- Email: [email protected]
Hyperinsulinemia caused by dexamethasone treatment is associated with reduced insulin clearance and lower hepatic activity of insulin-degrading enzyme
Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
Contents lists available at ScienceDirect
Journal of Steroid Biochemistry & Molecular Biology journal homepage: www.elsevier.com/locate/jsbmb
Hyperinsulinemia caused by dexamethasone treatment is associated with reduced insulin clearance and lower hepatic activity of insulin-degrading enzyme André Otávio Peres Protzeka , Luiz Fernando Rezendea , José Maria Costa-Júniora , Sandra Mara Ferreiraa , Ana Paula Gameiro Cappellia , Flávia Maria Moura de Paulaa , Jane Cristina de Souzaa , Mirian Ayumi Kurautia , Everardo Magalhães Carneiroa , Alex Rafachob,c,* ,1, Antonio Carlos Boscheroa,** ,1 a b c
Department of Structural and Functional Biology, Institute of Biology, Campinas State University (UNICAMP), Campinas, Brazil Department of Physiological Sciences, Federal University of Santa Catarina (UFSC), Florianópolis, Brazil Multicenter Graduate Program in Physiological Sciences, Center of Biological Sciences, Federal University of Santa Catarina (UFSC), Florianópolis, Brazil
A R T I C L E I N F O
A B S T R A C T
Article history: Received 27 April 2015 Received in revised form 10 September 2015 Accepted 12 September 2015 Available online 16 September 2015
Objectives: Glucocorticoid treatment induces insulin resistance (IR), which is counteracted by a compensatory hyperinsulinemia, due to increased pancreatic b-cell function. There is evidence for also reduced hepatic insulin clearance, but whether this correlates with altered activity of insulin-degrading enzyme (IDE) in the liver, is not fully understood. Here, we investigated whether hyperinsulinemia, in glucocorticoid-treated rodents, is associated with any alteration in the insulin clearance and activity of the IDE in the liver. Materials/methods: Adult male Swiss mice and Wistar rats were treated with the synthetic glucocorticoid dexamethasone intraperitoneally [1 mg/kg body weight (b.w.)] for 5 consecutive days. Results: Glucocorticoid treatment induced IR and hyperinsulinemia in both species, but was more impactful in rats that also displayed glucose intolerance and hyperglycemia. Insulin clearance was reduced in glucocorticoid-treated rats and mice, as judged by the reduction of insulin decay rate and increased insulin area-under-the-curve (47% and 87%, respectively). These results were associated with reduced activity (35%) of hepatic IDE in rats and a tendency to reduction (p = 0.068) in mice, without alteration in hepatic IDE mRNA content, in both species. Conclusion: In conclusion, the reduced insulin clearance in glucocorticoid-treated rodents was due to the reduction of hepatic IDE activity, at least in rats, which may contributes to the compensatory hyperinsulinemia. These findings corroborate the idea that short-term and/or partial inhibition of IDE activity in the liver could be beneficial for the glycemic control. ã 2015 Elsevier Ltd. All rights reserved.
Keywords: Dexamethasone Glucocorticoid Glucose homeostasis Insulin clearance Insulin-degrading enzyme (IDE) Insulin sensitivity
1. Introduction Abbreviations: AI, adrenal incidentaloma; AD, Alzheimer’s disease; AUC, areaunder-curve; CTL, saline-treated group; CNTF, ciliary neurotrophic factor; GC, glucocorticoid-treated group; ipGTT, intraperitoneal glucose tolerance test; ipITT, intraperitoneal insulin tolerance test; IR, insulin resistance; KITT, constant rate of glucose decay; RIA, radioimmunoassay; T2DM, type 2 diabetes mellitus. * Corresponding author at: Departamento de Ciências Fisiológicas, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina (UFSC), Florianópolis 88040-900, Brazil. ** Corresponding author at: Departamento de Biologia Funcional e Estrutural, Instituto de Biologia, Universidade Estadual de Campinas (UNICAMP), Campinas 13083-865, Brazil. E-mail addresses: [email protected] (A. Rafacho), [email protected] (A.C. Boschero). 1 Contributed equally to this work. http://dx.doi.org/10.1016/j.jsbmb.2015.09.020 0960-0760/ ã 2015 Elsevier Ltd. All rights reserved.
Type 2 diabetes mellitus (T2DM) is a multifactorial disease characterized by hyperglycemia and associated with obesity, peripheral insulin resistance (IR), pancreatic b- and a-cell dysfunction, and altered insulin clearance [1–6]. At the onset of T2DM, before the development of overt hyperglycemia, the IR induces an adaptive response of pancreatic b cells that results in increased insulin secretion, leading to hyperinsulinemia [7]. Whether this compensatory hyperinsulinemia will persist depends on the ability of b cells to maintain this continuous requirement of insulin hypersecretion [2]. However, evidence also suggests that a primary persistent hyperinsulinemia, generated by environmental
2
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
or genetic factors may induce IR, obesity and T2DM as consequence [8,9]. Some therapies may also cause IR and hyperinsulinemia and glucocorticoid-based therapies that are prescribed due to their anti-inflammatory, antialergic and immunosuppressive properties are one of more relevant clinical example. In excess, glucocorticoids promote an imbalance on glucose homeostasis that include IR, glucose intolerance and, depending on the individual susceptibility, T2DM [5,10]. The IR induced by glucocorticoid treatment is initially counteracted by compensatory insulin hypersecretion, due to increased b-cell function and proliferation [11–15]. Hyperinsulinemia present during obesity is also a result of increased b-cell function, but there are also evidences for a contribution of reduced hepatic insulin clearance (defined as the rate of insulin removal from plasma) in humans [16–19], monkeys [1], dogs [4] and rats [20]. Decreased hepatic insulin clearance seems to precede the b-cell compensation in obese dogs, and this hepatic adaptive mechanism contributes to the augmented circulating insulin levels during obesity [4]. In accordance, glucocorticoid-treated dogs [21] and insulin-resistant nondiabetic adrenal incidentaloma (AI) patients [22] exhibit decreased hepatic insulin clearance. However, the molecular mechanisms underlying this compensatory adaptation are unknown. Insulin clearance occurs predominantly in the liver [3,18] and insulin degradation is mainly processed by the insulin-degrading enzyme (IDE), a 110 kDa zinc-metalloproteinase that is ubiquitously expressed [18]. Treatment of hepatic cells with glucocorticoids lead to reduction of insulin binding to IDE [23] and reduction of insulin degrading capacity [24], suggesting that glucocorticoids may regulate insulin clearance due to alterations upon the IDE expression or activity. IDE is also a major protease involved in the degradation of the amyloid b-protein (Ab) [25]. Reduced Ab degradation by several proteases, including IDE, has been suggested to play a role in the onset and progression of Alzheimer’s disease (AD) [26,27]. In fact, the IDE knockout (IDE/) mice display reduced Ab degradation in brain fractions and primary neurons, providing a molecular mechanism for the recently recognized association among hyperinsulinemia, T2DM and AD [26]. Chronic glucocorticoid treatment is associated with diminished IDE expression in the brain of macaques [27]. In accordance, astrocytes treated with glucocorticoid present reduced IDE mRNA and protein content [28]. Considering the importance of the IDE in the glycemic control and that glucocorticoid excess impairs such glucose homeostasis we investigated whether activity of hepatic IDE could be modulated in a model of hyperinsulinemia caused by dexamethasone treatment. By using two experimental models, Swiss mice and Wistar rats, we demonstrated that hyperinsulinemic rodents exhibited lower insulin clearance that was associated with lower activity of hepatic IDE, mainly in rats. 2. Material and methods
125
I-labeled insulin, used in the radioimmunoassay (RIA) (PerkinElmer, Boston, MA, USA), were used in our experiments. 2.3. Animals and experimental design All of the experiments were performed in male Swiss mice and Wistar rats (80–100 days old) purchased from the State University of Campinas Animal Breeding Center. All of the rodents were maintained in appropriate animal cages and kept at 22 1 C on a 12:12 light dark cycle (lights on 0600, lights off 1800). Rodents had access to food and water ad libitum. Mice and rats were divided into a GC-treated group (GC) that received 5 consecutive daily intraperitoneal injections of dexamethasone phosphate [intraperitoneal (i.p.), 1.0 mg/kg body weight (b.w.) in saline] and a control group (CTL) that received 5 consecutive daily injections of saline (1.0 ml/kg b.w.) between 0800 and 0900 h, according to previous publication [29]. To avoid overlapping of the acute and chronic glucocorticoid effects, all experiments were initiated 24 h after the last dexamethasone injection (on the sixth day). 2.4. Intraperitoneal insulin tolerance test (ipITT) A group of conscious rodents were fasted for two hours and then injected with insulin (i.p. 1 U/Kg b.w. in saline). Blood glucose was determined from the tail tip immediately before insulin administration (0 min) and 5, 10, 15, and 30 min after insulin administration. Glycemia was evaluated by a glucometer (AccuChek Advantage, Roche Diagnostic, Switzerland) and then converted into a natural logarithm (Ln); the slope was calculated using linear regression (time Ln [glucose]) and multiplied by 100 to obtain the constant rate of glucose decay per minute (%/min) during the ipITT (KITT) [6,15]. Insulinemia was measured by RIA, as previously described [6,15]. 2.5. In vivo insulin clearance We measured the insulinemia in rodents submitted to the ipITT. Insulin clearance was evaluated as previously described [30]. The constant rate for insulin disappearance (insulin decay) was calculated by converting insulin measurements into a Ln; the slope was calculated using linear regression (time Ln [insulin]) and multiplied by 100 to obtain the insulin decay constant rate per minute (%/min). The AUC of insulin during the ipITT was calculated as previously described [6]. 2.6. Intraperitoneal glucose tolerance test (ipGTT) and insulin dynamics A separate group of rodents received an i.p. injection of 50% glucose solution after 10 h of fasting (1 g/kg b.w.). Blood samples (75–100 ml) were collected from the tail tip immediately before glucose administration (0 min) and after 15 and 60 min to determine glycemia and insulinemia as described before. The AUC of glucose and insulin during the ipGTT were calculated as previously described.
