En. adhaerens and the species in the genus formerly known as Sinorhizobium (Yutani et al., 2011).
16
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
Fig. 8. Metabolic pathways of THI in mice, spinach, and soil and the proposed metabolic pathways of degradation of THI by En. meliloti CGMCC 7333.
Sinorhizobium bacteria are capable of nitrogen fixation in symbiosis with leguminous plants. Sinorhizobium meliloti is an a-proteobacterium that forms agronomically important N2-fixing root nodules in legumes (Kuiper et al., 2004). Interestingly, we recently found that En. adhaerens CGMCC 6315, a thiamethoxam degrading bacterium reported by Zhou et al. (2013), can hydrolyze THI to THI amide. We isolated an Ensifer sp. SCL3-19, which is different from En. meliloti CGMCC 7333 by morphology and 16S rRNA gene analysis, that also degrades THI to THI amide (data not shown). The NHase genes from En. adhaerens CGMCC 6315 and Ensifer sp. SCL319 are being cloned and expressed to further explore the functions of NHases from genus Ensifer. THI is quickly degraded in soil under laboratory or field conditions. For example, the half-life of THI in soils under field conditions in northern Europe ranged from 9 to 27 d, and was 10e16 d in southern European soil (Krohn, 2001); the half-lives of THI in Chinese soils under laboratory conditions were less than 5 d (Liu et al., 2011; Wang et al., 2011). We further proved that soil microbial activity strongly affects the degradation of THI and isolated a yeast, R. mucilaginosa IM-2, and a bacterium, V. boronicumulans CGMCC 4969, which could degrade THI with half-lives of 14.3 d and 1.8 d, respectively (Dai et al., 2010; Liu et al., 2011; Zhang et al., 2012). In this study, En. meliloti CGMCC 7333 displayed more rapid THI degradation than R. mucilaginosa IM-2 and V. boronicumulans CGMCC 4969, and its half-life of THI degradation is only 20.1 h. En. meliloti CGMCC 7333 also exhibited THI degradation in soil, but its half-life is 37.3 d (R2 ¼ 0.98). A lower THI degradation in soil compared to culture broth was also observed for THI degradation by R. mucilaginosa IM-2 (Dai et al., 2010); even V. boronicumulans CGMCC 4969 cannot degrade THI in soil (data not shown). We speculate that there may be diverse THI degrading microbes in natural soils, which might act in combination with En.
meliloti CGMCC 7333 and/or R. mucilaginosa IM-2 to quickly degrade THI. En. meliloti is the first N2-fixing bacterium found to be capable of transforming the neonicotinoid insecticide THI in pure culture and in soil. We propose that En. meliloti may be used for the biodegradation of neonicotinoid THI in contaminated soil and can be developed as a bio-fertilizer. Acknowledgments This research was financed by the Priority Academic Program Development (PAPD) of Jiangsu Higher Education Institutions, National Science Foundation of China (31370143, 30970040), and NSFC for Talents Training in Basic Science (J1103507). References Banerjee, A., Sharma, R., Banerjee, U., 2002. The nitrile-degrading enzymes: current status and future prospects. Appl. Microbiol. Biotechnol. 60, 33e44. Barillot, C.C., Sarde, C.-O., Bert, V., Tarnaud, E., Cochet, N., 2013. A standardized method for the sampling of rhizosphere and rhizoplan soil bacteria associated to a herbaceous root system. Ann. Microbiol. 63, 471e476. Cameron, R.A., Sayed, M., Cowan, D.A., 2005. Molecular analysis of the nitrile catabolism operon of the thermophile Bacillus pallidus RAPc8. Biochim. Biophys. Acta 1725, 35e46. Casida, J.E., 2011. Neonicotinoid metabolism: compounds, substituents, pathways, enzymes, organisms, and relevance. J. Agric. Food Chem. 59, 2923e2931. Dai, Y.J., Ji, W.W., Chen, T., Zhang, W.J., Liu, Z.H., Ge, F., Yuan, S., 2010. Metabolism of the Neonicotinoid insecticides acetamiprid and thiacloprid by the yeast Rhodotorula mucilaginosa strain IM-2. J. Agric. Food Chem. 58, 2419e2425. Feng, Y.S., Lee, C.-M., Chen, L.-J., 2007. The effect of urea, glucose, and ε-caprolactam on the conversion of nitriles into amides by Nocardioides jensenii and Mesorhizobium sp. Int. Biodeterior. Biodegrad. 59, 211e215. Jeschke, P., Nauen, R., Schindler, M., Elbert, A., 2011. Overview of the status and global strategy for neonicotinoids. J. Agric. Food Chem. 59, 2897e2908.
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17 Krohn, J., 2001. Behaviour of thiacloprid in the environment. PflanzenschutzNachrichten Bayer. 54, 281e290. Kuiper, I., Lagendijk, E.L., Bloemberg, G.V., Lugtenberg, B.J.J., 2004. Rhizoremediation: a beneficial plant-microbe interaction. Mol. Plant-Microbe Interact. 17, 6e15. Liu, Z., Dai, Y., Huang, G., Gu, Y., Ni, J., Wei, H., Yuan, S., 2011. Soil microbial degradation of neonicotinoid insecticides imidacloprid, acetamiprid, thiacloprid and imidaclothiz and its effect on the persistence of bioefficacy against horsebean aphid Aphis craccivora Koch after soil application. Pest Manag. Sci. 67, 1245e1252. Lopez, O., Fernandez-Bolanos, J.G., Gil, M.V., 2005. New trends in pest control: the search for greener insecticides. Green Chem. 7, 431e442. Nagasawa, T., Shimizu, H., Yamada, H., 1993. The superiority of the third-generation catalyst, Rhodococcus rhodochrous J1 nitrile hydratase, for industrial production of acrylamide. Appl. Microbiol. Biotechnol. 40, 189e195. Nielsen, M.K.K., Holtze, M.S., Svensmark, B., Juhler, R.K., 2007. Demonstrating formation of potentially persistent transformation products from the herbicides bromoxynil and ioxynil using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Pest Manag. Sci. 63, 141e149. Rzeznicka, K., Schätzle, S., Böttcher, D., Klein, J., Bornscheuer, U.T., 2010. Cloning and functional expression of a nitrile hydratase (NHase) from Rhodococcus equi TG328-2 in Escherichia coli, its purification and biochemical characterisation. Appl. Microbiol. Biotechnol. 85, 1417e1425. Shi, X., Dick, R.A., Ford, K.A., Casida, J.E., 2009. Enzymes and inhibitors in neonicotinoid insecticide metabolism. J. Agric. Food Chem. 57, 4861e4866. Sgroy, V., Cassan, F., Masciarelli, O., Del Papa, M.F., Lagares, A., Luna, V., 2009. Isolation and characterization of endophytic plant growth-promoting (PGPB) or stress homeostasis-regulating (PSHB) bacteria associated to the halophyte Prosopis strombulifera. Appl. Microbiol. Biotechnol. 85, 371e381.
