- Email: [email protected]
Hydroxy-pentanones production by Bacillus sp. H15-1 and its complete genome sequence
Accepted Manuscript Title: Hydroxy-pentanones production by Bacillus sp. H15-1 and its complete genome sequence Authors: Zijun Xiao, Linhui Wang, Rulin Gu, Jing-yi Zhao, Xiaoyuan Hou, Hu Zhu PII: DOI: Reference:
S0168-1656(17)31594-8 http://dx.doi.org/10.1016/j.jbiotec.2017.08.008 BIOTEC 7988
To appear in:
Journal of Biotechnology
Received date: Revised date: Accepted date:
14-1-2017 8-8-2017 9-8-2017
Please cite this article as: Xiao, Zijun, Wang, Linhui, Gu, Rulin, Zhao, Jingyi, Hou, Xiaoyuan, Zhu, Hu, Hydroxy-pentanones production by Bacillus sp.H15-1 and its complete genome sequence.Journal of Biotechnology http://dx.doi.org/10.1016/j.jbiotec.2017.08.008 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Journal: Journal of Biotechnology Manuscript ID: JBIOTEC-D-17-00050
REVISION
Short genome communications
Hydroxy-pentanones production by Bacillus sp. H15-1 and its complete genome sequence
Zijun Xiao a, Linhui Wang a, Rulin Gu a, Jing-yi Zhao a, Xiaoyuan Hou a, Hu Zhu a,b*
a
Center for Bioengineering and Biotechnology, State Key Laboratory of Heavy Oil Processing,
China University of Petroleum (East China), Qingdao 266580, China b
College of Chemistry and Materials, Fujian Normal University, Fuzhou 350007, China
*Corresponding author. H. Zhu: [email protected], Phone / Fax: 0086-532-86981561
-1-
Highlights
Two unknown metabolites were produced by a new thermophilic Bacillus isolate.
The two unknown metabolites were identified to be hydroxy-pentanones.
The complete genome of this Bacillus strain was sequenced.
ALS and ALDC were found to be capable of transforming pyruvate and 2-oxobutanoate to the two hydroxy-pentanones.
Abstract Acyloins are useful organic compounds with reactive adjacent hydroxyl group and carbonyl group. Current research is usually constrained to acetoin (i.e. 3-hydroxy-2-butanone) and the biological production of other acyloins was scarcely reported. In this study, two hydroxy-pentanone metabolites (3-hydroxy-2-pentanone and 2-hydroxy-3-pentanone) of Bacillus sp. H15-1 were identified by gas chromatography–mass spectrometry and authentic standards. Then the complete genome of this strain was sequenced and de novo assembled to a single circular chromosome of 4,162,101 bp with a guanine-cytosine content of 46.3%, but no special genes were found for the biosynthesis of the hydroxy-pentanones. Since hydroxy-pentanones are the homologues of acetoin, the two genes alsD and alsS (encoding α-acetolactate decarboxylase and α-acetolactate synthase, respectively) responsible for acetoin formation in this strain were respectively expressed in Escherichia coli. The purified enzymes were found to be capable of transforming pyruvate and 2-oxobutanoate to the two hydroxy-pentanones. This study extends the knowledge on the biosynthesis of acyloins and provides
-2-
helpful information for further utilizing Bacillus sp. H15-1 as a source of valuable acyloins.
Keywords: 3-hydroxy-2-pentanone and 2-hydroxy-3-pentanone; biosynthesis mechanism; Bacillus sp. H15-1; complete genome sequence
Acyloins are a class of organic compounds that contain a hydroxyl group placed on the α-position of a carbonyl group. Acetoin (3-hydroxy-2-butanone) is the mostly studied acyloin due to its broad usages (Xiao and Lu, 2014a) and important physiological meanings (Xiao and Xu, 2007). This compound widely exists in nature and it can be biosynthesized by not only some microorganisms but also some higher plants and animals (Xiao and Lu, 2014b). Similar to acetoin, other aliphatic acyloins can also be found in a variety of food materials such as cheese, butter, wine, coffee, honey, durian, etc. (Neuser et al., 2000). However, when compared with acetoin, there are only very limited investigations for these compounds. The potential of their applications and physiological significances may have been underestimated before. Bacillus sp. H15-1 can produce 50.8 g/L of acetoin and 32.1 g/L of 2,3-butanediol from maize flour at 50 °C, which is a new titer record of acetoin fermentation among known thermophilic producing systems (Xiao et al., 2017). During gas chromatography (GC) analysis of the products, two new unknown peaks emerged. To exclude the influence of the culture medium, strain H15-1 was cultivated in an ordinary medium, the Luria-Bertani (LB) medium, supplemented with glucose. Briefly, the seed culture of H15-1 was prepared by growing the bacterium at 50 °C in 50 mL of LB broth in a 250-mL baffled flask for 12 h with agitation at 120 rpm. Then 1.0 mL of the seed culture
-3-