2.1. Ethical approval 2.7. Tissue samples and IDE activity The experiments with rats and mice were approved by the State University of Campinas Committee for Ethics in Animal Experimentation (approval ID: 2285-1). 2.2. Materials Dexamethasone phosphate (Decadron) (Aché, Campinas, SP, Brazil), human recombinant insulin (Humulin R) (Lilly, Indianapolis, IN, USA), D-glucose (Synth, Labsynth, Diadema, SP, Brazil) and
A separate group of rats and mice were killed (by exposure to CO2 followed by decapitation) and liver samples were collected for determination of IDE activity after homogenization of tissue in icecold assay buffer (AnaSpec, Inc., Fremont, CA, USA). IDE activity was assessed with the fluorimetric SensoLyte1 520 IDE activity assay kit (cat. AS-72231) (AnaSpec, Inc., Fremont, CA, USA) according to the manufacturer’s instructions. Sample fluorescence was monitored at a wavelength of 490 nm and an emission
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
wavelength of 520 nm on SpectraMax M3 plate reader (Molecular Devices, Ismaning, Germany). Reactions were performed in duplicate samples from six to seven different rodents. Enzyme activity was normalized per mg of total protein. The kinetic assay was expressed as 5-FAM (mM/mg protein) and the total enzyme activity were expressed in relation to control according to previous publication [31]. Protein concentration was determined by Bradford reagent (BioRad, Hercules, CA, USA). 2.8. Quantitative Real-time PCR Liver samples of rats and mice were collected from the same animals used for determination IDE activity and homogenized in Trizol1 following phenol-chloroform RNA extraction, according to the manufacturer’s instructions (Gibco-BRL, Gaithers- burg, MD, USA). RNA integrity was asserted through agarose gel and its concentration was measured by Nanodrop (Nanodrop Thermo scientific, Wilmington, DE, USA). The following reverse transcriptase PCR for cDNA synthesis was made using the TaqDNA polymerase (Phoneutria, Belo Horizonte, BR). Quantification was performed using the 7500 Fast Real-time PCR Systems (Applied Biosystems, Foster City, CA, USA). The specificities of amplifications were verified
3
by melting-curve analyses and by size characterization of the amplification products on 2% agarose gels. The Sense (S) and Antisense (AS) oligonucleotide primers were designed and tested against Mus musculus (Ide S: 50 -CTGTGCCCCTTGTTTGATGC-30 ; AS: 50 GTTCCCCGTAGCCTTTTCCA-30 ; Gapdh S: 50 -CCTGCACCACCAACTGCTTA-30 ; AS: 50 -GCCCCACGGCCATCACGCCA-30 ) or Rattus norvegicus genome (Ide S: 50 -AGGAAATGTTGGCTGTGGACGCA-30 ; AS: 50 -CCTGGCAAGAACGTGGACGGATA-30 ; Gapdh S: 50 - GGAGAAACCTGCCAAGTATGATG-30 ; AS: 50 - ACCCTGGTCCTCAGTGTAGCCCC -30 ) (Gene Bank) to ensure no amplification of unspecific cDNAs. 2.9. Statistical analysis All analyzes were performed using Graphpad prism v.5.01 (Graphpad Inc.; La Jolla, USA) software. The symmetry of the data was tested by Shapiro Wilk’s test. The results were expressed as the mean standard error of the mean (SEM). Unpaired Student’s ttest was used for intergroup (CTL vs. GC group) comparisons of parametric data or Mann–Whitney test for variables with asymmetric distribution. A p-value 0.05 was considered to be significant.
Fig. 1. Glucocorticoid treatment reduces insulin sensitivity in rats and mice. (A,D) Blood glucose during intraperitoneal insulin tolerance test (ipITT; 1 U/Kg b.w.) in glucocorticoid-treated rats and mice, respectively; (B,E) Blood glucose normalized as % of the initial moment (0 min) during the ipITT in glucocorticoid-treated rats and mice, respectively; (C,F) the constant rate for glucose disappearance (KITT) during ipITT in glucocorticoid-treated rats and mice, respectively. Values are mean SEM; n = 6– 9 rodents per group. *Significantly different vs. CTL. Unpaired Student’s t-test, p 0.05.
4
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
3. Results 3.1. Glucocorticoid treatment reduced insulin sensitivity in mice and rats It is known that in vivo glucocorticoid administration induces a decrease in insulin sensitivity in mice [32], rats [33,34], and humans [11,14]. Here, glucocorticoid-treated rats displayed a 56% reduction in insulin sensitivity compared to CTL groups, as observed in the ipITT (Fig. 1A and B) and indicated by the KITT (Fig. 1C). Mice submitted to the same dexamethasone regimen displayed a 36% reduction in insulin sensitivity (Fig. 1D,E), as indicated by the KITT values (Fig. 1F). 3.2. Compensatory hyperinsulinemia to the glucocorticoid-induced IR Due to the reciprocal relationship between peripheral insulin sensitivity and pancreatic islet function [2], insulin-resistant rats and mice demonstrated a compensatory increase in circulating insulin levels after 2 h (150% and 137%, respectively) and 12 h of fasting (297% and 243%, respectively) following glucocorticoid administration, compared to their respective CTL groups (Table 1), which corroborates previous data [15,32–34]. Glucocorticoidtreated rats exhibited hyperglycemia after both 2 h (54%) and 12 h of fasting (33%) compared to CTL rats, but glucocorticoid-treated mice exhibited no elevation, indicating a disruption of glucose homeostasis only in GC-treated rats (Table 1). 3.3. Compensatory hyperinsulinemia did not prevent the development of glucose intolerance in rats Next, we submitted the rodents to a glucose challenge (ipGTT). Similarly to previous observations [15,33,34], glucocorticoidtreated rats remained glucose intolerant, as indicated by higher blood glucose levels and the increased glucose AUC during the ipGTT (Fig. 2A and inset). This altered glucose tolerance in glucocorticoid-treated rats occurred even in the presence of higher insulin response to glucose, as judged by the higher insulin AUC during the ipGTT, compared to CTL rats (Fig. 2B and inset). Glucocorticoid-treated mice also had a higher insulin response to glucose when compared to their CTL group (Fig. 2D and inset), but remained glucose tolerant (Fig. 2C), indicating an adequate equilibrium between insulin sensitivity and islet function. 3.4. Glucocorticoid treatment reduced in vivo insulin clearance By evaluating the systemic (venous) insulin levels, we indirectly determined the in vivo insulin clearance (decreased removal of insulin from plasma) and observed whether this parameter could be attenuated during the hyperinsulinemic state caused by glucocorticoid treatment. Both rats and mice treated with glucocorticoid were hyperinsulinemic before insulin administration (Fig. 3A and D). Five minutes after the insulin administration,
both CTL groups of rats and mice reached similar levels of circulating insulin compared to their respective glucocorticoidtreated groups. Fig. 3 shows that plasma insulin clearance was significantly lower in glucocorticoid-treated rats and mice 60 min after insulin load, as judged by the increased AUC (47% and 87% respectively; Fig. 3B and E) and by the reduced insulin decay rate (47% and 72%, respectively; Fig. 3C and F), compared to CTL groups. Thus, hyperinsulinemia in glucocorticoid-treated rodents is associated with reduced insulin removal from plasma. 3.5. Glucocorticoid treatment reduced IDE activity in liver We next determined the IDE activity in liver from all groups. Activity of IDE in liver from glucocorticoid-treated rats was significantly reduced (35%) compared with the CTL group (Fig. 4A and B, respectively). Activity of hepatic IDE in glucocorticoidtreated mice had a tendency towards a reduction (p = 0.068) for the last 15 min monitoring (kinetic assay) as well as for total enzyme activity compared with the CTL mice (Fig. 4C and D, respectively). Thus, reduced insulin clearance in glucocorticoid-treated rodents is associated with reduced hepatic IDE activity, mainly in rats. 3.6. Glucocorticoid treatment do not alter Ide mRNA levels in liver We further evaluated whether the reduced activity of IDE in liver from glucocorticoid-treated rodents were associated with reduced Ide mRNA content. No difference was observed in the Ide mRNA content in glucocorticoid-treated rodents liver, compared to the CTL groups (Fig. 5A and B), suggesting that post-transcription regulation may be involved with the reduced activity of IDE in the liver. 4. Discussion The present study provides evidence that the compensatory hyperinsulinemia observed in insulin-resistant rats and mice, induced by glucocorticoid treatment, is due, at least in part, to a reduced insulin clearance that is associated with lower IDE activity in the liver in rats, with a tendency towards a reduction in mice. These findings corroborate the hypothesis that short-term and/or partial inhibition of the hepatic IDE expression may enhance the hypoglycemic action of insulin, which could be beneficial for the glycemic control [8,35]. Although reduced hepatic insulin clearance was previously reported to be associated with hyperinsulinemia in glucocorticoid-treated dogs [21] and in AI patients [22], we are the first to measure the hepatic IDE activity in insulin-resistant rats and mice made by glucocorticoid treatment. Glucocorticoid treatment reduced the insulin sensitivity in rats and mice (Fig. 1), which was counteracted by a compensatory hyperinsulinemia (Table 1). However, mice had a milder IR that was accompanied by a compensatory hyperinsulinemia sufficient to prevent the hyperglycemia and glucose intolerance (Fig. 2).
Table 1 Metabolic parameters in glucocorticoid-treated rats and mice. Rats
Mice
CTL
GC
Ratio
CTL
GC
Ratio
2 h Fasting Glycemia (mg/dL) Insulinemia (pmol/L)
100 1 638 118
154 13a 1600 114a
1.54 2.5
146 8 400 44
125 8 949 187a
0.86 2.37
12 h Fasting Glycemia (mg/dL) Insulinemia (pmol/L)
101 3 284 38
134 8a 1128 207a
1.33 3.97
100 6 83 8
93 7 285 78a
0.93 3.43
a
Significantly different using unpaired t-test vs. CTL p < 0.05; n = 5–6; values are mean SEM.
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
5
Fig. 2. Glucocorticoid treatment induces hyperinsulinemia in rats and mice, but glucose intolerance only in rats. (A,C) Blood glucose (B,D) and plasma insulin during intraperitoneal glucose tolerance test (ipGTT; 1 g/Kg b.w.) in glucocorticoid-treated rats and mice, respectively; the inset in A and C depicts the glucose AUC; in D, the inset depicts the insulinemia in another scale and the insulin AUC; in B, the inset depicts the insulin AUC; Values are mean SEM; n = 6–9 rodents per group. *Significantly different vs. CTL. Unpaired Student’s t-test, p 0.05.
Fig. 3. Glucocorticoid treatment reduces in vivo insulin clearance in rats and mice. (A,D) Plasma insulin before (0 min), and 5, 30 and 60 min after insulin injection in glucocorticoid-treated rats and mice, respectively; (B,E) insulin AUC during the ipITT and (C,F) insulin decay over 60 min; Values are mean SEM; n = 6–9 rodents per group. *Significantly different vs. CTL. Unpaired Student’s t-test, p 0.05.
6
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
Fig. 4. Glucocorticoid treatment reduces activity of hepatic IDE, mainly in rats. (A,C) Kinetic IDE assay in fragments of liver from rats and mice, respectively; (B,D) graphs represents total IDE activity in relation to controls; n = 6–7 rodents per group. *Significantly different vs. CTL. Unpaired Student’s t-test, p 0.05. For C and D Mann–Whitney test was applied.