17
Velankar, H., Clarke, K.G., du Preez, R., Cowan, D.A., Burton, S.G., 2010. Developments in nitrile and amide biotransformation processes. Trends Biotechnol. 28, 561e569. Wang, C., Guan, W.-B., Zhang, H.-Y., 2011. Dissipation and residue of thiacloprid in cabbage and soil. Bull. Environ. Contam. Toxicol. 87, 440e443. Yang, Y., Chen, T., Ma, P., Shang, G., Dai, Y., Yuan, S., 2010. Cloning, expression and functional analysis of nicotinate dehydrogenase gene cluster from Comamonas testosteroni JA1 that can hydroxylate 3-cyanopyridine. Biodegradation 21, 593e 602. Yutani, M., Taniguchi, H., Borjihan, H., Ogita, A., Fujita, K.-i., Tanaka, T., 2011. Alliinase from Ensifer adhaerens and its use for generation of fungicidal activity. AMB Express 1, 1e8. Zhang, H.J., Zhou, Q.W., Zhou, G.C., Cao, Y.M., Dai, Y.J., Ji, W.W., Shang, G.D., Yuan, S., 2012. Biotransformation of the neonicotinoid insecticide thiacloprid by the bacterium Variovorax boronicumulans strain J1 and mediation of the major metabolic pathway by nitrile hydratase. J. Agric. Food Chem. 60, 153e159. Zhao, Y.J., Dai, Y.J., Yu, C.G., Luo, J., Xu, W.P., Ni, J.P., Yuan, S., 2009. Hydroxylation of thiacloprid by bacterium Stenotrophomonas maltophilia CGMCC 1.1788. Biodegradation 20, 761e768. Zhou, G.C., Wang, Y., Zhai, S., Ge, F., Liu, Z.H., Dai, Y.J., Yuan, S., Hou, J.Y., 2013. Biodegradation of the neonicotinoid insecticide thiamethoxam by the nitrogenfixing and plant-growth-promoting rhizobacterium Ensifer adhaerens strain TMX-23. Appl. Microbiol. Biotechnol. 97, 4065e4074. Zhou, Z., Hashimoto, Y., Kobayashi, M., 2009. Self-subunit swapping chaperone needed for the maturation of multimeric metalloenzyme nitrile hydratase by a subunit exchange mechanism also carries out the oxidation of the metal ligand cysteine residues and insertion of cobalt. J. Biolog. Chem. 284, 14930e14938.
Contents lists available at ScienceDirect
International Biodeterioration & Biodegradation journal homepage: www.elsevier.com/locate/ibiod
Hydrolysis of the neonicotinoid insecticide thiacloprid by the N2-fixing bacterium Ensifer meliloti CGMCC 7333 Feng Ge, Ling-Yan Zhou, Ying Wang, Yuan Ma, Shan Zhai, Zhong-Hua Liu, Yi-Jun Dai*, Sheng Yuan Jiangsu Key Laboratory for Microbes and Functional Genomics, Jiangsu Engineering and Technology Research Center for Industrialization of Microbial Resources, College of Life Science, Nanjing Normal University, Nanjing 210023, People’s Republic of China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 November 2013 Received in revised form 15 April 2014 Accepted 5 May 2014 Available online
A thiacloprid (THI)-degrading bacterium CGMCC 7333 was isolated from soil and identified as the N2fixing bacterium Ensifer meliloti. The major metabolite was identified as THI amide derived from the cyano moiety by hydrolysis of THI, using liquid chromatography-mass spectrometry and nuclear magnetic resonance analysis. En. meliloti CGMCC 7333 degraded 86.8% of 200 mg/L THI in 60 h with a half-life of 20.9 h and 90.9% of the reduced THI was converted to THI amide. CGMCC 7333 can convert THI to THI amide in the soil. Hydrolysis of THI by En. meliloti CGMCC 7333 is mediated by a nitrile hydratase (NHase) and the NHase gene cluster codes a cobalt-type NHase composed of an a-subunit, b-subunit, and accessory protein with lengths of 213, 219, and 128 amino acids, respectively. Whole cells of Escherichia coli Rosetta overexpressing NHase degraded 80.7% of THI (0.63 mmol/L) in 10 min and formed 0.58 mmol/L of THI amide, and the half-life of THI degradation was 5.2 min. The purified NHase degraded 80.6% of THI (0.70 mmol/L) and formed 0.60 mmol/L of THI amide in 5 min with a molar conversion rate of 85.7%, and the half-life of THI degradation was 6.9 min. Ó 2014 Elsevier Ltd. All rights reserved.
Keywords: Biodegradation Ensifer meliloti Nitrile hydratase Thiacloprid Thiacloprid amide
1. Introduction Neonicotinoids are a class of N-heterocyclic insecticides that function primarily as systemic compounds that are absorbed and translocated by plants to control sucking insect pests. These compounds are the newest class of synthetic insecticides produced during the past two decades and the biggest selling insecticide class worldwide (Jeschke et al., 2011). Thiacloprid (THI), (Z)-[3-[(6chloro-3-pyridinyl)methyl]-2-thiazolidinylidene]cyanamide, was developed by Bayer Cropscience in 2000 to control a variety of sucking and chewing insects, primarily aphids and whiteflies. THI has a favorable environmental profile with good margins of safety for birds, fish species, and many beneficial arthropods. Its safety profile for bees also allows its application during the blossoming period of bee-attracting crops (Jeschke et al., 2011). The metabolism of THI in plants and mammals shows that it is converted to the 4-hydroxy, olefin, and sulfoxide metabolites and, in addition, the cleavage or hydrolysis of the cyanoguanidine moiety gives the descyano or N-carbamoylimine derivatives,
* Corresponding author. Tel.: þ86 25 85891731; fax: þ86 25 85891067. E-mail address: [email protected] (Y.-J. Dai). http://dx.doi.org/10.1016/j.ibiod.2014.05.001 0964-8305/Ó 2014 Elsevier Ltd. All rights reserved.