was inoculated into 50 mL of fermentative medium (LB + 80 g/L of glucose) and cultured at 50 °C for 36 h with agitation at 150 rpm. The broth was extracted with dichloromethane and analyzed using an Agilent 7890B GC according to a previous method (Xiao et al., 2014). As shown in Figure 1A, the two new unknown peaks (X and Y) also occurred in the LB plus glucose culture broth. Gas chromatography–mass spectrometry (GC-MS) analysis were performed at CI (chemical ionization) mode (Figure 1B) and EI (electron impact) mode (Figure 1C) using GCMS-QP2010 (Shimadzu) equipped with a 30 m DB-5MS column (J & W Scientific, USA). Peak X and Y were tentatively identified to be 3-hydroxy-2-pentanone (3-HP) and 2-hydroxy-3-pentanone (2-HP), respectively. The EI–MS of 3-HP and 2-HP were identical to those reported by Höckelmann and Jüttner (2005). However, the authors did not illustrate the mass spectral fragmentation pathways. More seriously, Neuser et al. (2000) reported quit different EI–MS data of the two compounds. 3-HP and 2-HP were unavailable from commercial sources. Thus in order to further confirm the two metabolites, 3-HP and 2-HP were synthesized by the oxidation of 2-pentanone with sodium bromate followed by basic hydrolysis according to a similar method for acetoin synthesis (Zhu et al., 2009). The synthesized hydroxy-pentanones shared identical GC retention times and mass spectra with those of the two metabolites. Therefore, the two new unknown products of strain H15-1 were identified to be 3-HP and 2-HP. As discussed above, there were some reports about the occurrences of these aliphatic acyloins, but scarce reports about their biosynthesis mechanisms. On the other hand, there are about three hundred complete genomes of Bacillus species currently available in the GenBank database, but the information whether these Bacillus species can produce the hydroxy-pentanones is unavailable. In -4-
order to identify the mechanism of hydroxy-pentanones production on genomic level, we have sequenced the complete genome of strain H15-1. Genomic DNA from Bacillus sp. H15-1 was extracted using TIANamp Bacteria DNA Kit from TIANGEN Biotech (Beijing) Co., Ltd. Then a 10 kb insert SMRTbell DNA library was constructed and sequenced on the single molecule real-time (SMRT) DNA sequencing platform by the PacBio RS II sequencer (Pacific Biosciences, CA) (Eid et al., 2009). After the filtration of low quality reads, a total of 75,834 qualified reads with mean length of 10,816 bp were de novo assembled using the hierarchical genome assembly process (HGAP) (Chin et al., 2013) protocol RS_HGAP_Assembly.3 (Pacific Biosciences, CA) (Jeong et al., 2016), resulting in 197.1x coverage of one circular chromosome of 4,162,101 bp. The coding sequences (CDSs) were predicted by Prokaryotic Genome Annotation Pipeline (PGAP) version 4.0 software on NCBI (https://www.ncbi.nlm.nih.gov/genome/annotation_prok/). The features for the complete genome sequence of Bacillus sp. H15-1 are summarized in Table 2. As two homologues of acetoin, one may consider that 3-HP and 2-HP are derived from acetoin. However, the direct carbon-chain elongation is challenging for most chemical reactions and there are only a very limited number of enzymes that have been found for C–C bond formation (Resch et al., 2011). The two directions of the acetoin molecular carbon-chain are different but similar amount of 3-HP and 2-HP were detected, which is unusual if direct carbon-chain elongation of acetoin was catalyzed by enzymes. To further exclude the hypothesis that the two acyloins are the products of modification of acetoin during fermentation, 3-HP and 2-HP producing cells (at the age of 36 h of the fermentation process, while the amounts of 3-HP and 2-HP were still increasing in the fermentation -5-
broth) were harvested by centrifugation. These cells were then washed with sterile saline before inoculated into an acetoin medium (LB + 20 g/L of acetoin) for a prolonged cultivation. Control experiments were carried out using a glucose medium (LB + 40 g/L of glucose). 3-HP and 2-HP were detected in the control experiments but not in the testing set using the acetoin medium. Acetylbutanediol, a common metabolite of acetoin catabolism (Xiao et al., 2009), was detected, indicating that the acetoin metabolic pathway of strain Bacillus sp. H15-1 is similar to that of typical Bacillus strains. As is well known, α-acetolactate decarboxylase (ALDC, encoded by alsD) and α-acetolactate synthase (ALS, encoded by alsS) are responsible for acetoin biosynthesis in Bacillus species (Xiao and Lu, 2014a). Since hydroxy-pentanones are the homologues of acetoin, there might be extra homologous genes of alsD and alsS responsible for hydroxy-pentanone biosynthesis in strain H15-1. However, BLAST searches of the whole genome of strain H15-1 using validated ALDC and/or ALS sequences from all known species as queries did not find any special genes for the generation of the hydroxy-pentanones, but just found a very common acetoin biosynthesis gene cluster including alsD (locus tag BSZ43_18955), alsS (BSZ43_18960), and alsR (BSZ43_18965, encoding a LysR family transcriptional regulator). Thus alsD and alsS were postulated to not only be responsible for acetoin biosynthesis, but also play a part in hydroxy-pentanone formation in strain H15-1. To verify this hypothesis, the two genes were cloned and expressed in Escherichia coli (Xiao et al., 2010). Briefly, the alsD gene was amplified by PCR (forward primer, CGCCATATGATGAAAAGTGCAAGCA; reverse primer, CCGGAATTCTTACTCGGGATTGCCT) and inserted into pET-28a using restriction endonucleases NdeI and EcoRI and expressed in E. coli BL21 (DE3). The alsS gene was amplified -6-