These data suggest that mice are less vulnerable than rats to the deleterious effect of GC treatment on glucose homeostasis. In fact, mice treated with dexamethasone (1 mg/Kg b.w.) for 5 consecutive days exhibit normal non-esterified fatty acid (NEFA) levels and normal glycemic response to a pyruvate tolerance test, compared to control mice. These parameters were both impaired in rats treated with the same glucocorticoid regimen [29]. This suggests that dexamethasone-treated mice have a more preserved insulin action on fat and liver tissues compared to rats. In accordance, rats treated with dexamethasone exhibit increased fat lipolysis [36] and pyruvate intolerance [29,37] that may be, at least in part, responsible for their elevated NEFA and impaired glucose tolerance [29,37]. It is important to consider that mice exhibit higher metabolic rate in relation to rats [38], and such aspect might be taken into account for the less pronounced adverse effects of dexamethasone regimen (1 mg/kg b.w.) on mice metabolism. As previously reported [11–15,33,34,39], the hyperinsulinemia in glucocorticoid-treated human and rodents is associated with increased insulin secretion, due to increased b-cell mass and function. Our ipGTT confirms an enhancement of insulin secretion in response to glucose, in glucocorticoid-treated mice and rats that
Fig. 5. Glucocorticoid treatment does not alter Ide mRNA levels in rodents’ liver. (A,B) graphs represents mean SEM of mRNA levels of Ide in rats and mice liver, respectively; n = 4–5 rodents per group.
was of higher magnitude in rats (Fig. 2). According to disposition index (the product of insulin sensitivity by insulin secretion), for a given reduction in insulin sensitivity, a reciprocal increase in insulin secretion must be expected in a healthy organism to maintain blood glucose at physiological range. Considering that glucocorticoid-treated rats displayed an insulin insensitivity more pronounced than glucocorticoid-treated mice, it seems that their pancreatic b-cell compensation (insulin hypersecretion) was adequate, but this was not enough to avoid glucose intolerance and hyperglycemia in these animals. In fact, glucose-intolerant rats, made by dexamethasone (1 mg/kg b.w.) administration, demonstrate impaired a-cell function in response to high glucose that contributes for increased plasma glucagon levels [40]; which is corroborated by human studies [11,41]. Hyperinsulinemia, observed during elevation of glucocorticoid levels, may be explained also by an impairment of insulin clearance in liver both by direct glucocorticoid action [23,24] and by the own insulin effect [9]. After its secretion by pancreatic islets, insulin is collected by the portal vein, and approximately 50% is removed from plasma during this first passage through the liver [17,18]. Approximately 80% of the total plasma insulin content is bound by hepatic insulin receptors [42]. Therefore, the liver is the primary site of insulin clearance [17,43], which suggests the participation of the liver in hyperinsulinemia. As judged by the reduced insulin decay and increased insulin AUC, after an insulin bolus (Fig. 3), the removal of insulin from plasma was reduced in glucocorticoidtreated mice and rats, compared to their CTL groups. These results are in accordance with previous reports in which hepatic insulin clearance was reduced in glucocorticoid-treated dogs [21] and in AI humans [22]. Glucocorticoid-treated rodents had lower insulin decay after the ipITT (Fig. 3) as well as lower IDE activity (mainly in rats) in the liver than in CTL groups (Fig. 4). These data suggest that reduced hepatic clearance of insulin may contribute to hyperinsulinemia in both rodents treated with glucocorticoid, which are in agreement with higher levels of plasma insulin at any metabolic state for these species (Table 1). This association was more apparent in rats treated with dexamethasone and, possibly, the dexamethasone regimen defined in our study were not sufficient to cause a metabolic context (e.g., elevation in glycemic values) in
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
mice that might result in an effective downregulation of IDE activity, as observed in the glucocorticoid-treated rats. In alignment with that, there is evidence for reduced regulation of IDE activity by insulin in hepatic cells (HepG2), exposed to high glucose conditions [44]. This evidence corroborates our results, since both rats and mice treated with dexamethasone had similar ratios of insulin increment at any metabolic state, related to their own controls, but hyperglycemia was observed only in rats (Table 1). Reduced insulin decay, observed in mice treated with dexamethasone, does correlate with normotolerance and prevents hyperglycemia in mice. In fact, the increased function of islet b-cell (e.g., insulin hypersecretion), observed in mice treated with the same dexamethasone regimen [29], seems to surpass the metabolic demand caused by the reduction of insulin sensitivity, which favors for a slight reduction in blood glucose levels (Table 1). Our results are in line with previous in vitro studies in which hepatic cells, cultured in the presence of dexamethasone, showed a lower interaction between insulin and IDE [23] and reduced insulin degradation [24]. These findings corroborate the hypothesis that in vivo glucocorticoid treatment leads to a decreased insulin clearance by, at least in part, reduced expression and/or activity of IDE in the liver. Similarly, alloxan-treated mice displayed a reduced IDE expression in the liver when treated with ciliary neurotrophic factor (CNTF), resulting in lower insulin clearance, which in turn protected against the diabetogenic effects of alloxan [6]. In the same way, hepatic cells (HepG2), treated with CNTF, displayed reduced IDE expression and reduced insulin degradation [6], supporting the hypothesis that transient IDE inhibition in the liver may favor the glycemic control. The pharmacological inhibition of IDE led to increased insulin receptor autophosphorylation in cultured cells [35] and the acute in vivo inhibition of IDE improved the glycemic control [45], indicating that IDE regulates insulin signaling by a rapid degradation of internalized pools of the hormone. The role of IDE on the glycemic control was demonstrated using the IDE/ mice [8]. Young (2 months old) IDE/ mice displayed hyperinsulinemia, increased insulin sensitivity and glucose tolerance. At the contrary, in aged (6 months) IDE/ mice, the hyperinsulinemia was accompanied by IR and glucose intolerance, due to insulin receptor down-regulation (e.g., adaptation to chronically elevated insulin levels) [8]. Thus, our results may be interpreted in two points of view: first is that, initially, reduction of insulin clearance may be part of the compensatory mechanisms that contribute for glycemic control and second is that, if this hyperinsulinemia is persisted with prolongation of glucocorticoid treatment, it may led to peripheral insulin receptor dow-regulation with subsequent impairment in the insulin action. The unchanged Ide mRNA liver levels in glucocorticoid-treated rodents (Fig. 5) suggests that reduced IDE activity, at least in rats, is possibly not a result from transcriptional regulation, but rather a result of post-translational modulation, probably associated with the increased plasma and/or hepatic lipids and glucose in glucocorticoid-treated rodents [29,46], which are known to reduce insulin clearance [3,20,44,47,48]. The dissociation among Ide mRNA and IDE protein content/activity in the liver was recently described in an animal model of high fat diet (HFD) and in hepatoma cell-line (1c1c7) cultured with fatty acids [31], supporting the hypothesis that post-translational modulation, such as ubiquitination [49], may underlie the reduced IDE expression in liver from the dexamethasone-treated rodents. In conclusion, our results suggest that compensatory hyperinsulinemia in glucocorticoid-treated rodents may be explained, at least partially, due to a reduced hepatic insulin clearance that is associated with reduced hepatic IDE activity, at least in rats. We
7
suggest that short-term and/or partial reduction of the IDE activity, in the liver, could be beneficial for the glycemic control. Conflict of interest We declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported. Funding This research was supported by Grants from Fundação de Apoio a Pesquisa do Estado de São Paulo-FAPESP (ID no. 2010-05196-2). Authorship contributions Conceived and designed the experiments: A.O.P.P, L.F.R., A.R. and A.C.B. Conducted experiments: A.O.P.P, J.M.C.J, S.M.F, A.P.C., F. M.M.P, J.C.S and M.A.K. Contributed with analytic tools and data analysis: A.O.P.P, L.F.R., A.R. and A.C.B. Contributed with reagents/ materials: E.M.C and A.C.B. Wrote and edited paper: A.O.P.P, L.F.R., A.R and A.C.B. Acknowledgments We thank Mrs. Marise Brunelli for technical assistance; Mr. Bill Floriano, Mr. Washington Gomes, Mr. Juvenal Dantas, Mrs. Francine Quinelato and Mrs. Priscila Silva for animal care; and FAPESP for supporting this research. References [1] B.C. Hansen, J.S. Striffler, N.L. Bodkin, Decreased hepatic insulin extraction precedes overt noninsulin dependent (Type II) diabetes in obese monkeys, Obes. Res. 1 (1993) 252–260. [2] S.E. Kahn, The relative contributions of insulin resistance and beta-cell dysfunction to the pathophysiology of Type 2 diabetes, Diabetologia 46 (2003) 3–19. [3] A. Kotronen, L. Juurinen, M. Tiikkainen, S. Vehkavaara, H. Yki-Jarvinen, Increased liver fat, impaired insulin clearance, and hepatic and adipose tissue insulin resistance in type 2 diabetes, Gastroenterology 135 (2008) 122–130. [4] S.D. Mittelman, G.W. Van Citters, S.P. Kim, D.A. Davis, M.K. Dea, M. HamiltonWessler, R.N. Bergman, Longitudinal compensation for fat-induced insulin resistance includes reduced insulin clearance and enhanced beta-cell response, Diabetes 49 (2000) 2116–2125. [5] A. Rafacho, H. Ortsäter, A. Nadal, I. Quesada, Glucocorticoid treatment and endocrine pancreas function: implications for glucose homeostasis, insulin resistance and diabetes, J. Endocrinol. 223 (2014) R49–R62. [6] L.F. Rezende, G.J. Santos, J.C. Santos-Silva, E.M. Carneiro, A.C. Boschero, Ciliary neurotrophic factor (CNTF) protects non-obese Swiss mice against type 2 diabetes by increasing beta cell mass and reducing insulin clearance, Diabetologia 55 (2012) 1495–1504. [7] V. Poitout, J. Amyot, M. Semache, B. Zarrouki, D. Hagman, G. Fontes, Glucolipotoxicity of the pancreatic beta cell, Biochim. Biophys. Acta 1801 (2010) 289–298. [8] S.O. Abdul-Hay, D. Kang, M. McBride, L. Li, J. Zhao, M.A. Leissring, Deletion of insulin-degrading enzyme elicits antipodal, age-dependent effects on glucose and insulin tolerance, PLoS One 6 (2011) e20818. [9] B.E. Corkey, Banting lecture 2011: hyperinsulinemia: cause or consequence? Diabetes 61 (2012) 4–13. [10] H. Schacke, W.D. Docke, K. Asadullah, Mechanisms involved in the side effects of glucocorticoids, Pharmacol. Ther. 96 (2002) 23–43. [11] J.C. Beard, J.B. Halter, J.D. Best, M.A. Pfeifer, D. Porte Jr., Dexamethasoneinduced insulin resistance enhances B cell responsiveness to glucose level in normal men, Am. J. Physiol. 247 (1984) E592–596. [12] C. Binnert, S. Ruchat, N. Nicod, L. Tappy, Dexamethasone-induced insulin resistance shows no gender difference in healthy humans, Diabetes Metabol. 30 (2004) 321–326. [13] N. Nicod, V. Giusti, C. Besse, L. Tappy, Metabolic adaptations to dexamethasone-induced insulin resistance in healthy volunteers, Obes. Res. 11 (2003) 625–631. [14] D.H. van Raalte, V. Nofrate, M.C. Bunck, T. van Iersel, J. Elassaiss Schaap, U.K. Nassander, R.J. Heine, A. Mari, W.H. Dokter, M. Diamant, Acute and 2-week exposure to prednisolone impair different aspects of beta-cell function in healthy men, Eur. J. Endocrinol. 162 (2010) 729–735.