respectively (Casida, 2011). Investigation of the metabolism of THI in the soil revealed that it is mainly hydrolyzed to the N-carbamoylimine derivative, (Z)-[3-[(6-chloro-3-pyridinyl)methyl]-2thiazolidinylidene]urea (THI amide), with about 70% of THI converted to THI amide (Krohn, 2001). Microbial metabolism of THI in pure culture indicated that the bacterium Stenotrophomonas maltophilia CGMCC 1.1788 is able to degrade THI via hydroxylation in the thiazolidine ring to form the metabolite 4-hydroxy THI (Zhao et al., 2009); the yeast Rhodotorula mucilaginosa strain IM-2 and the bacterium Variovorax boronicumulans strain CGMCC 4969 degrade THI to the THI amide with a molar conversion rate of 69% and 98%, respectively (Dai et al., 2010; Zhang et al., 2012). The soil and microbial metabolism of THI to THI amide with a high molar conversion rate implies that the hydrolysis of THI to produce THI amide is the major pathway of degradation of THI in the soil, and this biotransformation is mainly caused by soil microbes (Liu et al., 2011). Therefore, investigation of the mechanism of microbial hydrolysis of THI to the amide metabolite will help to enhance our understanding of the environmental fate of the cyano groupcontaining neonicotinoid insecticide THI. The nitrile (cyano)-converting bacteria are currently applied to the industrial production of amide compounds, such as the transformation of acrylnitrile to acrylamide and 3-cyanopyridine to
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
nicotinamide by the three generations of bacteria Rhodococcus sp. N-774, Pseudomonas chlororaphis B23, and Rhodococcus rhodochrous J1 (Banerjee et al., 2002). The corresponding nitrile-converting enzymes, nitrile hydratases (NHase, EC 4.2.1.84), have also been extensively explored and are well understood (Nagasawa et al., 1993; Cameron et al., 2005). In pesticide chemistry, the cyano group embedded in the pesticide molecular structure can enhance its toxic effects on the central nervous system of pest insects and, therefore, many cyano group-containing pesticides have been developed and are widely used in modern agriculture (Lopez et al., 2005). The biodegradations of some cyano moiety-containing pesticides have been studied (Feng et al., 2007; Nielsen et al., 2007); however their corresponding enzymatic mechanisms have rarely been elucidated (Zhang et al., 2012). In a previous study, an NHase coding gene from V. boronicumulans CGMCC 4969 was cloned and expressed in Escherichia coli BL21 (DE3). Whole cells of Es. coli BL21 overexpressing NHase could transform THI to the major metabolite THI amide. The above results first proved that NHase is responsible for the degradation of cyano group-containing neonicotinoid pesticides (Zhang et al., 2012). To further study the enzymatic mechanism of hydrolysis of cyano group-containing pesticides, we continued to isolate THI-degrading bacteria and explore its degradation mechanism. In the present study, a THIhydrolyzing bacterium with a more rapid THI degradation rate than V. boronicumulans CGMCC 4969 was isolated, and the kinetics of THI degradation, the metabolite formed and its THI degradation in soil by the isolate were studied in detail. Furthermore, the NHase gene cluster was cloned and expressed in Es. coli Rosetta and the corresponding NHase of the present isolate was bioinformatically compared with that from V. boronicumulans CGMCC 4969. The present study will help to elucidate the mechanism of enzymatic THI degradation. 2. Materials and methods 2.1. Chemicals THI was provided by Professor Jueping Ni of the Jiangsu Pesticide Research Institute, Nanjing, China (>98% purity). Methanol and acetonitrile for HPLC analysis were HPLC grade and were purchased from Merck KGaA (Darmstadt, Germany). All other reagents were of analytical grade and purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). 2.2. Media The enrichment medium was mineral salt (MS) broth (pH 7.5) of the following composition: 10.0 g glucose, 1.36 g KH2PO4, 2.13 g Na2HPO4 and 0.50 g MgSO4$7H2O in 1.0 L deionized water. The LuriaeBertani (LB) medium (pH 7.2) contained 10.0 g peptone, 5.0 g yeast extract, and 10.0 g NaCl in 1.0 L deionized water and was used for the isolation and purification of bacteria. Nitrogen-free base (NFb) medium (pH 7.0) was used to examine the nitrogen-fixing ability of the isolated microorganisms and contained 1.20 g KH2PO4, 0.80 g K2HPO4, 5.0 g glucose, 0.20 g MgSO4$7H2O, 0.20 g NaCl, 0.02 g CaCl2$2H2O, 0.002 g FeSO4$7H2O, and 2.0 mL solution of inorganic salts in 1.0 L deionized water. 2.3. Isolation and identification of microbes from soil samples Rhizosphere soils from around leguminous plants were collected for microbe isolation from Cangzhou in Hebai Province and Suzhou and Nanjing in Jiangsu Province, China. The method for the sampling of rhizosphere soil was referenced by Barillot et al. (2013). Each soil sample (2.0 g) was added to a 100-mL flask
11
containing 18 mL sterilized MS broth, and then 5 mL of the mixture was inoculated into a 500-mL flask containing 200 mL MS broth with 200 mg/L of THI. The culture was incubated at 30 C on a rotary shaker at 220 rpm. The culture broth was sampled every week and the residual THI was determined by HPLC analysis. Samples with the ability to degrade THI were diluted and spread on LB plates to isolate and purify the microbes. The 16S rRNA gene was amplified by colony polymerase chain reaction (PCR) and sequenced by Sangon Biotech Co., Ltd. (Shanghai, China) (Zhang et al., 2012). The accession number of the 16S rRNA gene of the THI degrading bacterium named as SCL3-10 in the Genbank database is KF304576. 2.4. N2-fixation test The identified isolates were inoculated onto plates containing NFb agar to examine their N2-fixing ability. The plates were incubated at 28 C for 7e14 d, and bacterial growth was observed as qualitative evidence of atmospheric nitrogen fixation (Sgroy et al., 2009). Ensifer adhaerens CGMCC 6315 and Es. coli K12 DH10B were used as positive and negative controls, respectively (Zhou et al., 2013). 2.5. Biodegradation of THI by resting cells and preparation of metabolites To evaluate the ability of resting cells to biotransform THI, bacteria were pre-cultivated in LB broth with 0.1 mmol/L CoCl2 in an incubator shaker for 24 h and then harvested by centrifugation at 6000 g for 5 min. Next, the cell sediments obtained were washed with 0.2 mol/L sodium phosphate buffer (pH 7.5) and then resuspended in 10 mL of the same buffer with 200 mg/L THI added. These cell suspensions were used for resting cell transformations of THI. Meanwhile, the above resting cells transformation broth excluding substrate THI or cells was used as a control. The transformations were conducted under the above cultivation conditions for the indicated times. The samples were centrifuged at 10,000 g for 10 min to remove the residual cells and the supernatant was collected, filtered, and diluted to a volume appropriate for analysis of the substrates and metabolites by HPLC. To prepare the metabolite, the biotransformation by the isolate was conducted in a 5-L fermenter (Auzone Bio-equipment, Shanghai, China). A single colony of the isolate was inoculated to a 1-L flask containing 300 mL of LB broth and cultivated in a rotary shaker at 220 rpm and 30 C for 24 h. Then, the culture broth was poured into the fermenter containing 3.0 L LB broth for cultivation. During cultivation, the fermenter was constantly aerated with filtered sterile air at a flow rate of 3 L/min and stirred at 300 rpm and 30 C. After cultivation for 16 h, the cells were harvested from the fermentation broth at 6000 g for 20 min and suspended in 3.0 L of the above phosphate buffer with 0.60 g THI in the fermenter for transformation. Following transformation for 60 h, the cell residues were removed by centrifugation of the mixture at 6000 g for 20 min. The supernatant was extracted twice with equal volumes of ethyl acetate. The organic fraction was dehydrated with anhydrous sodium sulfate, after which the organic phase was filtered using an organic membrane (0.22-mm pore size) and then concentrated. The product crystals were washed with acetonitrile to eliminate the remaining THI until a purity of greater than 98% was observed upon HPLC analysis, after which the purified metabolite was dried under vacuum. 