using primers (forward, CGGATCCTTGAATAATGTAGCCGCT; reverse, CCGGAATTCTCAAGATTGCTTAGAG) and inserted into petDuet-1 using BamHI and EcoRI and also expressed in BL21 (DE3). The His-tagged proteins were then routinely separated using Ni-NTA agarose columns. As shown in Figure 2B, the two enzymes ALDC and ALS were purified to homogeneity. The purified enzymes were used in the following reaction system: 100 mM of pyruvate or 50 mM of pyruvate plus 50 mM of 2-oxobutanoate, 1 mM of MgCl2, 1 mM of thiamine pyrophosphate (TPP), and 20 μM of flavin adenine dinucleotide in 100 mM of phosphate buffer. The reactions were carried out at pH 7.0 in 50 °C water bath for 60 min. The reactants were extracted with dichloromethane and submitted to GC analysis. When pyruvate was served as the sole substrate, only acetoin was detected (Figure 2A, red line). However, when pyruvate and 2-oxobutanoate were used as the co-substrates, not only acetoin, but also 3-HP and 2-HP were detected (Figure 2A, black line). By calculating the peak areas of the products, the enzymatic activity decreased to about one sixth when co-substrates were used. Control experiments without the two enzymes did not yield the hydroxy-pentanone products. 2-Oxobutanoate can be generated from threonine or 3-methylmalate in vivo. Therefore, ALDC and ALS catalysing pyruvate and 2-oxobutanoate transformation were thus postulated to involve in the generation of 3-HP and 2-HP in Bacillus sp. H15-1. The odors of these two hydroxy-pentanones can be described as caramel-sweet, buttery, and hay-like (Neuser et al., 2000). These acyloins can be produced by some lactic acid bacteria (Ávila et al., 2006), cyanobacteria (Höckelmann and Jüttner, 2005), coconut (Borse et al., 2007), and codfish (Chang et al., 2016). Neuser et al. (2000) obtained theses flavors by condensing either aldehydes -7-
with pyruvate or 2-keto acids with acetaldehyde using yeast pyruvate decarboxylases. Pyruvate dehydrogenases from higher animals can also catalyse the reaction between pyruvate and saturated aldehydes to produce 3-hydroxyalkan-2-ones (Montgomery et al., 1993). In Pseudomonas putida ATCC 12633, benzoylformate and acetaldehyde can be condensed to 2-hydroxypropiophenone by the action of benzoylformate decarboxylase (Wilcocks et al., 1992). In thermophilic bacterium Thermosporothrix hazakensis SK20-1, 4-methyl-2-oxovalerate and phenyl pyruvate can be transformed to acyloins by Thzk0150, which is also a TPP-dependent enzyme (Park et al., 2014). Nevertheless, to the best of our knowledge, this is the first finding of hydroxy-pentanone formation catalysed by ALDC and ALS. The present study extends the knowledge on the biosynthesis of acyloins and the genome data would be helpful for further developing Bacillus sp. H15-1 as a source of valuable acyloin products.
Strain and nucleotide sequence accession number Bacillus sp. H15-1 has been deposited in China General Microbiological Culture Collection Center with deposition number CGMCC 12389. The complete genome sequence has been deposited in GenBank under accession number CP018249.
Acknowledgments This research was funded by the National Natural Science Foundation of China (grant No. 21376264), the Natural Science Foundation of Shandong Province (grant No. ZR2016CB11), and the Fundamental Research Funds for the Central Universities of China (grant Nos. 17CX05014, -8-
16CX02043A).
References Ávila, M., Garde, S., Fernández-García, E., Medina, M., Nuñez, M., 2006. Effect of high-pressure treatment and a bacteriocin-producing lactic culture on the odor and aroma of Hispánico cheese: Correlation of volatile compounds and sensory analysis. J. Agric. Food Chem. 54, 382–389. doi:10.1021/jf051848f Borse, B.B., Rao, L.J.M., Ramalakshmi, K., Raghavan, B., 2007. Chemical composition of volatiles from coconut sap (neera) and effect of processing. Food Chem. 101, 877–880. doi:10.1016/j.foodchem.2006.02.026 Chang, Y., Hou, H., Li, B., 2016. Identification of volatile compounds in codfish (Gadus) by a combination of two extraction methods coupled with GC-MS analysis. J. Ocean Univ. China 15, 509–514. doi:10.1007/s11802-016-2852-9 Chin, C.-S., Alexander, D.H., Marks, P., Klammer, A.A., Drake, J., Heiner, C., Clum, A., Copeland, A., Huddleston, J., Eichler, E.E., Turner, S.W., Korlach, J., 2013. Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nat. Meth. 10, 563–569. doi:10.1038/nmeth.2474 Eid, J., Fehr, A., Gray, J., Luong, K., Lyle, J., Otto, G., Peluso, P., Rank, D., Baybayan, P., Bettman, B., Bibillo, A., Bjornson, K., Chaudhuri, B., Christians, F., Cicero, R., Clark, S., Dalal, R., deWinter, A., Dixon, J., Foquet, M., Gaertner, A., Hardenbol, P., Heiner, C., Hester, K., Holden, D., Kearns, G., Kong, X., Kuse, R., Lacroix, Y., Lin, S., Lundquist, P., Ma, C., Marks, P., -9-