8
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
[15] A. Rafacho, J.L. Abrantes, D.L. Ribeiro, F.M. Paula, M.E. Pinto, A.C. Boschero, J.R. Bosqueiro, Morphofunctional alterations in endocrine pancreas of short- and long-term dexamethasone-treated rats, Horm. Metab. Res. 43 (2011) 275–281. [16] E. Bonora, I. Zavaroni, C. Coscelli, U. Butturini, Decreased hepatic insulin extraction in subjects with mild glucose intolerance, Metabolism 32 (1983) 438–446. [17] W.C. Duckworth, F.G. Hamel, D.E. Peavy, Hepatic metabolism of insulin, Am. J. Med. 85 (1988) 71–76. [18] W.C. Duckworth, R.G. Bennett, F.G. Hamel, Insulin degradation: progress and potential, Endocr. Rev. 19 (1998) 608–624. [19] M. Krotkiewski, P. Lonnroth, K. Mandroukas, Z. Wroblewski, M. Rebuffe-Scrive, G. Holm, U. Smith, P. Bjorntorp, The effects of physical training on insulin secretion and effectiveness and on glucose metabolism in obesity and type 2 (non-insulin-dependent) diabetes mellitus, Diabetologia 28 (1985) 881–890. [20] G. Stromblad, P. Bjorntorp, Reduced hepatic insulin clearance in rats with dietary-induced obesity, Metabolism 35 (1986) 323–327. [21] Z. Chap, R.H. Jones, J. Chou, C.J. Hartley, M.L. Entman, J.B. Field, Effect of dexamethasone on hepatic glucose and insulin metabolism after oral glucose in conscious dogs, J. Clin. Invest. 78 (1986) 1355–1361. [22] C.H. Anderwald, A. Tura, A. Gessl, A. Luger, G. Pacini, M. Krebs, Adequately adapted insulin secretion and decreased hepatic insulin extraction cause elevated insulin concentrations in insulin resistant non-diabetic adrenal incidentaloma patients, PLoS One 8 (2013) e77326. [23] S. Harada, R.M. Smith, D.Q. Hu, L. Jarett, Dexamethasone inhibits insulin binding to insulin-degrading enzyme and cytosolic insulin-binding protein p82, Biochem. Biophys. Res. Commun. 218 (1996) 154–158. [24] M. Ali, C. Plas, Glucocorticoid regulation of chloroquine nonsensitive insulin degradation in cultured fetal rat hepatocytes, J. Biol. Chem. 264 (1989) 20992– 20997. [25] W.Q. Qiu, D.M. Walsh, Z. Ye, K. Vekrellis, J. Zhang, M.B. Podlisny, M.R. Rosner, A. Safavi, L.B. Hersh, D.J. Selkoe, Insulin-degrading enzyme regulates extracellular levels of amyloid beta-protein by degradation, J. Biol. Chem. 273 (1998) 32730–32738. [26] W. Farris, S. Mansourian, Y. Chang, L. Lindsley, E.A. Eckman, M.P. Frosch, C.B. Eckman, R.E. Tanzi, D.J. Selkoe, S. Guenette, Insulin-degrading enzyme regulates the levels of insulin, amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain in vivo, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 4162–4167. [27] J.J. Kulstad, P.J. McMillan, J.B. Leverenz, D.G. Cook, P.S. Green, E.R. Peskind, C.W. Wilkinson, W. Farris, P.D. Mehta, S. Craft, Effects of chronic glucocorticoid administration on insulin-degrading enzyme and amyloid-beta peptide in the aged macaque, J. Neuropathol. Exp. Neurol. 64 (2005) 139–146. [28] Y. Wang, M. Li, J. Tang, M. Song, X. Xu, J. Xiong, J. Li, Y. Bai, Glucocorticoids facilitate astrocytic amyloid-beta peptide deposition by increasing the expression of APP and BACE1 and decreasing the expression of amyloid-betadegrading proteases, Endocrinology 152 (2011) 2704–2715. [29] A.O. Protzek, J.M. Costa-Júnior, L.F. Rezende, G.J. Santos, T.G. Araújo, J.F. Vettorazzi, F. Ortis, E.M. Carneiro, A. Rafacho, A.C. Boschero, Augmented b-Cell function and mass in glucocorticoid-treated rodents are associated with increased islet Ir-b/AKT/mTOR and decreased AMPK/ACC and AS160 signaling, Int. J. Endocrinol. 2014 (2014) 983453. [30] B. Ahrén, K. Thomaseth, G. Pacini, Reduced insulin clearance contributes to the increased insulin levels after administration of glucagon-like peptide 1 in mice, Diabetologia 48 (2005) 2140–2146. [31] X. Wei, B. Ke, Z. Zhao, X. Ye, Z. Gao, J. Ye, Regulation of insulin degrading enzyme activity by obesity-associated factors and pioglitazone in liver of dietinduced obese mice, PLoS One 9 (2014) e95399. [32] R. Jatwa, A. Kar, Amelioration of metformin-induced hypothyroidism by Withania somnifera and Bauhinia purpurea extracts in Type 2 diabetic mice, Phytother. Res. 23 (2009) 1140–1145.
[33] A. Rafacho, T.M. Cestari, S.R. Taboga, A.C. Boschero, J.R. Bosqueiro, High doses of dexamethasone induce increased beta-cell proliferation in pancreatic rat islets, Am. J. Physiol. Endocrinol. Metabol. 296 (2009) E681–689. [34] A. Rafacho, S. Quallio, D.L. Ribeiro, S.R. Taboga, F.M. Paula, A.C. Boschero, J.R. Bosqueiro, The adaptive compensations in endocrine pancreas from glucocorticoid-treated rats are reversible after the interruption of treatment, Acta Physiol. (Oxf.) 200 (2010) 223–235. [35] M.A. Leissring, E. Malito, S. Hedouin, L. Reinstatler, T. Sahara, S.O. Abdul-Hay, S. Choudhry, G.M. Maharvi, A.H. Fauq, M. Huzarska, et al., Designed inhibitors of insulin-degrading enzyme regulate the catabolism and activity of insulin, PLoS One 5 (2010) e10504. [36] E.A. Nunes, L.M. Gonçalves-Neto, F.B. Ferreira, C. Dos Santos, L.C. Fernandes, A. C. Boschero, P.C. Calder, A. Rafacho, Glucose intolerance induced by glucocorticoid excess is further impaired by co-administration with b-hydroxy-b-methylbutyrate in rats, Appl. Physiol. Nutr. Metabol. 38 (2013) 1137–1146. [37] K. Motta, A.M. Barbosa, F. Bobinski, A.C. Boschero, A. Rafacho, JNK and IKKb phosphorylation is reduced by glucocorticoids in adipose tissue from insulinresistant rats, J. Steroid Biochem. Mol. Biol. 145 (2015) 1–12. [38] G.M. Kowalski, C.R. Bruce, The regulation of glucose metabolism: implications and considerations for the assessment of glucose homeostasis in rodents, Am. J. Physiol. Endocrinol. Metabol. 307 (2014) E859–71. [39] S. Karlsson, B. Ostlund, U. Myrsen-Axcrona, F. Sundler, B. Ahren, Beta cell adaptation to dexamethasone-induced insulin resistance in rats involves increased glucose responsiveness but not glucose effectiveness, Pancreas 22 (2001) 148–156. [40] A. Rafacho, L.M. Gonçalves-Neto, J.C. Santos-Silva, P. Alonso-Magdalena, B. Merino, S.R. Taboga, E.M. Carneiro, A.C. Boschero, A. Nadal, I. Quesada, Pancreatic alpha-cell dysfunction contributes to the disruption of glucose homeostasis and compensatory insulin hypersecretion in glucocorticoidtreated rats, PLoS One 9 (2014) e93531. [41] D.H. van Raalte, K.A. Kwa, R.E. van Genugten, M.E. Tushuizen, J.J. Holst, C.F. Deacon, J.M. Karemaker, R.J. Heine, A. Mari, M. Diamant, Islet-cell dysfunction induced by glucocorticoid treatment: potential role for altered sympathovagal balance? Metabolism 62 (2013) 568–577. [42] R. Hovorka, J.K. Powrie, G.D. Smith, P.H. Sonksen, E.R. Carson, R.H. Jones, Fivecompartment model of insulin kinetics and its use to investigate action of chloroquine in NIDDM, Am. J. Physiol. 265 (1993) E162–E175. [43] H. Sato, T. Terasaki, H. Mizuguchi, K. Okumura, A. Tsuji, Receptor-recycling model of clearance and distribution of insulin in the perfused mouse liver, Diabetologia 34 (1991) 613–621. [44] O. Pivovarova, O. Gögebakan, A.F. Pfeiffer, N. Rudovich, Glucose inhibits the insulin-induced activation of the insulin-degrading enzyme in HepG2 cells, Diabetologia 52 (2014) 1656–1664. [45] J.P. Maianti, A. McFedries, Z.H. Foda, R.E. Kleiner, X.Q. Du, M.A. Leissring, W.J. Tang, M.J. Charron, M.A. Seeliger, A. Saghatelian, et al., Anti-diabetic activity of insulin-degrading enzyme inhibitors mediated by multiple hormones, Nature 511 (2014) 94–98. [46] L.M. Gonçalves-Neto, F.B. Ferreira, L. Souza, C. dos Santos, A.C. Boschero, V.A. Facundo, A.R. Santos, E.A. Nunes, A. Rafacho, Disruption of glucose tolerance caused by glucocorticoid excess in rats is partially prevented, but not attenuated, by arjunolic acid, Indian J. Exp. Biol. 52 (2014) 972–982. [47] M.M. Hennes, A. Dua, A.H. Kissebah, Effects of free fatty acids and glucose on splanchnic insulin dynamics, Diabetes 46 (1997) 57–62. [48] J. Svedberg, G. Stromblad, A. Wirth, U. Smith, P. Bjorntorp, Fatty acids in the portal vein of the rat regulate hepatic insulin clearance, J. Clin. Invest. 88 (1991) 2054–2058. [49] G. Grasso, E. Rizzarelli, G. Spoto, How the binding and degrading capabilities of insulin degrading enzyme are affected by ubiquitin, Biochim. Biophys. Acta 1784 (2008) 1122–1126.