2.6. Biodegradation of THI in the soil by the isolate The physicochemical properties of the test soil were pH 6.6, 4.5 g/kg organic matter, 14.4% clay, 81.9% sand, and 3.7% silt by
12
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
mass. For soil biodegradation experiments, 10.0 g sterilized dry soil samples were spread uniformly in 10-cm diameter Petri dishes. 200 mg/L of THI stock solution sterilized by filtration was added to a final THI concentration of 20 mg/kg soil. Bacteria pre-cultured in LB broth for 16 h were collected and re-suspended in 20 mmol/L sterilized phosphate buffer (pH 7.0), and then 1 mL of the suspension was inoculated into the soil samples at 109 bacterial colony-forming units/g soil. An additional 1 mL of sterilized, deionized water was added to each Petri dish. The dishes were incubated in an incubator at 28 C in darkness and 80% humidity. To examine the THI degradation, each soil sample was transferred to a 100-mL flask and 15 mL acetonitrile were added. The Erlenmeyer flask was sealed and placed in a rotary shaker at 220 rpm and equilibrated for 2 h. The extract was centrifuged at 10,000 g for 15 min and filtered prior to quantification by HPLC analysis. 2.7. HPLC, liquid chromatography-mass spectrometry (LC-MS), and nuclear magnetic resonance (NMR) analyses An Agilent 1200 HPLC system equipped with an HC-C18 column (4.6 250 mm, 5 mm particle size, Agilent Technologies, Santa Clara, CA) was employed for analysis of THI and its metabolite. Elution was conducted at a flow rate of 1 mL/min in a mobile phase that contained water and acetonitrile as well as 0.01% acetic acid (water: acetonitrile, 65:35). The signal was monitored at a wavelength of 242 nm using an Agilent G1314A UV detector. LC-MS was conducted using an Agilent LC-MS system equipped with an electrospray ion source that was operated in the positive ion mode. 13C and 1H NMR spectra of the metabolite were obtained in DMSO-d6 using a Bruker AV-400 spectrometer (Switzerland) operating at 100 and 400 MHz, respectively. Chemical shifts were referenced against internal tetramethylsilane. NMR techniques, heteronuclear multiple bond correlation (HMBC) and heteronuclear single-quantum correlation spectroscopy (HSQC), were used to assign proton and carbon atom chemical shifts (d). 2.8. Cloning the NHase gene from the strain SCL3-10, insertion of recombinant NHase genes into pET28a plasmid The total genomic DNA from the isolate was extracted using a MiniBEST bacterial genomic DNA extraction Kit (TaKaRa, Dalian, China). The primers (Table 1) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The PCR conditions were as reported in our previous studies (Zhang et al., 2012). The PCR product was cloned into the pMD18-T vector (TaKaRa, code: D101A) and sequenced. The primers NHCOII-f and NHCOII-r, designed by alignment of the nucleotides of NHase genes from the genus Ensifer in the Genbank database, were used for cloning the NHase a-subunit gene. Then Table 1 PCR primers used in this study. Primer
Sequence (50 e30 )
Restriction site
NHCoII-f NHCoII-r NHCoIII-f NHCoIII-r NHCOIV-f NHCOIV-r NHCOV-f NHCOV-r NHCOVI-f NHCOVI-r
CCATCACCACGACAACCACC CCCAGGGATAGCAGGAGCA ACGCTGTGCTCCTGCTATCC GCCATTGCGGGTTCTCG CTGTAGAGGAGCCAGGAATG CCAGGGATAGCAGGAGCA GAGACCCCGCAATGG TGCTTCAACGCAGAG GCTAGCATGTCCGAGC ATCATCATGGGC AAGCTTACGCAGA GGATCATTCGCGAG
NheI HindIII
All primers were purchased form Sangon Bio Co., Ltd (Shanghai, China). Restriction sites are in underling.
the new primers NHCOIII-f and NHCOIII-r were used for cloning the genes downstream of the NHase a-subunit and upstream of the bsubunit. The primers NHCOIV-f and NHCOIV-r were designed for cloning the gene upstream of the a-subunit. The primers NHCOV-f and NHCOV-r were designed for cloning the gene downstream of the b-subunit and the full length NHase activator gene. The nucleotide sequence analysis and multiple sequence alignments were performed by the software DNAMAN version 6.0 (Lynnon Biosoft, Quebec, Canada) and the BLAST program in the GenBank database. The strategy for cloning the NHase coding gene from En. meliloti CGMCC 7333 is shown in Fig. 1. To construct the expression plasmid vector, primers NHCOVI-f and NHCOVI-r with the NheI restriction enzyme site and the HindIII restriction enzyme site, respectively, were used for amplification of the NHase gene cluster involving the a- and b-subunits and activator genes (Fig. 1), and PrimeSTAR HS DNA Polymerase (Takara Code: DR010A) was used for PCR amplification. Appropriately amplified DNA fragments, excised by restriction digestion with NheI/HindIII restriction enzymes, were cloned between the same restriction sites of the appropriate expression vector pET28a. Ligations were performed according to the manufacturer’s (TaKaRa) protocols. 2.9. Expression and purification of recombinant NHase in Es. coli Rosetta (DE3) Preparation of Es. coli Rosetta (DE3) competent cells and calcium chloride transformation were conducted according to the method of Yang et al. (2010). Overexpression of the recombinant NHase in Es. coli Rostta (DE3) and purification of the NHase by His-tag affinity chromatography followed the method described by Rzeznicka et al. (2010). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out according to the method of Yang et al. (2010). A standard molecular weight protein mixture was used as the reference. Gels were stained for protein detection with Coomassie Brilliant Blue. To analyze enzyme solubility, the cell pellets were resuspended in 0.2 culture volumes of 0.2 mol/L phosphate buffer and disrupted by sonication (10 s) for 3 min at 4 C. A total protein sample was collected from the cell suspension after sonication, and a soluble protein sample was collected from the supernatant after the insoluble debris were pelleted by centrifugation at 12,000 g for 20 min. NHase activity was determined using HPLC analysis and one unit (U) of NHase activity was defined as the amount of enzyme that catalyzed the formation of 1 mmol of THI amide in 1 min. 2.10. Half-life of THI degradation Half-life values for THI degradation were determined by plotting ln (I/Io) against time using the equation ln (I/Io) ¼ kt, where Io and I represent the initial and residual concentrations. The half-life was calculated as follows:
Fig. 1. Strategy for cloning and expression of the NHase coding gene from En. meliloti CGMCC 7333.