Maxham, M., Murphy, D., Park, I., Pham, T., Phillips, M., Roy, J., Sebra, R., Shen, G., Sorenson, J., Tomaney, A., Travers, K., Trulson, M., Vieceli, J., Wegener, J., Wu, D., Yang, A., Zaccarin, D., Zhao, P., Zhong, F., Korlach, J., Turner, S., 2009. Real-time DNA sequencing from single polymerase molecules. Science 323, 133–138. doi:10.1126/science.1162986 Höckelmann, C., Jüttner, F., 2005. Off-flavours in water: hydroxyketones and beta-ionone derivatives as new odour compounds of freshwater cyanobacteria. Flavour Fragr. J. 20, 387–394. doi:10.1002/ffj.1464 Jeong, H., Lee, D.-H., Ryu, C.-M., Park, S.-H., 2016. Toward complete bacterial genome sequencing through the combined use of multiple next-generation sequencing platforms. J. Microbiol. Biotechnol. 26, 207–212. doi:10.4014/jmb.1507.07055 Montgomery, J.A., Jetté, M., Huot, S., Des Rosiers, C., 1993. Acyloin production from aldehydes in the perfused rat heart: the potential role of pyruvate dehydrogenase. Biochem. J. 294, 727–733. doi:10.1042/bj2940727 Neuser, F., Zorn, H., Berger, R.G., 2000. Generation of odorous acyloins by yeast pyruvate decarboxylases and their occurrence in sherry and soy sauce. J. Agric. Food Chem. 48, 6191–6195. doi:10.1021/jf000535b Park, J.-S., Kagaya, N., Hashimoto, J., Izumikawa, M., Yabe, S., Shin-ya, K., Nishiyama, M., Kuzuyama, T., 2014. Identification and biosynthesis of new acyloins from the thermophilic bacterium Thermosporothrix hazakensis SK20-1(T). Chembiochem 15, 527–532. doi:10.1002/cbic.201300690
- 10 -
Resch, V., Schrittwieser, J.H., Siirola, E., Kroutil, W., 2011. Novel carbon-carbon bond formations for biocatalysis. Curr. Opin. Biotechnol. 22, 793–799. doi:10.1016/j.copbio.2011.02.002 Wilcocks, R., Ward, O.P., Collins, S., Dewdney, N.J., Hong, Y., Prosen, E., 1992. Acyloin formation by benzoylformate decarboxylase from Pseudomonas putida. Appl. Environ. Microbiol. 58, 1699–1704. Xiao, Z., Gu, R., Hou, X., Zhao, J., Zhu, H., Lu, J.R., 2017. Non-sterilized fermentative production of acetoin with 2,3-butanediol as a main byproduct from maize hydrolysate by a newly isolated thermophilic Bacillus strain. J. Chem. Technol. Biotechnol. doi:10.1002/jctb.5301 Xiao, Z., Hou, X., Lyu, X., Xi, L., Zhao, J., 2014. Accelerated green process of tetramethylpyrazine production from glucose and diammonium phosphate. Biotechnol. Biofuels 7, 106. doi:10.1186/1754-6834-7-106 Xiao, Z., Lu, J.R., 2014a. Strategies for enhancing fermentative production of acetoin: A review. Biotechnol. Adv. 32, 492–503. doi:10.1016/j.biotechadv.2014.01.002 Xiao, Z., Lu, J.R., 2014b. Generation of acetoin and its derivatives in foods. J. Agric. Food Chem. 62, 6487–6497. doi:10.1021/jf5013902 Xiao, Z., Lv, C., Gao, C., Qin, J., Ma, C., Liu, Z., Liu, P., Li, L., Xu, P., 2010. A novel whole-cell biocatalyst with NAD+ regeneration for production of chiral chemicals. PLoS One 5, 1–6. doi:10.1371/journal.pone.0008860 Xiao, Z., Ma, C., Xu, P., Lu, J.R., 2009. Acetoin catabolism and acetylbutanediol formation by Bacillus pumilus in a chemically defined medium. PLoS One 4. doi:10.1371/journal.pone.0005627 - 11 -
Xiao, Z., Xu, P., 2007. Acetoin metabolism in bacteria. Crit. Rev. Microbiol. 33, 127–140. doi:10.1080/10408410701364604 Zhu, Z., Huang, S., Yang, H., Zhao, Y., Chen, X., Su, L., Li, Y., 2009. Synthesis of acetoin by oxidation with sodium bromate. Flavour Fragr. Cosmet. 4, 11–13.
- 12 -
Table 1. Genome features of Bacillus sp. H15-1. Features
Values
Chromosome number
1
Genome size (bp)
4,162,101
Guanine-cytosine content (%) 46.3 Plasmid number
0
Genes (total)
4,293
Genes (coding)
4,012
Pseudo genes
171
rRNAs
24
tRNAs
81
ncRNAs
5
- 13 -
Figure Captions
Figure 1. GC and MS analysis of the two unknown metabolites (X and Y) of Bacillus sp. H15-1. A, GC profile of the products from strain H15-1 when cultured in LB medium supplemented with 80 g/L of glucose; B and C, CI and EI mass spectra of the two unknown metabolites and their proposed ion fragmentation pathways.
Figure 2. GC profile of the enzymatic products (A) and SDS-PAGE analysis of the purified enzymes (B). Red line of the GC profile, pyruvate as the substrate; black line, pyruvate and 2-oxobutanoate as - 14 -
the co-substrates. Left lane of the SDS-PAGE, ALDC; right lane, ALS; marker: 97.2, 66.4, 44.3, 29.0, 20.1, 14.3 kDa. Calculated molecular weights from amino acid sequences of ALDC and ALS are 31.157 and 65.627 kDa, respectively.