Contents lists available at ScienceDirect
Journal of Steroid Biochemistry & Molecular Biology journal homepage: www.elsevier.com/locate/jsbmb
Hyperinsulinemia caused by dexamethasone treatment is associated with reduced insulin clearance and lower hepatic activity of insulin-degrading enzyme André Otávio Peres Protzeka , Luiz Fernando Rezendea , José Maria Costa-Júniora , Sandra Mara Ferreiraa , Ana Paula Gameiro Cappellia , Flávia Maria Moura de Paulaa , Jane Cristina de Souzaa , Mirian Ayumi Kurautia , Everardo Magalhães Carneiroa , Alex Rafachob,c,* ,1, Antonio Carlos Boscheroa,** ,1 a b c
Department of Structural and Functional Biology, Institute of Biology, Campinas State University (UNICAMP), Campinas, Brazil Department of Physiological Sciences, Federal University of Santa Catarina (UFSC), Florianópolis, Brazil Multicenter Graduate Program in Physiological Sciences, Center of Biological Sciences, Federal University of Santa Catarina (UFSC), Florianópolis, Brazil
A R T I C L E I N F O
A B S T R A C T
Article history: Received 27 April 2015 Received in revised form 10 September 2015 Accepted 12 September 2015 Available online 16 September 2015
Objectives: Glucocorticoid treatment induces insulin resistance (IR), which is counteracted by a compensatory hyperinsulinemia, due to increased pancreatic b-cell function. There is evidence for also reduced hepatic insulin clearance, but whether this correlates with altered activity of insulin-degrading enzyme (IDE) in the liver, is not fully understood. Here, we investigated whether hyperinsulinemia, in glucocorticoid-treated rodents, is associated with any alteration in the insulin clearance and activity of the IDE in the liver. Materials/methods: Adult male Swiss mice and Wistar rats were treated with the synthetic glucocorticoid dexamethasone intraperitoneally [1 mg/kg body weight (b.w.)] for 5 consecutive days. Results: Glucocorticoid treatment induced IR and hyperinsulinemia in both species, but was more impactful in rats that also displayed glucose intolerance and hyperglycemia. Insulin clearance was reduced in glucocorticoid-treated rats and mice, as judged by the reduction of insulin decay rate and increased insulin area-under-the-curve (47% and 87%, respectively). These results were associated with reduced activity (35%) of hepatic IDE in rats and a tendency to reduction (p = 0.068) in mice, without alteration in hepatic IDE mRNA content, in both species. Conclusion: In conclusion, the reduced insulin clearance in glucocorticoid-treated rodents was due to the reduction of hepatic IDE activity, at least in rats, which may contributes to the compensatory hyperinsulinemia. These findings corroborate the idea that short-term and/or partial inhibition of IDE activity in the liver could be beneficial for the glycemic control. ã 2015 Elsevier Ltd. All rights reserved.
Keywords: Dexamethasone Glucocorticoid Glucose homeostasis Insulin clearance Insulin-degrading enzyme (IDE) Insulin sensitivity
1. Introduction Abbreviations: AI, adrenal incidentaloma; AD, Alzheimer’s disease; AUC, areaunder-curve; CTL, saline-treated group; CNTF, ciliary neurotrophic factor; GC, glucocorticoid-treated group; ipGTT, intraperitoneal glucose tolerance test; ipITT, intraperitoneal insulin tolerance test; IR, insulin resistance; KITT, constant rate of glucose decay; RIA, radioimmunoassay; T2DM, type 2 diabetes mellitus. * Corresponding author at: Departamento de Ciências Fisiológicas, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina (UFSC), Florianópolis 88040-900, Brazil. ** Corresponding author at: Departamento de Biologia Funcional e Estrutural, Instituto de Biologia, Universidade Estadual de Campinas (UNICAMP), Campinas 13083-865, Brazil. E-mail addresses: [email protected] (A. Rafacho), [email protected] (A.C. Boschero). 1 Contributed equally to this work. http://dx.doi.org/10.1016/j.jsbmb.2015.09.020 0960-0760/ ã 2015 Elsevier Ltd. All rights reserved.
Type 2 diabetes mellitus (T2DM) is a multifactorial disease characterized by hyperglycemia and associated with obesity, peripheral insulin resistance (IR), pancreatic b- and a-cell dysfunction, and altered insulin clearance [1–6]. At the onset of T2DM, before the development of overt hyperglycemia, the IR induces an adaptive response of pancreatic b cells that results in increased insulin secretion, leading to hyperinsulinemia [7]. Whether this compensatory hyperinsulinemia will persist depends on the ability of b cells to maintain this continuous requirement of insulin hypersecretion [2]. However, evidence also suggests that a primary persistent hyperinsulinemia, generated by environmental
2
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
or genetic factors may induce IR, obesity and T2DM as consequence [8,9]. Some therapies may also cause IR and hyperinsulinemia and glucocorticoid-based therapies that are prescribed due to their anti-inflammatory, antialergic and immunosuppressive properties are one of more relevant clinical example. In excess, glucocorticoids promote an imbalance on glucose homeostasis that include IR, glucose intolerance and, depending on the individual susceptibility, T2DM [5,10]. The IR induced by glucocorticoid treatment is initially counteracted by compensatory insulin hypersecretion, due to increased b-cell function and proliferation [11–15]. Hyperinsulinemia present during obesity is also a result of increased b-cell function, but there are also evidences for a contribution of reduced hepatic insulin clearance (defined as the rate of insulin removal from plasma) in humans [16–19], monkeys [1], dogs [4] and rats [20]. Decreased hepatic insulin clearance seems to precede the b-cell compensation in obese dogs, and this hepatic adaptive mechanism contributes to the augmented circulating insulin levels during obesity [4]. In accordance, glucocorticoid-treated dogs [21] and insulin-resistant nondiabetic adrenal incidentaloma (AI) patients [22] exhibit decreased hepatic insulin clearance. However, the molecular mechanisms underlying this compensatory adaptation are unknown. Insulin clearance occurs predominantly in the liver [3,18] and insulin degradation is mainly processed by the insulin-degrading enzyme (IDE), a 110 kDa zinc-metalloproteinase that is ubiquitously expressed [18]. Treatment of hepatic cells with glucocorticoids lead to reduction of insulin binding to IDE [23] and reduction of insulin degrading capacity [24], suggesting that glucocorticoids may regulate insulin clearance due to alterations upon the IDE expression or activity. IDE is also a major protease involved in the degradation of the amyloid b-protein (Ab) [25]. Reduced Ab degradation by several proteases, including IDE, has been suggested to play a role in the onset and progression of Alzheimer’s disease (AD) [26,27]. In fact, the IDE knockout (IDE/) mice display reduced Ab degradation in brain fractions and primary neurons, providing a molecular mechanism for the recently recognized association among hyperinsulinemia, T2DM and AD [26]. Chronic glucocorticoid treatment is associated with diminished IDE expression in the brain of macaques [27]. In accordance, astrocytes treated with glucocorticoid present reduced IDE mRNA and protein content [28]. Considering the importance of the IDE in the glycemic control and that glucocorticoid excess impairs such glucose homeostasis we investigated whether activity of hepatic IDE could be modulated in a model of hyperinsulinemia caused by dexamethasone treatment. By using two experimental models, Swiss mice and Wistar rats, we demonstrated that hyperinsulinemic rodents exhibited lower insulin clearance that was associated with lower activity of hepatic IDE, mainly in rats. 2. Material and methods
125
I-labeled insulin, used in the radioimmunoassay (RIA) (PerkinElmer, Boston, MA, USA), were used in our experiments. 2.3. Animals and experimental design All of the experiments were performed in male Swiss mice and Wistar rats (80–100 days old) purchased from the State University of Campinas Animal Breeding Center. All of the rodents were maintained in appropriate animal cages and kept at 22 1 C on a 12:12 light dark cycle (lights on 0600, lights off 1800). Rodents had access to food and water ad libitum. Mice and rats were divided into a GC-treated group (GC) that received 5 consecutive daily intraperitoneal injections of dexamethasone phosphate [intraperitoneal (i.p.), 1.0 mg/kg body weight (b.w.) in saline] and a control group (CTL) that received 5 consecutive daily injections of saline (1.0 ml/kg b.w.) between 0800 and 0900 h, according to previous publication [29]. To avoid overlapping of the acute and chronic glucocorticoid effects, all experiments were initiated 24 h after the last dexamethasone injection (on the sixth day). 2.4. Intraperitoneal insulin tolerance test (ipITT) A group of conscious rodents were fasted for two hours and then injected with insulin (i.p. 1 U/Kg b.w. in saline). Blood glucose was determined from the tail tip immediately before insulin administration (0 min) and 5, 10, 15, and 30 min after insulin administration. Glycemia was evaluated by a glucometer (AccuChek Advantage, Roche Diagnostic, Switzerland) and then converted into a natural logarithm (Ln); the slope was calculated using linear regression (time Ln [glucose]) and multiplied by 100 to obtain the constant rate of glucose decay per minute (%/min) during the ipITT (KITT) [6,15]. Insulinemia was measured by RIA, as previously described [6,15]. 2.5. In vivo insulin clearance We measured the insulinemia in rodents submitted to the ipITT. Insulin clearance was evaluated as previously described [30]. The constant rate for insulin disappearance (insulin decay) was calculated by converting insulin measurements into a Ln; the slope was calculated using linear regression (time Ln [insulin]) and multiplied by 100 to obtain the insulin decay constant rate per minute (%/min). The AUC of insulin during the ipITT was calculated as previously described [6]. 2.6. Intraperitoneal glucose tolerance test (ipGTT) and insulin dynamics A separate group of rodents received an i.p. injection of 50% glucose solution after 10 h of fasting (1 g/kg b.w.). Blood samples (75–100 ml) were collected from the tail tip immediately before glucose administration (0 min) and after 15 and 60 min to determine glycemia and insulinemia as described before. The AUC of glucose and insulin during the ipGTT were calculated as previously described.