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
t1=2 ¼ ðln 2Þ=k; where t1/2 is the half-life and k is the apparent elimination constant. In all cases, the first order equation provided a satisfactory fit for the data (r > 0.9), providing the basis for the half-life calculation (Zhang et al., 2012). 3. Results 3.1. Isolation and identification of THI-degrading microbes Among the MS broths that had been inoculated with different soil extracts, the sample inoculated with the soil extract from Cangzhou, Hebei Province, demonstrated the highest THIdegrading capacity by HPLC analysis. A total of 80 pure isolates were isolated in LB agar and tested for THI-degrading ability. Among them, 4 strains were able to degrade THI and the strain SCL3-10 displayed the highest THI degradation. Nucleotide BLAST (BLASTn) analysis and phylogenic tree analysis of the 16S rRNA gene sequences indicated that SCL3-10 was clustered with En. meliloti strain LMTR32 (AY196963) (Fig. 2). En. meliloti SCL3-10 was deposited in the China General Microbiological Culture Collection Center (CGMCC) (Beijing, China) under the accession number CGMCC 7333. En. meliloti (formerly Sinorhizobium meliloti) is a bacterium with a unique N2-fixing root-nodule symbiosis (Kuiper et al., 2004) and therefore its N2-fixing ability was confirmed in a standard NFb agar plate. Cells of En. meliloti CGMCC 7333 and the positive control En. adhaerens CGMCC 6315 grew on NFb agar, whereas those of the negative control Es. coli DH10B did not. These results confirmed that En. meliloti CGMCC 7333 is an atmospheric N2-fixing bacterium.
13
THI amide. LC-MS analysis (Fig. 3A) indicated that the metabolite displayed a protonated ion (M) at m/z 270 and a sodiated adduct (MeH þ Na) at m/z 292, a fragment ion (MeNH2CO) at m/z 227, and an unknown fragment ion at m/z 253. The mass of the metabolite was enhanced by the addition of a water molecule when compared to the substrate THI (M) at m/z 252. There are 11 protons in the 1H NMR spectrum of the THI metabolite, which is 2 protons more than in the substrate THI. The two new protons (d 6.30 and 6.54) have no correlation with the carbon atoms according to HMBC and HSQC analysis. Therefore, they are assigned as protons of the amide moiety. There are 10 carbon atoms in the 13C NMR spectrum, which is the same number as in the spectrum of the parent THI, but the chemical shift of the carbon atom of the cyano group was not observed and a new chemical shift (d 163.6) appeared in the metabolite, which is assigned as the carbon atom of the amide moiety. Based on mass and NMR analysis, the metabolite produced in the biotransformation of THI by En. meliloti CGMCC 7333 is identified as THI amide.
3.2. Identification of the metabolite formed by biotransformation of THI by En. meliloti CGMCC 7333 Biotransformation of THI by resting cells of En. meliloti CGMCC 7333 resulted in the formation of a polar metabolite with an HPLC retention time of 4.95 min, and no comparable peak was observed upon analysis of the controls excluding the cells (Fig. 3B) or the substrate THI (Fig. 3C) or both the cells and substrate THI (Fig. 3D). The polar metabolite has the same retention time as the standard
Fig. 2. Neighbor-joining phylogenetic tree of strain SCL3-10, other members of the genus Ensifer, and representatives of some other taxa based on 16S rRNA gene sequence comparisons. Bootstrap percentages from 1000 replicates are shown at nodes. The sequence of Rhizobium leguminosarum was used as the outgroup. Bar, 0.5% sequence divergence.
Fig. 3. HPLC of the biotransformation of THI by resting cells of En. meliloti CGMCC 7333 and the LC-MS spectrum of the metabolite. A, transformation broth with inoculation of bacterium and additional THI at amount of 0.79 mmol/L; B, transformation broth without bacterium inoculation; C, transformation broth without additional THI; D, transformation broth without bacterium inoculation and additional THI. The cell density at wavelength of 600 nm was 5. The sample for HPLC was diluted 5 times.
14
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
3.3. THI biodegradation by En. meliloti CGMCC 7333 in the pure culture broth and the soil
Table 2 Degradation of THI by En. meliloti CGMCC 7333 in soil. Time (d)
Time-course analysis of the hydration of THI by the resting cells of En. meliloti CGMCC 7333 (Fig. 4) indicated that the quantity of THI declined from 0.76 mmol/L to 0.10 mmol/L in 60 h. The degradation ratio and half-life were calculated as 86.8% and 20.9 h, respectively. The quantity of THI amide had increased by 0.60 mmol/L, which was equivalent to a mole transformation ratio of 90.9%. As shown in Table 2, in soil inoculated with En. meliloti CGMCC 7333 and incubated for 9 d, THI was reduced from the initial 19.01 mg/kg soil to 16.03 mg/kg soil and the degradation rate was 15.7%. In control soil lacking bacterial inoculation, THI was slightly degraded. In experimental soil with inoculation of the bacteria, 2.41 mg/kg soil of metabolite THI amide were formed, while only 0.36 mg THI amide/kg soil was formed in control soil. These results showed that inoculation of En. meliloti CGMCC 7333 into the soil accelerated THI degradation and THI amide formation. 3.4. Cloning the NHase gene cluster from En. meliloti CGMCC 7333 and bioinformatical analysis of the putative proteins By using the four pairs of primers NHCOII, NHCOIII, NHCOIV, and NHCOV, DNA fragments of lengths 329 bp, 851 bp, 382 bp, and 496 bp were cloned and then assembled to form a DNA fragment of 1762 bp (Fig. 1). This 1762-bp DNA consists of a full NHase gene cluster with length of 1671 bp. The NHase gene cluster is composed of an a-subunit gene of 642 bp and a b-subunit gene of 660 bp and an accessory protein gene of 387 bp. The accession numbers of the NHase a-, b-subunit, and accessory protein coding genes from En. meliloti CGMCC 7333 are KF601242, KF601243, and KF601244, respectively, in the Genbank database. The a and b-subunit genes have a 4-bp overlapping sequence of “ATGA”, and the b-subunit and accessory protein genes have a 14-bp overlapping sequence of “TTGAACCCGCATAG”. The putative a-subunit (213 amino acids) (AHB33637), b-subunit (219 amino acids) (AHB33638), and accessory protein (128 amino acids) (AHB33639) have the highest identities of 99%, 99%, and 98% to the corresponding proteins from the newly determined genome of En. meliloti 4H41 with accession numbers of
Fig. 4. Time course of THI biodegradation by resting cells of En. meliloti CGMCC 7333. En. meliloti CGMCC 7333 was pre-cultured in LB broth containing 0.1 mmol/L CoCl2 for 24 h, collected, washed, and suspended into 0.2 mol/L phosphate buffer (pH 7.5) with 200 mg/L THI; OD600 value of resting cell suspensions was 5; conditions of the resting cell THI transformation described in Materials and Methods; Average values and standard deviations were calculated from three parallel cultures in three experiments (n ¼ 9).