- 15 -
S0168-1656(17)31594-8 http://dx.doi.org/10.1016/j.jbiotec.2017.08.008 BIOTEC 7988
To appear in:
Journal of Biotechnology
Received date: Revised date: Accepted date:
14-1-2017 8-8-2017 9-8-2017
Please cite this article as: Xiao, Zijun, Wang, Linhui, Gu, Rulin, Zhao, Jingyi, Hou, Xiaoyuan, Zhu, Hu, Hydroxy-pentanones production by Bacillus sp.H15-1 and its complete genome sequence.Journal of Biotechnology http://dx.doi.org/10.1016/j.jbiotec.2017.08.008 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Journal: Journal of Biotechnology Manuscript ID: JBIOTEC-D-17-00050
REVISION
Short genome communications
Hydroxy-pentanones production by Bacillus sp. H15-1 and its complete genome sequence
Zijun Xiao a, Linhui Wang a, Rulin Gu a, Jing-yi Zhao a, Xiaoyuan Hou a, Hu Zhu a,b*
a
Center for Bioengineering and Biotechnology, State Key Laboratory of Heavy Oil Processing,
China University of Petroleum (East China), Qingdao 266580, China b
College of Chemistry and Materials, Fujian Normal University, Fuzhou 350007, China
*Corresponding author. H. Zhu: [email protected], Phone / Fax: 0086-532-86981561
-1-
Highlights
Two unknown metabolites were produced by a new thermophilic Bacillus isolate.
The two unknown metabolites were identified to be hydroxy-pentanones.
The complete genome of this Bacillus strain was sequenced.
ALS and ALDC were found to be capable of transforming pyruvate and 2-oxobutanoate to the two hydroxy-pentanones.
Abstract Acyloins are useful organic compounds with reactive adjacent hydroxyl group and carbonyl group. Current research is usually constrained to acetoin (i.e. 3-hydroxy-2-butanone) and the biological production of other acyloins was scarcely reported. In this study, two hydroxy-pentanone metabolites (3-hydroxy-2-pentanone and 2-hydroxy-3-pentanone) of Bacillus sp. H15-1 were identified by gas chromatography–mass spectrometry and authentic standards. Then the complete genome of this strain was sequenced and de novo assembled to a single circular chromosome of 4,162,101 bp with a guanine-cytosine content of 46.3%, but no special genes were found for the biosynthesis of the hydroxy-pentanones. Since hydroxy-pentanones are the homologues of acetoin, the two genes alsD and alsS (encoding α-acetolactate decarboxylase and α-acetolactate synthase, respectively) responsible for acetoin formation in this strain were respectively expressed in Escherichia coli. The purified enzymes were found to be capable of transforming pyruvate and 2-oxobutanoate to the two hydroxy-pentanones. This study extends the knowledge on the biosynthesis of acyloins and provides
-2-
helpful information for further utilizing Bacillus sp. H15-1 as a source of valuable acyloins.
Keywords: 3-hydroxy-2-pentanone and 2-hydroxy-3-pentanone; biosynthesis mechanism; Bacillus sp. H15-1; complete genome sequence
Acyloins are a class of organic compounds that contain a hydroxyl group placed on the α-position of a carbonyl group. Acetoin (3-hydroxy-2-butanone) is the mostly studied acyloin due to its broad usages (Xiao and Lu, 2014a) and important physiological meanings (Xiao and Xu, 2007). This compound widely exists in nature and it can be biosynthesized by not only some microorganisms but also some higher plants and animals (Xiao and Lu, 2014b). Similar to acetoin, other aliphatic acyloins can also be found in a variety of food materials such as cheese, butter, wine, coffee, honey, durian, etc. (Neuser et al., 2000). However, when compared with acetoin, there are only very limited investigations for these compounds. The potential of their applications and physiological significances may have been underestimated before. Bacillus sp. H15-1 can produce 50.8 g/L of acetoin and 32.1 g/L of 2,3-butanediol from maize flour at 50 °C, which is a new titer record of acetoin fermentation among known thermophilic producing systems (Xiao et al., 2017). During gas chromatography (GC) analysis of the products, two new unknown peaks emerged. To exclude the influence of the culture medium, strain H15-1 was cultivated in an ordinary medium, the Luria-Bertani (LB) medium, supplemented with glucose. Briefly, the seed culture of H15-1 was prepared by growing the bacterium at 50 °C in 50 mL of LB broth in a 250-mL baffled flask for 12 h with agitation at 120 rpm. Then 1.0 mL of the seed culture
-3-