2.1. Ethical approval 2.7. Tissue samples and IDE activity The experiments with rats and mice were approved by the State University of Campinas Committee for Ethics in Animal Experimentation (approval ID: 2285-1). 2.2. Materials Dexamethasone phosphate (Decadron) (Aché, Campinas, SP, Brazil), human recombinant insulin (Humulin R) (Lilly, Indianapolis, IN, USA), D-glucose (Synth, Labsynth, Diadema, SP, Brazil) and
A separate group of rats and mice were killed (by exposure to CO2 followed by decapitation) and liver samples were collected for determination of IDE activity after homogenization of tissue in icecold assay buffer (AnaSpec, Inc., Fremont, CA, USA). IDE activity was assessed with the fluorimetric SensoLyte1 520 IDE activity assay kit (cat. AS-72231) (AnaSpec, Inc., Fremont, CA, USA) according to the manufacturer’s instructions. Sample fluorescence was monitored at a wavelength of 490 nm and an emission
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
wavelength of 520 nm on SpectraMax M3 plate reader (Molecular Devices, Ismaning, Germany). Reactions were performed in duplicate samples from six to seven different rodents. Enzyme activity was normalized per mg of total protein. The kinetic assay was expressed as 5-FAM (mM/mg protein) and the total enzyme activity were expressed in relation to control according to previous publication [31]. Protein concentration was determined by Bradford reagent (BioRad, Hercules, CA, USA). 2.8. Quantitative Real-time PCR Liver samples of rats and mice were collected from the same animals used for determination IDE activity and homogenized in Trizol1 following phenol-chloroform RNA extraction, according to the manufacturer’s instructions (Gibco-BRL, Gaithers- burg, MD, USA). RNA integrity was asserted through agarose gel and its concentration was measured by Nanodrop (Nanodrop Thermo scientific, Wilmington, DE, USA). The following reverse transcriptase PCR for cDNA synthesis was made using the TaqDNA polymerase (Phoneutria, Belo Horizonte, BR). Quantification was performed using the 7500 Fast Real-time PCR Systems (Applied Biosystems, Foster City, CA, USA). The specificities of amplifications were verified
3
by melting-curve analyses and by size characterization of the amplification products on 2% agarose gels. The Sense (S) and Antisense (AS) oligonucleotide primers were designed and tested against Mus musculus (Ide S: 50 -CTGTGCCCCTTGTTTGATGC-30 ; AS: 50 GTTCCCCGTAGCCTTTTCCA-30 ; Gapdh S: 50 -CCTGCACCACCAACTGCTTA-30 ; AS: 50 -GCCCCACGGCCATCACGCCA-30 ) or Rattus norvegicus genome (Ide S: 50 -AGGAAATGTTGGCTGTGGACGCA-30 ; AS: 50 -CCTGGCAAGAACGTGGACGGATA-30 ; Gapdh S: 50 - GGAGAAACCTGCCAAGTATGATG-30 ; AS: 50 - ACCCTGGTCCTCAGTGTAGCCCC -30 ) (Gene Bank) to ensure no amplification of unspecific cDNAs. 2.9. Statistical analysis All analyzes were performed using Graphpad prism v.5.01 (Graphpad Inc.; La Jolla, USA) software. The symmetry of the data was tested by Shapiro Wilk’s test. The results were expressed as the mean standard error of the mean (SEM). Unpaired Student’s ttest was used for intergroup (CTL vs. GC group) comparisons of parametric data or Mann–Whitney test for variables with asymmetric distribution. A p-value 0.05 was considered to be significant.
Fig. 1. Glucocorticoid treatment reduces insulin sensitivity in rats and mice. (A,D) Blood glucose during intraperitoneal insulin tolerance test (ipITT; 1 U/Kg b.w.) in glucocorticoid-treated rats and mice, respectively; (B,E) Blood glucose normalized as % of the initial moment (0 min) during the ipITT in glucocorticoid-treated rats and mice, respectively; (C,F) the constant rate for glucose disappearance (KITT) during ipITT in glucocorticoid-treated rats and mice, respectively. Values are mean SEM; n = 6– 9 rodents per group. *Significantly different vs. CTL. Unpaired Student’s t-test, p 0.05.
4
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
3. Results 3.1. Glucocorticoid treatment reduced insulin sensitivity in mice and rats It is known that in vivo glucocorticoid administration induces a decrease in insulin sensitivity in mice [32], rats [33,34], and humans [11,14]. Here, glucocorticoid-treated rats displayed a 56% reduction in insulin sensitivity compared to CTL groups, as observed in the ipITT (Fig. 1A and B) and indicated by the KITT (Fig. 1C). Mice submitted to the same dexamethasone regimen displayed a 36% reduction in insulin sensitivity (Fig. 1D,E), as indicated by the KITT values (Fig. 1F). 3.2. Compensatory hyperinsulinemia to the glucocorticoid-induced IR Due to the reciprocal relationship between peripheral insulin sensitivity and pancreatic islet function [2], insulin-resistant rats and mice demonstrated a compensatory increase in circulating insulin levels after 2 h (150% and 137%, respectively) and 12 h of fasting (297% and 243%, respectively) following glucocorticoid administration, compared to their respective CTL groups (Table 1), which corroborates previous data [15,32–34]. Glucocorticoidtreated rats exhibited hyperglycemia after both 2 h (54%) and 12 h of fasting (33%) compared to CTL rats, but glucocorticoid-treated mice exhibited no elevation, indicating a disruption of glucose homeostasis only in GC-treated rats (Table 1). 3.3. Compensatory hyperinsulinemia did not prevent the development of glucose intolerance in rats Next, we submitted the rodents to a glucose challenge (ipGTT). Similarly to previous observations [15,33,34], glucocorticoidtreated rats remained glucose intolerant, as indicated by higher blood glucose levels and the increased glucose AUC during the ipGTT (Fig. 2A and inset). This altered glucose tolerance in glucocorticoid-treated rats occurred even in the presence of higher insulin response to glucose, as judged by the higher insulin AUC during the ipGTT, compared to CTL rats (Fig. 2B and inset). Glucocorticoid-treated mice also had a higher insulin response to glucose when compared to their CTL group (Fig. 2D and inset), but remained glucose tolerant (Fig. 2C), indicating an adequate equilibrium between insulin sensitivity and islet function. 3.4. Glucocorticoid treatment reduced in vivo insulin clearance By evaluating the systemic (venous) insulin levels, we indirectly determined the in vivo insulin clearance (decreased removal of insulin from plasma) and observed whether this parameter could be attenuated during the hyperinsulinemic state caused by glucocorticoid treatment. Both rats and mice treated with glucocorticoid were hyperinsulinemic before insulin administration (Fig. 3A and D). Five minutes after the insulin administration,
both CTL groups of rats and mice reached similar levels of circulating insulin compared to their respective glucocorticoidtreated groups. Fig. 3 shows that plasma insulin clearance was significantly lower in glucocorticoid-treated rats and mice 60 min after insulin load, as judged by the increased AUC (47% and 87% respectively; Fig. 3B and E) and by the reduced insulin decay rate (47% and 72%, respectively; Fig. 3C and F), compared to CTL groups. Thus, hyperinsulinemia in glucocorticoid-treated rodents is associated with reduced insulin removal from plasma. 3.5. Glucocorticoid treatment reduced IDE activity in liver We next determined the IDE activity in liver from all groups. Activity of IDE in liver from glucocorticoid-treated rats was significantly reduced (35%) compared with the CTL group (Fig. 4A and B, respectively). Activity of hepatic IDE in glucocorticoidtreated mice had a tendency towards a reduction (p = 0.068) for the last 15 min monitoring (kinetic assay) as well as for total enzyme activity compared with the CTL mice (Fig. 4C and D, respectively). Thus, reduced insulin clearance in glucocorticoid-treated rodents is associated with reduced hepatic IDE activity, mainly in rats. 3.6. Glucocorticoid treatment do not alter Ide mRNA levels in liver We further evaluated whether the reduced activity of IDE in liver from glucocorticoid-treated rodents were associated with reduced Ide mRNA content. No difference was observed in the Ide mRNA content in glucocorticoid-treated rodents liver, compared to the CTL groups (Fig. 5A and B), suggesting that post-transcription regulation may be involved with the reduced activity of IDE in the liver. 4. Discussion The present study provides evidence that the compensatory hyperinsulinemia observed in insulin-resistant rats and mice, induced by glucocorticoid treatment, is due, at least in part, to a reduced insulin clearance that is associated with lower IDE activity in the liver in rats, with a tendency towards a reduction in mice. These findings corroborate the hypothesis that short-term and/or partial inhibition of the hepatic IDE expression may enhance the hypoglycemic action of insulin, which could be beneficial for the glycemic control [8,35]. Although reduced hepatic insulin clearance was previously reported to be associated with hyperinsulinemia in glucocorticoid-treated dogs [21] and in AI patients [22], we are the first to measure the hepatic IDE activity in insulin-resistant rats and mice made by glucocorticoid treatment. Glucocorticoid treatment reduced the insulin sensitivity in rats and mice (Fig. 1), which was counteracted by a compensatory hyperinsulinemia (Table 1). However, mice had a milder IR that was accompanied by a compensatory hyperinsulinemia sufficient to prevent the hyperglycemia and glucose intolerance (Fig. 2).
Table 1 Metabolic parameters in glucocorticoid-treated rats and mice. Rats
Mice
CTL
GC
Ratio
CTL
GC
Ratio
2 h Fasting Glycemia (mg/dL) Insulinemia (pmol/L)
100 1 638 118
154 13a 1600 114a
1.54 2.5
146 8 400 44
125 8 949 187a
0.86 2.37
12 h Fasting Glycemia (mg/dL) Insulinemia (pmol/L)
101 3 284 38
134 8a 1128 207a
1.33 3.97
100 6 83 8
93 7 285 78a
0.93 3.43
a
Significantly different using unpaired t-test vs. CTL p < 0.05; n = 5–6; values are mean SEM.
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
5
Fig. 2. Glucocorticoid treatment induces hyperinsulinemia in rats and mice, but glucose intolerance only in rats. (A,C) Blood glucose (B,D) and plasma insulin during intraperitoneal glucose tolerance test (ipGTT; 1 g/Kg b.w.) in glucocorticoid-treated rats and mice, respectively; the inset in A and C depicts the glucose AUC; in D, the inset depicts the insulinemia in another scale and the insulin AUC; in B, the inset depicts the insulin AUC; Values are mean SEM; n = 6–9 rodents per group. *Significantly different vs. CTL. Unpaired Student’s t-test, p 0.05.
Fig. 3. Glucocorticoid treatment reduces in vivo insulin clearance in rats and mice. (A,D) Plasma insulin before (0 min), and 5, 30 and 60 min after insulin injection in glucocorticoid-treated rats and mice, respectively; (B,E) insulin AUC during the ipITT and (C,F) insulin decay over 60 min; Values are mean SEM; n = 6–9 rodents per group. *Significantly different vs. CTL. Unpaired Student’s t-test, p 0.05.
6
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
Fig. 4. Glucocorticoid treatment reduces activity of hepatic IDE, mainly in rats. (A,C) Kinetic IDE assay in fragments of liver from rats and mice, respectively; (B,D) graphs represents total IDE activity in relation to controls; n = 6–7 rodents per group. *Significantly different vs. CTL. Unpaired Student’s t-test, p 0.05. For C and D Mann–Whitney test was applied.