Content (mg/kg soil) Bacterium inoculation THI
0 3 6 9
19.01 17.94 17.59 16.03
Control
THI amide
0.88 1.60 0.78 0.75
0.00 1.09 1.85 2.41
0.00 0.11 0.14 0.26
THI 18.66 18.47 18.60 18.38
THI amide
1.03 1.38 0.71 0.67
0.00 0.00 0.00 0.36
0.00 0.00 0.00 0.10
Soils were sterilized before use; initial THI concentration was 20 mg/kg soil; THI recovery was 95%; tested soils were inoculated with 109 CFU of En. meliloti CGMCC 7333/g of soil; Average values and standard deviations were calculated from three parallel cultures in three experiments (n ¼ 9).
WP_018095389.1, WP_018095388.1, WP_018095387.1, respectively. The putative a-subunit from En. meliloti CGMCC 7333 has only 63.7% identity to the a-subunit from V. boronicumulans CGMCC 4969 (accession number AER36563). Phylogenetic tree analysis further showed that Ensifer NHases (a-subunit) cluster in a branch independent from Variovorax NHase (Fig. 5). The a-subunit has a conserved motif composed of the amino acid sequence val-cys-thrleu-cys-ser-cys. The third amino acid is threonine, not serine, indicating that the CGMCC 7333 NHase is a cobalt-type NHase, not an iron-type NHase (Cameron et al., 2005). 3.5. Expression of the NHase in Es. coli Rosetta (DE3)and its degradation of THI In a previous study, we reported that NHase genes (a- and bsubunits) from V. boronicumulans CGMCC 4969 could be expressed in Es. coli BL21 (DE3) and the NHase over-expressed Es. coli degraded THI to THI amide; however only 40.8% of THI at an initial concentration of 20 mg/L was degraded in 24 h (Zhang et al., 2012). Co-expression of the downstream accessory protein gene may improve the NHase activity (Cameron et al., 2005), and there are rare Es. coli codons in NHase genes from En. meliloti CGMCC 7333. Therefore, the NHase gene cluster involving the a-subunit, b-subunit, and accessory protein genes was co-expressed in host Es. coli Rosetta (DE3), not BL21 (DE3). SDS-PAGE analysis indicated that the NHase was expressed in Es. coli Rosetta (DE3) pET28a-NHase (Fig. 6 lanes 1 and 3, respectively), whereas it was not in control experiments with Es. coli Rosetta (DE3) pET28a (lanes 2 and 4, respectively). The a-subunit with histag and b-subunit with predicted molecular weights of 27 and 24 kDa, respectively, are clearly observed in Fig. 6. The accessory protein gene of 14 kDa is not observed in lanes 1 and 3, whereas it could be observed in the purified NHase (lane 6, arrow III) and its quantity was comparatively lower than the a-subunit. Interestingly, the expressed En.
Fig. 5. Neighbor-joining phylogenetic tree of NHases. Bootstrap percentages from 1000 replicates shown at nodes; bar, 2% sequence divergence; Pseudomonas and Rhodococcus species selected from Blastp results in the GenBank database.
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
Fig. 6. SDS-PAGE of CGMCC 7333 NHase gene overexpressed in Es. coli Rosetta (DE3). Lane 1, soluble proteins of Es. coli Rosetta-pET28a harboring NHase genes; lane 2, soluble proteins of Es. coli Rosetta-pET28a lacking NHase genes; lane 3, total proteins of Es. coli Rosetta-pET28a harboring NHase genes; lane 4, total proteins of Es. coli RosettapET28a lacking NHase genes; lane M, standard protein markers (116.0, 66.2, 45.0, 35.0, 25.0, 18.4, and 14.4 kDa); lane 5, soluble proteins of overexpressed NHase in Es. coli Rosetta; lane 6, the purified NHase; lane 7, the proteins in the eluted solution of immobilized metal affinity chromatography after binding NHase. Arrows I, II and III represent the expressed a-subunit, b-subunit and accessory protein.
meliloti NHase is the main soluble protein (Fig. 6 lane 1), other than the major inclusion bodies of the expressed V. boronicumulans CGMCC 4969 NHase under the same overexpression conditions (Zhang et al., 2012). Transformation of THI by the resting cells of Es. coli Rosetta (DE3) pET28a-NHase with overexpression of NHase indicated that THI was converted to THI amide according to HPLC analysis, whereas cells without the recombinant NHase gene did not transform THI. After transformation for 10 min, the cells of Es. coli Rosetta (DE3) pET28a-NHase degraded 80.7% of THI (0.63 mmol/L) and formed 0.58 mmol/L of THI amide (Fig. 7A). The half-life of THI degradation was only 5.2 min. 3.6. Purification of NHase and its biotransformation of THI A six-His tag at the N-terminus end enabled purification of the recombinant NHase by immobilized metal affinity chromatography. The purified NHase was confirmed as electrophoretically pure by SDS-PAGE as shown in Fig. 6 (lane 6). HPLC analysis indicated that the purified NHase converted THI to THI amide, whereas the control without the recombinant NHase did not transform THI (Fig. 7B). The NHase degraded 80.6% of THI (0.70 mmol/L) and formed 0.60 mmol/L of THI amide in 5 min. The molar conversion rate was 85.7% and the half-life of THI degradation was 6.9 min (R ¼ 0.98). The specific enzyme activity for hydrolysis of THI to form THI amide was calculated as 1.37 U/mg proteins. The heterogeneous overexpression of the NHase gene and the purified NHase indicated that the major hydration pathway in the biotransformation of THI by En. meliloti CGMCC 7333 is mediated by a nitrile hydratase. The NHase gene cluster is composed of three genes corresponding to the a-subunit, b-subunit and accessory protein genes, and the protein expression system only labeled the N-terminus end of the a-subunit and the C-terminus end of the accessory protein with the His tag. Therefore, the majority of the b-subunit without His tag was eluted during the purification of the recombinant NHase by immobilized metal affinity chromatography (Fig. 6 lane 7). The purified NHase therefore lacks an adequate amount of the b-subunit to carry out catalysis and this leads to the specific enzyme activity for the transformation of THI to the amide metabolite being only 1.37 U/mg protein. Because the b-subunit is essential for NHase activity (Zhou et al., 2009), a small amount of b-subunit should be existed in the purified NHase, though it could not be clearly observed in SDS-PAGE (Fig. 6 lane 6).