was inoculated into 50 mL of fermentative medium (LB + 80 g/L of glucose) and cultured at 50 °C for 36 h with agitation at 150 rpm. The broth was extracted with dichloromethane and analyzed using an Agilent 7890B GC according to a previous method (Xiao et al., 2014). As shown in Figure 1A, the two new unknown peaks (X and Y) also occurred in the LB plus glucose culture broth. Gas chromatography–mass spectrometry (GC-MS) analysis were performed at CI (chemical ionization) mode (Figure 1B) and EI (electron impact) mode (Figure 1C) using GCMS-QP2010 (Shimadzu) equipped with a 30 m DB-5MS column (J & W Scientific, USA). Peak X and Y were tentatively identified to be 3-hydroxy-2-pentanone (3-HP) and 2-hydroxy-3-pentanone (2-HP), respectively. The EI–MS of 3-HP and 2-HP were identical to those reported by Höckelmann and Jüttner (2005). However, the authors did not illustrate the mass spectral fragmentation pathways. More seriously, Neuser et al. (2000) reported quit different EI–MS data of the two compounds. 3-HP and 2-HP were unavailable from commercial sources. Thus in order to further confirm the two metabolites, 3-HP and 2-HP were synthesized by the oxidation of 2-pentanone with sodium bromate followed by basic hydrolysis according to a similar method for acetoin synthesis (Zhu et al., 2009). The synthesized hydroxy-pentanones shared identical GC retention times and mass spectra with those of the two metabolites. Therefore, the two new unknown products of strain H15-1 were identified to be 3-HP and 2-HP. As discussed above, there were some reports about the occurrences of these aliphatic acyloins, but scarce reports about their biosynthesis mechanisms. On the other hand, there are about three hundred complete genomes of Bacillus species currently available in the GenBank database, but the information whether these Bacillus species can produce the hydroxy-pentanones is unavailable. In -4-
order to identify the mechanism of hydroxy-pentanones production on genomic level, we have sequenced the complete genome of strain H15-1. Genomic DNA from Bacillus sp. H15-1 was extracted using TIANamp Bacteria DNA Kit from TIANGEN Biotech (Beijing) Co., Ltd. Then a 10 kb insert SMRTbell DNA library was constructed and sequenced on the single molecule real-time (SMRT) DNA sequencing platform by the PacBio RS II sequencer (Pacific Biosciences, CA) (Eid et al., 2009). After the filtration of low quality reads, a total of 75,834 qualified reads with mean length of 10,816 bp were de novo assembled using the hierarchical genome assembly process (HGAP) (Chin et al., 2013) protocol RS_HGAP_Assembly.3 (Pacific Biosciences, CA) (Jeong et al., 2016), resulting in 197.1x coverage of one circular chromosome of 4,162,101 bp. The coding sequences (CDSs) were predicted by Prokaryotic Genome Annotation Pipeline (PGAP) version 4.0 software on NCBI (https://www.ncbi.nlm.nih.gov/genome/annotation_prok/). The features for the complete genome sequence of Bacillus sp. H15-1 are summarized in Table 2. As two homologues of acetoin, one may consider that 3-HP and 2-HP are derived from acetoin. However, the direct carbon-chain elongation is challenging for most chemical reactions and there are only a very limited number of enzymes that have been found for C–C bond formation (Resch et al., 2011). The two directions of the acetoin molecular carbon-chain are different but similar amount of 3-HP and 2-HP were detected, which is unusual if direct carbon-chain elongation of acetoin was catalyzed by enzymes. To further exclude the hypothesis that the two acyloins are the products of modification of acetoin during fermentation, 3-HP and 2-HP producing cells (at the age of 36 h of the fermentation process, while the amounts of 3-HP and 2-HP were still increasing in the fermentation -5-
broth) were harvested by centrifugation. These cells were then washed with sterile saline before inoculated into an acetoin medium (LB + 20 g/L of acetoin) for a prolonged cultivation. Control experiments were carried out using a glucose medium (LB + 40 g/L of glucose). 3-HP and 2-HP were detected in the control experiments but not in the testing set using the acetoin medium. Acetylbutanediol, a common metabolite of acetoin catabolism (Xiao et al., 2009), was detected, indicating that the acetoin metabolic pathway of strain Bacillus sp. H15-1 is similar to that of typical Bacillus strains. As is well known, α-acetolactate decarboxylase (ALDC, encoded by alsD) and α-acetolactate synthase (ALS, encoded by alsS) are responsible for acetoin biosynthesis in Bacillus species (Xiao and Lu, 2014a). Since hydroxy-pentanones are the homologues of acetoin, there might be extra homologous genes of alsD and alsS responsible for hydroxy-pentanone biosynthesis in strain H15-1. However, BLAST searches of the whole genome of strain H15-1 using validated ALDC and/or ALS sequences from all known species as queries did not find any special genes for the generation of the hydroxy-pentanones, but just found a very common acetoin biosynthesis gene cluster including alsD (locus tag BSZ43_18955), alsS (BSZ43_18960), and alsR (BSZ43_18965, encoding a LysR family transcriptional regulator). Thus alsD and alsS were postulated to not only be responsible for acetoin biosynthesis, but also play a part in hydroxy-pentanone formation in strain H15-1. To verify this hypothesis, the two genes were cloned and expressed in Escherichia coli (Xiao et al., 2010). Briefly, the alsD gene was amplified by PCR (forward primer, CGCCATATGATGAAAAGTGCAAGCA; reverse primer, CCGGAATTCTTACTCGGGATTGCCT) and inserted into pET-28a using restriction endonucleases NdeI and EcoRI and expressed in E. coli BL21 (DE3). The alsS gene was amplified -6-