These data suggest that mice are less vulnerable than rats to the deleterious effect of GC treatment on glucose homeostasis. In fact, mice treated with dexamethasone (1 mg/Kg b.w.) for 5 consecutive days exhibit normal non-esterified fatty acid (NEFA) levels and normal glycemic response to a pyruvate tolerance test, compared to control mice. These parameters were both impaired in rats treated with the same glucocorticoid regimen [29]. This suggests that dexamethasone-treated mice have a more preserved insulin action on fat and liver tissues compared to rats. In accordance, rats treated with dexamethasone exhibit increased fat lipolysis [36] and pyruvate intolerance [29,37] that may be, at least in part, responsible for their elevated NEFA and impaired glucose tolerance [29,37]. It is important to consider that mice exhibit higher metabolic rate in relation to rats [38], and such aspect might be taken into account for the less pronounced adverse effects of dexamethasone regimen (1 mg/kg b.w.) on mice metabolism. As previously reported [11–15,33,34,39], the hyperinsulinemia in glucocorticoid-treated human and rodents is associated with increased insulin secretion, due to increased b-cell mass and function. Our ipGTT confirms an enhancement of insulin secretion in response to glucose, in glucocorticoid-treated mice and rats that
Fig. 5. Glucocorticoid treatment does not alter Ide mRNA levels in rodents’ liver. (A,B) graphs represents mean SEM of mRNA levels of Ide in rats and mice liver, respectively; n = 4–5 rodents per group.
was of higher magnitude in rats (Fig. 2). According to disposition index (the product of insulin sensitivity by insulin secretion), for a given reduction in insulin sensitivity, a reciprocal increase in insulin secretion must be expected in a healthy organism to maintain blood glucose at physiological range. Considering that glucocorticoid-treated rats displayed an insulin insensitivity more pronounced than glucocorticoid-treated mice, it seems that their pancreatic b-cell compensation (insulin hypersecretion) was adequate, but this was not enough to avoid glucose intolerance and hyperglycemia in these animals. In fact, glucose-intolerant rats, made by dexamethasone (1 mg/kg b.w.) administration, demonstrate impaired a-cell function in response to high glucose that contributes for increased plasma glucagon levels [40]; which is corroborated by human studies [11,41]. Hyperinsulinemia, observed during elevation of glucocorticoid levels, may be explained also by an impairment of insulin clearance in liver both by direct glucocorticoid action [23,24] and by the own insulin effect [9]. After its secretion by pancreatic islets, insulin is collected by the portal vein, and approximately 50% is removed from plasma during this first passage through the liver [17,18]. Approximately 80% of the total plasma insulin content is bound by hepatic insulin receptors [42]. Therefore, the liver is the primary site of insulin clearance [17,43], which suggests the participation of the liver in hyperinsulinemia. As judged by the reduced insulin decay and increased insulin AUC, after an insulin bolus (Fig. 3), the removal of insulin from plasma was reduced in glucocorticoidtreated mice and rats, compared to their CTL groups. These results are in accordance with previous reports in which hepatic insulin clearance was reduced in glucocorticoid-treated dogs [21] and in AI humans [22]. Glucocorticoid-treated rodents had lower insulin decay after the ipITT (Fig. 3) as well as lower IDE activity (mainly in rats) in the liver than in CTL groups (Fig. 4). These data suggest that reduced hepatic clearance of insulin may contribute to hyperinsulinemia in both rodents treated with glucocorticoid, which are in agreement with higher levels of plasma insulin at any metabolic state for these species (Table 1). This association was more apparent in rats treated with dexamethasone and, possibly, the dexamethasone regimen defined in our study were not sufficient to cause a metabolic context (e.g., elevation in glycemic values) in
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
mice that might result in an effective downregulation of IDE activity, as observed in the glucocorticoid-treated rats. In alignment with that, there is evidence for reduced regulation of IDE activity by insulin in hepatic cells (HepG2), exposed to high glucose conditions [44]. This evidence corroborates our results, since both rats and mice treated with dexamethasone had similar ratios of insulin increment at any metabolic state, related to their own controls, but hyperglycemia was observed only in rats (Table 1). Reduced insulin decay, observed in mice treated with dexamethasone, does correlate with normotolerance and prevents hyperglycemia in mice. In fact, the increased function of islet b-cell (e.g., insulin hypersecretion), observed in mice treated with the same dexamethasone regimen [29], seems to surpass the metabolic demand caused by the reduction of insulin sensitivity, which favors for a slight reduction in blood glucose levels (Table 1). Our results are in line with previous in vitro studies in which hepatic cells, cultured in the presence of dexamethasone, showed a lower interaction between insulin and IDE [23] and reduced insulin degradation [24]. These findings corroborate the hypothesis that in vivo glucocorticoid treatment leads to a decreased insulin clearance by, at least in part, reduced expression and/or activity of IDE in the liver. Similarly, alloxan-treated mice displayed a reduced IDE expression in the liver when treated with ciliary neurotrophic factor (CNTF), resulting in lower insulin clearance, which in turn protected against the diabetogenic effects of alloxan [6]. In the same way, hepatic cells (HepG2), treated with CNTF, displayed reduced IDE expression and reduced insulin degradation [6], supporting the hypothesis that transient IDE inhibition in the liver may favor the glycemic control. The pharmacological inhibition of IDE led to increased insulin receptor autophosphorylation in cultured cells [35] and the acute in vivo inhibition of IDE improved the glycemic control [45], indicating that IDE regulates insulin signaling by a rapid degradation of internalized pools of the hormone. The role of IDE on the glycemic control was demonstrated using the IDE/ mice [8]. Young (2 months old) IDE/ mice displayed hyperinsulinemia, increased insulin sensitivity and glucose tolerance. At the contrary, in aged (6 months) IDE/ mice, the hyperinsulinemia was accompanied by IR and glucose intolerance, due to insulin receptor down-regulation (e.g., adaptation to chronically elevated insulin levels) [8]. Thus, our results may be interpreted in two points of view: first is that, initially, reduction of insulin clearance may be part of the compensatory mechanisms that contribute for glycemic control and second is that, if this hyperinsulinemia is persisted with prolongation of glucocorticoid treatment, it may led to peripheral insulin receptor dow-regulation with subsequent impairment in the insulin action. The unchanged Ide mRNA liver levels in glucocorticoid-treated rodents (Fig. 5) suggests that reduced IDE activity, at least in rats, is possibly not a result from transcriptional regulation, but rather a result of post-translational modulation, probably associated with the increased plasma and/or hepatic lipids and glucose in glucocorticoid-treated rodents [29,46], which are known to reduce insulin clearance [3,20,44,47,48]. The dissociation among Ide mRNA and IDE protein content/activity in the liver was recently described in an animal model of high fat diet (HFD) and in hepatoma cell-line (1c1c7) cultured with fatty acids [31], supporting the hypothesis that post-translational modulation, such as ubiquitination [49], may underlie the reduced IDE expression in liver from the dexamethasone-treated rodents. In conclusion, our results suggest that compensatory hyperinsulinemia in glucocorticoid-treated rodents may be explained, at least partially, due to a reduced hepatic insulin clearance that is associated with reduced hepatic IDE activity, at least in rats. We
7
suggest that short-term and/or partial reduction of the IDE activity, in the liver, could be beneficial for the glycemic control. Conflict of interest We declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported. Funding This research was supported by Grants from Fundação de Apoio a Pesquisa do Estado de São Paulo-FAPESP (ID no. 2010-05196-2). Authorship contributions Conceived and designed the experiments: A.O.P.P, L.F.R., A.R. and A.C.B. Conducted experiments: A.O.P.P, J.M.C.J, S.M.F, A.P.C., F. M.M.P, J.C.S and M.A.K. Contributed with analytic tools and data analysis: A.O.P.P, L.F.R., A.R. and A.C.B. Contributed with reagents/ materials: E.M.C and A.C.B. Wrote and edited paper: A.O.P.P, L.F.R., A.R and A.C.B. Acknowledgments We thank Mrs. Marise Brunelli for technical assistance; Mr. Bill Floriano, Mr. Washington Gomes, Mr. Juvenal Dantas, Mrs. Francine Quinelato and Mrs. Priscila Silva for animal care; and FAPESP for supporting this research. References [1] B.C. Hansen, J.S. Striffler, N.L. Bodkin, Decreased hepatic insulin extraction precedes overt noninsulin dependent (Type II) diabetes in obese monkeys, Obes. Res. 1 (1993) 252–260. [2] S.E. Kahn, The relative contributions of insulin resistance and beta-cell dysfunction to the pathophysiology of Type 2 diabetes, Diabetologia 46 (2003) 3–19. [3] A. Kotronen, L. Juurinen, M. Tiikkainen, S. Vehkavaara, H. Yki-Jarvinen, Increased liver fat, impaired insulin clearance, and hepatic and adipose tissue insulin resistance in type 2 diabetes, Gastroenterology 135 (2008) 122–130. [4] S.D. Mittelman, G.W. Van Citters, S.P. Kim, D.A. Davis, M.K. Dea, M. HamiltonWessler, R.N. Bergman, Longitudinal compensation for fat-induced insulin resistance includes reduced insulin clearance and enhanced beta-cell response, Diabetes 49 (2000) 2116–2125. [5] A. Rafacho, H. Ortsäter, A. Nadal, I. Quesada, Glucocorticoid treatment and endocrine pancreas function: implications for glucose homeostasis, insulin resistance and diabetes, J. Endocrinol. 223 (2014) R49–R62. [6] L.F. Rezende, G.J. Santos, J.C. Santos-Silva, E.M. Carneiro, A.C. Boschero, Ciliary neurotrophic factor (CNTF) protects non-obese Swiss mice against type 2 diabetes by increasing beta cell mass and reducing insulin clearance, Diabetologia 55 (2012) 1495–1504. [7] V. Poitout, J. Amyot, M. Semache, B. Zarrouki, D. Hagman, G. Fontes, Glucolipotoxicity of the pancreatic beta cell, Biochim. Biophys. Acta 1801 (2010) 289–298. [8] S.O. Abdul-Hay, D. Kang, M. McBride, L. Li, J. Zhao, M.A. Leissring, Deletion of insulin-degrading enzyme elicits antipodal, age-dependent effects on glucose and insulin tolerance, PLoS One 6 (2011) e20818. [9] B.E. Corkey, Banting lecture 2011: hyperinsulinemia: cause or consequence? Diabetes 61 (2012) 4–13. [10] H. Schacke, W.D. Docke, K. Asadullah, Mechanisms involved in the side effects of glucocorticoids, Pharmacol. Ther. 96 (2002) 23–43. [11] J.C. Beard, J.B. Halter, J.D. Best, M.A. Pfeifer, D. Porte Jr., Dexamethasoneinduced insulin resistance enhances B cell responsiveness to glucose level in normal men, Am. J. Physiol. 247 (1984) E592–596. [12] C. Binnert, S. Ruchat, N. Nicod, L. Tappy, Dexamethasone-induced insulin resistance shows no gender difference in healthy humans, Diabetes Metabol. 30 (2004) 321–326. [13] N. Nicod, V. Giusti, C. Besse, L. Tappy, Metabolic adaptations to dexamethasone-induced insulin resistance in healthy volunteers, Obes. Res. 11 (2003) 625–631. [14] D.H. van Raalte, V. Nofrate, M.C. Bunck, T. van Iersel, J. Elassaiss Schaap, U.K. Nassander, R.J. Heine, A. Mari, W.H. Dokter, M. Diamant, Acute and 2-week exposure to prednisolone impair different aspects of beta-cell function in healthy men, Eur. J. Endocrinol. 162 (2010) 729–735.