15
Fig. 7. Time course of THI biodegradation by resting cells of Es. coli Rosetta pET28aNHase (A) and the purified NHase (B). Overexpression of NHase and resting cell THI transformation conditions described in Materials and Methods; OD600 of resting cell suspensions was 5. The enzyme concentration was 67.9 mg/mL in 0.2 mol/L phosphate buffer (pH 7.5) with the addition of 0.1 mmol/L CoCl2 and the reaction conditions were the same as for the resting cells transformation of THI. Average values and standard deviations were calculated from three parallel cultures in three experiments (n ¼ 9).
4. Discussion THI consists of three structural components involving a 6chloro-3-pyridinylmethyl moiety, a thiazolidine ring and a cyanoimine group, and metabolic pathway studies have revealed that it is readily biodegraded by metabolic attack at these three structural components. The proposed pathway of THI degradation in spinach, mice and soil is given in Fig. 8 (Khron, 2001; Casida, 2011). In the present study, En. meliloti CGMCC 7333 specifically hydrolyzed the cyanoimine group of THI to the amide metabolite and 90.9% of the reduced THI was converted to THI amide. Therefore the hydrolysis of THI to its amide metabolite is the major pathway of degradation of THI by En. meliloti CGMCC 7333 (Fig. 8). It has been proposed that THI amide is cleaved to THI imine or converted to THI sulfonic acid (M30) in soil, and microbial metabolism is the major pathway of degradation of THI in soil (Krohn, 2001). However, no other peaks were observed in the HPLC and LC-MS analyses of THI transformation by CGMCC 7333. Therefore, THI amide appears to be the final metabolite in the transformation of THI by CGMCC 7333, precluding further degradation to THI imine or M30 by CGMCC 7333. On the other hand, studies on interactions between enzymes and inhibitors and neonicotinoid insecticides have indicated that cytochrome P450 enzymes are involved in the hydroxylation of the THI thiazolidine ring to form 4-hydroxy THI. Cytochrome P450 enzymes are usually NAD(P)H-dependent oxidoreductases and require a utilizable substrate such as glucose or succinate as an electron donor to perform hydroxylation (Shi et al., 2009; Zhao et al., 2009). In the present study, Es. coli Rosetta (DE3) pET28aNHase overexpressing NHase and the purified NHase both hydrolyze THI to THI amide, which indicates that NHase is responsible for this biotransforamtion. NHase is a metalloenzyme with mononuclear iron or non-corrinoid cobalt in its active site and, therefore, iron or cobalt should be supplied during cell growth and the NHase induction period (Cameron et al., 2005). NHases have also been discovered in several genera of plantassociated bacteria and N2-fixing bacteria, such as Agrobacterium, Bradyrhizobium, Mesorhizobium, Rhizobium, Pseudomonas, and Variovorax. However, only NHase from Variovorax have been studied in detail (Velankar et al., 2010; Zhang et al., 2012). The genus Ensifer comprises En. adhaerens and the species in the genus formerly known as Sinorhizobium (Yutani et al., 2011).
16
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17
Fig. 8. Metabolic pathways of THI in mice, spinach, and soil and the proposed metabolic pathways of degradation of THI by En. meliloti CGMCC 7333.
Sinorhizobium bacteria are capable of nitrogen fixation in symbiosis with leguminous plants. Sinorhizobium meliloti is an a-proteobacterium that forms agronomically important N2-fixing root nodules in legumes (Kuiper et al., 2004). Interestingly, we recently found that En. adhaerens CGMCC 6315, a thiamethoxam degrading bacterium reported by Zhou et al. (2013), can hydrolyze THI to THI amide. We isolated an Ensifer sp. SCL3-19, which is different from En. meliloti CGMCC 7333 by morphology and 16S rRNA gene analysis, that also degrades THI to THI amide (data not shown). The NHase genes from En. adhaerens CGMCC 6315 and Ensifer sp. SCL319 are being cloned and expressed to further explore the functions of NHases from genus Ensifer. THI is quickly degraded in soil under laboratory or field conditions. For example, the half-life of THI in soils under field conditions in northern Europe ranged from 9 to 27 d, and was 10e16 d in southern European soil (Krohn, 2001); the half-lives of THI in Chinese soils under laboratory conditions were less than 5 d (Liu et al., 2011; Wang et al., 2011). We further proved that soil microbial activity strongly affects the degradation of THI and isolated a yeast, R. mucilaginosa IM-2, and a bacterium, V. boronicumulans CGMCC 4969, which could degrade THI with half-lives of 14.3 d and 1.8 d, respectively (Dai et al., 2010; Liu et al., 2011; Zhang et al., 2012). In this study, En. meliloti CGMCC 7333 displayed more rapid THI degradation than R. mucilaginosa IM-2 and V. boronicumulans CGMCC 4969, and its half-life of THI degradation is only 20.1 h. En. meliloti CGMCC 7333 also exhibited THI degradation in soil, but its half-life is 37.3 d (R2 ¼ 0.98). A lower THI degradation in soil compared to culture broth was also observed for THI degradation by R. mucilaginosa IM-2 (Dai et al., 2010); even V. boronicumulans CGMCC 4969 cannot degrade THI in soil (data not shown). We speculate that there may be diverse THI degrading microbes in natural soils, which might act in combination with En.