using primers (forward, CGGATCCTTGAATAATGTAGCCGCT; reverse, CCGGAATTCTCAAGATTGCTTAGAG) and inserted into petDuet-1 using BamHI and EcoRI and also expressed in BL21 (DE3). The His-tagged proteins were then routinely separated using Ni-NTA agarose columns. As shown in Figure 2B, the two enzymes ALDC and ALS were purified to homogeneity. The purified enzymes were used in the following reaction system: 100 mM of pyruvate or 50 mM of pyruvate plus 50 mM of 2-oxobutanoate, 1 mM of MgCl2, 1 mM of thiamine pyrophosphate (TPP), and 20 μM of flavin adenine dinucleotide in 100 mM of phosphate buffer. The reactions were carried out at pH 7.0 in 50 °C water bath for 60 min. The reactants were extracted with dichloromethane and submitted to GC analysis. When pyruvate was served as the sole substrate, only acetoin was detected (Figure 2A, red line). However, when pyruvate and 2-oxobutanoate were used as the co-substrates, not only acetoin, but also 3-HP and 2-HP were detected (Figure 2A, black line). By calculating the peak areas of the products, the enzymatic activity decreased to about one sixth when co-substrates were used. Control experiments without the two enzymes did not yield the hydroxy-pentanone products. 2-Oxobutanoate can be generated from threonine or 3-methylmalate in vivo. Therefore, ALDC and ALS catalysing pyruvate and 2-oxobutanoate transformation were thus postulated to involve in the generation of 3-HP and 2-HP in Bacillus sp. H15-1. The odors of these two hydroxy-pentanones can be described as caramel-sweet, buttery, and hay-like (Neuser et al., 2000). These acyloins can be produced by some lactic acid bacteria (Ávila et al., 2006), cyanobacteria (Höckelmann and Jüttner, 2005), coconut (Borse et al., 2007), and codfish (Chang et al., 2016). Neuser et al. (2000) obtained theses flavors by condensing either aldehydes -7-
with pyruvate or 2-keto acids with acetaldehyde using yeast pyruvate decarboxylases. Pyruvate dehydrogenases from higher animals can also catalyse the reaction between pyruvate and saturated aldehydes to produce 3-hydroxyalkan-2-ones (Montgomery et al., 1993). In Pseudomonas putida ATCC 12633, benzoylformate and acetaldehyde can be condensed to 2-hydroxypropiophenone by the action of benzoylformate decarboxylase (Wilcocks et al., 1992). In thermophilic bacterium Thermosporothrix hazakensis SK20-1, 4-methyl-2-oxovalerate and phenyl pyruvate can be transformed to acyloins by Thzk0150, which is also a TPP-dependent enzyme (Park et al., 2014). Nevertheless, to the best of our knowledge, this is the first finding of hydroxy-pentanone formation catalysed by ALDC and ALS. The present study extends the knowledge on the biosynthesis of acyloins and the genome data would be helpful for further developing Bacillus sp. H15-1 as a source of valuable acyloin products.
Strain and nucleotide sequence accession number Bacillus sp. H15-1 has been deposited in China General Microbiological Culture Collection Center with deposition number CGMCC 12389. The complete genome sequence has been deposited in GenBank under accession number CP018249.
Acknowledgments This research was funded by the National Natural Science Foundation of China (grant No. 21376264), the Natural Science Foundation of Shandong Province (grant No. ZR2016CB11), and the Fundamental Research Funds for the Central Universities of China (grant Nos. 17CX05014, -8-
16CX02043A).
References Ávila, M., Garde, S., Fernández-García, E., Medina, M., Nuñez, M., 2006. Effect of high-pressure treatment and a bacteriocin-producing lactic culture on the odor and aroma of Hispánico cheese: Correlation of volatile compounds and sensory analysis. J. Agric. Food Chem. 54, 382–389. doi:10.1021/jf051848f Borse, B.B., Rao, L.J.M., Ramalakshmi, K., Raghavan, B., 2007. Chemical composition of volatiles from coconut sap (neera) and effect of processing. Food Chem. 101, 877–880. doi:10.1016/j.foodchem.2006.02.026 Chang, Y., Hou, H., Li, B., 2016. Identification of volatile compounds in codfish (Gadus) by a combination of two extraction methods coupled with GC-MS analysis. J. Ocean Univ. China 15, 509–514. doi:10.1007/s11802-016-2852-9 Chin, C.-S., Alexander, D.H., Marks, P., Klammer, A.A., Drake, J., Heiner, C., Clum, A., Copeland, A., Huddleston, J., Eichler, E.E., Turner, S.W., Korlach, J., 2013. Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nat. Meth. 10, 563–569. doi:10.1038/nmeth.2474 Eid, J., Fehr, A., Gray, J., Luong, K., Lyle, J., Otto, G., Peluso, P., Rank, D., Baybayan, P., Bettman, B., Bibillo, A., Bjornson, K., Chaudhuri, B., Christians, F., Cicero, R., Clark, S., Dalal, R., deWinter, A., Dixon, J., Foquet, M., Gaertner, A., Hardenbol, P., Heiner, C., Hester, K., Holden, D., Kearns, G., Kong, X., Kuse, R., Lacroix, Y., Lin, S., Lundquist, P., Ma, C., Marks, P., -9-