8
A.O.P. Protzek et al. / Journal of Steroid Biochemistry & Molecular Biology 155 (2016) 1–8
[15] A. Rafacho, J.L. Abrantes, D.L. Ribeiro, F.M. Paula, M.E. Pinto, A.C. Boschero, J.R. Bosqueiro, Morphofunctional alterations in endocrine pancreas of short- and long-term dexamethasone-treated rats, Horm. Metab. Res. 43 (2011) 275–281. [16] E. Bonora, I. Zavaroni, C. Coscelli, U. Butturini, Decreased hepatic insulin extraction in subjects with mild glucose intolerance, Metabolism 32 (1983) 438–446. [17] W.C. Duckworth, F.G. Hamel, D.E. Peavy, Hepatic metabolism of insulin, Am. J. Med. 85 (1988) 71–76. [18] W.C. Duckworth, R.G. Bennett, F.G. Hamel, Insulin degradation: progress and potential, Endocr. Rev. 19 (1998) 608–624. [19] M. Krotkiewski, P. Lonnroth, K. Mandroukas, Z. Wroblewski, M. Rebuffe-Scrive, G. Holm, U. Smith, P. Bjorntorp, The effects of physical training on insulin secretion and effectiveness and on glucose metabolism in obesity and type 2 (non-insulin-dependent) diabetes mellitus, Diabetologia 28 (1985) 881–890. [20] G. Stromblad, P. Bjorntorp, Reduced hepatic insulin clearance in rats with dietary-induced obesity, Metabolism 35 (1986) 323–327. [21] Z. Chap, R.H. Jones, J. Chou, C.J. Hartley, M.L. Entman, J.B. Field, Effect of dexamethasone on hepatic glucose and insulin metabolism after oral glucose in conscious dogs, J. Clin. Invest. 78 (1986) 1355–1361. [22] C.H. Anderwald, A. Tura, A. Gessl, A. Luger, G. Pacini, M. Krebs, Adequately adapted insulin secretion and decreased hepatic insulin extraction cause elevated insulin concentrations in insulin resistant non-diabetic adrenal incidentaloma patients, PLoS One 8 (2013) e77326. [23] S. Harada, R.M. Smith, D.Q. Hu, L. Jarett, Dexamethasone inhibits insulin binding to insulin-degrading enzyme and cytosolic insulin-binding protein p82, Biochem. Biophys. Res. Commun. 218 (1996) 154–158. [24] M. Ali, C. Plas, Glucocorticoid regulation of chloroquine nonsensitive insulin degradation in cultured fetal rat hepatocytes, J. Biol. Chem. 264 (1989) 20992– 20997. [25] W.Q. Qiu, D.M. Walsh, Z. Ye, K. Vekrellis, J. Zhang, M.B. Podlisny, M.R. Rosner, A. Safavi, L.B. Hersh, D.J. Selkoe, Insulin-degrading enzyme regulates extracellular levels of amyloid beta-protein by degradation, J. Biol. Chem. 273 (1998) 32730–32738. [26] W. Farris, S. Mansourian, Y. Chang, L. Lindsley, E.A. Eckman, M.P. Frosch, C.B. Eckman, R.E. Tanzi, D.J. Selkoe, S. Guenette, Insulin-degrading enzyme regulates the levels of insulin, amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain in vivo, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 4162–4167. [27] J.J. Kulstad, P.J. McMillan, J.B. Leverenz, D.G. Cook, P.S. Green, E.R. Peskind, C.W. Wilkinson, W. Farris, P.D. Mehta, S. Craft, Effects of chronic glucocorticoid administration on insulin-degrading enzyme and amyloid-beta peptide in the aged macaque, J. Neuropathol. Exp. Neurol. 64 (2005) 139–146. [28] Y. Wang, M. Li, J. Tang, M. Song, X. Xu, J. Xiong, J. Li, Y. Bai, Glucocorticoids facilitate astrocytic amyloid-beta peptide deposition by increasing the expression of APP and BACE1 and decreasing the expression of amyloid-betadegrading proteases, Endocrinology 152 (2011) 2704–2715. [29] A.O. Protzek, J.M. Costa-Júnior, L.F. Rezende, G.J. Santos, T.G. Araújo, J.F. Vettorazzi, F. Ortis, E.M. Carneiro, A. Rafacho, A.C. Boschero, Augmented b-Cell function and mass in glucocorticoid-treated rodents are associated with increased islet Ir-b/AKT/mTOR and decreased AMPK/ACC and AS160 signaling, Int. J. Endocrinol. 2014 (2014) 983453. [30] B. Ahrén, K. Thomaseth, G. Pacini, Reduced insulin clearance contributes to the increased insulin levels after administration of glucagon-like peptide 1 in mice, Diabetologia 48 (2005) 2140–2146. [31] X. Wei, B. Ke, Z. Zhao, X. Ye, Z. Gao, J. Ye, Regulation of insulin degrading enzyme activity by obesity-associated factors and pioglitazone in liver of dietinduced obese mice, PLoS One 9 (2014) e95399. [32] R. Jatwa, A. Kar, Amelioration of metformin-induced hypothyroidism by Withania somnifera and Bauhinia purpurea extracts in Type 2 diabetic mice, Phytother. Res. 23 (2009) 1140–1145.
[33] A. Rafacho, T.M. Cestari, S.R. Taboga, A.C. Boschero, J.R. Bosqueiro, High doses of dexamethasone induce increased beta-cell proliferation in pancreatic rat islets, Am. J. Physiol. Endocrinol. Metabol. 296 (2009) E681–689. [34] A. Rafacho, S. Quallio, D.L. Ribeiro, S.R. Taboga, F.M. Paula, A.C. Boschero, J.R. Bosqueiro, The adaptive compensations in endocrine pancreas from glucocorticoid-treated rats are reversible after the interruption of treatment, Acta Physiol. (Oxf.) 200 (2010) 223–235. [35] M.A. Leissring, E. Malito, S. Hedouin, L. Reinstatler, T. Sahara, S.O. Abdul-Hay, S. Choudhry, G.M. Maharvi, A.H. Fauq, M. Huzarska, et al., Designed inhibitors of insulin-degrading enzyme regulate the catabolism and activity of insulin, PLoS One 5 (2010) e10504. [36] E.A. Nunes, L.M. Gonçalves-Neto, F.B. Ferreira, C. Dos Santos, L.C. Fernandes, A. C. Boschero, P.C. Calder, A. Rafacho, Glucose intolerance induced by glucocorticoid excess is further impaired by co-administration with b-hydroxy-b-methylbutyrate in rats, Appl. Physiol. Nutr. Metabol. 38 (2013) 1137–1146. [37] K. Motta, A.M. Barbosa, F. Bobinski, A.C. Boschero, A. Rafacho, JNK and IKKb phosphorylation is reduced by glucocorticoids in adipose tissue from insulinresistant rats, J. Steroid Biochem. Mol. Biol. 145 (2015) 1–12. [38] G.M. Kowalski, C.R. Bruce, The regulation of glucose metabolism: implications and considerations for the assessment of glucose homeostasis in rodents, Am. J. Physiol. Endocrinol. Metabol. 307 (2014) E859–71. [39] S. Karlsson, B. Ostlund, U. Myrsen-Axcrona, F. Sundler, B. Ahren, Beta cell adaptation to dexamethasone-induced insulin resistance in rats involves increased glucose responsiveness but not glucose effectiveness, Pancreas 22 (2001) 148–156. [40] A. Rafacho, L.M. Gonçalves-Neto, J.C. Santos-Silva, P. Alonso-Magdalena, B. Merino, S.R. Taboga, E.M. Carneiro, A.C. Boschero, A. Nadal, I. Quesada, Pancreatic alpha-cell dysfunction contributes to the disruption of glucose homeostasis and compensatory insulin hypersecretion in glucocorticoidtreated rats, PLoS One 9 (2014) e93531. [41] D.H. van Raalte, K.A. Kwa, R.E. van Genugten, M.E. Tushuizen, J.J. Holst, C.F. Deacon, J.M. Karemaker, R.J. Heine, A. Mari, M. Diamant, Islet-cell dysfunction induced by glucocorticoid treatment: potential role for altered sympathovagal balance? Metabolism 62 (2013) 568–577. [42] R. Hovorka, J.K. Powrie, G.D. Smith, P.H. Sonksen, E.R. Carson, R.H. Jones, Fivecompartment model of insulin kinetics and its use to investigate action of chloroquine in NIDDM, Am. J. Physiol. 265 (1993) E162–E175. [43] H. Sato, T. Terasaki, H. Mizuguchi, K. Okumura, A. Tsuji, Receptor-recycling model of clearance and distribution of insulin in the perfused mouse liver, Diabetologia 34 (1991) 613–621. [44] O. Pivovarova, O. Gögebakan, A.F. Pfeiffer, N. Rudovich, Glucose inhibits the insulin-induced activation of the insulin-degrading enzyme in HepG2 cells, Diabetologia 52 (2014) 1656–1664. [45] J.P. Maianti, A. McFedries, Z.H. Foda, R.E. Kleiner, X.Q. Du, M.A. Leissring, W.J. Tang, M.J. Charron, M.A. Seeliger, A. Saghatelian, et al., Anti-diabetic activity of insulin-degrading enzyme inhibitors mediated by multiple hormones, Nature 511 (2014) 94–98. [46] L.M. Gonçalves-Neto, F.B. Ferreira, L. Souza, C. dos Santos, A.C. Boschero, V.A. Facundo, A.R. Santos, E.A. Nunes, A. Rafacho, Disruption of glucose tolerance caused by glucocorticoid excess in rats is partially prevented, but not attenuated, by arjunolic acid, Indian J. Exp. Biol. 52 (2014) 972–982. [47] M.M. Hennes, A. Dua, A.H. Kissebah, Effects of free fatty acids and glucose on splanchnic insulin dynamics, Diabetes 46 (1997) 57–62. [48] J. Svedberg, G. Stromblad, A. Wirth, U. Smith, P. Bjorntorp, Fatty acids in the portal vein of the rat regulate hepatic insulin clearance, J. Clin. Invest. 88 (1991) 2054–2058. [49] G. Grasso, E. Rizzarelli, G. Spoto, How the binding and degrading capabilities of insulin degrading enzyme are affected by ubiquitin, Biochim. Biophys. Acta 1784 (2008) 1122–1126.