meliloti CGMCC 7333 and/or R. mucilaginosa IM-2 to quickly degrade THI. En. meliloti is the first N2-fixing bacterium found to be capable of transforming the neonicotinoid insecticide THI in pure culture and in soil. We propose that En. meliloti may be used for the biodegradation of neonicotinoid THI in contaminated soil and can be developed as a bio-fertilizer. Acknowledgments This research was financed by the Priority Academic Program Development (PAPD) of Jiangsu Higher Education Institutions, National Science Foundation of China (31370143, 30970040), and NSFC for Talents Training in Basic Science (J1103507). References Banerjee, A., Sharma, R., Banerjee, U., 2002. The nitrile-degrading enzymes: current status and future prospects. Appl. Microbiol. Biotechnol. 60, 33e44. Barillot, C.C., Sarde, C.-O., Bert, V., Tarnaud, E., Cochet, N., 2013. A standardized method for the sampling of rhizosphere and rhizoplan soil bacteria associated to a herbaceous root system. Ann. Microbiol. 63, 471e476. Cameron, R.A., Sayed, M., Cowan, D.A., 2005. Molecular analysis of the nitrile catabolism operon of the thermophile Bacillus pallidus RAPc8. Biochim. Biophys. Acta 1725, 35e46. Casida, J.E., 2011. Neonicotinoid metabolism: compounds, substituents, pathways, enzymes, organisms, and relevance. J. Agric. Food Chem. 59, 2923e2931. Dai, Y.J., Ji, W.W., Chen, T., Zhang, W.J., Liu, Z.H., Ge, F., Yuan, S., 2010. Metabolism of the Neonicotinoid insecticides acetamiprid and thiacloprid by the yeast Rhodotorula mucilaginosa strain IM-2. J. Agric. Food Chem. 58, 2419e2425. Feng, Y.S., Lee, C.-M., Chen, L.-J., 2007. The effect of urea, glucose, and ε-caprolactam on the conversion of nitriles into amides by Nocardioides jensenii and Mesorhizobium sp. Int. Biodeterior. Biodegrad. 59, 211e215. Jeschke, P., Nauen, R., Schindler, M., Elbert, A., 2011. Overview of the status and global strategy for neonicotinoids. J. Agric. Food Chem. 59, 2897e2908.
F. Ge et al. / International Biodeterioration & Biodegradation 93 (2014) 10e17 Krohn, J., 2001. Behaviour of thiacloprid in the environment. PflanzenschutzNachrichten Bayer. 54, 281e290. Kuiper, I., Lagendijk, E.L., Bloemberg, G.V., Lugtenberg, B.J.J., 2004. Rhizoremediation: a beneficial plant-microbe interaction. Mol. Plant-Microbe Interact. 17, 6e15. Liu, Z., Dai, Y., Huang, G., Gu, Y., Ni, J., Wei, H., Yuan, S., 2011. Soil microbial degradation of neonicotinoid insecticides imidacloprid, acetamiprid, thiacloprid and imidaclothiz and its effect on the persistence of bioefficacy against horsebean aphid Aphis craccivora Koch after soil application. Pest Manag. Sci. 67, 1245e1252. Lopez, O., Fernandez-Bolanos, J.G., Gil, M.V., 2005. New trends in pest control: the search for greener insecticides. Green Chem. 7, 431e442. Nagasawa, T., Shimizu, H., Yamada, H., 1993. The superiority of the third-generation catalyst, Rhodococcus rhodochrous J1 nitrile hydratase, for industrial production of acrylamide. Appl. Microbiol. Biotechnol. 40, 189e195. Nielsen, M.K.K., Holtze, M.S., Svensmark, B., Juhler, R.K., 2007. Demonstrating formation of potentially persistent transformation products from the herbicides bromoxynil and ioxynil using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Pest Manag. Sci. 63, 141e149. Rzeznicka, K., Schätzle, S., Böttcher, D., Klein, J., Bornscheuer, U.T., 2010. Cloning and functional expression of a nitrile hydratase (NHase) from Rhodococcus equi TG328-2 in Escherichia coli, its purification and biochemical characterisation. Appl. Microbiol. Biotechnol. 85, 1417e1425. Shi, X., Dick, R.A., Ford, K.A., Casida, J.E., 2009. Enzymes and inhibitors in neonicotinoid insecticide metabolism. J. Agric. Food Chem. 57, 4861e4866. Sgroy, V., Cassan, F., Masciarelli, O., Del Papa, M.F., Lagares, A., Luna, V., 2009. Isolation and characterization of endophytic plant growth-promoting (PGPB) or stress homeostasis-regulating (PSHB) bacteria associated to the halophyte Prosopis strombulifera. Appl. Microbiol. Biotechnol. 85, 371e381.
17
Velankar, H., Clarke, K.G., du Preez, R., Cowan, D.A., Burton, S.G., 2010. Developments in nitrile and amide biotransformation processes. Trends Biotechnol. 28, 561e569. Wang, C., Guan, W.-B., Zhang, H.-Y., 2011. Dissipation and residue of thiacloprid in cabbage and soil. Bull. Environ. Contam. Toxicol. 87, 440e443. Yang, Y., Chen, T., Ma, P., Shang, G., Dai, Y., Yuan, S., 2010. Cloning, expression and functional analysis of nicotinate dehydrogenase gene cluster from Comamonas testosteroni JA1 that can hydroxylate 3-cyanopyridine. Biodegradation 21, 593e 602. Yutani, M., Taniguchi, H., Borjihan, H., Ogita, A., Fujita, K.-i., Tanaka, T., 2011. Alliinase from Ensifer adhaerens and its use for generation of fungicidal activity. AMB Express 1, 1e8. Zhang, H.J., Zhou, Q.W., Zhou, G.C., Cao, Y.M., Dai, Y.J., Ji, W.W., Shang, G.D., Yuan, S., 2012. Biotransformation of the neonicotinoid insecticide thiacloprid by the bacterium Variovorax boronicumulans strain J1 and mediation of the major metabolic pathway by nitrile hydratase. J. Agric. Food Chem. 60, 153e159. Zhao, Y.J., Dai, Y.J., Yu, C.G., Luo, J., Xu, W.P., Ni, J.P., Yuan, S., 2009. Hydroxylation of thiacloprid by bacterium Stenotrophomonas maltophilia CGMCC 1.1788. Biodegradation 20, 761e768. Zhou, G.C., Wang, Y., Zhai, S., Ge, F., Liu, Z.H., Dai, Y.J., Yuan, S., Hou, J.Y., 2013. Biodegradation of the neonicotinoid insecticide thiamethoxam by the nitrogenfixing and plant-growth-promoting rhizobacterium Ensifer adhaerens strain TMX-23. Appl. Microbiol. Biotechnol. 97, 4065e4074. Zhou, Z., Hashimoto, Y., Kobayashi, M., 2009. Self-subunit swapping chaperone needed for the maturation of multimeric metalloenzyme nitrile hydratase by a subunit exchange mechanism also carries out the oxidation of the metal ligand cysteine residues and insertion of cobalt. J. Biolog. Chem. 284, 14930e14938.