Maxham, M., Murphy, D., Park, I., Pham, T., Phillips, M., Roy, J., Sebra, R., Shen, G., Sorenson, J., Tomaney, A., Travers, K., Trulson, M., Vieceli, J., Wegener, J., Wu, D., Yang, A., Zaccarin, D., Zhao, P., Zhong, F., Korlach, J., Turner, S., 2009. Real-time DNA sequencing from single polymerase molecules. Science 323, 133–138. doi:10.1126/science.1162986 Höckelmann, C., Jüttner, F., 2005. Off-flavours in water: hydroxyketones and beta-ionone derivatives as new odour compounds of freshwater cyanobacteria. Flavour Fragr. J. 20, 387–394. doi:10.1002/ffj.1464 Jeong, H., Lee, D.-H., Ryu, C.-M., Park, S.-H., 2016. Toward complete bacterial genome sequencing through the combined use of multiple next-generation sequencing platforms. J. Microbiol. Biotechnol. 26, 207–212. doi:10.4014/jmb.1507.07055 Montgomery, J.A., Jetté, M., Huot, S., Des Rosiers, C., 1993. Acyloin production from aldehydes in the perfused rat heart: the potential role of pyruvate dehydrogenase. Biochem. J. 294, 727–733. doi:10.1042/bj2940727 Neuser, F., Zorn, H., Berger, R.G., 2000. Generation of odorous acyloins by yeast pyruvate decarboxylases and their occurrence in sherry and soy sauce. J. Agric. Food Chem. 48, 6191–6195. doi:10.1021/jf000535b Park, J.-S., Kagaya, N., Hashimoto, J., Izumikawa, M., Yabe, S., Shin-ya, K., Nishiyama, M., Kuzuyama, T., 2014. Identification and biosynthesis of new acyloins from the thermophilic bacterium Thermosporothrix hazakensis SK20-1(T). Chembiochem 15, 527–532. doi:10.1002/cbic.201300690
- 10 -
Resch, V., Schrittwieser, J.H., Siirola, E., Kroutil, W., 2011. Novel carbon-carbon bond formations for biocatalysis. Curr. Opin. Biotechnol. 22, 793–799. doi:10.1016/j.copbio.2011.02.002 Wilcocks, R., Ward, O.P., Collins, S., Dewdney, N.J., Hong, Y., Prosen, E., 1992. Acyloin formation by benzoylformate decarboxylase from Pseudomonas putida. Appl. Environ. Microbiol. 58, 1699–1704. Xiao, Z., Gu, R., Hou, X., Zhao, J., Zhu, H., Lu, J.R., 2017. Non-sterilized fermentative production of acetoin with 2,3-butanediol as a main byproduct from maize hydrolysate by a newly isolated thermophilic Bacillus strain. J. Chem. Technol. Biotechnol. doi:10.1002/jctb.5301 Xiao, Z., Hou, X., Lyu, X., Xi, L., Zhao, J., 2014. Accelerated green process of tetramethylpyrazine production from glucose and diammonium phosphate. Biotechnol. Biofuels 7, 106. doi:10.1186/1754-6834-7-106 Xiao, Z., Lu, J.R., 2014a. Strategies for enhancing fermentative production of acetoin: A review. Biotechnol. Adv. 32, 492–503. doi:10.1016/j.biotechadv.2014.01.002 Xiao, Z., Lu, J.R., 2014b. Generation of acetoin and its derivatives in foods. J. Agric. Food Chem. 62, 6487–6497. doi:10.1021/jf5013902 Xiao, Z., Lv, C., Gao, C., Qin, J., Ma, C., Liu, Z., Liu, P., Li, L., Xu, P., 2010. A novel whole-cell biocatalyst with NAD+ regeneration for production of chiral chemicals. PLoS One 5, 1–6. doi:10.1371/journal.pone.0008860 Xiao, Z., Ma, C., Xu, P., Lu, J.R., 2009. Acetoin catabolism and acetylbutanediol formation by Bacillus pumilus in a chemically defined medium. PLoS One 4. doi:10.1371/journal.pone.0005627 - 11 -
Xiao, Z., Xu, P., 2007. Acetoin metabolism in bacteria. Crit. Rev. Microbiol. 33, 127–140. doi:10.1080/10408410701364604 Zhu, Z., Huang, S., Yang, H., Zhao, Y., Chen, X., Su, L., Li, Y., 2009. Synthesis of acetoin by oxidation with sodium bromate. Flavour Fragr. Cosmet. 4, 11–13.
- 12 -
Table 1. Genome features of Bacillus sp. H15-1. Features
Values
Chromosome number
1
Genome size (bp)
4,162,101
Guanine-cytosine content (%) 46.3 Plasmid number
0
Genes (total)
4,293
Genes (coding)
4,012
Pseudo genes
171
rRNAs
24
tRNAs
81
ncRNAs
5
- 13 -
Figure Captions
Figure 1. GC and MS analysis of the two unknown metabolites (X and Y) of Bacillus sp. H15-1. A, GC profile of the products from strain H15-1 when cultured in LB medium supplemented with 80 g/L of glucose; B and C, CI and EI mass spectra of the two unknown metabolites and their proposed ion fragmentation pathways.
Figure 2. GC profile of the enzymatic products (A) and SDS-PAGE analysis of the purified enzymes (B). Red line of the GC profile, pyruvate as the substrate; black line, pyruvate and 2-oxobutanoate as - 14 -
the co-substrates. Left lane of the SDS-PAGE, ALDC; right lane, ALS; marker: 97.2, 66.4, 44.3, 29.0, 20.1, 14.3 kDa. Calculated molecular weights from amino acid sequences of ALDC and ALS are 31.157 and 65.627 kDa, respectively.
- 15 -